[pdf] the nitrogen footprint tool network: a multi-institution program to reduce nitrogen pollution | semantic scholar skip to search formskip to main content> semantic scholar's logo search sign increate free account you are currently offline. some features of the site may not work correctly. doi: . /sus. . .eac corpus id: the nitrogen footprint tool network: a multi-institution program to reduce nitrogen pollution @article{castner thenf, title={the nitrogen footprint tool network: a multi-institution program to reduce nitrogen pollution}, author={elizabeth a. castner and allison m. leach and n. leary and j. baron and j. compton and j. galloway and m. hastings and j. kimiecik and jonathan lantz-trissel and elizabeth de la reguera and r. ryals}, journal={sustainability (new rochelle, n.y.)}, year={ }, volume={ }, pages={ - } } elizabeth a. castner, allison m. leach, + authors r. ryals published environmental science, medicine sustainability (new rochelle, n.y.) abstract anthropogenic sources of reactive nitrogen have local and global impacts on air and water quality and detrimental effects on human and ecosystem health. this article uses the nitrogen footprint tool (nft) to determine the amount of nitrogen (n) released as a result of institutional consumption. the sectors accounted for include food (consumption and upstream production), energy, transportation, fertilizer, research animals, and agricultural research. the nft is then used for scenario… expand view pdf save to library create alert cite launch research feed share this paper citationshighly influential citations background citations methods citations view all figures, tables, and topics from this paper figure table figure table blood urea nitrogen measurement fossils emission - male genitalia finding fossil fuels fertilizers neurofibrillary degeneration (morphologic abnormality) citations citation type citation type all types cites results cites methods cites background has pdf publication type author more filters more filters filters sort by relevance sort by most influenced papers sort by citation count sort by recency a community nitrogen footprint analysis of baltimore city, maryland elizabeth sara milo dukes, j. galloway, + authors elizabeth a. castner environmental science save alert research feed comparing institution nitrogen footprints: metrics for assessing and tracking environmental impact elizabeth a. castner, allison m. leach, j. compton, j. galloway, j. andrews environmental science, medicine sustainability pdf view excerpt, cites background save alert research feed an integrated tool for calculating and reducing institution carbon and nitrogen footprints allison m. leach, j. galloway, elizabeth a. castner, j. andrews, n. leary, j. aber environmental science, medicine sustainability pdf save alert research feed reducing the nitrogen footprint of a small residential college n. leary, elizabeth de la reguera, s. fitzpatrick, olivia boggiano-peterson environmental science, medicine sustainability pdf save alert research feed from production to consumption: a coupled human-environmental nitrogen flow analysis in china. z. luo, s. hu, dingjiang chen, b. zhu environmental science, medicine environmental science & technology save alert research feed virtual water as a metric for institutional sustainability l. natyzakjennifer, a. castnerelizabeth, d'odoricopaolo, n. gallowayjames economics save alert research feed defining system boundaries of an institution nitrogen footprint elizabeth de la reguera, elizabeth a. castner, j. galloway, allison m. leach, n. leary, j. tang environmental science, medicine sustainability pdf save alert research feed geographic versus institutional drivers of nitrogen footprints: a comparison of two urban universities g. macdonald, j. talbot, + authors brian e. robinson geography save alert research feed the challenges of dealing with nitrogen pollutants in groundwater stephanye zarama-alvarado environmental science pdf save alert research feed life cycle assessment of nitrogen efficiency strategies for canadian egg supply chains s. z. ershadi environmental science highly influenced view excerpts, cites methods save alert research feed ... ... references showing - of references sort byrelevance most influenced papers recency a nitrogen footprint model to help consumers understand their role in nitrogen losses to the environment allison m. leach, j. galloway, a. bleeker, j. w. erisman, r. kohn, j. kitzes business pdf view excerpt, references background save alert research feed comparing institution nitrogen footprints: metrics for assessing and tracking environmental impact elizabeth a. castner, allison m. leach, j. compton, j. galloway, j. andrews environmental science, medicine sustainability pdf save alert research feed an integrated tool for calculating and reducing institution carbon and nitrogen footprints allison m. leach, j. galloway, elizabeth a. castner, j. andrews, n. leary, j. aber environmental science, medicine sustainability pdf save alert research feed reducing the nitrogen footprint of a small residential college n. leary, elizabeth de la reguera, s. fitzpatrick, olivia boggiano-peterson environmental science, medicine sustainability pdf save alert research feed from production to consumption: a coupled human-environmental nitrogen flow analysis in china. z. luo, s. hu, dingjiang chen, b. zhu environmental science, medicine environmental science & technology save alert research feed virtual water as a metric for institutional sustainability l. natyzakjennifer, a. castnerelizabeth, d'odoricopaolo, n. gallowayjames economics save alert research feed integrating ecological, carbon and water footprint into a "footprint family" of indicators: definition and role in tracking human pressure on the planet a. galli, t. wiedmann, ertug ercin, doris knoblauch, brad r. ewing, s. giljum business save alert research feed environmental impact food labels combining carbon, nitrogen, and water footprints allison m. leach, kyle a. emery, + authors j. galloway computer science pdf save alert research feed the nitrogen cascade j. galloway, j. aber, + authors b. cosby biology , pdf save alert research feed climate action planning at the university of new hampshire. sara m. cleaves, b. pasinella, j. andrews, c. wake political science save alert research feed ... ... related papers abstract figures, tables, and topics citations references related papers stay connected with semantic scholar sign up about semantic scholar semantic scholar is a free, ai-powered research tool for scientific literature, based at the allen institute for ai. learn more → resources datasetssupp.aiapiopen corpus organization about usresearchpublishing partnersdata partners faqcontact proudly built by ai with the help of our collaborators terms of service•privacy policy the allen institute for ai by clicking accept or continuing to use the site, you agree to the terms outlined in our privacy policy, terms of service, and dataset license accept & continue comparison of volatile compounds produced by wild lactococcus lactis in miniature chihuahua-type cheeses hal id: hal- https://hal.archives-ouvertes.fr/hal- submitted on nov hal is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. the documents may come from teaching and research institutions in france or abroad, or from public or private research centers. l’archive ouverte pluridisciplinaire hal, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés. comparison of volatile compounds produced by wild lactococcus lactis in miniature chihuahua-type cheeses carolina nájera-domínguez, nestor gutiérrez-méndez, guadalupe nevárez-moorillon, irma caro-canales to cite this version: carolina nájera-domínguez, nestor gutiérrez-méndez, guadalupe nevárez-moorillon, irma caro- canales. comparison of volatile compounds produced by wild lactococcus lactis in miniature chihuahua-type cheeses. dairy science & technology, edp sciences/springer, , ( ), pp. - . � . /s - - - �. �hal- � https://hal.archives-ouvertes.fr/hal- https://hal.archives-ouvertes.fr original paper comparison of volatile compounds produced by wild lactococcus lactis in miniature chihuahua-type cheeses carolina nájera-domínguez & nestor gutiérrez-méndez & guadalupe nevárez-moorillon & irma caro-canales received: march /revised: june /accepted: june / published online: june # inra and springer-verlag france abstract strains of lactococcus lactis used for a long time as starter cultures in the production of cheese have not only acquired special features like fast utilization of lactose, but it is also believed that they have lost certain metabolic capabilities. certain wild strains of l. lactis isolated from vegetables or raw milk products are able to generate flavors different from those produced by industrial strains. the aim of this work was to assess the production of volatile compounds in miniature chihuahua-type cheeses manufactured with different strains of l. lactis isolated from vegetables, raw milk products, and industrial cultures. there was variation among volatile profiles in the miniature cheeses manufactured with different strains of l. lactis. however, some compounds were seen in most of the cheeses such as acetic, lactic, butyric, and caproic acids, acetoin, -methyl- -butanol, and , -butanediol. the source of isolation of the strains (plants, raw milk products, and industrial cultures) did not have a clear influence on the production of volatile compounds in miniature cheeses. according to principal component analysis, out of strains of l. lactis produced volatile profiles similar to the three pasteurized chihuahua cheeses analyzed, but only strains generated profiles similar to the commercial raw milk cheese. however, further research is required to understand the metabolic and genetic differences of these strains. keywords lactococcus lactis . wild strains . volatile compounds . chihuahua cheese dairy sci. & technol. ( ) : – doi . /s - - - c. nájera-domínguez: n. gutiérrez-méndez: g. nevárez-moorillon facultad de ciencias químicas, universidad autónoma de chihuahua, chihuahua, chihuahua, méxico i. caro-canales departamento de higiene y tecnología de los alimentos, universidad de león, campus vegazana, león, españa n. gutiérrez-méndez (*) circuito universitario s/n, col., altavista, c.p. , méxico e-mail: ngutierrez@uach.mx introduction chihuahua cheese or mennonite cheese is one of the most popular cheeses in mexico and the hispanic community in the usa (tunick et al. ). the color of chihuahua cheese is yellow and turns golden yellow with age. its consistency is sliceable, semi-hard, and its sensory characteristics are similar to month-aged cheddar; although rheological analysis suggests it is more like fresh colby cheese (gutiérrez-méndez and nevárez-moorillon ). artisanal chihuahua cheese is manufactured with unpasteurized milk; neverthe- less, nowadays, it is also produced at a large scale using pasteurized milk. according to van hekken et al. ( ), chihuahua cheeses manufactured with unpasteurized milk have a stronger flavor and softer texture than chihuahua cheeses made with pasteurized milk. flavors are chemical sensations produced by certain molecules released from the food during eating (voilley and etiévant ). the pleasant flavors perceived by consumers in fermented dairy products come from the correct balance of flavor compounds (smit et al. ). lactic acid bacteria (lab) provide a high contribution of enzymes that transform the milk components into flavor compounds (santos et al. ). lactococcus lactis has been involved in cheese making since ancient times, and nowadays, these bacteria are most widely used as a starter culture in the manufacture of cheese (klijn et al. ). the natural niches of l. lactis are plant environments such as grass, corn leaves, sweet peas, cucumbers, and beans. this microorganism has adapted to other environments including soil, cow’s skin (mainly udder and teats), and milk (desmasures et al. ; doman-pytka et al. ; nomura et al. ). the adaptation of l. lactis to milk or milk-related environments has promoted the acquisition of special features like fast lactose utilization (mills et al. ; gutiérrez-méndez et al. ). however, the adaptation of these bacteria to rich nutrient environments like milk also has caused the loss of certain metabolic capabilities. for example, plant-derived lactococci have a more efficient use of peptides and greater tolerance to stress than milk-derived strains of l. lactis (nomura et al. ; picon et al. ). some authors have proposed that wild strains of l. lactis isolated from vegetables or raw milk products are able to generate flavors different from those produced by industrial strains (ayad et al. ). certain flavor characteristics observed in artisanal raw milk cheeses are poorly detected in cheeses manufactured with pasteurized milk (centeno et al. ). therefore, the use of wild strains of l. lactis for the development of new flavors or flavors that resemble those perceived in raw milk cheeses may have potential. the aim of this work was to assess the production of volatile compounds in miniature chihuahua-type cheeses manufactured with different strains of l. lactis isolated from vegetables, commercial starter cultures, and raw milk products. volatile compounds observed in miniature cheeses were also compared with those found in commercial raw and pasteurized milk chihuahua cheeses. materials and methods . microorganisms the strains of l. lactis used in this study (except the atcc strain) were obtained and partially characterized in a previous work (gutiérrez-méndez et al. b). these c. nájera-domínguez et al. strains were isolated from raw milk dairy products, vegetables, and different commer- cial dairy starter cultures (table ). all the strains were kept at − °c in an m broth (difco laboratories, detroit mich.) with % (v/v) glycerol before use. additionally, the citrate-fermenting capacity of the strains was assessed using the kempler and mckay (kmk) agar (kempler and mckay ). the production of acetoin by the strains was detected by the voges-proskauer (vp) reaction (passerini et al. ). . chihuahua cheese samples five different brands of chihuahua cheese were bought from the local market and stored at °c. the cheese brands were chosen based on a previous survey that determined which were the top selling brands in chihuahua city (almanza-rubio et al. ). mennonite cheese factories located in cuauhtémoc (chihuahua state, mexico) produced all the cheese brands used in this study. the brands used were as follows: queso menonita (brand ), clavel (brand ), los pinos (brand ), lacmeno (brand ), and laurel (brand ). only one brand (brand ) was a cheese manufactured with raw milk. . manufacture of miniature chihuahua-type cheeses miniature model cheeses were produced in the laboratory under controlled conditions in order to minimize the manufacture variations and reduce the microbial contamina- tion. the protocol used was previously developed in the laboratory, to reproduce similar characteristics than commercial chihuahua cheeses (gutiérrez-méndez et al. ). each strain of l. lactis was grown individually in sterile milk ( % fat) at °c over h. these fermented milks were used as inoculum in the production of miniature table strains of lactococcus lactis used in the manufacture of chihuahua-type miniature cheeses strain source of isolation strain source of isolation atcc (american type culture collection) ez cb- lsc (ezal, rhodia food, france) c raw milk chihuahua cheesea ez a lsc (ezal, rhodia food, france) de b raw milk chihuahua cheeseb ez b lsc (ezal, rhodia food, france) rq whey cheese fdvsbs lsc (chr hansen, denmark) alf- lucerne (medicago sativo) kk lsc (danisco, denmark) bb beetroot (beta vulgaris) kk lsc (danisco, denmark) ej green beans (phaseolus vulgaris) li lsc (chr hansen, denmark) mh corn leaves (zea maiz) ma lsc (chr hansen, denmark) mm corn earn (zea miz) mm lsc (danisco, denmark) cm lsc (ezal, rhodia food, france) pk lsc (danisco, denmark) ez ab lsc (ezal, rhodia food, france) vegetable samples were obtained from local producers in chihuahua state, mexico lsc lyophilized starter culture of mesophilic lactococci a cheese manufactured in cuauhtémoc, chihuahua, mexico b cheese manufactured in delicias, chihuahua, mexico comparison of volatile compounds by wild lactococcus lactis chihuahua-type cheese. the milk used for the manufacture of cheeses was obtained from the faculty of animal science and ecology (university autonomous of chihua- hua, chihuahua, mexico). the milk was standardized to obtain the following compo- sition: . ± . g.l− fat, . ± . g.l− protein, and . ± . g.l− lactose. portions of g of pasteurized milk were poured into four -ml glass beakers. milk portions were added % (v/v) with the inoculum of the corresponding strain of l. lactis. the milk was incubated h at °c and μl of cacl . mol.l − and . μl of chymosin (chy-max, chr hansen, horsholm, denmark) added. after h of incubation at °c, the coagulum was cut with a stainless steel spatula in small cubes of . cm , held for min, and then stirred at rpm for min on an orbital shaker. the whey was drained and the curd warmed to °c in a water bath (isotemp , fisher sci, iowa, usa) until ph reached . . then, the curd was salted at % (w/w) nacl and transferred into metallic u-bottom tubes and centrifuged at , ×g for min at room temperature. the expelled whey was drained, and the curd was centrifuged again for min at , ×g. mini cheeses were removed from the tubes and dipped into a sorbate ( . %w/v) and natamycin ( . %w/v) solution. cheeses were stored unpacked at °c and % of relative humidity for week in order to remove the excess of moisture in the cheeses. finally, mini cheeses were wiped with tissue paper, packed in sealed polyethylene bags ( . cm× . cm), and stored at °c for month. miniature chihuahua cheeses had an average size of cm (diameter)× . cm (height) and a weight of ± . g. three mini cheeses were manufactured with each separate strains of l. lactis. . compositional analysis of cheeses cheeses were analyzed for moisture, protein, fat, and ash content using aoac methods: . , . , . , and . , respectively (aoac ). the ph of the cheeses was measured with a ph meter (pinnacle, corning, ny, usa) according to the aoac method . (aoac ). . analysis of volatile compounds the protocol used for the analysis of volatile compounds in cheese was adapted from bourdat-deschamps et al. ( ). volatile compounds in miniature and commercial cheeses were extracted by solid phase microextraction (spme) using a fiber of cm in length coated with a film of ( μm) carboxen/polydimethylsiloxane (supelco, bellefonte, pa, usa) and analyzed by gas chromatography–mass spectrometry (gc- ms). the cheese samples were prepared as follows: g of grated cheese and g of nacl were added to a -ml container (nalgene nunc international, ny, usa). then, the car/pdms fiber was placed into the container headspace and held for h at °c. the fiber was retracted and injected into the chromatograph inlet and desorbed by min at °c. volatile compounds were separated on a gc-ms equipment (autosystem xl, perkin-elmer, norwalk, ct, usa) with a polyethylene glycol (elite- wax etr, perkin-elmer, norwalk, ct, usa) column ( m× . mm i.d.) using the following conditions: initial temperature °c held for min, heating to °c at °c.min− and held for min, heating to °c at °c.min− , and holding for min. ionization was performed in the mass spectrometer (turbo mass gold, perkin-elmer, c. nájera-domínguez et al. norwalk, ct, usa) applying an electronic impact of ev. autotune calibration was routinely performed before each injection sequence. compounds were presumptively identified by nist mass spectral database version . and their mass spectra compared to those reported in the literature. . statistical analysis a multivariate analysis was performed using the relative peak areas of total ion chromatograms. principal component analysis (pca) was calculated using a covari- ance matrix of standardized data collected from peak areas. factor scores from pca were used as euclidean distance matrix for non-hierarchical (k-means) cluster analysis. statistical analysis was carried out with the software minitab (minitab inc, state college, pa, usa). results . fermentation of citrate and production of diacetyl most of the strains of l. lactis used in this study were positive to citrate fermentation using the kmk agar (kmk+) method, and only the strains li and ma were considered as citrate negative (kmk−). according to the voges-proskeaur (vp) reaction, the majority of the strains were able to produce acetoin during growth on milk (vp+), except strains bb , mm , cm , and ma (vp−). . characterization of miniature and commercial chihuahua cheeses the compositional parameters of miniature chihuahua cheeses and commercial chi- huahua cheeses were similar (t student, p< . ). the average composition of minia- ture cheeses (expressed as g. g− ) was as follows: moisture . ± . , protein . ± . , fat . ± . , ash . ± . , and ph . ± . . the average composition of commercial chihuahua cheeses (expressed as g. g− ) was as follows: moisture . ± . , protein . ± . , fat . ± . , ash . ± . , and ph . ± . . . volatile compounds in chihuahua cheese brands in this work, four of the brands analyzed were cheeses manufactured with pasteurized milk (brands , , , and ), and only one brand (brand ) was a cheese made with raw milk. the cheeses manufactured with pasteurized milk require the addition of com- mercial starter cultures, whereas raw milk uses the natural flora of the milk to ferment the curd. as was expected, the type and proportion of volatile compounds varied among chihuahua cheese brands (fig. ). however, some volatile compounds were found in all cheese brands, like certain organic acids (acetic, formic, butyric, caproic, and lactic acid) as well as , -butanediol (tables and ). the presence of formic acid in all cheese brands was unexpected, because this compound has a pungent, penetrating odor and has only been identified in some cheeses like cheddar cheese (mullin and emmons ). all the cheeses manufactured with pasteurized milk showed some comparison of volatile compounds by wild lactococcus lactis fig. volatile compound profiles observed in pasteurized milk chihuahua cheese (brands and ) and raw milk chihuahua cheese (brand ) by gas chromatography–mass spectrometry (gc-ms) and solid phase micro extraction (spme). details of volatile compounds are shown in table c. nájera-domínguez et al. volatile compounds like -methyl- -butanone and acetoin, but these compounds were not found in the cheese manufactured with raw milk. likewise, some volatile com- pounds observed in the raw milk cheese were not found in pasteurized milk cheeses: valeric acid, decanoic acid, ethylhexanoate, and , -propanediol-diacetate. pasteurized milk cheeses had acetoin and butyric acid as the major volatile components, whereas the raw milk cheese had caproic and butyric acids as the main volatile components (fig. ). table list of major volatile compounds identified in miniature chihuahua-type cheeses and five of the best selling brands of chihuahua cheese id compound retention timea (min) acids a methanoic acid (formic) . – . a ethanoic acid (acetic acid) . – . a -methylpropanoic acid (isobutyric acid) . – . a -hydroxypropanoic acid (lactic acid) . – . a butanoic acid (butyric acid) . – . a -methylbutanoic acid (isovaleric acid) . – . a pentanoic acid (valeric acid) . a hexanoic acid (caproic acid) . – . a octanoic acid (caprylic acid) . – . a - -hexadienoic acid (sorbic acid) . – . a decanoic acid . – . alcohols al -butanol . al -methyl, -butanol . – . al -methyl- , -pentanediol . al , -octanediol, , -dimethyl . al , -butanediol . – . aldehyde ah -methylpropanal . esters e ethyl butyrate . e ethylhexanoate . e ethyl octanoate . e , -propanediol,diacetate . ketones k -methyl- -butanone . – . k -hydroxybutanone (acetoin) . – . k -hydroxy- -methyl- pentanone . – . terpene t limonene . – . a range of time obtained from all the cheeses analyzed ( cheese treatments and commercial brands of chihuahua cheese) comparison of volatile compounds by wild lactococcus lactis . volatile compounds in miniature chihuahua-type cheeses the miniature cheeses manufactured with different strains of l. lactis had a wide variation in their volatile profiles (tables and ). nevertheless, all the miniature cheeses had certain volatile compounds like acetic, lactic, butyric, and caproic acids, as well as acetoin, -methyl- -butanol (except strain mm ), and , -butanediol (except the atcc strain). these acids, alcohols, and ketone are compounds commonly found in cheese (barbieri et al. ; garde et al. ; bertolino et al. ; hou et al. ). according to the principal component analysis and the k-mean clustering analysis (fig. ), the cheeses were organized in three clusters. the first cluster included six cheeses manufactured with strains isolated from commercial cultures (fdvsbs, ma , kk , ez cb- , kk , ez a), two cheeses manufactured with strains isolated from raw milk cheeses (de b, c ), and three cheeses manufactured with strains isolated from vegetables (alf- , bb , ej ). the volatile profiles of the cheeses that belong to this cluster were similar to the volatile profiles of two commer- cial chihuahua cheeses (brands and ). the main characteristic of these cheeses was the high proportion of ketones (acetoin, -methyl- -butanone, and -hydroxy- - methyl- pentanone) in comparison with the other volatile compounds (i.e., strain fdvsbs; fig. ). additionally, isobutyric acid was identified in some cheeses of the first cluster like those made with the strains c and de b. the second cluster included the volatile profiles of five miniature cheeses made with strains isolated from commercial cultures (ez ab, mm , li, ez b, pk ), one cheese manufactured with a strain isolated from corn earn (mm ), one cheese manufactured with a strain isolated from whey cheese (rq ), and one commercial pasteurized milk cheese (brand ). some of the cheeses of this cluster showed flavor compounds like limonene (strains ez b, mm , and mm ) or decanoic acid (strain mm ). the volatile compounds most abun- dant in the cheeses of the second cluster were as follow: acetic acid, lactic acid, butyric acid, ethylbutyrate, and -methyl- -butanol. in contrast to the first cluster, these compounds were found in higher proportion than acetoin (i.e., strain rq ; fig. ). the third cluster comprised the volatile profiles of one miniature cheese manufactured with a strain isolated from commercial culture (cm ), one miniature cheese manufactured with a strain isolated from corn leaves (mh ), and two commercial cheeses (brands and ). the patterns of volatile compounds that presented these cheeses were very different to the volatile profiles seen in the other mini cheeses and those observed in three out five commercial chihuahua cheeses. the most abundant volatile compounds in the cheeses of the third cluster were as follows: lactic acid, butyric acid, caproic acid, ethylbutyrate, and , -butanediol (i.e., strain mh ; fig. ). some volatile compounds like valeric acid, ethyl ethanoate, and ethyl octanoate were found exclusively in the raw milk cheese (brand ) belonging to this third cluster. this commercial chihuahua cheese made with raw milk (brand ) had also large differences with most of the commercial pasteurized milk cheeses (brands , , and ), whereas there were some similarities with brand . furthermore, only the two mini cheeses made using l. lactis strains cm and mh had volatile profiles similar to the raw milk cheese. c. nájera-domínguez et al. t ab le v o la ti le co m po un ds (a ci ds an d te rp en e) o bs er ve d in m in ia tu re c hi hu ah u a- ty pe ch ee se s m an uf ac tu re d w it h di ve rs e st ra in s of l .l ac ti s an d co m m er ci al c h ih ua hu a ch ee se s m ad e fr om ra w an d pa st eu ri ze d m il k s ou rc e c he es e sa m pl e v o la ti le co m po un ds a a a a a a a a a a a t r el at iv e p ea k ar ea s ex pr es se d in ar bi tr ar y un it s (e + ) f ir st cl u st er p -m b ra nd . – – . . . – . – – – – c f d v s b s – . – – . – – . – . – – a t c c – . – . . – – . – . – – c m a – . – . . . – . . . – – v e j – . – . . . – . – . – . r c – . . – . . – . . . – – r d e b – . . . . . – . . . – – c k k – . – . . . – . . . – – v a lf - – . – . . . – . – . – – c k k – . – . . – – . . . – – p -m b ra nd . – – . . – – . . . – – c e z a – . – . . . – . – . – – v b b – . – . . – – . – . – – c e z cb - – . – . . – – . – – – s ec o nd cl u st er c p k – . – . . – . . . – – c e z b – . – . . . – . . . – . c l i – . – . . . – . – . – – c m m – . – . . . – . – . – . p -m b ra nd . – – . . – – . . . – – v m m – – . – . – – . . comparison of volatile compounds by wild lactococcus lactis t ab le (c on ti nu ed ) s ou rc e c he es e sa m pl e v o la ti le co m po un ds a a a a a a a a a a a t r el at iv e p ea k ar ea s ex pr es se d in ar bi tr ar y un it s (e + ) c e z ab – . – . . . – . – – – – r r q – . – . . – – . . . – – t h ir d cl us te r p -m b ra nd . – – . – – . . . – – v m h – . – . . . – . . . – – c c m – . – . . . – . – . – – r -m b ra nd . – – . . – . . . . . – n = ; cl us te rs d et er m in ed b y pr in ci pa l co m po ne nt an al ys is ; id of vo la ti le co m po un ds ar e sh ow n in t ab le v st ra in is ol at ed fr o m ve ge ta bl e, c st ra in is o la te d fr om in du st ri al st ar te r cu lt ur e, r st ra in is ol at ed fr om ra w m il k pr od uc t, p -m pa st eu ri ze d m il k c hi hu ah ua ch ee se , r -m ra w m il k c h ih ua hu a ch ee se c. nájera-domínguez et al. t ab le v ol at il e co m po un ds (a lc oh ol s, al de hy de s, es te rs , an d k et on es ) o bs er ve d in m in ia tu re c hi hu ah ua -t yp e ch ee se s m an uf ac tu re d w it h di ve rs e st ra in s of l . la ct is an d co m m er ci al c h ih ua hu a ch ee se s m ad e fr om ra w an d p as te u ri ze d m il k s ou rc e c he es e sa m p le v ol at il e co m po u nd s a l a l a l a l a l a h e e e e k k k r el at iv e pe ak ar ea s ex pr es se d in ar bi tr ar y u ni ts (e + ) f ir st cl u st er p -m b ra nd – . . – . – – – – – . – c f d v s b s – . – – . – – – – – – . a t c c – . – – – – – – – – . . . c m a – . – – . – – – – – . . – v e j – . . – . – – – – – . – r c – . . – . – – – – – . . – r d e b – . . – . – – – – – . . – c k k – . . – . – . – – – . – v a lf - – . – – . – – – – – – – c k k – . – . . – – – – – . . . p -m b ra nd . – . – . – . – – . . . – c e z a – . . . . – . – – – . . – v b b – . – . . – – – – – . . c e z cb - – . – . . . – – – – . . s ec o nd cl u st er c p k – . . – . . . – – – . . – c e z b – . – – . – . – – – . . – c l i – . – – . – – – – – . . – c m m – . . – . – – – – – – . – p -m b ra nd . . – – . – . – – . . . – v m m – – – – – . – – – – – comparison of volatile compounds by wild lactococcus lactis t ab le (c on ti nu ed ) s ou rc e c he es e sa m p le v ol at il e co m po u nd s a l a l a l a l a l a h e e e e k k k r el at iv e pe ak ar ea s ex pr es se d in ar bi tr ar y u ni ts (e + ) c e z ab – . – . . – – – – – . . – r r q – . – . . – . – – – – . . t h ir d cl us te r p -m b ra nd – . . – . . – – – . . . – v m h – . – – . – . – – – . . . c c m – . – – . . . – – – – . – r -m b ra nd – – – – . – . . . – – – – n = ; cl us te rs d et er m in ed b y pr in ci pa l co m po ne nt an al ys is ; id of vo la ti le co m po un ds ar e sh ow n in t ab le v st ra in is ol at ed fr om ve ge ta bl e, c st ra in is ol at ed fr om in du st ri al st ar te r cu lt ur e, r st ra in is ol at ed fr om ra w m il k pr od uc t, p -m pa st eu ri ze d m il k c h ih ua hu a ch ee se , r -m ra w -m il k c h ih ua hu a ch ee se c. nájera-domínguez et al. fig. volatile compound profiles obtained by gas chromatography–mass spectrometry (gc-ms) and solid phase micro extraction (spme) in miniature chihuahua-type cheeses manufactured with three different strains of l. lactis isolated from a commercial starter culture (fdvsbs- ), whey cheese (rq ), and a vegetable sample (mh ). details of volatile compounds are shown in table comparison of volatile compounds by wild lactococcus lactis discussion there is the perception by local consumers that raw milk chihuahua cheeses have stronger and more pleasant flavor than most of the pasteurized milk cheeses. van hekken et al. ( ) reported that raw milk chihuahua cheeses had more intense sour and bitter flavor than pasteurized milk cheeses. it was anticipated that some differences among the volatile profiles of cheeses manufactured with pasteurized milk and raw milk cheeses will occur. these differences can be attributed to many different factors but mainly to the heat treatment of the cheese milk and the variety of microorganisms present in the milk and the cheeses. bricker et al. ( ) reported that chihuahua cheeses manufactured with pasteurized milk contained mostly lab (mesophilic lactococci, lecuconostoc spp., thermophilic lactococci and lactobacilli), whereas raw milk cheeses had lab, coliforms, enterococci, and coagulase-positive staphylococci. nevertheless, it is difficult to establish the effect of microorganisms other than lab on the production of volatile compounds. on the other hand, it is widely known that heat treatment of the milk increases the presence of certain volatile compounds (fatty acids, esters, ketones, and aldehydes) modifying the flavor in the milk (hettinga et al. ). according to zabbia et al. ( ), cooked and flat flavors that develop in the milk during thermal processing derive essentially from maillard compounds including methyl ketones, furans, pyrazines, sulfur, and nitrogen-containing compounds. this could explain the absence of certain ketones ( -methyl- -butanone and acetoin) in the cheeses manufactured with raw milk (fig. ). the miniature cheeses ( month-aged) made with different strains of l. lactis showed a wide variation in their volatile profiles. these differences in volatile profiles were generally not related with the source of isolation of the strains (tables and ; fig. ). nevertheless, one strain isolated from artisanal whey cheese (strain rq ) and one strain isolated from corn leaves (strain mh ) had unusual patterns of volatile compounds (figs. and ). in a previous study, gutiérrez-méndez et al. ( b) assessed the aroma of milks fermented with different strains of l. lactis isolated from vegetables, raw milk cheeses, and industrial starter cultures. the analysis of these fermented milks using an electronic nose did not show a clear relationship between the source of isolation and the ability of lactococci to produce aroma, though some milks fermented with wild strains presented stronger yogurt-like aroma than those milks fermented with industrial strains. ayad et al. ( ) reported that milks fermented with some wild strains of l. lactis isolated from goat and cow milk contained higher levels of certain volatile compounds than milks fermented with industrial strains. nomura et al. ( ) reported that milks fermented with plant- derived strains of l. lactis had a similar flavor than milks fermented with reference strains; however, the milk fermented with some strains of l. lactis isolated from cow milk had a malty taste. centeno et al. ( ) reported that ewes’ cheese manufactured with industrial strains of l. lactis and wild strains of l. lactis isolated from raw milk cheeses had higher abundance of volatile compounds that cheese manufactured only with industrial strains. from results obtained by different authors (ayad et al. ; centeno et al. ; nomura et al. ; gutiérrez-méndez et al. b), it could be established that not all the wild strains of l. lactis have the capability to generate more volatile compounds than industrial strains, but some particular wild strains of l. lactis can produce unusual compounds and/or higher abundance of volatiles. c. nájera-domínguez et al. l. lactis produces different flavor compounds during its growth in the milk, curd, and cheese mostly from the fermentation of citrate and protein degradation. the citrate fermentation generates important flavor compounds like acetaldehyde, diacetyl, acetoin, and , -butanediol (goupry et al. ). all the miniature cheeses manufactured with different strains of l. lactis contained acetoin and , -butanediol. probably because most of the strains used were identified as citrate positive by kmk agar (kmk+) and positive to acetoin production by the vg reaction (vg+). however, the cheeses manufactured with the strains identified as kmk− and/or vg− also presented large amounts of acetoin and , -butanediol. the inconsistencies of these results may be attributed to the lack specificity of the kmk and vg methods. according to passerini et al. ( ), the kmk and vg methods have poor correlation with the real utilization of citrate and the presence of citrate catabolic genes. these authors also confirmed that strains of l. lactis that harbored the citp gene and the citm- g cluster produced a larger number of aroma compounds than those strains without this genetic information. on the other hand, degradation of milk proteins by l. lactis produces a large variety and amount of volatile compounds. the proteolytic system of lab is composed of proteinases that initially cleave the milk proteins to peptides, and then, these peptides are hydrolyzed to amino acids by intracellular peptidases. amino acids are catabolized producing a variety of low molecular weight compounds like aldehydes, alcohols, carboxylic acids, esters, and sulfur compounds (savijoki et al. ). the gene prtp that encodes the cell envelope-associate proteinase in l. lactis is harbored in extrachro- mosomal dna acquired by continuous exposure with other microorganisms that grow fig. principal component analysis (pca) of volatile compounds observed in five brands of chihuahua cheese and miniature chihuahua-type cheeses ( -month-old) manufactured with different strains of l. lactis: white circles strains isolated from commercial cultures, white squares strains isolated from vegetables, white triangles strains isolated from raw milk chihuahua cheeses, black circles commercial chihuahua cheeses. clusters were defined by k-mean clustering analysis comparison of volatile compounds by wild lactococcus lactis in the milk (mills et al. ). for this reason, it has been suggested that plant-derived strains have limited proteolytic activity against caseins (ayad et al. ; picon et al. ). in a previous characterization of the strains of l. lactis used in this work, the strains isolated from vegetables were found with low proteolytic activities, though the strain mh (isolated from corn leaves) showed a very high proteolytic activity (nájera-domínguez and gutiérrez-méndez ). it is worth noting that strain mh produced an unusual volatile profile with a large variety of volatile compounds. the majority of volatile compounds produced by l. lactis come from the catabolism of amino acids (yvon and rijnen ). the limiting step in the catabolism of amino acids is the depletion of α-ketoglutarate (α-kg), which acts as an amino group acceptor during the transamination step. some strains of l. lactis can synthesize the α-kg from glutamate through the glutamate dehydrogenase (gdh) enzyme (van kranenburg et al. ). for this reason, some authors have suggested that gdh activity could be the most important criteria for the selection of flavor-producing l. lactis (tanous et al. ) and nonstarter lab (kieronczyk et al. ). in the present study, the strains mh , cm , and rq produced unusual volatile profiles. these strains have been previously identified with gdh activity. two out of three strains (mh and rq ) with gdh-nadp activities and one strain with gdh-nad activity (gutiérrez-méndez et al. a). however, other strains similarly confirmed with gdh activities and also used in this work did not produce unusual patterns or large abundance of volatile compounds. conclusions the volatile profiles of commercial chihuahua cheeses made from pasteurized milk were clearly different to that made with raw milk. the capacity of l. lactis to produce volatile compounds in miniature cheeses was strain-dependent. the source of isolation of the strains did not influence the production of volatile compounds. most of the wild strains and industrial strains of l. lactis produced similar volatile compounds. nevertheless, the cheeses manufactured with some particular strains (cm , mh , and rq ) showed unusual profiles of volatile compounds. however, further research is required to understand the metabolic and genetic differences of these strains. all over the world local governments urge cheese makers to pasteurize the milk during the manufacture of cheese and thus reduce the risk of food-borne pathogenic bacteria. from the point of view of cheese makers and consumers, pasteurized milk cheeses have different flavors than raw milk cheeses. for this reason, there is a growing interest in the use of wild strains of l. lactis isolated from raw milk products to obtain similar flavors than artisanal cheeses. however, in this work, it was observed that only few wild strains are able to produce unusual flavor compounds. acknowledgments the mexican national council of science and technology (conacyt) supported this research through the research project no. cb- - / . c. nájera-domínguez et al. references almanza-rubio jl, orozco-mena re, gutiérrez-méndez n ( ) assessing consumer preference toward chihuahua cheese and chihuahua-type cheese. tecnociencia : – aoac ( ) official methods of analysis, ed. association of official analytical chemists, washington d.c. usa ayad ehe, verheul a, de jong c et al ( ) flavour forming abilities and amino acid requirements of lactococcus lactis strains isolated from artisanal and non-dairy origin. int dairy j : – barbieri g, bolzoni l, careri m, mangia a ( ) study of the volatile fraction of parmesan cheese. j agric food chem : – bertolino m, dolci p, giordano m et al ( ) evolution of chemico-physical characteristics during manufacture and ripening of castelmango pdo cheese in wintertime. food chem : – bourdat-deschamps m, lebars d, yvon m, chapot-chartier m-p ( ) autolysis of lactococcus lactis am stimulates the formation of certain aroma compounds from amino acids in a cheese model. int dairy j : – bricker al, van hekken dl, guerrero vm, gardea aa ( ) microflora isolated from mexican mennonite-style cheeses. food prot trends : – centeno ja, tomillo fj, fernández-garcia e et al ( ) effect of wild strains of lactococcus lactis on the volatile profile and the sensory characteristics of ewes’s raw milk cheese. j dairy sci : – desmasures n, opportune w, guéguen m ( ) lactococcus spp., yeasts and pseudomonas spp. on teats and udders of milking cows as potential sources of milk contamination. int dairy j : – . doi: . /s - ( ) - doman-pytka m, renault p, bardowski j ( ) gene-cassette for adaptation of lactococcus lactis to a plant environment. lait : – garde s, carbonell m, fernández-garcia e et al ( ) volatile compounds in hispánico cheese manufactured using a mesophilic starter, a thermophilic starter, and bacteriocin-producing lactococcus lactis subsp. lactis inia . j agric food chem : – goupry sp, croguennec t, gentil e, robins rj ( ) metabolic flux in glucose/citrate co-fermentation by lactic acid bacteria as measured by isotopic ratio analysis. fems microbiol lett : – . doi: . /j. - . .tb .x gutiérrez-méndez n, nevárez-moorillon gv ( ) chihuahua cheese: the history of a mexican cheese. carnilac ind : – gutiérrez-méndez n, valenzuela-soto e, gonzález-cordova af, vallejo-cordoba b ( a) α-ketoglutarate biosynthesis in wild and industrial strains of lactococcus lactis. lett appl microbiol : – gutiérrez-méndez n, vallejo-cordoba b, gonzález-cordova af et al ( b) evaluation of aroma generation of lactococcus lactis with an electronic nose and sensory analysis. j dairy sci : – gutiérrez-méndez n, rodríguez-figueroa jc, gonzález-cordova af et al ( ) phenotypic and genotypic characteristics of lactococcus lactis strains isolated from different ecosystems. can j microbiol : – gutiérrez-méndez n, trancoso-reyes n, leal-ramos my ( ) texture profile analysis of fresh cheese and chihuahua cheese using miniature cheese models. tecnociencia : – hettinga ka, van valenberg hjf, van hooijdonk acm ( ) quality control of raw cows’ milk by headspace analysis. int dairy j : – . doi: . /j.idairyj. . . hou j, hannon ja, mcsweeney pl et al ( ) effect of curd washing on cheese proteolysis, texture, volatile compounds, and sensory grading in full fat cheddar cheese. int dairy j : – kempler gm, mckay ll ( ) improved medium for detection of citrate-fermenting streptococcus lactis subsp. diacetylactis. appl environ microbiol : – kieronczyk a, skeie s, olsen k, langsrud t ( ) metabolism of amino acids by resting cells of non-starter lactobacilli in relation to flavour development in cheese. int dairy j : – . doi: . /s - ( ) - klijn n, weerkamp ah, de vos wm ( ) detection and characterization of lactose-utilizing lactococcus spp. in natural ecosystems. appl environ microbiol : – mills s, mcauliffe oe, coffey a et al ( ) plasmids of lactococci—genetic accessories or genetic necessities? fems microbiol rev : – . doi: . /j. - . . .x mullin wj, emmons db ( ) determination of organic acids and sugars in cheese, milk and whey by high performance liquid chromatography. food res int : – . doi: . /s - ( ) - nájera-domínguez c, gutiérrez-méndez n ( ) autolytic and proteolytic properties of strains of lactococcus lactis isolated from different vegetables, raw-milk cheeses and commercial starter cultures. food nutr sci : – . doi: . /fns. . a comparison of volatile compounds by wild lactococcus lactis http://dx.doi.org/ . /s - ( ) - http://dx.doi.org/ . /s - ( ) - http://dx.doi.org/ . /j. - . .tb .x http://dx.doi.org/ . /j. - . .tb .x http://dx.doi.org/ . /j.idairyj. . . http://dx.doi.org/ . /s - ( ) - http://dx.doi.org/ . /s - ( ) - http://dx.doi.org/ . /j. - . . .x http://dx.doi.org/ . /s - ( ) - http://dx.doi.org/ . /fns. . a nomura m, kobayashi m, narita t et al ( ) phenotypic and molecular characterization of lactococcus lactis from milk and plants. j appl microbiol : – passerini d, laroute v, coddeville m et al ( ) new insights into lactococcus lactis diacetyl- and acetoin- producing strains isolated from diverse origins. int j food microbiol : – picon a, garcía-casado ma, nuñez m ( ) proteolytic activities, peptide utilization and oligopeptide transport systems of wild lactococcus lactis strains. int dairy j : – . doi: . /j.idairyj. . . santos mv, ma y, caplan z, barbano dm ( ) sensory threshold of off-flavors caused by proteolysis and lipolysis in milk. j dairy sci : – . doi: . /jds.s - ( ) -x savijoki k, ingmer h, varmanen p ( ) proteolytic systems of lactic acid bacteria. appl microbiol biotechnol : – . doi: . /s - - - smit g, smit ba, engels wjm ( ) flavour formation by lactic acid bacteria and biochemical flavour profiling of cheese products. fems microbiol rev : – tanous c, kieronczyk a, helinck s et al ( ) glutamate dehydrogenase activity: a major criterion for the selection of flavour-producing lactic acid bacteria strains. antonie van leeuwenhoek : – tunick mh, van hekken dl, molina-corral fj et al ( ) queso chihuahua: manufacturing procedures, composition, protein profiles, and microbiology. int j dairy technol : – van hekken dl, drake ma, molina-corral fj et al ( ) mexican chihuahua cheese: sensory profiles of young cheese. j dairy sci : – van kranenburg r, kleerebezem m, vlieg jvh et al ( ) flavour formation from amino acids by lactic acid bacteria: predictions from genome sequence analysis. int dairy j : – voilley a, etiévant p ( ) flavour in food. crc press, boca raton yvon m, rijnen l ( ) cheese flavour formation by amino acid catabolism. int dairy j : – zabbia a, buys em, dekock hl ( ) undesirable sulphur and carbonyl flavor compounds in uht milk: a review. crit rev food sci nutr : – c. nájera-domínguez et al. http://dx.doi.org/ . /j.idairyj. . . http://dx.doi.org/ . /j.idairyj. . . http://dx.doi.org/ . /jds.s - ( ) -x http://dx.doi.org/ . /s - - - comparison of volatile compounds produced by wild lactococcus lactis in miniature chihuahua-type cheeses abstract introduction materials and methods microorganisms chihuahua cheese samples manufacture of miniature chihuahua-type cheeses compositional analysis of cheeses analysis of volatile compounds statistical analysis results fermentation of citrate and production of diacetyl characterization of miniature and commercial chihuahua cheeses volatile compounds in chihuahua cheese brands volatile compounds in miniature chihuahua-type cheeses discussion conclusions references volume refuge number © luann good gingrich and thea enns, . this open-access work is licensed under a creative commons attribution-noncommercial . international licence, which permits use, reproduction, and distribution in any medium for non-commercial purposes, provided the original authorship is credited and the original publication in refuge: canada’s journal on refugees is cited. cette œuvre en libre accès fait l’objet d’une licence creative commons attribu- tion-noncommercial . international license, laquelle autorise l’utilisation, la reproduction et la distribution de l’œuvre sur tout support à des fins non commer- ciales, pourvu que l’auteur ou les auteurs originaux soient mentionnés et que la publication originale dans refuge : revue canadienne sur les réfugiés soit citée. a reflexive view of refugee integration and inclusion: a case study of the mennonite central committee and the private sponsorship of refugees program luann good gingrich and thea enns abstract through a qualitative case study with mennonite central committee (mcc) sponsorship groups and former refugee newcomers, we adopt a reflexive, relational, and systemic lens (bourdieu) to analyze the institutional and interper- sonal relationships in the private sponsorship of refugees (psr) program, and more specifically, the ways in which mcc ontario’s sponsorship program invigorates or frustrates dynamics of social inclusion. we situate the institutional relations of the psr program as nested social fields and sub- fields, revealing complementary and competing systems of capital that direct explicit and implicit visions for “success” in mcc sponsorships. a peculiar mennonite/mcc social field and structure of capital generates institutional and social tensions, yet an ambivalent disposition or divided habitus presents possibilities for seeing, understanding, and challenging dynamics of social exclusion. résumé À travers une étude de cas qualitative avec des groupes de parrainage du comité central mennonite (mcc) et d’anciens nouveaux arrivants comme réfugiés, nous adop- tons une perspective réflexive, relationnelle et systémique (bourdieu) pour analyser les relations institutionnelles et interpersonnelles dans le programme de parrainage privé des réfugiés, et plus spécifiquement les façons dont le pro- gramme de parrainage du mcc ontario fortifie ou entrave les dynamiques d’inclusion sociale. nous situons les diverses relations institutionnelles du programme de parrainage privé des réfugiés comme étant des champs et sous-champs sociaux imbriqués, révélant des systèmes complémentaires et concurrents de capital qui orientent des visions explicites et implicites de la “réussite” dans les parrainages du mcc. un champ social et une structure de capital mennonite singuliers génèrent des tensions institutionnelles et sociales. volume refuge number toutefois une disposition ambivalente ou un habitus divisé présentent des possibilités pour voir, comprendre et remettre en question les dynamiques d’exclusion sociale. what is the sponsor’s role? your role … is not to provide instant answers, but rather to encour- age the newcomers to weigh and test a variety of possibilities…. sponsors should be involved in a mutual learning process…. each culture, and individuals within that culture, have their own way of doing things…. remember that they, as yourself, need to be treated as people with feelings and needs…. patience, mutual respect, good humour and love are invaluable assets as you work together in resettlement. the private sponsorship of refugees (psr) program in canada has been hailed by some as an exemplar for social inclusion and integration of refugee newcom- ers into the host society. this self-proclaimed “pioneering refugee resettlement program,” overseen by immigration, refugees and citizenship canada (ircc) through the refu- gee sponsorship training program (rstp), gives “ordinary people across the country” the opportunity to use their own personal resources (monetary and otherwise) “to be directly involved in the resettlement of refugees from abroad.” according to ircc, the role of a sponsor, post-arrival, is “to support the refugees for the length of the sponsorship [one year]. this includes help for housing, clothing and food, as well as social and emotional support.” sponsoring groups are directed to partner with ircc-funded service provider organizations (spos) to “support the settlement and integration of psrs.” while settlement and integration are not defined in gov- ernment documents, emphasis is given to independence and self-sufficiency. for example, the rstp handbook for sponsor- ing groups states, “during the first year, newcomers learn a tremendous amount and generally move from a high degree of dependence to a high degree of independence. through it all, your role is that of an enabler, supporting newcomers to equip themselves, make their own decisions and find out as much as possible about their new environment. above all, you are providing warm friendship and support.” the specific outcomes identified by the canadian gov- ernment—“finding employment, learning english, learning life skills to function in canada” —suggest that priority is placed on effecting individual level adaptation so that the refugee newcomer family reaches economic self-sufficiency through paid work. in contrast, we open this article with an excerpt from a mennonite central committee (mcc) document when the psr program was in its infancy. this passage provides a glimpse of a peculiar mennonite/mcc ethos that is defined by a non-conformist and communal heritage, culture, and institutional structure. this, we argue, is consequential for the nature of sponsor–newcomer rela- tionships, associated values and goals, and positions and dis- positions that develop through mcc’s refugee sponsorships. we adopt a reflexive, relational, and systemic lens to ana- lyze the institutional and interpersonal relationships in the private sponsorship of refugees. we are most interested in examining the tensions and contradictions of sponsor–new- comer relationships and associated positions and disposi- tions (or habitus) that are produced, at the institutional and interpersonal scales. we situate the psr program as a social field with a particular system of capital and habitus. this theoretical lens brings to our attention the symbolic economy, or logic, of the social relations of private sponsor- ship, revealing both complementary and competing systems of capital that direct explicit and implicit visions for “success” in mcc sponsorships, and result in institutional and social tensions and an ambivalent disposition or divided habitus. we argue that the “double privatization” of the psr program is consequential, even in shaping individual private sponsor- ship roles and associated dispositions. equally important in this case example is the unique synergies between mcc as an organization and the congregations that make up its base of support, many of which have sponsored refugees for a sustained period of time. thus, we theorize, these local and global synergies reproduce a distinct mennonite ethos (or social field) that is embodied in institutions and individuals. in this article we draw on focus group and interview data with mcc constituent group (cg) members and former refugee newcomers, along with organizational documents, to examine the nature and evolution of the relationships, responsibilities, positions, and dispositions of private sponsorship. we begin with a brief history of the private refugee sponsorship program in canada and mcc’s part in its development, followed by an outline of this study’s theo- retical framework and methodology. the bulk of the article is devoted to our analysis of institutional and interpersonal relationships, tensions, contradictions, and possibilities as they emerged in our data. private refugee sponsorship in canada complementing canada’s government-assisted refugee (gar) program, the immigration act officially institu- tionalized the psr program. cameron and labman note that “sponsorship is permitted through three types of sponsorship groups: ‘groups of five,’ ‘community sponsors,’ and ‘con- stituent groups (cgs),’ who are members of an organiza- tion that is a sponsorship agreement holder (sah).” as of february , there were sahs across canada, per cent of which are connected with religious communities. approximately per cent of refugees privately resettled are sponsored or co-sponsored by a sah. volume refuge number until recently, much of the literature on private refu- gee sponsorship has focused on program evaluation and history and falls within the context of the indochinese refugee movement, when the program was initially used and internationally recognized. research tends to com- pare refugee resettlement streams (e.g., gars versus psrs) or demographic features and is focused more on outcomes for refugee newcomers than on processes and practices in resettlement. more recently an influx of research has addressed the realities of private sponsorship of syrian refu- gee newcomers, considering identity or motivations and characteristics of sponsors. there is a much smaller body of literature on the unique history and involvement of mcc during this time and prior to signing the first master agree- ment. mcc’s role in refugee resettlement is acknowledged within the larger fabric of christian institutions in canada, while some literature specifically addresses cross-cultural and religious interactions between indochinese refugees and their mennonite sponsors. our focus is on the sponsoring relationships within a larger social system and specific social subfield of mcc as a sah. theoretical considerations: models of integration, social fields, and structures of capital integration and inclusion are regularly considered critical to settlement of refugee newcomers. in practice, integration and inclusion are often used interchangeably, notwithstand- ing discrete conceptual roots and distinct vast literatures. particularly in the context of settlement services for immi- grants and refugees, inclusion may emphasize a subjective sense of belonging and trust over the material realities of settlement and integration. despite their ubiquity, definitions and indicators of inclu- sion, or integration, commonly remain implicit and specific to national contexts and cultural trends that shift over time, revealing the normative nature of an unquestioned social ideal. we consider concepts of refugee integration or inclu- sion to be produced by an assumed logic that is associated with material and symbolic capital (or resources) in a social field. from an individualistic and categorical point of view, integration is most often equated with participation in various social arenas, and interventions focus on increas- ing individual capacity for meaningful incorporation into mainstream communities and institutions. for example, the stated objective of settlement services in canada is “to help them [refugee newcomers] to become participating members of canadian society as quickly as possible.” this familiar evaluative gaze lands squarely and exclusively on the refugee newcomer, producing an invisible yet ideal- ized individual and collective self. integration or inclusion through person-change measures—to help them fit into social systems, institutions, and cultural norms—implies a “centre” or series of centres whereby voluntary engagement or mandatory insertion moves an individual from exclusion to inclusion. offering more depth of meaning and complexity, a popu- lar analogy for integration or inclusion of immigrants and refugees is a “two-way street,” recognizing the need for reciprocal change between newcomers and hosts, where “both the receiving communities and the newcomers change, and change each other.” emphasis is placed not only on rights, but also on responsibilities of both the newcomer and residents to create the “opportunities for the immigrants’ full economic, social, cultural and political participation.” this interpersonal change remains focused on the level of the individual, yet gives some recognition to the self in rela- tion to the other. aiming for a more robust conception of integration, or inclusion, that recognizes refugee newcomers as “stakehold- ers” in integration rather than sites of intervention, lamping, bertolo, and wahlrab posit that the primary goal of resettle- ment is not to provide services, but to build relationships and a welcoming community. similarly, hynie’s holistic integra- tion model strengthens the emphasis on changes within the social context and on the interrelatedness of different social levels or dimensions. this shift from the individual to the social as the unit of analysis and site of intervention requires situating the other in a social context, stressing place change over person change. a key principle or value that operates in mcc’s refugee sponsorship program is a concept of “mutually transforma- tive relationships,” suggesting a model of integration or inclusion that expands the sites of intervention to include interpersonal change, place change, and even system change. we propose that an approach to integration or inclusion of refugee newcomers that is congruent with the mennonite/ mcc ethos (or structure of capital) situates refugee sponsor- ship within the broader context of forced migration—in con- flict that is at once interpersonal and systemic, manifesting itself in fractured relationships between individuals, groups, communities, societies, and nations. this, we argue, is the essence of social exclusion. in writing about transforma- tive relationships in protracted internal and international- ized conflict—contexts that produce refugees—mennonite scholar and practitioner john paul lederach emphasizes the “interdependence between various levels of society affected by and affecting change processes.” thus, a system-change model of integration involves transformation at all levels— personal, relational, institutional, and cultural. seeing integration, or inclusion, as conflict transforma- tion, or system change, is uncommon in refugee-receiving volume refuge number countries in the global north. the social and legal envi- ronments of host nations are relatively just and fair, com- pared to refugee source countries, and by virtue of offering safety and protection, a national moral superiority is implied. furthermore, this narrow perspective denies the inextrica- ble ties between “refugee-producing” and “refugee-saving” nation-states, and the incessant historical practices that give rise to collective violence and “populations that have expe- rienced a deep fracture in human relationships as a result of fundamental violations of their human rights.” especially in the relationships of refugee sponsorship, system change is a demanding point of view, as a critical gaze must be turned to the self and the other in social and historical relations of power. to recognize the sustained conflict and slow violence of “soft domination” requires eschewing common sense binaries to, instead, hold paradox. some definitions of terms are required. according to french sociologist pierre bourdieu, the social world is made up of multiple and diverse social fields and subfields, or are- nas of contest and struggle. a social field, analogous to a field of play in a highly competitive game of sport, is defined by its structure of capital, both material and symbolic, as individuals and groups compete for available resources that are effective and valued in that social field. all social space is ordered according to the legitimate means of appropriat- ing and circulating capital, and the resulting structure and volumes possessed by individuals and groups engaged in any given social field. occupants of various positions in social fields “seek, individually or collectively, to safeguard or improve their position.” in other words, a particular dis- position, or habitus, is associated with advancement in this social field, with the accumulation of various species of capi- tal. the habitus—much more than identity—is “socialized subjectivity” and “the product of collective and individual history,” which is expressed through taste and disposition, or embodied habits that are adjusted to social economies in which we engage. a divided habitus, or “coherent incoherence,” is a necessary “conciliation of contraries” in response to competing social fields and structures of capital, and coincident and opposing positions (i.e., dominant and dominated) in each. we will draw on this tripartite concept in the analysis that follows. methods and methodology: a case study of mcc history of mcc and canada’s private sponsorship model mennonite central committee (mcc) was founded in when famine and the decimation of mennonite communi- ties in ukraine during the russian revolution stirred men- nonites in north america to respond to the need of their co-religionists. in addition to aid, resettlement to canada was an important aspect of the work of the newly formed organization. between and , canada accepted over , mennonites from the soviet union, with the understanding that canadian mennonite communities would provide for and resettle these newcomers. in the fol- lowing decades, mcc expanded its relief and international development work well beyond assistance to fellow men- nonites. according to william janzen, a long-time director of mcc canada’s (mccc) ottawa office, the historical experi- ence of mcc in refugee resettlement served as a precedent for canada’s private sponsorship of refugee (psr) program, which was established more than fifty years after mcc was established. janzen also served as one of the negotiators of canada’s original master agreement, which mccc signed in . this agreement with the federal government provided the legal basis for mccc to work with local congregations that, in turn, offered organizational and logistical support for groups of citizens to privately sponsor refugees. mccc has sustained a vibrant refugee sponsorship program among mennonite churches for forty years. today mcc defines itself as “a worldwide ministry of ana- baptist churches,” with national offices in both winnipeg (manitoba) and akron (pennsylvania), enabling congrega- tions to become engaged in “relief, development and peace in the name of christ” at home and abroad. mcc provides a longstanding and unique case example for considering the relationships of private sponsorship in canada for at least four key factors: its origins in provid- ing aid to refugees; its role in canada’s private sponsorship program; its ties with mennonite and anabaptist churches and their refugee heritage; and the sustained engagement of individuals, sponsorship groups, and sponsoring congrega- tions in private sponsorship. research methods this analysis emerged from a qualitative research partner- ship between mcc ontario (mcco) and york university. our study used a reflexive community-based framework, whereby the research purpose, question, design, and data generation were collectively formulated and conducted in a partnership between researchers at york university, the mcco refugee sponsorship and settlement associate, and the mcco refugee program coordinator. the objective of this study was to examine how the relationships and practices within mccc’s private sponsorship program invigorate or frustrate dynamics of social inclusion. qualitative data were gathered in through seven focus groups with five to eight sponsors each, totalling forty- nine participants from twenty-one churches in six geograph- ical regions that sponsored refugees through mcc ontario between and ; seven interviews with seventeen former refugee newcomers who were sponsored by one of volume refuge number the sample groups; a key informant interview with brian dyck, the national migration and resettlement program coordinator; and mcc documents and publications. none of the sponsorships were named cases, but rather the spon- sored individuals and families were identified through the visa office referred (vor) or blended visa office–referred (bvor) program. this is significant for the purposes of our study, since sponsors had no prior relationship with the refu- gee newcomers they sponsored. apart from one sponsoring church that was affiliated with the evangelical missionary church of canada, all congregations within the sample were members of mennonite denominations that are formal con- tributing constituents of mccc, with the majority belonging to the mennonite church. mcco staff used its database to identify sponsors across ontario and provided formal invitations on behalf of the organization. because a primary objective of the research was to understand the nature and development of sponsorship roles and relationships over time, the sample of cgs was limited to those who had spon- sored a family or individual prior to the – syrian reset- tlement efforts. contact information for cgs before was limited, thus our sample captured sponsors between and . however, as the data reveal, several congregations had been sponsoring for decades, even since . a purpo- sive sample of these long-standing groups that had engaged in multiple sponsorships prior to was selected from regions in ontario with the largest representation of these groups: waterloo region, stratford, niagara, and the greater toronto area. aiming for multiplicity of perspective, purpo- sive sampling was further employed to add three additional focus groups: ( ) sponsors from the leamington area, to provide a rural perspective; ( ) sponsors from ottawa men- nonite church, to understand the experiences of the longest- standing cg with the most completed sponsorships; and ( ) a cg comprising individuals who attended two different mennonite churches and were sponsored through mccc but independent of either congregation. subsequently, sponsors extended the invitation to participate to those whom they had sponsored, resembling a purposive snowball sampling method, as recruitment was limited to former refugee newcomers with whom sponsors had an ongoing relation- ship. refugee countries of origin represented included iraq, syria, eritrea, south sudan, and colombia. interpreters were used for four of the seven newcomer interviews, for arabic, tigrinya, and spanish. focus group discussions and interviews were audio- recorded and transcribed. discussions with sponsors centred on the following topics: expectations or goals of sponsor- ship, values and guiding principles of sponsorship, shifting and growing relationships between sponsor and sponsored refugees over time, best practices, and personal experiences of sponsorship. demographic information for each focus group participant was collected prior to each focus group. thematic analysis of the focus group data was conducted through a collaborative and iterative approach, combining independent analyses by authors enns and good gingrich, and collaborative analysis with mcco program coordinators. direct quotations from former refugee newcomers are identified with pseudonyms, and those from sponsors with the number of the focus group. a reflexive lens research and practice that adopt a relational and systems framework are necessarily reflexive. in other words, the focus of attention is on the ways in which we engage with one another, as well as the outcomes of our work together. we identify the overarching methodology that guided this research project as “epistemic reflexivity.” bourdieu’s prac- tice of reflexivity entails the systematic analysis of practice in everyday social relations, “the objective archeology of our unconscious,” and the arbitrary. reflexive sociology “is critical of established patterns of power and privilege as well as of the politics that supports them.” more simply, a reflex- ive analysis shifts our gaze. rather than the conventional focus on excluded individuals or groups—the other—who are the targets of policies and services to help them become included or integrated, we take as our object of study the social spaces that comprise this largely uncontested “centre,” specifically, the institutional and interpersonal relationships of private refugee sponsorship: a primary objective is “to his- toricize and so denaturalize that which seems most natural in the social order,” to the point of seeming inevitable. epis- temic reflexivity requires us to see what we take for granted, to recognize that we have a world view that is not the only way to view the world. institutional relations: the nested social fields of refugee sponsorship as for all social fields, the institutional relations of private sponsorship are arenas of contest and struggle. specifically, mccc has a duty through its sponsorship agreement to func- tion as an extension of the federal government (ircc) in carrying out the directives of the psr program. yet equally important in our case example is mccc’s obligation to its constituency of mennonite and affiliated congregations. thus, mccc is answerable to two distinct constituencies and systems of institutions, policies, and practices. as a broker between government directives and sponsors, mccc must hold in tension two conflicting sets of values, or structures of capital. we will explore the institutional and interpersonal implications of these contradictory social fields and struc- tures of capital in the following sections. volume refuge number the market-state social field with its primary purpose of refugee settlement, canada’s psr program fits within the social welfare arm of the nation-state. yet private sponsorship programs do not fall neatly under one of the four sectors commonly associated with national welfare states: government (or public), market (or private for-profit), community/voluntary sector (private not-for- profit), and family (private and informal). the “settlement and integration of psrs” is to be achieved through a “part- nership of support” from informal civil society (sponsorship groups) and publicly funded service provider organizations (spos). canada’s psr program is designed to be a public-private partnership, but direct service provision and a portion or all of the cost is delegated to the formal not-for-profit com- munity/voluntary sector as well as informal family and civil society, yet the state imposes the legal framework and prac- tice regulations. this is a double privatization, as the mar- ketized public transfers international and domestic respon- sibility to both the formal and informal not-for-profit private sectors, blurring multiple boundaries within and beyond the nation-state. the logic or structure of capital of the psr program is made explicit in its goals, the terms for “success,” and what sponsors are “to make/to do.” even a cursory glance at ircc guidelines and instructions for sponsors reveals that the standard for successful private sponsorship is measured primarily by a particularly narrow version of self-sufficiency of refugee newcomers at the end of the one-year sponsor- ship. in practice, whether defined as settlement, integration, or inclusion, the outcome is most often assessed through individual and static indicators of financial independence and/or an emotional sense of belonging and trust. market logic assumes that the subjective and material realities of social exclusion are best addressed through paid work. such person-change measures constitute enforced dependency on the market. this is social exclusion by design, as we know that inclusion is not available for everyone through paid work. the mennonite/mcc social field: a countercultural system of capital despite a range of personal beliefs and contradictory expres- sions of proximity or distance to religion and the mennonite church, a common sponsorship ethos, or structure of capi- tal, runs through official mcc discourse and all participant responses. this ethos is institutionalized in mcc and its constituent churches and is reinforced in the specific prac- tices of synergy that are mutually productive for mennonite organizations, mcc programs, and participating individuals. we have argued elsewhere that mccc has maintained a com- mitment to refugee sponsorship largely as the result of his- torical beginnings steeped in refugee resettlement, its local and national credibility as a sah, its substantial presence and history in international development work, and its structure and grassroots connections with mennonite and affiliating denominations in north america. consequently, we theo- rize this diverse yet singular social context as a social field, with its own “institutional boundaries,” “barriers to entry,” and “specialists in the elaboration of a distinctive source of authority and sociodicy.” as with all social fields, the mennonite/mcc social field functions according to its own discernible structure of capital that cuts across place and time and directs the accumulation and exchange of mate- rial and symbolic assets, and produces a particular habitus or disposition. we identify the following distinct features of the men- nonite/mcc social field that have supported and sustained a unique model of refugee sponsorship with long-standing sponsoring groups for over forty years. a heritage of persecution mennonite identity is steeped in “refugeeness.” the mcc dis- position, or habitus, is rooted in stories of mennonite refu- gees from the twentieth century. janzen and epp-tiessen identify the significance of an inherited refugee story, most importantly flight from the soviet union during and after the first and second world wars, in motivating mennon- ites to become involved in the sponsorship of indo-chinese refugees. epp-tiessen explains: “they, their parents, or grandparents had been refugees, and they now wished to ease the suffering of others.” a familiar and inspiring grand narrative is the almost -page first-hand account of mcc’s second refugee resettlement effort of , uprooted men- nonites from russia to south and north america from to , as told by lifelong mcc workers and canadian men- nonites peter and elfrieda dyck ( ). the title, up from the rubble: the epic rescue of thousands of war-ravaged men- nonite refugees, contains the essence of this legendary david and goliath story. nearly half of the sponsors in our study articulated a familial refugee story. this sense of personal connection to “refugeeness” was repeatedly identified as a motivating factor for sponsors: “i think one of the reasons that i feel strongly about this is that my parents were refugees after the second world war.” some respondents described a direct and inti- mate relationship with mcc, as they associated their current life in canada with the support and aid provided by mcc when they themselves, or their family, resettled in canada as refugees. when asked why they chose to sponsor through mcc, an older couple noted, “when we talk about our family volume refuge number experience, it was mcc who was there, and they found spon- sors for my parents and they found sponsors for [my wife] and family. the natural choice.” while not all north american mennonites reference a familial refugee past from the twentieth century, the men- nonite heritage and collective identity also draws from sto- ries of sixteenth-century anabaptists, who were persecuted for opposing the religious and political leaders and institu- tions of the day. the anabaptist disposition is countercul- tural, even radical, outside the mainstream and inclined toward the margins. mennonites often use this history to identify with the disadvantaged and powerless, as social and cultural capital—far more important than material capital in a mennonite social field—is associated with (triumph over) oppression and suffering. this “posture” for the dispossessed and the outsider has shaped the particular anabaptist/men- nonite interpretation of biblical teaching and theological explanations for mcc’s vision and mission of “serving with humility and in partnership to meet local needs with local solutions” and “to prevent violence and promote peace and justice.” a culture of beliefs in action/an ethos of sponsorship a practical and collective response to human crisis or need is an obligation that grows out of religious and humanitarian beliefs and values that have shaped mennonite cultures for over years. for focus group participants who articulated a refugee past, sponsorship was clearly expressed as a means to strengthen their mennonite identity by weaving this herit- age with their current practice. some also drew on classic formulations of anabaptist/mennonite theology to explain their motivation to sponsor: “our congregation is very influ- enced by anabaptist theology. specifically, we recognize the call of the gospel to make a difference in the world and dis- cipleship and service, so the thrust of our service is that we want to reach out to some of these people globally that are in stressed situations.” discipleship, central to mennonite theology and culture, emerged as an important element for some sponsors who specifically described sponsorship through mcc as “an extension, a practical part of [mennon- ite] faith” and of “loving mercy and acting justly.” one respondent from a congregation in southern ontario with a long history of sponsorship noted that refugee sponsorship is a “christian service,” and there “seems to be this understand- ing that within the call to discipleship we should be doing something, and we do this.” although all respondents had some affiliation with a mennonite church or heritage, several explicitly articulated that their involvement in sponsorship was not tied to faith: “the fact that we can do it is why we did it. not out of any obligation, out of any faith, or anything else. it was just that we had the means, and therefore we could participate.” for these sponsors, mcc’s “theological hands-off ” stance made it possible to participate in “a hands- on, real thing—it’s not just talking about it…. this is real. i can contribute to making a real difference, a meaningful difference.” for mennonites in canada, whether claiming religious affiliation or not, sponsorship through mcc gives expression to a past refugee experience, a current represen- tation of triumph over hardship, and a sustained collective identity as people of peace. in turn, a unique mcc sponsor- ship ethos is reinforced. a community of sponsoring communities mcc’s structure expresses an organizational commitment to “relationships with our local partners and churches” that is consistent with anabaptist principles of community, mutual aid, and sharing of material and social resources. the church as a faith community provides a natural structure and cul- ture for sponsorship. a prominent theme in focus group discussions was the mutually supportive and constitutive relationship—an institutional synergy—between mcc and affiliated churches. congregations that have maintained a long-term engagement in private sponsorship are heavily reliant on mcc, its structure, reputation, and staff support. in turn, the stability of mcc’s refugee program is owed to the sustained engagement of individual congregations. the tight connection between mennonite churches and mcc was articulated by a focus group member: “our churches are all part of mcc, we are constituents of mcc—we see mcc as the extension of our local congregation that does the local and international relief and development work and mcc as an extension of the community and development work.” in addition to the reputation and practical support of mcc, long-standing congregational structures, practices, and rela- tionships offer the material, social, and symbolic resources necessary for refugee sponsorship. local congregations are an established collective of people who provide financial and in-kind resources, form sponsorship groups, replace group members as necessary, generate additional supports and resources, connect with community networks, and have ready access to a physical space to hold events or meetings. many churches have designated funds for refugee support in the form of mission budgets, benevolence funds, or even a designated budget line specifically for refugee resettlement needs. further, the congregation provides a financial and social safety net, a pool of potential resources. furthermore, mcc’s extensive international development work and the involvement of north american mennonite churches has cultivated institutional and interpersonal relationships that extend across place and time. mcc has programs in fifty-six countries and is involved in another ten countries, with , workers around the world, and volume refuge number depends on both local staff and a substantial contingent of north american mennonite volunteers to implement its international programs. with its unique capacity to pro- vide accessible and popular international programming that grows a community of returned alumni—known as “mccers”—mcc’s international work is infused into local congregations through interpersonal relationships. the high number of refugees sponsored from specific countries (e.g., colombia, palestine) reflects mcc’s long-term and trusted relationships with international and local partners in those countries, including churches, governments, service organi- zations, and communities. peacebuilding a centrepiece of anabaptist/mennonite theology and tradi- tion is pacifism, or non-violent resistance. similarly, mcc values initiatives that encourage “relationship-building as peacebuilding.” mcc views sponsorship through this peace lens, and hopes for “transforming and everlasting” relationships, particularly between people of different faiths and cultures. writing as an employee of mcc, steph- anie dyck states that mcc encourages sponsors to “move to deeper levels of engagement” with newcomers to encourage a “mutually transformative process of integration and com- munity building.” while much of the material on success- ful sponsorship of refugees emphasizes self-sufficiency and independence, mcc’s focus on mutually transformative relationships is somewhat unusual in the world of refugee sponsorship. for example, unlike many sahs that select refugees to sponsor through named cases, mcc is committed to meeting the resettlement needs of any refugee, regardless of religion or culture. this was a deliberate decision made after a review of the sponsorship program in , when mccc stipulated that at least per cent of all cases were to be referred by unhcr or the canada visa office in order to prioritize those who had been identified as most in need. further demonstrating this commitment, mccc resettled approximately one-third of all refugees identified for reset- tlement by unhcr in . mcc’s goal of relationships of mutual transformation appears in various organization documents and repeat- edly came up in conversation with staff during the course of our research. dyck asserts that sponsorship can promote “mutually transformative relationships.” although the term defies definition, it is clear that the ideal of transformative relationships as an objective of sponsorship emphasizes relationships over belief and goes beyond the utilitarian roles and expectations commonly associated with newcomer integration. whereas mccc may mark “successful” sponsor- ship with economic independence of the refugee newcomer family, a hope for long-term reciprocal relationships is an additional and equally valued ideal, producing a split in the habitus in mennonite sponsoring relationships. mcc refugee sponsorship: an arena of contest and struggle from a relational and reflexive point of view, the dynamics of social exclusion and inclusion produced in the private spon- sorship of refugees are directly tied to the nested social fields, their operating structures of capital, and associated positions and dispositions of the sponsor in relation to the other. the conflicting structures of capital of the mennonite/mcc and market-state social fields introduce complexities, tensions, contradictions, and possibilities for a range of positions and dispositions in the sponsoring relationship and practices that both promote and obstruct social inclusion. the divided habitus of mennonite sponsorship the identities and roles afforded refugee newcomers in the sponsorship relationship and beyond have recently been examined. for example, kyriakides et al. draw on said’s theory of orientalism to argue that the refugee, as “non- western other,” is constructed as “uncivilised, unruly, and lacking in cultural sophistication,” thus rendering “‘our’ western morality and civilization.” alternatively, humani- tarian views of the refugee subject emphasize the suffering and hardship experienced by “undifferentiated masses” of refugees and asylum seekers, framing the character of the refugee in a positive light, but without agency. similarly, kyriakides et al. focus attention on “representations of pas- sivity and infantilization which must be negotiated as part of the resettlement experience.” the refugee as deviant, ascribed low power and low value, is easily turned to threat. in contrast, the refugee as passive victim is deemed a worthy recipient of aid and support. in the context of the sponsorship relationship, the ascribed identities of the refugee newcomer have everything to do with the disposition, posture, and (imagined) identity taken up by the sponsor. a focus on the other as the object of study and site of intervention constructs certain configu- rations of “them,” but more importantly, assembles an ideal- ized “us.” the refugee as threat, which winter and colleagues point out is common in social and news media, feeds a col- lective illusion of vulnerability, even victimization by the undefined other. in the sponsoring relationship, this dual- ity is unlikely, as the undeserving refugee justifies avoidance of engagement, withholding of support, or even punish- ment and retaliation. in contrast, however, the constructed identities of humanitarian discourse fit nicely within the sponsorship relationship, as the “passive ‘them’” positions the sponsor as the “agentic ‘us.’” the natural disposition of the sponsor in relation to the refugee newcomer in need volume refuge number of a humanitarian response is one of “helper” or “protector,” which, as kyriakides et al. imply, reinforces a good deal of social distance and a hierarchical order of things. the helper habitus is inclined toward a person-change approach to refu- gee newcomer integration. these positions and dispositions—commanding helper and passive victim—seem natural, especially in the early days of settlement. the sponsoring relationship was reported by both sponsors and refugee newcomers to be primarily utilitarian for the first six to eight months, assisting new- comers with the basics of everyday life as outlined by mcco, such as financial, health, housing, education, shopping, and transportation. humanitarianism also encourages sponsors to “‘put themselves in the shoes’ of people coping with difficult situations.” this position and disposition, contrasting the helper habitus, brings the self into full view. mennonite sponsors were particularly inclined toward this “alongside” position. one sponsor illustrated how the refugee history had been absorbed into his own identity as a mennonite and how the story of “the refugee” had become his own story: “many of us came from refugee families ourselves, as russian mennonites, and that story resonates especially strongly with me. my parents were both victims of violence and [witnesses to] murder in russia and then came here as refugees, and their story became my story.” similarly, one respondent felt connected to the past work of mcc and believed he was continuing a tradition of helping others: “[mcc] is still there, and i can tell this muslim family, ‘the same organization that helped my ancestors come to canada, now helps you, and it has been around a long time.’” for these individuals, sponsorship offers a means to engage in the work of mcc to give back to an organization from which they themselves, or their ancestors, had personally benefited. even though still rooted in humanitarianism, this sponsor disposition is dis- tinct from both the masterful “helper” and the compassion- ate “protector,” as the identification of the self with the other collapses social distance. the pretence of sameness suggests an ambivalent disposition and position in relation to the refugee newcomer, because only the sponsor is afforded the capacity to take on and discard “refugeeness” and the associ- ated symbolic power at will. sponsoring relationships evolve, often moving from more immediate and practical concerns to emotional and social supports. imposing the helper disposition into more personal aspects of life, some sponsors aspired to direct the decisions of newcomers, “to make them good, canadian citizens.” ideas of citizenship were associated with learning english, finding employment, and becoming “contributing members of canadian society.” both sponsors and former refugee newcomers related encountering uncertainty, disappointment, and frustration. revealing some coherence with the dominant market-state social field, sponsors’ efforts toward person-change integra- tion—defined for and practised to the refugee newcomer — sometimes backfired. for example, sponsors described using their time and social resources to find potential employment options for newcomers, efforts that were ignored or rejected. one respondent lamented, “part of this makes me angry, like they’re milking the system—this bothers me…. we’re trying to be helpful and they’re not really willing to do their end of the bargain.” shifting the locus of control, the newcomers who reported having a sustained job and were satisfied in their line of work had ultimately settled on employment that they had sought and secured on their own accord. for many newcomers, the “survival jobs” available to them could not replace the livelihoods they left behind. nicolas commented that his occupational background was “useless” in canada and explained how he was struggling with finances: “i can’t stop. there are no savings, no safety net.” as commonly reported in previous research, our data indicate that new- comers continue to encounter barriers to dignified employ- ment, even years after resettlement. the complicated nature of sponsorship relationships was defined by one sponsor as a “tension between wanting to help and wanting to not help too much.” most sponsors asserted that newcomers should become independent, and many noted certain times when they felt newcomers should “make their own way in life.” revealing an ambivalent disposition, or divided habitus, many sponsors expressed a desire or expectation for their relationships with the refugee newcomer to extend beyond the sponsorship year, noting that “successful [sponsorships] are the ones where there have been positive relationships established and maintained.” in some instances, the objective of “independence” was over- shadowed by the desire to maintain close relationships. for example, sponsors recognized their involvement might do newcomers a “disservice” and have direct impact on their independence. to enable newcomers to learn and make decisions themselves required sponsors to back off: “i think for some committees, they [refugees] almost become like children and so they’re very happy when the sponsorship groups make decisions for them, [but] for me, the goal was independence—to make myself redundant as quickly as possible.” extending the helper-helped dispositions well beyond the sponsoring year, sponsors reflected the need to strategically position themselves in the relationship so they do not abandon the newcomer, but also do not cre- ate new relationships of dependence. this framing largely assumes that sponsors are the ones who are both providing volume refuge number independence and standing in the way of it—that they alone bear this responsibility. encouraging an alternative sponsor position and disposi- tion, a valuable role identified by former refugee newcomers was that of simply listening—as tiffany said, to “listen to the needs of the person they’re taking care of ” and “be patient,” because newcomers “know things” but may find it difficult to express themselves, or as ayah said, “to talk to us, to feel comfortable.” although sponsors readily fulfilled their utili- tarian responsibilities, few recognized this more passive role and disposition, to simply visit with the family and to learn “what’s important to them…. we think that we know what is the best way to do things, but sometimes you really have to listen to them and let them do what they think they have to do.” staying with the helper-helped dyad, yet expressing a shift in the sponsor disposition, it was noted that a certain amount of advocacy is necessary for the utilitarian responsi- bilities of sponsors, such as facilitating access to medical and education systems. the objective of advocacy was often iden- tified as negotiating adjustment in the interaction between the individual and institution rather than individual-level change, thus bringing the social context into view. adopting a reflexive point of view and extending the line of vision even further to include the self in social relations, sponsors also described recognizing and using their personal privilege and influence to challenge the institution itself. indeed, sponsors noted advocating for change within their own congregations and larger communities in order to shift the narrative on refugee issues and dispel myths that fed xenophobia: “peo- ple have this notion that refugees are given tons and tons of money, more than anybody else…. when i see something like that and i say, ‘this isn’t true, check your facts—don’t go spreading false rumours about what’s happening…. you gotta give your head a shake and speak up.” this recogni- tion of relative privilege—not by virtue of personal merit but due to uneven social relations in canadian institutions and communities—shifts the emphasis from person change to system change. as responsibilities officially end come “month ,” there is a need to redefine and reshape the sponsorship relationship. the majority of sponsors and newcomers described their ongoing relationships in familial terms, and in some respects, the use of familial words legitimizes the continuation of the sponsorship relationship. with an average age of sixty-five among the sample’s sponsors, many noted that they consid- ered themselves parents to many of the newcomers. nearly all newcomers at some point referred to sponsorship mem- bers in relation to family. hassan commented, “the sponsor- ship group is my family. all of them, because they help me to understand the future.” omar explained, “until today, we still communicate and we still get together every once in a while, and we just became a small family. or, i should say, we added to their big family.” omar’s self-correction highlights contradictory meanings of these familial relationships, as sponsors incorporate new members into their existing fami- lies and lives, while newcomers are forced to begin their lives in canada from experiences of loss. as dhalia said, “they were our family, we had nobody here.” mcc encourages “mutually transformative” relationships that continue beyond sponsorship, facilitating the shift “from sponsorship to [interpersonal-change] integration.” navi- gating this transition from an uneven relationship bound within the duties of one year to that of “mutual transforma- tion” post-sponsorship, is paradoxical, introducing tensions and conflicts—and possibilities—in practice. the divided habitus, an expression of congruence to multiple positions and the divided self, allows for paradox to be contained dividing practices in the market-state field to be subvert- ed. the cleft habitus—“to step into one’s authority while remaining ever mindful of its limits and offences” —opens the possibility to look beyond person-change integration, to interpersonal change, place change, and perhaps even sys- tem change. institutional tensions, contradictions, and possibilities distinctions between mcc’s international and domestic pro- grams (especially the refugee sponsorship program), par- ticularly vis-à-vis the ideal of mutually transformative rela- tionships in practice, highlight tensions and contradictions in the mennonite/mcc social field. specifically, mcc’s operat- ing principles and institutional theory of change, articulated in a brief internal document, “encapsulate mcc’s conviction that lasting change often requires long-term commitment and happens when all members of a community connect across lines of difference to actively participate in shaping and implementing visions for just social, environmental, and economic structures.” following the example of jesus, and working in partnership with local organizations and communities, “unjust systems that oppress and exclude” are transformed to “just economic relationships,” “conflict” into “relief and development work,” and “structures of injustice and their legacies” to “a just peace.” in its more prominent international relief and develop- ment work, mcc does not enter into agreements with foreign governments as is required for the refugee sponsorship pro- gram in canada. as a result, mcc is freer in its overseas work to contest governments, policies, and local practices, and “to engage in community-based efforts and public policy advo- cacy at local, national, and international levels that build durable peace.” unlike the international contexts in which mcc engages, little emphasis is placed on transformation of volume refuge number unjust social relations in canada, suggesting an institutional bifurcation between the need for transformation of com- munities, institutions, and economic systems at home and abroad. further, despite mcc’s focus on “the radical trans- formation of unjust systems” in its international programs, mcc staff and sponsors rarely identity or address refugee newcomer experiences of social exclusion in canada. a personal and institutional reluctance to recognize uneven power relationships in our own backyard is revealed. ironi- cally, reflexivity—to see the self and the other in social and historical relations of power—is resisted in refugee sponsor- ship. yet the shared principles of relationship-building and practical engagement are given expression and reinforced through mccc’s refugee sponsorship program. conclusions we return to our guiding research objective: to examine the ways in which mccc’s private sponsorship program invig- orates or frustrates dynamics of social inclusion. the settle- ment experiences articulated by former refugee newcomers in our study expose stubborn dynamics of social exclusion, mingled with genuine experiences of social inclusion. this is the paradox—the simultaneous gain and loss—of forced migration and settlement. former refugee newcomers expressed their appreciation for the hands-on, practical support they received from sponsors: nicolas commented, “people who arrive with the help of the mennonite [church] or with churches with programs like that arrive with a huge blessing. it’s a big help.” other newcomers recalled being pleasantly surprised by how they were received. fatimah stated, “i did not expect such treatment. i had never seen that kind of kindness and hospitality before.” however, the everyday lives of refugee newcomers con- tinue into “month ” and beyond, long after the contrived relationships of sponsorship end. even the sustained rela- tionships of some sponsorships could not shield the ways in which communities and institutions function to keep people marginalized. the persisting and intersecting dynamics of social exclusion experienced by former refugee newcomers included economic exclusion, or loss of livelihood and mean- ingful work that is commensurate with acquired education and skills; spatial exclusion, or isolation and loneliness com- pounded by segregation in one neighbourhood, apartment building, or high school; socio-political exclusion, or barri- ers to accessing informal and formal social supports, such as health care, education, even friends beyond the sponsorship group; and subjective exclusion, or discounted classification, to find oneself “boxed up,” defined by and for others as only refugees, as only vulnerable, as only needy. the system- atic devaluation of education, knowledge, and expertise for newcomers—even when they are no longer newcomers—in notes good gingrich and enns have no current or past for- mal relationship with mcc canada or mcc ontario. both authors are associated with the mennonite community and culture by ethnicity, with differing relationships with the church. we would like to thank kerry fast for her editing and consulting assistance. her expertise in developmental editing and her past involvement in mccc’s refugee pro- gram helped shape this article. mennonite central committee canada, an introduction to southeast asian refugees and suggestions for sponsors (winnipeg, mb: mccc, ). refugee sponsorship training program, “the private sponsorship of refugees (psr) program,” http://www. rstp.ca/en/refugee-sponsorship/the-private-sponsorship- of-refugees-program/. refugee sponsorship training program, “the private sponsorship of refugees (psr) program.” government of canada, “resettlement in canada as a refugee,” last modified september , https://www. canada.ca/en/immigration-refugees-citizenship/services/ ref uge es/help-outside-canada/pr ivate-sp ons orship- program.html. refugee sponsorship training program, “responsi- bilities of sponsorship groups & availability of ircc- funded resettlement and settlement services,” immi- gration, refugees and citizenship canada (ircc),” may , http://www.rstp.ca/en/resources/ircc-resources/ canada’s labour market and local communities is well docu- mented. subjective exclusion functions over time. this is the dispossession of symbolic capital, and it works to keep people in disadvantaged positions. the mennonite/mcc social field and structure of capital generates tensions and contradictions. yet this uncommon sense resists the common sense individualized perspective that limits integration to person change, thus presenting possibilities for seeing, understanding, and challenging processes and outcomes of social exclusion. the invisible yet idealized subject and “centre” of person-change integra- tion is brought into view from a position and disposition outside. yet in the context of the psr program in canada, identification with the other without a reflexive view of the self in social relations of power is disingenuous and unsta- ble. furthermore, well-meaning efforts to change or support the excluded individuals, while overlooking the processes that make them excluded, ultimately serve to reinforce long-standing social and economic divides. social inclusion requires us to reverse our gaze—to examine and confront the assumptions we hold and everyday practices in which we engage that prop up our undeserved places and identities of privilege. http://www.rstp.ca/en/refugee-sponsorship/the-private-sponsorship-of-refugees-program/ http://www.rstp.ca/en/refugee-sponsorship/the-private-sponsorship-of-refugees-program/ http://www.rstp.ca/en/refugee-sponsorship/the-private-sponsorship-of-refugees-program/ https://www.canada.ca/en/immigration-refugees-citizenship/services/refugees/help-outside-canada/private-sponsorship-program.html https://www.canada.ca/en/immigration-refugees-citizenship/services/refugees/help-outside-canada/private-sponsorship-program.html https://www.canada.ca/en/immigration-refugees-citizenship/services/refugees/help-outside-canada/private-sponsorship-program.html https://www.canada.ca/en/immigration-refugees-citizenship/services/refugees/help-outside-canada/private-sponsorship-program.html http://www.rstp.ca/en/resources/ircc-resources/responsibilities-of-sponsorship-groups-availability-of-ircc-funded-restlement-settlement-services/ volume refuge number responsibilities-of-sponsorship-groups-availability-of- ircc-funded-restlement-settlement-services/. immigration, refugees and citizenship canada, the rstp handbook for sponsoring groups, “chapter : the first year and beyond,” , http://www.rstp.ca/en/resources/ hand-book-for-sponsoring-groups/. immigration, refugees and citizenship canada, rstp handbook. see thea enns, luann good gingrich, and kaylee perez, “religious heritage, institutionalized ethos, and synergies: mennonite central committee and canada’s private spon- sorship of refugees program” (paper presented at “private refugee sponsorship: concepts, cases and consequences,” munk school of global affairs, university of toronto, october – , ). the research reported in this article is part of a larger pro- ject that aims to measure processes and outcomes of social exclusion and inclusion for immigrant and refugee new- comers in canada. the authors gratefully acknowledge the funding support of the social sciences and research coun- cil (sshrc) of canada through the insight grant entitled “advancing social inclusion in canada’s diverse commu- nities: neighbourhood, regional, and national compari- sons,” pi luann good gingrich. geoffrey cameron and shauna labman, “private refugee sponsorship: an evolving framework for refugee reset- tlement” (paper presented at “private refugee sponsor- ship: concepts, cases and consequences,” munk school of global affairs, university of toronto, october – , ) government of canada, “private sponsorship of refugees program: sponsorship agreement holders,” january , https://www.canada.ca/en/immigration-refugees- citizenship/services/refugees/help-outside-canada/private- sponsorship-program/agreement-holders/holders-list .html. judith kumin, welcoming engagement: how private spon- sorship can strengthen refugee resettlement in the european union, migration policy institute europe (december ). cameron and labman, “private sponsorship of refugees program,” . see jennifer hyndman, william payne, and shauna jime- nez, “private refugee sponsorship in canada,” forced migration review ( ): – ; shauna labman, “private sponsorship: complementary or conflicting interests?” refuge , no. ( ): – ; michael lanphier, “spon- sorship: organizational, sponsor, and refugee perspec- tives,” journal of international migration and integration , no. ( ): – ; barbara treviranus and michael cas- asola, “canada’s private sponsorship of refugees program: a practitioner’s perspective of its past and future,” journal of international migration and integration , no. ( ): – . see michael j. molloy, peter duschinsky, kurt f. jensen, and robert j. shalka, running on empty: canada and the indochinese refugees, – (montreal and kingston: mcgill-queen’s university press, ); “the indochi- nese refugee movement and the launch of canada’s pri- vate sponsorship program: special issue,” refuge , no. ( ). see, for example, ircc, evaluation of the resettlement pro- grams (gar, psr, bvor and rap) (ottawa: immigration, refugees and citizenship canada—evaluation division, ); laura simich, “negotiating boundaries of refugee resettlement: a study of settlement patterns and social support,” canadian review of sociology and anthropology , no. ( ): – ; lori a. wilkinson, “the integra- tion of refugee youth in canada” (phd diss., university of alberta, ), ; morton beiser, “sponsorship and reset- tlement success,” journal of international migration and integration , no. ( ): – . michaela hynie, “canada’s syrian refugee program, inter- group relationships and identities,” canadian ethnic stud- ies , no. ( ): – . audrey macklin, kathryn barber, luin goldring, jennifer hyndman, anna korteweg, shauna labman, and jona zyfi, “a preliminary investigation into private refugee sponsors,” canadian ethnic studies , no. ( ): – . macklin et al., “preliminary investigation.” christine mckinlay, “welcoming the stranger: the cana- dian church and the private sponsorship of refugees pro- gram” (ma thesis, ryerson university, ). see stephanie phetsamay stobbe, “cross-cultural experi- ences of laotian refugees and mennonite sponsors in brit- ish columbia and manitoba,” journal of mennonite studies ( ): – ; daphne n. winland, “christianity and community: conversion and adaptation among hmong refugee women,” canadian journal of sociology , no. ( ): – . a variety of terms have been adopted to reference the target outcome of settlement policies and programs for immigrants and refugees, such as acculturation, adaptation, assimilation, integration, and inclusion. for an overview of integration- related terms, definitions, and debates, see stephen castles, maja korac, ellie vasta, and steven vertovec, “integration: mapping the field” (oxford: university of oxford, centre for migration and policy research and refugee studies centre, ); jennifer hyndman, “research summary on resettled refugee integration in canada” (toronto: york university, centre for refugee studies, ). hynie, for example, integrates the subjective considera- tions of belonging and security commonly associated with inclusion into her “holistic integration model (him)” to strengthen emphasis on the social context and “the nature of the relationships between refugees and other mem- bers of their communities” as well as “general community attitudes and beliefs about refugees.” see michaela hynie. “refugee integration: research and policy,” peace and con- flict: journal of peace psychology , no. ( ): – , . immigration, refugees and citizenship canada, “reset- tlement services for government-assisted refugees,” last http://www.rstp.ca/en/resources/ircc-resources/responsibilities-of-sponsorship-groups-availability-of-ircc-funded-restlement-settlement-services/ http://www.rstp.ca/en/resources/ircc-resources/responsibilities-of-sponsorship-groups-availability-of-ircc-funded-restlement-settlement-services/ http://www.rstp.ca/en/resources/hand-book-for-sponsoring-groups/ http://www.rstp.ca/en/resources/hand-book-for-sponsoring-groups/ volume refuge number updated january , https://www.canada.ca/en/immi- gration-refugees-citizenship/news/ / /resettlement- and-settlement-services-for-government-assisted-refugees .html see luann good gingrich, out of place: social exclusion and mennonite migrants in canada (toronto: university of toronto press, ), – . hynie, “canada’s syrian refugee program,” . the idea of “two-way integration” has been taken up by governments in the global north, including canada, australia, and across the eu. hynie, “canada’s syrian refugee program.” see, for example, lara winnemore and john biles, “can- ada’s two-way street integration model: not without its stains, strains and growing pains,” canadian diversity/ diversité canadienne , no. ( ): – . council of the european union, immigrant integration pol- icy in the european union (brussels: council of the euro- pean union, ), . sally lamping, melissa bertolo, and tom wahlrab, “activ- ist citizens in an immigrant-friendly city: the natural helpers program,” peace and conflict: journal of peace psy- chology, ( ), – . michaela hynie, a. korn, and d. tao, “social context and social integration for government-assisted refugees in ontario, canada,” in after the flight: the dynamics of refu- gee settlement and integration, ed. m. poteet and s. nour- panah, – (newcastle upon tyne, uk: cambridge scholars, ); michaela hynie, “refugee integration: research and policy,” peace and conflict: journal of peace psychology , no. ( ): – . see, for example, stephanie dyck, “private refugee spon- sorship in canada: an opportunity for mutual transfor- mation,” intersections: challenges and opportunities in refugee resettlement , no. ( ): – . good gingrich proposes that social exclusion is, essen- tially, conflict that is manifested in processes and outcomes of economic, spatial, socio-political, and subjective divides. see good gingrich, out of place. john paul lederach, “the origins and evolution of infra- structures for peace: a personal reflection,” journal of peacebuilding & development , no. ( ): – . for a useful discussion of conflict transformation, see john paul lederach, preparing for peace: conflict transforma- tion across cultures (syracuse, ny: syracuse university press, ); john paul lederach, the moral imagination: the art and soul of building peace (oxford: oxford univer- sity press, ). shifting the dominant vantage point of refugee integra- tion from the global north to the global south, kihato and landau consider inclusion of (or by) place: caroline wanjiku kihato and loren b. landau, “stealth humani- tarianism: negotiating politics, precarity and performance management in protecting the urban displaced,” journal of refugee studies , no. ( ): – . adrienne chambon, susan mcgrath, ben zion shapiro, mulugeta abai, teresa dremetsikas, and suzanne dudziak, “from interpersonal links to webs of relations: creating befriending relationships with survivors of torture and of war,” journal of social work research , no. ( ): . pierre bourdieu et al., the weight of the world: social suf- fering in contemporary society, trans. priscilla parkhurst ferguson (stanford, ca: stanford university press, ), . pierre bourdieu, the logic of practice, trans. richard nice (stanford, ca: stanford university press, ). pierre bourdieu and and loïc wacquant, an invitation to reflexive sociology (chicago: university of chicago press, ), . see pierre bourdieu, “principles of an economic anthro- pology,” in the handbook of economic sociology, ed. neil j. smelser and richard swedberg (princeton, nj: princeton university press, ), . good gingrich, out of place, . pierre bourdieu, sketch for a self-analysis, trans. richard nice (cambridge: polity, ), . in october representatives from mennonite churches in manitoba, saskatchewan, and alberta met to organize a canadian central committee similar to the mennonite central committee just organized in the united states. the work of providing shelter and support for thousands of mennonite refugees “until they were financially viable” prompted the formation of multiple mennonite organiza- tions, including the canadian mennonite board of colo- nization in , the mennonite land settlement board in , the central mennonite immigration committee (made up of mennonite newcomers in canada), and the mennonite central relief committee in western can- ada. esther epp-tiessen notes that “by the end of , a wide representation of mennonite and brethren in christ denominations had agreed to the transformation of their existing inter-mennonite organizations into one new national entity known as mennonite central committee canada, with provincial counterparts.” see esther epp- tiessen, mennonite central committee in canada: a his- tory (winnipeg: cmu, ), ; frank h. epp, mennonite exodus: the rescue and resettlement of the russian men- nonites since the communist revolution (altona, mb: cana- dian mennonite relief and immigration council, ). william janzen, “the mcc canada master agreement for the sponsorship of refugees in historical perspective,” journal of mennonite studies ( ): – . sources: epp, mennonite exodus; jacob gerbrandt, “cana- dian mennonite board of colonization,” global anabaptist mennonite encyclopedia online, last edited july , http://gameo.org/index.php?title=canadian_mennonite_ board_of_colonization&oldid= . janzen, “ mcc canada master agreement,” . for mcc’s complete vision and mission statement, see mcc, “vision and mission,” , https://mcccanada.ca/learn/ about/mission. https://www.canada.ca/en/immigration-refugees-citizenship/news/ / /resettlement-and-settlement-services-for-government-assisted-refugees.html https://www.canada.ca/en/immigration-refugees-citizenship/news/ / /resettlement-and-settlement-services-for-government-assisted-refugees.html https://www.canada.ca/en/immigration-refugees-citizenship/news/ / /resettlement-and-settlement-services-for-government-assisted-refugees.html https://www.canada.ca/en/immigration-refugees-citizenship/news/ / /resettlement-and-settlement-services-for-government-assisted-refugees.html http://gameo.org/index.php?title=canadian_mennonite_board_of_colonization&oldid= http://gameo.org/index.php?title=canadian_mennonite_board_of_colonization&oldid= volume refuge number one interview with a former refugee newcomer/family was conducted in each of the six main focus group regions. individuals and families were chosen on the basis of the overall diversity of the sample, considering factors such as family makeup, country of origin, and time of arrival. seven separate interviews were conducted, comprising sev- enteen participants. for a list of mccc’s sponsoring denominations, see “lead- ership and board,” , https://mcccanada.ca/learn/about/ leadership. for the sake of brevity, and to highlight the identities of sponsorship relationships, former refugee newcomers or previously sponsored refugees are often identified as sim- ply “refugees” or “newcomers.” we recognize the symbolic violence of limiting the identity of sponsored individuals to refugees or newcomers, even years after resettlement. for more on epistemic reflexivity, see good gingrich, out of place. pierre bourdieu, masculine domination, trans. richard nice (stanford, ca: stanford university press, ), . loïc wacquant, “pierre bourdieu,” in key sociological thinkers, ed. r. stones (new york: new york university press, ), . bourdieu, masculine domination, . immigration, refugees and citizenship canada, “respon- sibilities of sponsorship groups & availability of ircc- funded resettlement and settlement services,” http://www. rstp.ca/wp-content/uploads/ / /responsibilities-of- sponsorship-groups-availability-of-ircc-resettlemen.... pdf. liisa h. malkki, the need to help: the domestic arts of international humanitarianism (durham, nc: duke uni- versity press, ). enns, good gingrich, and perez, “religious heritage.” in an interview with aksu akçaoğlu, loïc wacquant clari- fies pierre bourdieu’s concept of social field and symbolic power. see loïc wacquant and aksu akçaoğlu, “practice and symbolic power in bourdieu: the view from berkeley,” journal of classical sociology , no. ( ): . epp-tiessen, mennonite central committee, . sponsor, focus group . sponsor, focus group . mcc, “vision and mission.” sponsor, focus group a. sponsor, focus group . sponsor, focus group a. sponsor, focus group a. sponsor, focus group b. sponsor, focus group . mcc, “about mcc,” , https://mcccanada.ca/learn/about. sponsor, focus group . mcc, “where we work,” , https://mcccanada.ca/learn/ where. epp-tiessen, mennonite central committee, . mcc, “refugee response,” , https://mcccanada.ca/ learn/what/refugees/sponsorship. dyck, “private refugee sponsorship in canada,” . treviranus and casasola, “canada’s private sponsorship of refugees program,” . rachel bergen, “mcc resettles one-third of canada’s bvor refugees,” mcc, , https://mcccanada.ca/stories/ mcc-resettles-one-third-canadas-bvor-refugees. dyck, “private refugee sponsorship in canada.” christopher kyriakides, lubna bajjali, arthur mcluhan, and karen anderson, “beyond refuge: contested orien- talism and persons of self-rescue,” canadian ethnic stud- ies , no. ( ): . hynie, “canada’s syrian refugee program,” . hynie, “canada’s syrian refugee program,” . see mike berry, inaki garcia-blanco, and kerry moore, “press cov- erage of the refugee and migrant crisis in the eu: a con- tent analysis of five european countries,” , http:// www.unhcr.org/ bb c .html; vlad petre glăveanu, constance de saint-laurent, and ioana literat, “making sense of refugees online: perspective taking, political imagination, and internet memes,” american behavioral scientist , no. ( ): – ; simon goodman, ala sirriyeh, and simon mcmahon, “the evolving (re)cat- egorisations of refugees throughout the ‘refugee/migrant crisis,’” journal of community and applied social psychol- ogy ( ): – . kyriakides et al., “beyond refuge,” . donna l. lybecker, mark k. mcbeth, adam m. brewer, and carine de sy, “the social construction of a border: the us-canada border,” journal of borderlands studies , no. ( ): – . elke winter, anke patzelt, and mélanie beauregard, “l’imaginaire national, l’asile et les réfugiés syriens en allemagne et au canada: une analyse discursive,” cana- dian ethnic studies , no. ( ): – . hynie, “canada’s syrian refugee program,” . mcco, “committee roles template.” hynie, “canada’s syrian refugee program,” . sponsor, focus group a. sponsor, focus group . sponsor, focus group a. sponsor, focus group b. for an insightful discussion of pedagogy and the nature of relationships, see dorothy vaandering, “critical relational theory,” in restorative theory in practice: insights into what works and why, ed. belinda hopkins, – (london: jes- sica kingsley publishers, ). sponsor, focus group . sponsor, focus group . sponsor, focus group . sponsor, focus group a. sponsor, focus group . sponsor, focus group b. http://www.rstp.ca/wp-content/uploads/ / /responsibilities-of-sponsorship-groups-availability-of-ircc-resettlemen....pdf http://www.rstp.ca/wp-content/uploads/ / /responsibilities-of-sponsorship-groups-availability-of-ircc-resettlemen....pdf http://www.rstp.ca/wp-content/uploads/ / /responsibilities-of-sponsorship-groups-availability-of-ircc-resettlemen....pdf http://www.rstp.ca/wp-content/uploads/ / /responsibilities-of-sponsorship-groups-availability-of-ircc-resettlemen....pdf http://www.unhcr.org/ bb c .html http://www.unhcr.org/ bb c .html volume refuge number sponsor, focus group . sponsor, focus group . wendy adema, “month : from sponsorship to integra- tion,” mcc, , https://mcccanada.ca/stories/month- - sponsorship-integration. a divided habitus, inclined toward the conciliation of con- traries, functions to preserve a subordinate social field and protect one’s assets—particularly one’s symbolic power—in that system of capital. a cleft habitus permits the simulta- neous occupation of dominant and dominated social posi- tions in conflicting social fields. for example, agents may maintain material and symbolic assets and an upward tra- jectory in a secondary system of capital while having mini- mal capacity to accrue capital in the market-state social field. integrated ambiguity is to see and know different and often contradictory systems of capital and divergent rules of the game all at once, and to be inclined towards practices that preserve a coherent yet ambiguous self. see good gin- grich, out of place. good gingrich, out of place, . alain epp weaver, “mcc’s operating principles and essen- tial elements of change” (akron, oh: mennonite central committee, planning learning disaster response depart- ment, ), . epp weaver, “mcc’s operating principles,” . epp weaver, “mcc’s operating principles,” . see, for example, royden loewen, “boxing up the old colony mennonites,” canadian mennonite, august . paulo freire, in his famous pedagogy of the oppressed, identifies that people sometimes accept that they have been made “beings for others,” reduced to the level of a cat- egory or even object by unjust social relations. he calls for transformed social structures that allow people to become “beings for themselves,” to be fully human. paulo freire, pedagogy of the oppressed, th ed. (new york: continuum, ), – . luann good gingrich is an associate professor and the director of the global labour research centre at york university. she can be reached at luanngg@yorku.ca. thea enns works in the area of refugee resettlement in canada. she can be reached at t.s.enns@gmail.com. mailto:luanngg@yorku.ca chh volume issue front matter church history volume reprinted with the permission of the original publisher by periodicals service company germantown, ny core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core printed on acid-free paper. this reprint was reproduced from the best original edition copy available. core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core church history edited by matthew spinka robert hastings nichols charles lyttle volume viii published by the american society of church history core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core table of contents articles pages arbaugh, george b., gossner missionaries m america - baron, hans, calvinist republicanism and its historical roots - bella, julius l, father tyrrell's dogmas - downey, glanville, julian the apostate at antioch - gray, john r., the political theory of john knox - harkness, r. e. e., the development of democracy in the english reformation - hawley, charles arthur, gerald massey and america - hershberger, guy franklin, pacifism and the state in colonial pennsylvania ., - hudson, winthrop s., the morison myth concerning the founding of harvard college - hudson, winthrop s., the scottish effort to presbyterianize the church of england - kristeller, paul oskar, florentine platonism and its rela- tions with humanism and scholasticism - odlozilik, otakar, bohemian protestants and the calvinistic churches - outler, albert c, origen and the regulae fidei - pennington, edgar legare, john wesley's georgia ministry .... - spinka, matthew, latin church of the early crusades - sweet, william warren, church archives in the united states - minutes of the society minutes of the forty-sixth consecutive (thirty-second annual) meeting of the society and of the council, december, - minutes of the forty-seventh meeting of the society and of the council, april, - book reviews angus, s., essential christianity - attwater, donald, st. john chrysostom beardsley, frank granville, the history of christianity in america bentwich, n., solomon schechter: a biography - bernhart, joseph, the vatican as a world power berthold, s. m., thomas paine, america's first liberal - be"venot, maurice, st. cyprian's be unitate, chapter billington, e. a., the protestant crusade, - - binns, l. e., the church in the ancient world bonner, c, some baptist hymnists from the th century to modern times burton, k., paradise planters - cadbury, henry j., annual catalogue of george fox's papers - corrigan, kaymond, s. j., the church and the nineteenth century - coulton, g. g., inquisition and liberty coulton, g. g., medieval panorama: the english scene from conquest to 'reformation; coulton, g. g., social life in britain from the conquest to the reformation - davis, helen c. m., comp., some aspects of religious liberty dodd, charles harold, history and the gospels - dru, alexander, ed., the journals of soren kierkegaard > - duckett, eleanor shipley, the gateway to the middle ages - eisenach, g. j., a history of the german congregational churches in the united states - core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core pages fairchild, hoxie n., 'religious trends in english poetry, vol. i - finkelstein, louis, the pharisees, the sociological background of their faith - flew, r. newton, jesus and his church - foster, frank hugh, the modern movement in american theology - garraghan, gilbert j., the jesuits of the middle united states - garrett, c. h., the marian exiles, a study in the origins of elizabethan puritanism _ - gingerieh, melvin, the mennonites in iowa - gipson, lawrence henry, ed., the moravian indian mission of white river: diaries and letters - gobbel, l. l., church-state relations in education in north carolina since l ye - goodenough, erwin, the politics of philo judaeus: practice and theory - goodwin, mary c, papal conflict with josephinism gordon, antoinette k., the iconography of tibetan lamaism hagen, lois d., a parish in the pines - haller, william, the rise of puritanism - halperin, s. william, italy and the vatican at war - hardy, e. n., george whitefield, the matchless soul winner horstmann, j. h. and wernecke, h. h., through four centuries - hull, william i., the rise of quakerism in amsterdam, - - jordan, w. k., the development of religious toleration in england, - - jorgensen, j., saint catherine of siena - knapton, ernest john, the lady of the holy alliance: the life of julie de krudener - knox, wilfred l., st. paul and the church of the gentiles - latourette, k. s., the thousand years of uncertainty, a.d. -a.d. - lietzmann, h., die reichskirche bis zum tode julians; and the founding of the church universal - mackinnon, james, the origins of the reformation - mareuse, ludwig, soldier of the church-. the life of ignatius loyola - mcconnell, francis j., john wesley mckinney, w. w., early pittsburgh presbyterianism - mcneill, john t. and gamer, helena m., medieval handbooks of penance - merkel, h. m., history of methodism in utah - moland, e., the conception of the gospel in the alexandrine theology .... - moore, ernest carroll, the story of instruction - muller, karl, kirchengeschichte murison, w., sir david lyndsay, poet and satirist of the old church of scotland - nelson, william, john skelton, laureate - nobbs, douglas, theocracy and toleration, a study in dutch calvinism from - - parsons, ernest william, the religion of the new testament - payton, james simpson, our fathers have told us pennington, e. l., apostle of new jersey, john talbot phelan, m., a history of the expansion of methodism in texas, - pratt, parley p., jr., ed., life and letters of parley p. pratt - riley, arthur j., catholicism in new england to - smith, h. maynard, pre-reformation england - smith, joseph fielding, ed., teachings of the prophet joseph smith - sonne, niels henry, liberal kentucky — - - sturge, c, cuthbert tunszal, churchman, scholar, statesman, administrator - torrey, norman l., the spirit of voltaire - - trobridge, george, swedenborg: life and teachings - walten, m. g., ed., thomas fuller's the holy state and the profane state - walter, johannes von, die geschichte des christentums, vol. i i wenger, j. c, history of the mennonites of the franconia conference - wertenbaker, thomas jefferson, the founding of american civilization: the middle colonies - white, l. t., latin monasticism in norman sicily - williamson, claude, ed., great catholics - winters, r. l., francis lambert of avignon ( - ) - zyzykin, m. v., patriarch nikon - core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core the american society of church history founded by phtt.ip schaff, : reorganized, : incorporated by act of the legislature of new york, officers for charles lyttle president roland h. bainton vice-president matthew spinka secretary robert hastings nichols . treasurer robert fortenbaugh assistant secretary other members of the council william warren sweet herbert wallace schneider conrad henry moehlman reuben e. e. harkness frederick w i l l i a m loetscher f. w. buckler j o h n thomas mcneill e. r. hardy, jr. wllhelm pauck percy v. norwood editorial board of church history matthew s p i n k a , managing editor robert hastings nichols charles lyttle, ex officio publication office, berne, indiana executive and editorial office, chicago, illinois core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core church history editorial board matthew spinka, managing editor robert hastings nichols charles lyttle, ex officio vol. viii march, no. table of contents t h e development of democracy i n t h e e n g l i s h reformation r. e. e. harkness calvinist republicanism and its historical roots hans baron c h u r c h archives i n the u n i t e d states william warren sweet pacifism axnfd t h e state i n colonial pennsylvania gay franklin hershberger m i n u t e s of the forty-sixth consecutive ( t h i r t y - second a n n u a l ) meeting of t h e american society of c h u r c h history, december - , m i n u t e s of t h e meeting of t h e council of t h e american society of c h u r c h history, december , book reviews : binns, l. e.: the church in the ancient world, mervin m. deems lietzmann, h.: die reichskirche bis zuni tode julians; and the founding of the church universal, conrad henry moehlman core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core contents moland, e.: the conception of the gospel in the alexandrine theology c. c. richardson latourette, k. s.: the thousand years of uncertainty, a. d. -a. d. wilhelm pauck white, l. t.: latin monasticism in norman sicily massey h. shepherd, jr. coulton, g. g.: inquisition and liberty . roland h. bainton jorgensen, j.: saint catherine of siena .... robert hastings nichols murison, w.: sir david lyndsay, poet and satirist of the old church of scotland john t. mcneill sturge, c.: cuthbert tunstal, churchman, scholar, states- man, administrator john t. mcneill winters, r. l.: francis lambert of avignon ( - ) roland h. bainton garrett, c. h.: the marian exiles, a study in the origins of elizabethan puritanism raymond p. stearns bonner, c.: some baptist hymnists from the th century to modern times robert g. mccutchan wenger, j. c.: history of the mennonites of the franconia conference c. henry smith horstmann, j. h. and wernecke, h. h.: through four centuries david dunn hardy, e. n.: george white field, the matchless soul winner earnest e. eells pennington, e. l.: apostle of new jersey, john talbot william w. manross gobbel, l. l.: church-state relations in education in north carolina since s. m. tenney berthold, s. m.: thomas paine, america's first liberal charles lyttle mckinney, w. w.: early pittsburgh presbyterianism robert hastings nichols billington, r. a.: the protestant crusade, - windsor h. roberts eisenach, g. j.: a history of the german congregational churches in the united states john f. c. green phel,an, m.: a history of the expansion of methodism in texas, - robert w. goodloe bentwich, n.: solomon schechter: a biography, solomon grayzel core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core a s t u d y o p t h e g e r m a n l u t h e r a n a n d c a t h o l i c i m m i g r a n t s i n c a n a d a , f o r m e r l y r e s i d i n g i n t z a r i s t a n d s o v i e t r u s s i a b y e d m u n d h e i e r a t h e s i s s u b m i t t e d i n p a r t i a l f u l f i l m e n t o f t h e r e q u i r e m e n t s f o r t h e d e g r e e o f m a s t e r o f a r t s i n t h e d e p a r t m e n t o f s l a v o n i c s t u d i e s w e a c c e p t t h i s t h e s i s a s c o n f o r m i n g t o t h e s t a n d a r d r e q u i r e d f r o m c a n d i d a t e s f o r t h e d e g r e e o f m a s t e r o f a r t s • m e m b e r s o f t h e d e p a r t m e n t o f s l a v o n i c s t u d i e s . t h e u n i v e r s i t y o f b r i t i s h c o l u m b i a a p r i l , a study of the german lutheran and catholic immigrants in canada, formerly residing in tzarist and soviet russia abstract after empress katherine ii of russia issued a mani- festo i n , inviting european settlers to russia, a sub- stantial number of germans immigrated and settled, with special privileges, on the l e f t and right hand banks of the lower volga river. the napoleonic wars temporarily stopped this f i r s t influx of germans into russia. with the beginning of the th century, a second immigration of germans started to russia, which resulted in the foundation of numerous ger- man settlements i n the black sea region. the high birth rate amongst the german settlers soon made a land shortage appar- ent with the result that sister colonies were founded i n siberia and central asia. although the german settlers were on a low level "culturally, they progressed economically and when compared to their russian neighbors, the germans were a prosperous group. the revolution of i n russia brought about tremendous changes i n the german colonies, nevertheless the colonists remained residing in their original settlements u n t i l world war i i . with the outbreak of the second world war, the volga germans were termed "unreliables" and were resettled to siber- i a . the black sea germans, since that area was occupied by- german forces,, were repatriated to germany. as early as # , when the german colonists* p r i v i - leges were curtailed i n russia, an immigration to overseas countries had. started. the period from to world war i, marked their f i r s t immigration to canada. as the russian- germans were a rural people, they settled exclusively i n the three prairie provinces of canada. they settled according to their religious faith although their settlements i n canada were sporadic when compared to the close, dense settlements i n russia. the period between world war i and world war ii marked the second immigration of russian-germans to canada. very few of these immigrants became farmers, the majority of them settled in the c i t i e s . after world war ii the third im- migration period started. these russian-german immigrants were o'f the group who were resettled to germany during the second world war. the economic success i n canada culturally elevated the entire russian-german group. they were leaderless and lacked a national feeling. these two factors caused the ra- pid adoption of canadian culture by the russian-germans. while the adult immigrants have only reached a level of adjustment, their children, who are canadian born and edu- cated, no longer differ from any of their fellow canadians. acknowledgements i wish to express my sincere thanks to the members of the slavonic studies department at the university of british columbia, for their numerous suggestions and advice. i am also indebted to the british columbia youth foundation who by t'heir generosity have made the completion of this thesis possible. i owe much to those who have so willingly furnished me with valuable information for this work. table op contents part i the germans in russia page chapter i. german settlements in russia . . i. statistics and distribution of german settlements ii. settlement of the volga region iii. settlements near petersburg- leningrad iv. settlement of the black sea region chapter ii. general development u n t i l world war i. land question and economic development ii. state administration iii. self-government i n the colonies iv. educational system v. religion in the colonies vi. characteristics and cultural aspects vii. internal migration and sister colonies chapter iii. the colonists between the world wars... i. world war i and the imperial ukas of ii. the march revolution of iii. october revolution and self- determination iv. economic aspects v. religion i n the colonies vi. german national schools and culture chapter iv. resettlement and repatriation during world war ii i. the eve of world war ii i i . liquidation of the volga german republic iii. black sea colonies under german occupation iv. repatriation from the german occupied territory part.ii russian-germans in canada chapter v. immigration into canada. i. - - - • - i i . iii. iv. canadian immigration policy i n brief immigration into canada ^- ^ second immigration - ^ third immigration into canada - after world war ii page chapter vi. statistics and distribution of russian- germans in canada i. statistics of russian-germans i n canada ii. distribution of the russian-germans i n canada chapter vii. economic, social, and cultural development. i. economic development i i . religion iii. education iv. press and literary publications v. german societies in western canada chapter viii. adjustment and assimilation in canada...... ' bibliography , tables table i. table i i . table iii. table iv. table v. table vi. the original volga colonies general statistics of the black sea area distribution of religious denominations i n the black sea area colonies pounded by russian-germans in i immigration from russia for the years - total immigration from russia according to country of birth and racial origin table vii• odessa village school attendance maps map i. a.s.s.r. of the volga germans map ii. colonies i n the black sea area map iii. russian-german colonies i n western canada introduction this dissertation i s an attempt to present the his- tory of the german lutheran and catholic immigrants in cana- da who had formerly resided i n tzarist and soviet russia. the immediate purpose of this work, however, i s to determine the present extent of adjustment or assimilation of these russian-germans in canada. religious groups such as the mennonltes, hutterites, and other reformed sects, although they are russian-germans, have not been discussed i n this work. extensive written research has already been executed i n regard to the mentioned religious groups. references have been made to these groups only inasmuch as they had an imme- diate bearing on the main theme of this study. the thesis consists of two parts; part i deals with the group i n russia, part ii deals with the group i n canada. part i contains the h i s t o r i c a l background of the russian-ger- mans, with which knowledge we are enabled to have a greater insight into their present behavior. part ii contains the immigration of the russian-germans to canada, their develop- ment in canada, and their present status as canadians. throughout my work and research, i have been guided by walter kuhn's "theory of a language island" (a minority; i i group i n the midst of other nationals). the theory is a pro- duct of a study of a l l the german minority groups i n the world and expounded i n his book entitled, deutsche sprachlnsel- forschung. geschichte, aufgaben. verfahren. the theory presents a pattern according to which a minority group develops. as a substantial number of the same ethnic group settle i n one area, they form a language island. economic success or failure causes class differentiations, i.e. r i c h and poor farmers. a class of workers and craftsmen also emerges. later the group develops a class of i n t e l l i - gentsia, consisting of teachers, pastors, doctors, etc. last- ly a city group is founded. the foundation of a city group marks the cultural advancement which is obtained while draw- ing from the non-nationals. it is this f i n a l state which starts the process of assimilation within the isolated lang- uage island. the material used i n this study has been manifold. the h i s t o r i c a l background of the russian-germans has been ob- tained from literature. further history and development of the group has been obtained by f i e l d work and personal con- tact with russian-germans who have recounted their past from russia and their pioneering days i n canada. an exclusive work about the russian-germans i n canada has never been pub- lished i n canada or abroad. historical sketches of individ- ual colonies in canada were of extreme value. the most i l l outstanding work in which the russian-germans were extensive- ly treated was heinz lehmann's das deutschtum in westkanada. c. h. dawson's book entitled group settlement» ethnic commun- i t i e s i n western canada, was also of great value although he shows no differentiation as to the origin of the germans i n canada. part i the germans in russia chapter i german settlements in russia i . statistics and distribution of german settlements the germans i n russia did not belong to the numerous national groups which were subjugated by force to the tzarist regime, as were the peoples of the caucasus, those of central asia, and many others. as settlers with tolerable rights, they were invited by the imperial government for reasons of th and th century state policy, to settle in the wild or partially cultivated regions of russia. this led to numerous closed german farm settlements. in addition to the german farmers, there was an ex- tensive group of germans who lived in the c i t i e s , especially the main cities of european russia during the th century. these people migrated to russia individually where s k i l l e d services were in great demand, and most of them were to a greater or lesser degree absorbed by the russian population. before world war i almost two and a half million germans were resident in the russian empire. the separation of the western areas from russia, i.e. the baltic states, gallcia, bukovina and bessarabia, a l l strongly german, re- duced the number according to the soviet census in to ., , * . the germans were thus c l a s s i f i e d as the t h i r t e e n t h l a r g e s t n a t i o n a l group i n the s o v i e t union. of these ,- , were c l a s s e d as r u r a l and , as urban. from t o about i , german c o l o n i s t s migrated a t d i f f e r e n t times and from v a r i o u s areas of germany and had e s t a b l i s h e d the s o - c a l l e d 'mutterkolonlen' or main c o l o n i e s . . these main c o l o n i e s were founded by s e t t l e r s who came d i r e c t - l y from germany. only l a t e r i n the n i n e t e e n t h century were numerous s i s t e r c o l o n i e s founded. the s o v i e t census of shows the f o l l o w i n g numbers of c o l o n i s t s f o r the v a r i o u s r e - gions '.̂ . v o l g a german r e p u b l i c - , . . germans i n the adjacent p r o v i n c e s of a s t r a c h a n , saratov, s t a l i n g r a d , samara - , . . b l a c k sea r e g i o n and crimea - , . . transcaucasus - , . . orenburg - , .^ . north caucasus - , ,** . s i b e r i a (omsk) - , .^ . kazakhstan - , .i!- mende von, gerhard, die v o e l k e r der sowjetunion, rudolf s c h n e i d e r v e r l a g , reichenau, , p.. • " c o l o n i s t s " was the common term i n r u s s i a f o r the german s e t t l e r s . mende von, op. c i t . , p. . these were s i s t e r c o l o n i e s founded by germans coming from the main c o l o n i e s . perhaps a more u s e f u l d i v i s i o n of the germans i n r u s s i a i s one made a c c o r d i n g to t h e i r r e l i g i o u s denomination. although k a r l stumpp's t a b l e ^ i s incomplete, i t g i v e s us a f a i r p i c t u r e of the r e l i g i o u s groups i n the b l a c k sea r e g i o n . before world war i , the number of c o l o n i s t s i n t h i s area was about , - t w o - f i f t h s c a t h o l i c , t w o - f i f t h s lutheran and o n e - f i f t h mennonite.^ to these three we have to add the h u t t e r l t e s and.other reformed s e c t s , which amounted to o n l y a few thousand. the v o l g a germans, w i t h an aggregate p o p u l - a t i o n of about , i n , had a more uneven d i s t r i b u - t i o n ; about f o u r - f i f t h s were lutheran and o n e - f i f t h c a t h o l i c . a few thousand of the reformed group are i n c l u d e d w i t h the lutherans j i i . settlement of the volga region i n the th century a f t e r the t a t a r s on the v o l g a were d e s t r o y e d as a power, a constant e f f o r t was maintained by the r u s s i a n government to s e t t l e . t h i s area w i t h t h e i r own p e o p l e . thus we f i n d a c o n s i d e r a b l e group of ukranians s e t - t l i n g i n the lower v o l g a a r e a . k a t h e r i n e i i , empress of r u s s i a , made the o n l y attempt to s e t t l e these v a s t r e g i o n s see table i i i . stumpp, k a r l , die deutschen k o l o n l e n im schwarzmeergeblet. ausland und heimat v e r l a g s a k t i e n g e s e l l s c h a f t , s t u t t g a r t , , p. . verband deutscher vereine lm auslande e. v., wir deutsche i n d e r welt, kommissionsverlag v e r l a g s a n s t a l t otto s t o l l b e r g , b e r l i n g , , p. . with a non-russian population. conscious of the advantages of having russia's unpopulated areas .cultivated and develop- ed, she issued an imperial manifesto on the th of december, . in i t she invited west european settlement of these arable steppes along the volga river. the manifesto wag looked upon as an unreliable document by those who might, have desired to migrate to russia. since the document did not se- cure the immigrants* rights, they were fearful of becoming subjugated to the system of serfdom, which was at i t s peak at that time in russia. the result was that the empress i s - sued on the nd of july, , a second manifesto in which she promised the immigrants f u l l freedom to settle, either in the city or in the country. a number of privileges were also secured for the generations to come. the prospective settlers were promised the follow- ing privileges: . f u l l religious freedom. . exemption from taxes and other burdens for ten . years. . exemption from any kind of military and c i v i l i a n services; however, the settlers were welcome in the services. . a loan for building houses and other instalments repayable free of interest after ten years. . a grant of land of thirty, desjatins " per each family. des.jatln equals i. hectares or o. desjatins equals acre. . every family was permitted to bring its movable possessions as well as goods for market to the sum of three hundred rubles. . those who desired to return to their native land had to repay f i r s t their debts to the government as well as taxes for three years. (only main points are mentioned from the manifesto of .) after the proclamation of the manifesto a general agitation.was started by the diplomats and private agents of katherlne. western europe, and especially germany, became the recruiting f i e l d . especially successful in this.project; were the agents of regensburg, ulm and frankfurt on the river main. there were different reasons for the success of the emigrant agents: . the seven years' war devastated most of western germany, notably the palatinate and the province of hessen. . the despotic rule of the dukes in the century of absolution. . religious intolerance. . the introduction of new taxes and increase of prices i n general. . the severity with which minor crimes were pun- ished. . the general exhaustion of the citizens. langhans-ratzeburg, manfred, die wolgadeutschen. im ost- europa: verlag, berlin w. und koenigsberg, , pp. r- . brendel, johannes, aus deutschen koloriien im kutcherganer geblet, ausland und heimat verlags aktiengesellschaft, stutt- gart, , pp. - . the desire to emigrate became so strong that the governments often issued prohibitions from, leaving, the duch- ies, or were forced to create settlements for the dissatis- fied inside germany. there were , families with a total of , persons, who answered the c a l l of {catherine and migrated to the volga region within a period of four years, from to . the year ? , however, does not mark the end of german migration into russia; it continued u n t i l the second half of the th century into the black sea region. who were these people who l e f t germany with the hope of finding a better future i n the far-off land? histor- ians and descendants of.the volga group have described the majority of "katharine's pioneers" ..as the lowest class of the german people. there were former convicts, ruined merchants and craftsmen, officers and a r t i s t s , etc. - a i l people who had failed in l i f e . the least in numbers among them were those who were professional farmers. bonwetsch, however, dis putes this point and maintained that the majority were farm- ers. his arguments were based on the s t a t i s t i c a l report of count orlov in to the empress. langhans-ratzeburg, op. c i t . , p. . bonwetsch, gerhard, geschichte der deutschen kolonlen an der wolga. verlag von i. engelhorns nachf, stuttgart, , p. - we have only a very general knowledge of the origin of the volga germane, since available data f a i l s to give the exact points from which they emigrated. it is established, however, that most of the duchies of germany were represent- ed and that they came preponderantly from the hessen mountain side, palatinate, vogelsberg, wetterau, spesart and rhoen, also from wuerzburg, bamberg and bayreuth. larger emigra- tions were also recorded from the provinces of thuringla, weimar-eisenach and melningen.^ the route of migration of these people leads f i r s t to the so-called "meeting places" at luebeck and danzig, from there by sea to orienbann near petersburg and f i n a l l y by two different routes to the volga: . by land - novgorod, twer, moscow, rjazan, pensa to petrovsk i n the province of saratov . by water - neva, ladoga, volga to-saratov.-m* as almost a l l pioneers, they too had to experience deep disappointment because a l l they found was a vast area of uncultivated land with neither houses, huts, nor imple- ments to start the pioneer l i f e . many of the settlers were i l l and weak, thus they were unfit for hard labor such as i s demanded from the colonist. after having been convinced that important evidences to determine original places of immi- grants are language, place names, family names, and partly, also, the style of villages and houses. bonwetsch, op_. c i t . , pp. - . here, too, prevailed the now proverbial saying, "by the sweat of thy brow shalt thou earn thy dally bread", many returned to their land of origin; others remained i n russia only because they could not defray their travelling expenses. the promised capital of the manifesto to be used for building their houses was not at hand, they had to contrive implements and other instruments for themselves. the severe winter and surrounding nomadic people provided serious d i f f i - culties for the colonists; worse, however, were the various epidemic diseases. the pugachev rebellion of also l e f t i t s traces of devastation i n the newly founded settlements. ^ in spite of a l l these, they were not completely discouraged. they erected huts, which were soon transformed into wooden, houses. lumber was the best construction material on the volga, i n contrast with the south russian custom of using clay for building peasant houses. later immigrants from ger- many found conditions much better. in a letter dated jan. , , written by a colonist in russia to his homeland, we read: we received everything....houses to live in, barns for' the crop, horses and wagons and everything which is necessary for farming. ° according to a.s .s .r. der wolgadeutschen. deutscher staatsverlag, engels, , the colonists participated in the rebellion. pushkin also mentions i n his pugachevska.la vos- tanlja that the colonists joined pugachev and formed a regi- ment of hussars. bier, p. and schick, a., aus den leidenstagen der deutsch- en wolgakolonien. druck der l.g. wlttiehschen hofbuchdruckerei, darmstadt, , pp. - . the colonies were established on both sides of the lower volga river, k k colonies on the "bergseite", province of saratov, and colonies on the "wiesenseite", province of samara. one colony was founded by french settlers and c a l l - ed rossoschi or franzosen. in course of time i t was assimi- lated by the surrounding german colonies. the volga germans b u i l t their villages at a distance of to kilometers from each other. in this instance, the names of the settlements have no connection with the origin of the settlers. in a l - most every case the colony received the name of i t s leader. already in luebeck the agents had appointed these heads, whose function was to keep order. upon a r r i v a l at the volga colonies, each leader assumed his place as head of a particu- lar village, which thereafter was known by his name - so we find such settlement names as grimm, balzar or kraft. in add- i t i o n , each colony had i t s o f f i c i a l russian name, received either from the kontor "guardian office" or later in the se- cond half of the th century during the period of russifi- cation. ' during the soviet regime some of the colonies were further renamed. thus we find names such as engels, marx, and names of other leading communists. see map i and table i. kuhn, walter, deutsche sprachlnse -forschung, verlag: guenther wolff, plauen . vogtl,, , p.. . langhans-ratzeburg, op_. c i t . . pp. - . table i the original volga colonies presented according to year of foundation and administration of that time, made up of tables by beratz, g., die deutschen kolonlen an der unteren wolga in lhrer entstehung und ent- wloklung. berlin, , pp. ^ . year op number of county - foundation colonies province district * • • • .saratov.......kamyschin • • .saratov •'. .kamyschin i . . . . . • . .samara novousensk saratov kamyschin samarai novousensk . samara nikolajevsk r . . • •.. •.... .saratov. atkarsik i . . . . . . . . . . . .saratov...... .kamyschin . .samara novousensk samara..... nikola j e vsk iii. settlements near petersburg-leningrad the germans near petersburg-leningrad consisted predominantly of colonists who l e f t the main route to the volga and settled around petersburg-leningrad where they founded main colonies. in the course of time, sister colonies appeared with an aggregate population of , . land holdings according to private statistics amounted to about ,ooo desjatins, an area which is very l i k e l y too high. iv. settlement op the black sea region u n t i l the coast region of the black sea was i n the hands of the turks. in , after a six-month's siege, the russian fleldmarshal potemkin took the fortress of otchakov. this marked the beginning of the russian victor- ies over the turks. and f i n a l l y , according to the treaty of yassy i n » the turks had to clear the azov and black sea region. in spite of the russian victory the tatars, kinsmen of the turks, were not f u l l y subjugated and proved d i f f i c u l t especially on the crimean peninsula. this provoked the russ ian government to settle the crimean area with european set- t l e r s , i.e. to create a wall against internal enemies. deutsches ausland iristitut, per wanderweg der bussland- deutsohen, 'ff, kbhlhammer verlag, stuttgart & berlin, stutt- gart, , p. . at f i r s t settlers from the balkans, namely bulgar- ians, were attracted to the newly opened land which was giv- en the name "new russia". there were approximately . , bulgarians. the next group were the germans who were to settle i n this most valuable area of f e r t i l e black s o i l . however, greater precautions were observed this time. . the government had realized that among the volga germans there were very few able men who were f i t for pioneering work and consequently became a burden on the state. this caused tzar alexander i of russia to issue a decree on the th of february, ., this decree pointed out that among the volga germans there were very few useful elements. on the volga i t was v i t a l to bring i n as many people as possible since the area was almost completely unpopulated. in "new russia", already partly populated, i t was important to settle a limited number of people who had a knowledge of farming, craftsmanship, etc. thus, i f accept- ance of foreigners was to be continued, they must be settlers of good quality. in view exclusively was the settlement of the area "new russia" and since the crownlands were limited, the area for settlement was to be selected before bringing i n settlers;, special attention was to be given to f r u i t - growers, vine-dressers, cattle, arid sheep raisers. accepted, also were to be village craftsmen such as t a i l o r s , shoemakers stumpp, opy c i t . , pp. - . carpenters and smiths. a l l other artisans who had nothing to contribute to the development of the countryside, were to be excluded. each prospective settler before immigration into russia had to f u l f i l l a l l obligations to his government, i.e. taxes, military service, each one had to be in possession of money or property amounting to gulden. those lacking this were to be rejected as immigrants, as experience had shown that poverty-stricken people had great d i f f i c u l t y in establishing themselves. immigrants were to be men with f a m i l i e s . a second great migration of germans into russia be- gan about and lasted u n t i l the middle of the th cent- ury. their reasons for abandoning.their homeland were simi- lar to those of the volga settlers. the provinces of the upper rhine were once more i n ruin. for over ten years war had interrupted any peaceful existence as napoleon's army marched across europe. in addition to this, letters from german colonists in russia were in circulation. these pre- sented a very attractive picture of l i f e in russia, the russian agents were s t i l l agitating for emigration. and l a s t l y from across the rhine came streams of alsatians who wandered through germany into russia - they, too, automatic- a l l y became recruiting agents. brendel, op_. c i t . , p. . in addition to economic factors, religious oppres- sion was a prime consideration in determining emigration- this was especially true for the mennonites of west prussia and other reformed groups. in the south-west of germany i t was the schwalkheim separatist group, that broke away from the church because, of their extreme p l e t i s t i c views. seeing i n the religious tzar alexander, the founder of the thousand year kingdom, they emigrated between and. to russia, where they settled predominantly in the caucasus.^ year after.year the emigration into.russia increased. the years an marked the highest emigration into russia. this was a mass migration from, the province of baden which often depopulated whole areas. provinces along the rhine were not alone concerned i n this movement as.almost a l l duchies of south-west germany were represented. against these facts the admonitions of the governments and their i n - stitutions remained inefficacious. on the contrary, i t serv-. ed to create among the prospective emigrants a suspicion that the regent was trying to deprive them of a prosperous future. also, news items in the popular dally papers that the major- i t y of emigrants had died or were l i v i n g in misery, did not prevent the desire from growing in these people to seek a new and better homeland. emigration d i f f i c u l t i e s became more serious when the local administration suddenly demanded verband deutscher vereine im auslande e. v., op., c i t . . p p . - . ik proper documents for leaving the country.. however, neither these requirements nor the threatened loss of citizenship in case an emigrant wished to return to germany, could stop oh their determination to go. the route of migration of the black sea colonists was the following: . the immigrants from danzig and elblng went through koeningsberg, memel, riga and from there through dubrovna to the black sea. . the immigrants from south-west germany took the route from ulm along the danube through vienna and budapest as far.as ismail i n bessarabia and from there on land to odessa. those destined for the caucasus continued their route to cherson, taganrog, rostov, mosdok to t i f l l s . a) a great number branched off in vienna and took.the land route through radzwillov and from there to the black sea.. b) an- other group which migrated into russia in to chose their route through s i l e s i a , warsaw, grodno and then to the black sea region. ^ the journey was made at the expense of the russian government. similar procedures were maintained as with the volga germans. upon a r r i v a l at their destination they re- ceived the promised sums to build their houses and conditions zk deutsches ausland institut, op. pit., p. . stumpp, op. c i t . . p. . on the whole were much better than on the volga. the black sea germans had many craftsmen who were ready to start build- ing houses. the governor of odessa at the time, the due de richelieu, an opponent of napoleon to whom the early colon- ists owed much, went so far as to found the so-called "crafts manship colonies"near odessa for the purpose of helping the settlers with their building. ^ however, i n spite of the fact that the colonists i n the south found conditions much better, many of them disap- peared i n the f i r s t years after settlement. the despotic rule of the local german administrators ? became for many intolerable. prom a general view on the map ® one can see that they founded their colonies close to a river or i n a valley, always building, several colonies at the same time and estab- . lishing them exclusively according to religious denomination. thus we can speak of areas of group settlement, kutchurganer, beresan area, choritza and others. only sister colonies founded i n the second half of the th century had settlers of various faiths. the names of the colonies i n the south lelbbrandt, georg, die deutschen kolbnlen i n cherson und bessarablen. ausland und heimat verlags - aktienges.ellschaft, stuttgart, , introduction. see section.on self-government, chapter ii, infra. see map ii. almost always coincided with the name of the place of their origin. a. province of ekaterlnoslav the oldest colonies in the black sea region are those of the mennonites. in there wa already a colony of mennonites i n gluchov, province of tchernlgov, who had mi- grated from siebenbuergen, rumania. the mass migration of mennonites from west prussia started in , when large groups l e f t the areas of danzig, elbing and marienburg for russia. they a l l settled near ghortlza on the lower right bank of the dniepr i n the province of ekaterlnoslav. the co- lonists near mariupol migrated also from west prussia but were of the lutheran f a i t h . also settlers from pomerania, upper bavaria and austria in founded the colonies of yamburg and kybalsk near ekaterlnoslav. to complete the im- migration into the province of ekaterlnoslav we have to men- tion the colonists from the provinces of baden and hessen, who founded their colonies in to . ^ b. province of taurien - including crimea in the area near melitopol on the l e f t bank of the dniepr was settled by mennonites from-prussia who i n the course of time founded a system of colonies. in to south german settlers arrived and established the deutsches ausland institut, op_. c i t . , pp. - . colonies near prishib on the north side of the azov sea. in the following year many other settlers arrived and founded the largest complex of colonies called the molotchna. a l - most a l l religious groups were represented in this area; be- sides the mennonites, catholics and lutherans, there were quakers, hutterites and other reformed sects.^° the colonies near berdjansk were founded between and and were exclusively swabiane. simultaneously with the settlement of.the dniepr area, that of the crimean peninsula took place. in to the colonies neusatz and frledental near simferopol were established. these settlers were predominantly fruit-growers and vine-dressers who came from the provinces of wuertemberg, alsace and pfalz. swiss.immigrants i n founded zuerich- t a l near theodosia. on the whole, seven main colonies were founded. c. province of cherson originally i t was swedish settlers who founded, un- der katherine ii, the f i r s t farm colonies near the dniepr - known as the "old sweden village". however, because of c l i - matic conditions they soon l e f t the area. in to , swabian settlers migrated to the same area and established deutsches ausland instltut, op_. c i t . , p. . stumpp, op. c i t . . pp. - . the colonies of schlanzendorf, klosterdorf and muehlhausen. prom to , the glueckstal and grossliebental areas settled and contained a substantial number of colonies. the years to marked the founding of the kutchurgan and beresan d i s t r i c t s near odessa.^ these settlers migrated from alsace, baden and pfalz, with only a limited number from prussia and wuertemberg,-^ the settlers in the province were of lutheran and catholic faith. d . bessarabia the settlement of bessarabia by german colonists started i n from central poland. originally these mig- rated from wuertemberg to poland i n to . here their expectations had been so disappointed that many were easily provoked to migrate to the promised land of the tzar. in to . ,' together with other germans direct from wuert- emberg they founded the colonies of tarutino, kuhn, arzls, brienne, malojaroslavetz. these names r e c a l l battle sites which became famous during the napoleonic wars. in the next two decades germans from various parts of germany and poland migrated to bessarabia and founded the colonies of plotzk, denwitz, katzbach and paris. sarata was founded between and by settlers from wuertemberg and by settlers from the black sea area. almost a l l of the original settlers were see map ii and table.ii. stumpp., on. c i t . . pp. - . lutherans by faith. e. south caucasus in a group of families from wuertemberg near reutlingen and ulm migrated into russia. their aim was the south caucasus. enroute through odessa, families dropped out and founded the colony of hoffnungstal about kilometers north of odessa. however, about families from the v i c i n i t y of odessa joined the main body and migrat- ed with them to the caucasus, where they founded the colonies of alexanderdorf, katherlnenfeld, marienfeld and elisabet- stadt, and others near t l f l l s . out of eight main colonies there were eventually another twenty-one sister colonies es- tablished. among these people there were also of the schwaikhelm separatist group. before world war i, the trans- caucasus colonists had an aggregate population of , and held a land area of , desjatins. most of them were vine- dressers .-^ p. wolhynla the last mass migration into russia was that of the wolhynla germans, who came from poland. the actual migration into wolhynla started after the f i r s t polish insurrection in leibbrandt, op_. c i t . . pp. - . verband deutscher vereine lm auslande e. v., op. c i t . . pp. - . . also in to , •which marked the period of the second polish insurrection, a group of - , germans l e f t poland and settled i n wolhynla. many of them came from the lower vistula, s i l e s i a , and congress poland. here, too, we deal with a group similar to the bessarabian germans who also came from poland but had immigrated from germany a few de-. cades earlier. according to the f i r s t russian census in , there were resident , germans in wolhynla. with the exception of a few hundred hutterltes the wolhynla germans were a l l of the lutheran faith. deutsches ausland instltut, op_. c i t . , pp. - . t a b l e i i o r i g i n a l s e t t l e m e n t s o f t h e b l a c k s e a a r e a c o m p i l e d a c c o r d i n g t o s t a t i s t i c s o f s t u m p p , k a r l , d i e d e u t s o h e n k o l o n i e n i m s c h w a r z - m e e r g e b i e t . a u s l a n d u n d h e i m a t v e r l a g s a k t i e n g e s e l l s c h a f t , s t u t t g a r t , , p . . y e a r o f n u m b e r o f n u m b e r o f l a n d p o s s e s s e d f o u n d a t i o n . p r o v i n c e a r e a c o l o n i e s r e s i d e n t s i n d e s j a t i n s c h e r s o n . . . . . . . . . . . s c h w e d e n d i s t r i c t . . . . . . . . , .. , e k a t e r i n o s l a v s k . . . j o s e f s t a l , e t c . , . . .. , . . . . . . . . . e k a t e r i n o s l a v s k . . . c h o r i t z a . . . , . . . . . . . . . . . , - - . . . t a u r i e n . m o l o t s c h n a j a . . . . . . . . , . . . . . . . . . . , - . . . . . . c h e r s o n . . . . . . . . . . . g r o s s l l e b e n t a l . . , . , . c h e r s o n . . g l u e c k s t a l . , . . . . . . . . . . . . , . . . . . . . . . t a u r i e n . . c r i m e a . . . . . . . . . . . . , . , . . . c h e r s o n . . . k u t c h u r g a n . , . , . c h e r s o n . . b e r e s a n w . . , . t^^ - . . . . . . b e s s a r a b i a . . . . . . . . . . . . . . . . . . . . . . . . . . . , * . . , . . t a u r i e n b e r d j a n s k . ; . . . . . . . , . . ; . . . . . ' . . . . , - - . . . e k a t e r i n o s l a v s k . . . m a r i u p o l •• . . . , . . • . ' . . . . . . . , t o t a l . . . . . . . . . . , . . . . . . .... , chapter ii general development until world war i i. land question and economic development the original land granted to the volga colonist was desjatins per family. the land was not privately owned but belonged to the community, thus resembling the russian "mir system" which was in practice during the time of the volga settlement. every ten years the land was distributed among a l l male-members of the community - women did not r e - ceive any land. the fact that the land was divided only am- ong male persons resulted i n large families, since many sons meant much land. some families numbered ten to fifteen c h i l - dren. the table below shows the rapid increase of volga ger- mans. population increase of volga germans year population . . . , . . , . . . , . . . • . . . , . . . , verband deutscher verelne im ausland e. v., oj>. c i t . . p. . this rapid increase of the volga colonists and the r e s t r i c - tion of expansion of community land due to the close location of colonies, caused a definite land shortage even at the end of the f i r s t years of settlement. the rapidity with which the land-allowance per person.was reduced can be seen from the following table: reduction in land grants year land per male person . . . . . . . desjatins ...... . h * • . ' " • . " .... . • i '.' . . . . . b in view of these facts the volga germans were forc- ed to find a means of existence for their surplus population. these colonists had been mainly occupied with farming, f r u i t - growing and sheep-raising. now on the mountainside in the province of saratov a small industrial area began to develop, mainly textile manufacturing plants and mills. in in the colony of norka, there were , weaver looms in oper- ation. the textile industry had also began to develop on the l e f t side,of the volga. karamysh had employed as many as workers. tobacco plantations were common and in deutsches ausland institut, op_. c i t . , p. . there were , pud of tobacco harvested. a large num- ber of the surplus population found employment there, thus forming a new social class among the colonists. others were resettled with the help of the main colonies on the newly- granted land i n the province of samara. the land question became even more acute in the second half of the th cent- ury, which led to mass migrations to other provinces of russia; siberia and central asla.^ the land assigned to the colonists i n the black sea region was as the imperial government prescribed, community property. however, contrary to the volga system, the land was not periodically divided among the adult male persons; i t was allotted as hereditary property to each family. there one spoke of a " f u l l farm" (wirtschaft) or a "half farm". a f u l l farm amounted to - desjatins, the original amount of land granted to the colonists i n the black sea region, i.e. twice as much as that received by the volga germans. the land belonging to one family was inseparable, no division among the sons was tolerated, and the youngest son was entitled to the whole farm. only when a younger son was unfit to assume the responsibility as heir, was provision pud equals . kilograms. bonwetsch, op_. c i t . . pp. - . see section on migration within russia, i n f r a . stumpp, op_. cit.,, pp. - . m a d e t h a t a n e l d e r s o n b e c o m e t h e i n h e r i t o r . m o v a b l e p r o p e r - t y w a s a t t h e d i s p o s a l o f t h e p a r e n t s . t h i s p r a c t i c e w a s s i m i l a r t o t h e " e r d h o f - s y s t e m " - , a s y s t e m w h i c h w a s p o p u l a r i n g e r m a n y . t h e a d v a n t a g e o f m a i n t a i n i n g s u c h a s y s t e m w a s t h e f a c t t h a t b e t t e r d e v e l o p m e n t c o u l d b e a c c o m p l i s h e d b y h a v i n g t h e f a r m u n d i v i d e d , a n d t h a t e v e n t u a l l y t h e c o m m u n i t y w o u l d b e s a v e d f r o m i m p o v e r i s h m e n t . h e r e , t o o , m a n y l a n d l e s s p e o p l e w e r e r e c o r d e d , d u e t o t h e h e r e d i t a r y l a n d - s y s t e m p r a c t i c e d i n t h e r e g i o n , a n d t h e s i z e o f t h e f a m i l i e s . t h e t a b l e b e l o w g i v e s t h e i n c r e a s e o f b l a c k s e a g e r m a n s a n d i s v e r y s i m i l a r t o t h e i n c r e a s e o f v o l g a g e r m a n s . p o p u l a t i o n i n c r e a s e o f b l a c k s e a g e r m a n s y e a r p o p u l a t i o n , . . . . . . • , . . . . , , h o w e v e r , t h e p r o b l e m w a s s o l v e d b y b u y i n g l a n d o u t s i d e t h e c o m m u n i t y a r e a , o r b y r e n t i n g l a n d f r o m t h e r u s s i a n l a n d l o r d s . t h i s l a n d , t o o , u s u a l l y b e c a m e t h e p r o p e r t y o f t h e c o l o n i s t s . i n t h i s w a y t h e v a r i o u s " c h u t o r a s " ( s m a l l s e t t l e m e n t s o f c o l - o n i s t s ) w e r e f o u n d e d i n a n a r e a w h e r e t h e p o p u l a t i o n w a s n o n - g e r m a n . t h e e s t a b l i s h m e n t o f s m a l l i n d u s t r i e s , s u c h a s f l o u r v e r b a n d d e u t s c h e r v e r e i n e m a u s l a n d e . v . . o p . c i t . . p . . and o i l mills, further absorbed the landless population. many turned to s k i l l e d craftsmanship, which often resulted i n the foundations of small factories. examples of such are the wagon factory i n selz near odessa, and the hoehn farm implements factory in odessa. the largest starch factory in south russia was founded in halbstadt. stumpp maintains that the land which was acquired by the black sea colonists u n t i l world war i, exceeded the original crown grants six times. thus one can compare , desjatins of original crownland grants with some , , desjatins of acquired land by . most of this l ,nd was bought from russian landlords or generals who had received large areas of land after the liberation of the black sea region from the turks. the percentage of colonists and their land-holdings prior to , are indicated below: colonists land-holdings germans among the german owned local population land province of ekaterlnoslav - . $... . . $ province of taurien - . $i .. . $ district of taganrog..... - . $ , . $ district of simferopol... - . $ . $ district of odessa - . $. . $ stumpp, op_. c i t . , pp. o- . verband deutscher vereine im ausland e. v.; op. c i t . . pp. - . although the colonista had no real competition i n developing their economic position, they made l i t t l e progress in their f i r s t years of settlement. this may be due to a number of crop failures caused mainly by the settlers' lack of acquaintance with the new climate and s o i l . furthermore, the colonist had no market for his farm products - he simply produced for his own needs. it was not u n t i l the second half of the th century after the emancipation of the russian serfs i n that any real economic progress was recorded. means of communication improved, farm equipment could be ob- tained, and lastly, the colonist i n the black sea region was allowed to dispose over his land. the community land system i n the volga, however, was only abolished after the stolypin agrarian reform i n . from the two groups of colonists, those in the black sea region were more advanced and enjoyed a higher economic standard than their volga brothers in the north. the reason for this was the better climate and s o i l conditions in the south. the prosperity in the south was also due to the more advantageous location of the colonies, i.e. closer to trad- ing centers; furthermore, the colonists received twice as much land as those of the volga; and l a s t l y , they had better opportunities to obtain additional land for their surplus population. also, the different method of t i l l i n g the s o i l (dreifelder system) - crop rotation - had some bearing on their better yields. a comparison of the colonists with their russian neighbours i n respect to economic progress showed that the russian farmers never reached the level of the colonists. these were not only free peasants i n a country where serfdom prevailed u n t i l , but they were also blessed with the numerous concessions which the imperial government had be- stowed upon them. such factors put the colonists automati- cally i n a more favourable position which subsequently led to prosperity. the colonists were known as a diligent, hard-work- ing group who had started and completed their colonization process i n the best manner possible. the foundation of more than colonies with possession of over two million. des- jatins of land and an aggregate population of , be- fore world war i on the volga and the possession of four million desjatins of land and about , colonists with a total of settlements i n the black sea region, and also the foundation of numerous sister colonies in other regions of russia, may well be described as a success. many colon- izations i n the world had been started with a similar c a l - ibre of people, who met similar d i f f i c u l t i e s and were i n the end equally successful. deutsches ausland institut, op_. c i t . , pp. - , and verband deutsoher verelne im ausland e. v., op. c i t . . pp. - . stumpp, op. c i t . , p. . i i . state administration information i s extremely scarce regarding the russian state administration of the colonies in the f i r s t years after their a r r i v a l in russia. according to the mani- fest of july nd, , there was a "guardian office" for foreigners created i n the same month. the office was under the presidency of count orlov i n petersburg, and was known as the vormundschaftskanzlel-tutelkanzlei. count orlov was granted the authority of his state colleagues, i.e. that of a special ministry. the guardian office directed the settlement of the colonists and was under obligation to secure the privileges and rights of the settlers and to supply them with cattle, farm implements and capital to build their houses; for this purpose the guardian office received , rubles per year as long as the colonists required government assistance. according to bauer, the expense of settling the volga germans amounted to . million rubles, a sum which was to be repaid i n the course of time by means of farm products. however, katherine ii, reduced the sum i n to about . million r u b l e s . bauer, g., geschlohte der deutschen ansledler an der wolga s.eit der elnwanderung nach russland bis zur elnfuehrung der allgemeinen wehrpflicht - . nach gesetzlichen owuellen und muendlichen ueberlleferungen, saratov, , pp. - . for the purpose of better administration the area where colonists had settled was divided into d i s t r i c t s to which special commissions were appointed.; later, when the private colonies were dissolved which u n t i l then had been under the jurisdiction of their directors, the number of d i s t r i c t s was increased so that i n the volga area was divided into d i s t r i c t s (kreis) with that number of com- missioners. later in after the pugachev uprising and the decline of the kirghiz riots there were as many as d i s t r i c t s with an average of - colonies. -^ as the commissar.system proved to be very impracti- cal due to the enormous distance between the volga and peters- burg, the imperial government introduced a local center of administration in - the kontor of saratov,. the kontor consisted of a supreme judge with two assistants, a secret- ary and an interpreter. the kontor was to be only temporary u n t i l such time as the colonists had accepted russian ways. at the same time, however, the former commissars were retain- ed but were subordinated to the kontor. this system of administration x*as applicable onlyy to the crown colonies - colonies founded direct by the imper- i a l government, i n number. the remainder of the or- iginal colonies were privately sponsored by three companies. the colonist had signed a contract with these companies i n langhans-ratzeburg, op_. c i t . , p. . which the directors promised to: settle them on the volga, guard their privileges and administer their colonies. how- ever, the colonists soon discovered that they were being de- ceived and measures were taken to abolish the private com- panies. according to langhans-ratzeburg a l l private companies , were abolished by . a suitable time to incorporate the colonists into the general system of administration was apparent i n when the unitary provincial government was introducedifor the whole of russia. the unique state administration of the volga germans - the kontor i n saratov - was dissolved. the function of the kontor was from then on i n the hands of the provincial government. the d i s t r i c t commissars were replaced by the russian "zemski ispravnik", who was responsible for carrying out the law of the government. the sudden incorporation of the colonists into the new russian administration system caused a stagnation i n their development. tzar paul i recognized this and reintro- duced the system of administration which was in force from - . the guardian office and the kontor i n saratov, not responsible to any provincial government, were again the highest authority of state administration for the colonists. the o f f i c i a l language according to langhans-ratzeburg was langhans-ratzeburg, op_. c i t . . pp. - . german; beratz, however, maintains that i t was russian. upon the a r r i v a l of the black sea colonists at the beginning of the th century a similar system of administra- tion was put into effect. there too the area populated by settlers was divided into d i s t r i c t s which were subordinated to a trusteeship (puersorgekomitaet) having a function simi- l a r to that of the kontor i n saratov. however, this sy- stem of administration lasted: only u n t i l . in that year the russian provincial and d i s t r i c t state administration was f i n a l l y introduced as a permanent authority i n the german populated areas. the kontor's function and thatoof the fuereorgekomitaet was from then on limited to church and ed- ucational matters u n t i l the two offices were completely ab- olished in & . klaus sees i n this act a victory hostile to the german colonists and speaks also of the breaking of a pro- mise by the russian government. however, the colonists' sy- stem of administration was only created for a temporary per- iod; furthermore, no promise concerning the administration . was ever made i n the manifesto, hence from the point of view beratz, g., die deutschen kolonlen an der unteren wolga in ihrer entstehung und entwlcklung. berlin, , p. . leibbrandt, op. c i t . , p. . klaus, alexander, unsere kolonlen. verlag odessaer zeit- ung, odessa, , p. . of state administration the abolition of the kontor as well as the fuersorgekomitaet was justified. the new system had in many ways a negative result as the colonists were subju- gated to the provincial law, regardless of any individual characteristics. iii. se lp-government in the colonies the basis of self-government was set out in the imperial manifesto of * rights were granted the settlers to elect their local government. due to economic weakness the colonies never actually reached a uniform system of ad- ministration. each colony or d i s t r i c t seemed to thresh out i t s own system suited to its peculiar needs, which often f o l - lowed unwritten laws of the former homeland. . :•••'li- l i t t l e information i s available concerning these local governments. johannes brendel relates a number of i n - cidents which reflects the despotic power of the rulers, i.e. the community elders (dorfschulze). prom documents, orders given by the individual administrators to the colonists, we read, "i command..... forbid throughout these pa- pers the personal ego prevails, showing how a colony was at the mercy of those i n authority. only after katherlne ii issued a number of instruc- tions do we find a more unified system provided. the elder brendel, op,, c i t . , pp. i -i . of a colony was to be elected for a period of one year and was to rule to the best of his a b i l i t y . he was not only en- trusted with the administration but functioned also as a po- l i c e officer and was able to settle matters of jurisdiction as long as no serious crime was involved. no private buying or selling could be carried out except with permission of the e l d e r . from the manifesto we see that the imperial government denied the appointed russian d i s t r i c t commissars the right to interfere i n the self-government of the colon- i s t s . indeed, the function of the commissar was that of a state inspector. a comparison of the colonist self-government with that of the local russian administration, shows that the set- tlers were in a far more privileged position than their russian neighbors. the russian community administration con- sisted of a "starosta", village elder or tax collector, and a "sotnik", whose function was that of a police officer. an elected responsible administration as such did not exist. the peasants were thus constantly subjected to oppression and extortion. there was no measure i n their system which could protect them against unjustified and irresponsible demands of the collectors. after the kontor i n saratov was reintroduced, paul i saw the necessity of issuing new instructions governing the langhans-ratzeburg, op_. c i t . , pp. - . colonists. a new, complete and uniform system of self-gov- ernment was introduced. this functioned through two d i v i - sions, the community meeting - a kind of village parliament - and the elder with his office (dorfamt). in the community meeting each family was represented by a male member. the meeting was called several times a year depending on the de- cisions which were to be made. the dorfamt was elected by the community for two years. the d i s t r i c t administration was founded on a similar basis to the community meeting, the "oberschulze" was head of the d i s t r i c t and a l l village elders were responsible to him. an attempted reconstruction of the self-government apparatus creates the impression that the state administra- tion and the local administrations of the colonists ran i n two p a r a l l e l lines. however, from various reports and orders quoted by leibbrandt it is obvious that both schulze and oberschulze were obedient servants of either the kontor in saratov or the fuersorgekomitaet i n the black sea region. the rule of alexander ii brought a complete change i n the self-government of the colonies. on the th of july* ? , the colonial codex was abolished and replaced by the landforms issued i n . from then on the settlers were no langhans-ratzeburg, op_. c i t . , pp. - . leibbrandt, op_. c i t . , introduction and appendix. longer considered as a separate unit. they were subject to the general russian laxf, whereby the o f f i c i a l language was russian. the abolition of the laws of self-government and i t s replacement, by the general russian law of administration was thus a breach of the privileges originally granted in the manifesto of katherine ii. another breach of guarantee was the right which was so solemnly granted, of exemption from military service. according to the imperial reforms of the russian nobility as well as the colonists were subject to military draft. on- ly the mennonites were exempted from service by the law of may th, * as pacifists they were allowed to serve the same length of time i n the c i v i l services, forestry, etc., instead of the military service. the reforms of caused the f i r s t emigration of the colonists from russia to north and south america. iv. educational system . if we consider the colonists' economic development in russia as a success, we cannot say the same with respect to their educational progress. through diligence and endur- ance they were able to reach material prosperity but they bonwetsch, op..cit.. pp. - . kessler, joseph a., geschlchte der dioezese tyraspol. ver- lag von rev. george aberle, dickinson, north dakota, , pp. - . for d e t a i l see part ii, infra. were too materialistic to be inspired toward learning. they set no value on schooling and they were too avaricious to spend any money on education. land and property were a l l - important and this was their sole objective. according to brendel, a community i n the black sea region consisted of about ,per cent farmers and per cent ' other professions. only the latter class had any education. - similar conditions were recorded on the volga. from the sta- t i s t i c s of to , we can see that only per cent of the colonists were able to read, per cent were acquainted with mathematics, and only to per cent were able to read the written texts. u n t i l world war i the colonists speak of a constant intimate relation between church and school. teachers were always selected by the pastors and the teachers usually ac- ted as sextons of the church i n addition to the regular teaching duties. the school, in fact, was a church school i n which nothing else was taught but the abc's and the bible. indeed these were the only school texts during the f i r s t years of settlement. general enlightenment or creation of i n i t i a t i v e for self-education were not on the school program. means to maintain the school and pay the teachers were raised by the community, while the pastor acted as school-inspector. brendel, op_. c i t . . pp. - . a.s.s.r. der wolgadeutschen. op. c i t . , p. . the teacher, or schoolmaster, as the colonist used to c a l l him, was considered an important man by the very fact that he worked i n association with the pastor, who was a highly respected man i n the community. although the colonists had only popular schools and no institutions of higher learning, they had great d i f f i c u l t y i n finding teachers. education was another aspect of self-government, consequently there was no interference in the matter from either the kontor and fuersorgekomitaet or from the russian government. paul i, however, did confirm the pastor's super- vision over the school. only at the close of the th cent- ury, as imperial reforms curtailed the colonists' privileges, did education come to be a concern of the russian state. central schools were established throughout russia. such schools were also founded i n the area populated by the ger- man settlers. in iq a central school was established on the volga i n katherinenstadt and a second school was estab- lished i n at lessnol-karamysh (grimm). ? in the black sea region the following areas had german central schools: odessa, grossliebental, kutchurgan and landau prishib, mol- otschna and sarata i n bessarabia. these came to a total of twenty-two i n comparison to only two central schools on the volga. the f i r s t central school in the transcaucasus was established i n the lutheran community of helenendorf near a.s.s.r. der wolgadeutschen. op. c i t . , p. . t i f l i s , similarly a school was founded i n the latter. these central schools provided a higher education thus enabling the graduates to become teachers or o f f i c i a l s i n the village administrations. in fact these schools l a i d the basis of a village intelligentsia. brendel speaks of the central schools as having more than f u l f i l l e d their pur- pose;, not only had they established an educated society in the village but they also prepared students for university entrance. there seems to have been no unified standard of education at the time. according to bishop kessler almost a l l central schools were located i n lutheran communities. these were attended by students of various religious denom- inations. the schools were supported solely by the col- onists u n t i l they were russianized after . after graduation from the central schools a large number of colonists' sons were sent to higher educational i n - stitutions abroad. the protestants especially, who never founded a separate institution to provide training for their church leaders, were forced to send their students to the university of dorpat i n estonia, or to germany. a more for- tunate solution i n this respect was recorded by the catholic sect. in the diocese of tyraspol was founded and with boelitz, otto, das grenz und auslanddeutschtum. druck und verlag von r. oldenbourg, muenchen und berlin, , p. . kessler, oj>. c i t . . pp. -i . i t t h e s e m i n a r y i n . a s v e r y f e w s t u d e n t s e n t e r e d t h e p r i e s t h o o d m a n y b e c a m e t e a c h e r s i n t h e c o l o n i e s . t h e s e m i n - a r y i n s a r a t o v w a s t h e o n l y c a t h o l i c i n s t i t u t i o n f o r h i g h e r e d u c a t i o n . t h e r e w a s n o i n t e r f e r e n c e f r o m t h e m i n i s t r y o f e d u c a t i o n a s t h e i n s t i t u t i o n w a s u n d e r t h e j u r i s d i c t i o n o f t h e m i n i s t r y o f t h e i n t e r i o r . t h e s e m i n a r y w a s t h u s f r e e f r o m a n y p r e s c r i b e d s c h o o l p r o g r a m . t h e l a n g u a g e o f i n s t r u c - t i o n w a s g e r m a n . t h e n a t u r e o f e d u c a t i o n w a s g e n e r a l l y a l i b e r a l o n e , h o w e v e r a s a r e l i g i o u s i n s t i t u t i o n t h e r e w a s a s l i g h t t e n d e n c y t o w a r d s c h o l a s t i c i s m . a t t h e b e g i n n i n g o f t h e th c e n t u r y t h e i n s t r u c t o r s i n t h e s e m i n a r y w e r e e x c l u s i v e l y d e s c e n d a n t s o f t h e c o l o n i s t s . a c c o r d i n g t o s t a t i s t i c s g i v e n b y b i s h o p k e s s l e r , t h e n u m b e r o f p r i e s t s g r a d u a t e d f r o m t h e s e m i n a r y u n t i l i t s a b o l i t i o n b y t h e r e v o l u t i o n o f , w a s . f o u r o f t h e m b e c a m e b i s h o p s a n d j . a . k e s s l e r a n d a . z e r r w e r e a p p o i n t e d b i s h o p s t o t h e d i o c e s e o f t y r a s p o l . ^ a s s o o n a s t h e r u s s i a n s y s t e m o f p r o v i n c i a l a n d d i s - t r l c t a d m i n i s t r a t i o n w a s i n t r o d u c e d i n , t h e r u s s i a n g o v e r n m e n t e s t a b l i s h e d i t s s o - c a l l e d " o f f i c i a l d i s t r i c t s c h o o l s " . g r a d u a t e s f r o m t h e s e s c h o o l s w e r e p e r m i t t e d t o e n - t e r t h e c e n t r a l s c h o o l s . t h e c o m m u n i t y s h a r e d t h e e x p e n s e s k e s s l e r , o p _ . c i t . , p p . - - . i b i d , p p . - . s e e s e c t i o n o n a d m i n i s t r a t i o n , s u p r a . necessary to support the school. besides the o f f i c i a l d i s - t r i c t schools, the government established also the "minister- i a l schools". brendel claims that a ministerial school in a russian community was f u l l y supported by the government, where- as the same school i n a colonist center was to be supported by the colonists. the program of these schools was relat- ively wide and stimulated the desire for further education. upon graduation the student could enter the fourth grade of a russian gymnasium. with the introduction of these various governmental schools a definite russificatlon process had started. after the colonial codex was abolished in ? , education which was u n t i l then a matter of self-government, f e l l under the jurisdiction of the ministry of education. the colonists* schools were incorporated into the general russian school sy- stem and thus made subject to russian inspection. the lan- guage of instruction became russian - only religion was to be taught i n the settlers' mother tongue. a teacher had to be i n possession of a teaching diploma and a certificate of p o l i t i c a l r e l i a b i l i t y before being appointed. according to brendel the teachers of russian descent i n the german settlements amounted to per cent, the teach- ers of colonist descent only per cent. this percentage was so because the russian teachers usually had a better brendel, ojd. c i t . . pp. - . education. they were graduates of teaching seminaries and thus more readily appointed than the colonists who had not received any teachers training at a l l . the process of russlfication was not only notice- able i n education but also i n many other respects. the ab- o l i t i o n of the colonial codex, which resulted i n the curt- ailment of the colonial privileges; the use of russian in the colonies as the o f f i c i a l language; and the renaming of the german settlements i n the black sea region in i , i.e. giv- ing them russian..namesdo reveal a definite policy direc- ted toward russification of the settlers. due to the insur- rection of - the russian government periodically a l - leviated the russification policy and tolerated the establish- ing of german schools again, but soon also these schools were subjugated to the russian language and the russian school system. v. religion in the colonies the manifesto of ? promised the settlers f u l l religious freedom. they were allowed to build churches, but the foundation of monasteries was prohibited. in the begin- ning the government even provided the capital. this includ- ed funds to build churches and grants for pastors' salaries. brendel, op., c i t . . pp. - . handbuch des deutschtums im auslands. dietrich reimer (ernst bohsen), berlin, , p. . later on the colonies had to support their church leaders by themselves.'^ as already pointed out, the colonists settled i n separate religious communities. thus we find distinct s e t t l e - ments of lutherans, reformed groups, roman catholics or men- nonites. only the town of katherinenstadt (later marxstadt) on the yolga had a population of both catholics and protest- ants. because of these separated communities, any close re- lation between the religious groups was impossible. this separation was also to avoid religious f r i c t i o n among the sects, which would have been a certainty in a mixed commun- i t y . however, due to the lack of catholic priests i n the early years of settlement a number of catholics were convert- ed to the lutheran f a i t h . this was notably true in the crimea where the catholic and lutheran communities were located close to each other. on one occasion, a former catholic priest ignaz lindl advocated the black sea region colonists to con- vert to the lutheran f a i t h . with a small group of converted lutherans, he moved to bessarabia and helped found the colony of sarata i n no religious organization existed among the commun- i t i e s i n the f i r s t years after settlement. however after katherine's annexation of eastern poland the bishopric of beratz, g., op. c i t . . p. . kessler, op. c i t . , pp. - . mohilev was established and also included the german catholic settlers. since the consistorium of the bishopric was too far from the settlements the colonists received l i t t l e bene- f i t from i t . the lutheran sect had no higher church organi- zation whatsoever. although katherine ii permitted the est- ablishment of a lutheran consistorium i n each province i n , i t was not carried out u n t i l , so that each com- munity was l e f t to i t s own responsibility. the same is ap- plicable to the reformed s e c t s . ^ in an administration center of a l l non-ortho- dox churches was established which f e l l under the jurisdic- tion of the kultus ministry in . this enabled the lutheran church to establish an "imperial general cons stor- iumb for a l l lutheran churches in russia. the general gon-r slstorlum was subdivided into eight consistorlums which were located i n the centers of the main lutheran settlements. as the reformed groups and the lutherans could not be united, the general consistorium was limited to the lutheran sect. the system described above lasted only u n t i l when a l l lutheran communities in russia were divided into two sections, with their consistorlums i n moscow and petersburg.-' the lutherans comprised the largest group of set-, tiers i n the volga as well as i n the black sea region. four- langhans-ratzeburg, op_. c i t . . pp. - . ibid, pp. - . f i f t h s of the volga settlers were lutherans (this includes a few thousands of the reformed group) out of a total of about , before world war i. in the black sea region there was a total.of , plus about , wolhynla germans who were a l l of the lutheran faith, except a few thousand hutter- i t e s . * with regard to catholic church administration i n the th century, we must mention that the catholic settlers who belonged to the archdiocese of mohilev u n t i l were then incorporated into the newly established diocese of tyraspol with i t s seat f i r s t i n cherson, later saratov, and in i n odessa. according to bishop kessler, tzar nicholas i v i s i t - ed the pope of reign xvi in at which meeting negotiations for the foundation of the new diocese took place. a papal delegate was sent out to russia who made a survey of a l l the colonies and determined the boundary of the diocese. f i n a l - l y i n the document (urkunde) "universalis ecclesia cura" was signed which l a i d the foundation for the new diocese. until the priests among the colonists, were a l - most a l l of polish origin who scarcely spoke the language of the colonists. thus, the settlers were actually without see table iii. kessler, op. c i t . , pp. - . leaders and received very l i t t l e benefit from the services of the polish priests. this period without leadership was clear- l y reflected i n the development of the educational standard. even after the catholic seminary was established in , which produced teachers and leaders for the catholics, they . were unable to attain the level of the protestant group. ' only for a period of twenty years , from to , were german jesuits active i n the colonies. since these jesuits were only ten i n number and had to serve so great a popula- tion of colonists, they were unable to leave a deep impress- ion of their teachings. with the establishment of the seminary the numbers of priests were increased and one could then speak of an actual parish with a permanent priest. a parish often had several a f f i l i a t i o n s , and a few parishes made up a dekanet. there were twelve of these i n the diocese.**-* according to the catholic encyclopedia the diocese of tyraspol was the largest in the world i n area. the armenian catholics i n the bonwetsch, op. c i t . , p. . the protestant group devoted more attention to education and was thus more progressive. a striking i l l u s t r a t i o n of this fact i s that during the soviet regime the majority of the teachers i n the catholic communities were protectants. simultaneously with their progress i n education, they drew from russian culture at the expense of their own and i n con- sequence their national resistance was less than that of the conservative catholics. see section on education, supra. kessler, op_. c i t . , pp. - . k south of the caucasus, or those i n the crimea, did not belong to the diocese but formed a separate group. the members of the diocese were exclusively german colonists with only a few hundreds of other nationalities. regardless of what the religious denomination may have been, the colonists were ardent followers of their f a i t h and hence religious inter-marriages were very rare indeed. it was a serious offense not to attend church. the church was the only form of organization and the pastor was thus the leader. the church provided the only form of r e l i e f from the dally work of the colonists. they were extremely conserva- tive i n their attitude toward their f a i t h . the unusually high respect for the man of the chureh created an atmosphere of restraint between the pastor and parishioners, especially amongst the catholics. the end of the th and the beginning of the th century, as already stated, marked the period wherein the settlers* privileges were curtailed. however, the promised non-interference policy of katherine with regard to chureh matters was maintained u n t i l the revolution of . . characteristics and cultural aspects prom the previous chapters one can see that the c o l - onists' period of existence in russia was characterized on one hand by the economic, and on the other hand by the r e l i - gious strength of the group. table iii distribution op religious denominations in the black sea area compiled a c c o r d i n g t o s t a t i s t i c s of stumpp, k a r l , die dentschen kolonlen im schwarzmeergebiet, ausland und heimat verlags aktiengesellschaft, stuttgart, , p. . province lutherans catholics mennonites total bessarabia , , , cherson , , , . , taurien , .. , , .. • • .. , ekaterlnoslav.. . , , , .. , don region , , . , kharkov , , ... , . *• , total , , ..... . , ..... . , until the end of the th century the colonists were almost completely isolated from their original homeland. due to this isolation no cultural contact could have been main- tained, nor were there the learned people who would have look- ed to their homeland as a source of culture. the colonists' sole desire was to establish their economical standard. their a c t i v i t i e s were limited to the t i l l i n g of the s o i l . mind and soul were occupied with the number of cattle and horses. their ties with the new homeland were loose. thus there was the constant desire to emigrate which was inspired by lust for land. the colonists* l i f e was colorless. they were con- servative in their convictions, clinging to the old t r a d i - tions. lack of educated people deprived the settlers of ec- onomic, cultural, and p o l i t i c a l organizations. p o l i t i c a l and general enlightenment were outside the scope of their lntex*- est; a book or newspaper was for the schoolmaster. they had a strong belief i n god on whom they relied entirely. to the colonist the church tie was the strongest and often the only s p i r i t u a l requirement which released him from the duties of his daily existence. and as any isolated group, as walter kuhn maintained, their s p i r i t u a l nourishment (geistige nahr- ung) was drawn mainly from the bible, hymnbooks, and calen- dars. kuhn, £. c i t . , pp. - . the characteristic feature of the average colonist was that he was a farmer, firm, steady and f u l l of enormous i n i t i a t i v e ; branded however with the deeply etched features of a troublesome past. a certain slowness was to be seen in his behavior. he was suspicious and envious however, there- by cunning and scornful. god-fearing in isolation he be- came naive and confiding towards the events outside of his own world. although the colonists had almost completely lost the ties with their original homeland for reasons as stated above, they nevertheless preserved what they had inherited from their forefathers. the fact that they had founded pure- ly german settlements isolated from a l l other nationalities did enable them to preserve their national identity. many customs and habits which were victims of modernization i n germany remained unchanged in the colonies, so that a study of them would have been rewarding to the student of folklore. christmas and easter were the most celebrated church festivals. numerous fetes were also observed of which ; "kirchweih-kerva" and "fastnacht were the most important. folksongs were verbally transmitted from generation to gener- ation. an intensive analysis of the folksong of the russian- germans presents the gradual breakdown and change of the song; lines have been dropped from the original l y r i c s and there bonwetsch, op_. c i t . , p. . a r e o c c a s i o n a l l y o n l y i n d i v i d u a l v e r s e s r e m a i n i n g w h i c h i n c o u r s e o f t i m e w e r e a d o p t e d a s a c o m p l e t e s o n g i n i t s e l f . t h e o r i g i n a l c o n t e x t i s t h e r e f o r e o f t e n u n c o n s c i o u s l y m i s r e - p r e s e n t e d b y t h e s i n g e r . u n i n t e l l i g i b l e w o r d s o f s t a n d a r d h i g h g e r m a n b e c o m e r e p l a c e d b y s i m i l a r s o u n d i n g s e n s e l e s s e x - p r e s s i o n s . u n i s o n a n d s i m i l a r i t y o f c o n t e x t o f t e n l e d t o t h e b o r r o w i n g o f v e r s e s f r o m o t h e r s o n g s . a l l t h e s e p h e n o m e n a o f the deterioration of the s o n g s a l s o o c c u r r e d i n g e r m a n y , b u t a m o n g t h e g e r m a n s i n r u s s i a t h i s w a s m o r e a c u t e . t h e d i a l e c t s s p o k e n b y t h e e a r l y c o l o n i s t s w e r e f u l l y p r e s e r v e d . t h e m e n n o n i t e s s p o k e a w e s t - p r u s s i a n l o w g e r m a n d i a l e c t , w h e r e a s t h e l u t h e r a n s a n d c a t h o l i c s s p o k e t h e s o u t h - w e s t g e r m a n , l o w a l e m m a i n e a s w e l l a s t h e r h e m l s h - f r a n - c o n i a n d i a l e c t s . i n s o m e c o l o n i e s , n o t a b l y a m o n g t h e l u t h e r - a n s a n d c a t h o l i c s , a n e w d i a l e c t w a s s h a p e d a s s e t t l e r s f r o m v a r i o u s a r e a s c a m e t o g e t h e r i n o n e c o m m u n i t y . t h e i n f l u e n c e o f r u s s i a n c u l t u r e a f f e c t e d t h e c o l - o n i s t s t o a c e r t a i n e x t e n t , n o t a b l y a f t e r w o r l d w a r i . a l - t h o u g h t h e c o l o n i s t s w e r e g e n e r a l l y c o n s e r v a t i v e t h e y t r i e d t o m a i n t a i n t h e s t y l e s e t b y t h o s e w h o c a m e i n c o n t a c t w i t h t h e r u s s i a n u r b a n p o p u l a t i o n . i n a d d i t i o n c l i m a t i c c o n d i - t i o n s c a u s e d t h e m t o a d o p t r u s s i a n d r e s s , i . e . t h e b i g f u r c o a t a n d f e l t b o o t s w o r n d u r i n g t h e w i n t e r . t h e u r b a n s c h u e n e m a n n , g . , d a s l i e d d e r d e u t s c h e n k o l o n l s t e n i n r u s s l a n d . m u e n c h e n , , p . . germans were russified i n their moods but they s t i l l spoke the german language. because of this the urban german was more ready to inter-marry with the native russian. the v i l l - age intelligentsia also tended to imitate russian ways. this was usually the reflection of a higher russian educational institution. in the f i r s t years of settlement the borrowing from russian culture was limited to material cultural forms. ac- cording to kuhn this process actually works both ways. a certain exchange (ausglelch) takes place between the i s o l a t - ed language group and that of the native people. but only much later, after having been acquainted with the native people and after they are able to master the language of the hq natives does a borrowing of s p i r i t u a l cultural forms occur, ^ in such a process f a i r y tales and proverbial sayings were adopted. in matters of folk music, there has always been a tendency amongst the colonists of eastern europe to readily accept the superiority of the native music, especially if they have been l i v i n g amongst ukrainians and russians. in this manner russian and ukrainian melodies of song and dance were willingly adopted. the songs were adopted because of their beautiful melody, although the l y r i c was not understood. the influence of the russian language was unavoid- able since russian was the language of the country. the use kuhn, op_. c i t . , pp. - . of o f f i c i a l russian terms, expressions designating new types of furniture or clothing, for which no counterpart existed i n the dialect were common. the use of the f i r s t name and the father's name when addressing each other was striking as this i s a way which i s exclusively russian. in spite of this influence of russian culture, the average colonist had unconsciously maintained his nationality. as among other isolated minority groups, the church served as a great support to preserve this national character. elemen- tary schools were church schools" and were supervised by the pastors before the period of russification at the close of the th century. religious ceremonies were presented i n german. the church was the only form of organization amongst the c o l - onists and held them together. in isolation, the church thus beoame a facsimile of a national church, hovrever, there was no definite policy pursued that led to the preservation of their national identity. it was merely that deep desire to keep what was handed down through tradition by their fore- fathers.^ according to kuhn, as the isolated group begins to develop materially as well as s p i r i t u a l l y , and religious pam- phlets are replaced by news of the world, and as the people the preservation of the national identity was aided by the natural separation from the natives as the colonists set- tled i n purely separate religious communities. the d i f f e r - ence in faiths avoided inter-marriages and thereby also the association with the natives. acquire a higher standard of l i v i n g , as well as draw their cultural forms from non-nationals, then the isolated langu- age island has reached a dangerous period, that of assimila- tion. only then, a powerful impulse from the outside can re-awaken the national consciousness and re-establish the contact with the motherland as well as to secure future cult- ural sources. * the group i n russia never reached the level describ- ed by kuhn. the majority were s t i l l farmers l i v i n g i n their own secluded world and thus they never reached the point of assimilation. nevertheless they did receive such an impulse. the definite russification process at the end of the th century coupled with the antagonistic feeling following world war i, created a certain german consciousness i n the group. however, as germans who had no contact with germany and had never been there, they became a unique group which had i n course of time coined i t s own form of culture. as such the group was never f u l l y accepted by the average german. a fact which manifested i t s e l f when part of the group was resettled to germany during world war i i . they spoke of another mem- ber of the group as "one of ours", as the people of alsace do who c a l l themselves neither german nor french hut alsatians. # # # # # kuhn, £. c i t . , pp. - . literary publications amongst the settlers were scarce. in many of the calendars and magazines, h i s t o r i c a l sketches of individual colonies were published. notable for that was the "neuer haus- und landwirtschaftskalendar fuer die deutschen ansiedler im suedlichen russland". in , a noteworthy novel appeared anonymously on the volga entitled, nor net lopper g gewa. which described the attitude of the german colonist toward an idealist young teacher with progres slve views. ^ another publication which appeared on the vol- ga, was a collection of folksongs and childrens* poems of the volga colonists, which was written by goebel, gottlieb; and alexander hunger and entitled fest und true, oder der k l r g l - sen-michel. a l l this literature, including the historical works, were issued i n russia. only after world war i when for the f i r s t time in their history the colonists i n russia attracted the attention of their original homeland, did a number of publications appear in germany. the following l i s t contains calendars, newspapers,, magazines and h i s t o r i c a l works. the dates of publication for l i t e r a r y publications after world war i, see chapter iii, i n f r a . ' luther, arthur, "deutsche dichtung i n russland", der auslanddeutsche. jabrg. xii, no. , stuttgart, , pp. . in there were a series of research works published for the f i r s t time by the newly founded "institut fuer aus- landskunde und auslanddeutschtum" i n leipzig. the climax of research concern about the germans i n russia was reached i n germany after . mark the period of prosperity whereas they ceased, publishing with the onset of world war i when they were prohibited. a. calendars . amtskalender fuer evangelische gelstliche in russland. - .. . christlicher famlllenkalender, semferopol, . . per wolgabote. a calendar for german settlers on the vol- ga, - . . kalender der deutschen kolonlen in russland, petersburg. . molotschnaer volkskalender. for the german settlers in south russia, ^ . . neuer haus- und landwlrtschaftskalendar, for the german settlers in south russia, - . . wolgadeutscher kalender. - . . newspapers and magazines . hausfreund. issued by kanonikus rudolf relchert, odessa, - . . helmatglocken, talovka, , a lutheran weekly. . . klemens. a catholic weekly founded i n , saratov, pub- lished as a weekly u n t i l then issued as a supplement to the "deutsche rundschau" u n t i l . . moskauer deutsche zeltung. a weekly. » odessaer zeltung. a daily, - ; - . . st. petersburger zeltung. - . . saratower deutsche volkszeltung. saratov. handbueh des peutschtums im auslande, op. c i t . , pp. - . , : ibid. . unterhaltungsblatt, for the german settlers in south russia, odessa, - . c. historical books these works have been written by the descendants of the colonists and several of the books have been published abroad. ? . bauer, g., geschlchte der deutschen ansiedler an der wolga seit ihrer einwanderung nach russland bis zur einfuehrung der allgemeinen wehrpflicht, - . . beratz, gottleib, die deutschen kolonlen an der unteren wolga i n ihrer entstehung und ersten entwickelung, saratov, . . bonwetsch, gerhard, geschlchte der deutschen kolonlen an der wolga. stuttgart, . . kessler, bishop joseph a., geschlchte der dlozese tyras- poj., dickinson, north dakota, . . klaus, alexander, unsere kolonlen. odessa, . . loebsack, georg, elnsam kaempft das wolgalarid, leipzig, . . schenk, m. f., geschlchte der deutsche kolonlen in trans- kaukasien. . . schleuning, johannes, die deutschen kolonlen in wolga- geblet. . . schleuning, johannes, in kampf und todesnot. berlin - chariot t e nburg, . . stach jakob, das deutschtum i n slbirlen mittelaslen und dem fernen osten. stuttgart, . . stumpp, karl, die deutschen kolonlen im schwarzmeergeblet. stuttgart, . a great number of h i s t o r i c a l works and articles were pub- lished by the mennonltes, but since the mennonites and their l i t e r a r y works are well known, they shall not be mentioned. here. numerous verbal stories which were never written down circulated amongst the colonists. in the long winter evenings these stories were told; they a l l spoke of the c o l - onists' past and their adventures i n the early days of set- tlement. s t y l i s t i c a l l y they were an adoption of germanic heroic poems which were brought by the early settlers. in time the poems were localized, i . e . the characters and heroes in the poems were replaced by local people. the yearly festivals held by the church choirs must be mentioned here as an important aspect of the colonists a r t i s t i c activity. where cultural l i f e was at best so re- stricted, these religious celebrations helped to supply an important need i n the community. vii. internal migration and sister colonies perhaps no other national group in the world was i n such a constant uninterrupted movement as the germans of russia. the settlement of the mother colonies lasted from u n t i l the middle of the th century. the volga, black sea region, caucasus and wolhynla were selected as settlement areas. almost simultaneously with the completion of the set- tlement of the mother colonies, a new movement started into other areas of russia. neither pressure nor oppression on the part of the russian government caused this migration i n - to isolated d i s t r i c t s . the apparent land problem and the i n - herent urge of the colonists to acquire land, drove them to spread out from every nucleus of settlement. heads of fami- l i e s wished each son to have an area equal to his own. there- fore in.large families there was a constant search for new land. no opportunity was missed to enlarge holdings of pro- perty* price differences helped i n this regard. settlers sold their land when values were favorable and moved into distant areas where they could buy cheaply. the natural de- sire to own one's farm s o i l and the acquisitive nature of these colonists to possess cheap land and much of i t , sent them wandering from one d i s t r i c t into another. the early mi- gration had established mother colonies which soon were sur- rounded by sister colonies. when a l l the available land was taken, a migration eastward took place. according to jakob stach, as the colonists became subject to military service and emigration abroad had started, large numbers of mennonites from molotsohna migrated to the newly acquired territory in turkestan. the majority of them came from the province of taurien, later i n the 's they also came from the volga. the governor of turkestan promised each person a sum of f i f t y rubles and exemption from taxes for eleven years. the total of the settlers who accepted co this proposal was about , .-^ from to an ex- tensive number of colonists migrated from the.province of cherson i n bessarabia to the area of tashkent. stach, jakob, das deutschtum in slblrlen. mittelaslen und dem fernen oaten, kohlhammer verlag, stuttgart, , p. . the colonies i n the don area and north caucasus were founded by volga and black sea germans, in the don area the colonists settled near taganrog. later after , migra- . tions from here to the north caucasus and central asia were recorded. the foundation of the colonies i n the north cauca- sus followed the year i , when black sea and volga germans settled there. these colonies were predominantly located near stavrograd, vladikawkas and novorossljsk. before world war i the number of colonies was over seventy-six with the same number of chutoras (smaller settlements) and an aggre- gate population of , . as sister colonies they were small i n comparison to the mother colonies and had populat- cq ions of only , to , persons.-' the general migration to siberia at the beginning of the th century was due to two historical events i n tzar— st russia: (a) the construction of the trans-siberian r a i l - road; and (b) the stolypin agrarian reform of which was passed by the duma i n . the coming of the railway caused the resettlement of more than three and one half million people - even during the russo-japanese war , people were resettled in siber- i a . ^ the agrarian reform dissolved the "mir system" whereby boelitz, op_. c i t • , p. . stumpp, op_. c i t . , p. . stach, op_. c i t . , p. . the land was community owned and was periodically divided among the male members of the settlement. (note that only the black sea germans were not subject to the "mir system".) the new law freed the peasant from any obligation towards the community. he was free to buy or s e l l land wherever he wish- ed. furthermore, the land became his personal possession. this agrarian reform corrected the mistake of , whereby the abolition of serfdom did not bring with i t the right of private ownership. the reform i n turn marked the biggest colonization period of the th century as the government made a number of special concessions to the prospective settler for siber- i a . colonists were entitled to f i f t e e n desjatins of land be- sides a f a i r reduction for transportation, etc. these induce- ments brought in settlers from bessarabia, cherson and the volga. after the following complexes of colonies were founded i n siberia: in the area of slavgorod ; . colonies. in the area of omsk colonies. in the area of orenburg (european russia)...... colonies. in the area of khmolinsk colonies. in the area of semipalatlnsk (central asia).... colonies. although the above figures only present colonies, there were about german colonies i n siberia before world war i. stach, op. c i t . . pp. - . the colonists possessed a total of , desjatins i n land-holdings.^ summing up the mother colonies and sister colonies i n russia we see the following picture: out of original mother colonies founded by german settlers i n european russia, there were , sister colonies established with , chutoras'founded by the original german settlers. in time they increased eighteen times, i.e. . million by world k war i. to complete the migration of the german settlers within russia we must mention the last migration during the soviet regime. during world war i when the wolhynla germans were ordered to leave their homeland, an extensive number of them settled i n the par east of russia. in to , the period of collectivization marked a migration from a l l german settled areas to the far east. the soviet government granted tax exemption and and other concessions to people who were ready to settle in the far east. in this way fourteen c o l - onies were founded on the amur and ussuri rivers by german s e t t l e r s . ^ during the soviet regime, as the colonists were ousted, there was also a great influx of germans into the deutsches ausland institut, erg. c i t . . p. . k ibid. quiring, walter, "die russlanddeutschen fleuchtllnge i n china", der wanderweg der russlanddeutschen. deutsches aus- land institut, stuttgart, , pp. - . c i t i e s , where they took employment as laborers and various skilled crafts. chapter iii the colonists between the world wars i. world war i and the imperial ukas of the outbreak of world war i marked the beginning of the most d i f f i c u l t period i n the history of the colonists. the planned jubilee commemorating their a r r i v a l i n russia had to be forgotten. instead of the joyful festivals the pre- vailing mood was sadness and disappointment. as f u l l c i t i - zens of russia they were drafted into the army and had to fight against their land of origin. the antagonism existing towards the colonists reached a climax i n the ukas of . the location of the german settlements, i.e. wol- hynla which was strategically important to russia, led to a number of anti-german measures at the beginning of the war. the ukas of i proclaimed the confiscation, with compensa- tion, of the entire german land-holdings along the polish border. within a few days they had to start their march to- wards siberia. there were , people on the way to s i - beria. diseases and starvation were their constant compan- ions. these measures were the more drastic as the entire male population was fighting, only women and children home. deutsches ausland institut, op_. c i t . . p. k. in the tzariat government decreed the expulsion from their homes of the volga germans and those of the black sea region. the decree, however, f e l l into abeyance with the: overthrow of the tzarlst regime. only after the treaty of brest-litovsk i n , were the wolhynla germans allowed to return to their homes. there they found a devastated area, a reflection of a raging battle-field. as these measures had been enforced, the tzarist government could not expect any great loyalty from the c o l - onists. although individuals were i n the western b a t t l e - f i e l d against germany, i t was the policy of the russian government to have the colonists on the turkish front. georg loebsack i n his heroic treatment of the volga germans, elnsam kaempft das wolgaland. maintains that at least , volga ge rmans p had given their lives at the battle of erserum. erserum, near trapesunt, became the cemetery of the colonists i n world war i. i i . the march revolution of the march revolution of seemed to have brought better times as the provisional government restored cultural and national self-determination. they were to develop their future nationality free from any pressure and force of the government. a sudden desire for unity prevailed amongst a l l loebsack, georg, elnsam kaempft das wolgaland, r. voeigt- laeder verlag, leipzig, , p. . k the germans i n russia. a strong unification was craved by the colonists i n order that their rights would be preserved i n case of need. in order to give this new movement character and a uniform aim, professor llndemann, in accordance x-irith other leading colonists summoned representatives from the german settlements to moscow. the meeting took place i n april, the th to rd, , under the chairmanship of prof. llndemann and duma deputy lutz. eighty-six delegates from fifteen pro- vinces had gathered for the f i r s t time i n order to defend the colonists' cause i n russia. at this conference, resolutions of immediate importance were thrashed out. foremost amongst these was the demand for equal rights as russian citizens, the introduction of german in the colonists' schools, the foundation of german newspapers, the foundation of a german society i n russia,^ and immediate help for the expelled wol- k hynia germans. before the proclamation of self-determination of the peoples in russia by the provisional government on the th of march, , the volga germans had already founded a p r i - vate executive for the purpose of combating the unfavorable measures undertaken against the colonists. this private this society had no p o l i t i c a l a f f i l i a t i o n s . k schleuning, johannes, in kampf und todesnot. bernard u. graefe, berlin-charlottenburg, , pp. - . executive was now augmented to an organized executive which soon called a general meeting i n a p r i l , . three hundred and eighty-six delegates from a l l the volga colonist settle- ments had gathered and elected a "central committee" with its seat i n saratov. questions of economy and culture were to he administered by this committee. its primary aim, however, was the establishment of autonomy for the volga colonists.^ from march u n t i l the october revolution of , according to schleuning, there was an active participation noticeable amongst a l l the people for the re-establishment-of the "ver- lorenes volksgut (national character). during this period a german paper "die saratower deutsche volkszeitung" was founded and numerous teachers* congresses were held by the volga germans. similar activities were carried on by the black sea colonists. at the end of march of , they had already called a conference in odessa for the purpose of founding a "society of a l l germans in russia". here, too, the resolu- tions of the moscow conference were adopted which were to be carried out under the auspices of the elected "central com- mittee" with i t s seat i n odessa. a weekly magazine was founded to promote the cause of the colonist. this magazine was at f i r s t issued in russian and later in the german lang- uage. contrary to the volga germans, the black sea colonist langhans-ratzeburg, op_. c i t . , pp. - . did not strive for autonomy due to the t e r r i t o r i a l distances between the settlements. the caucasian colonists who especially had to exper- ience the antagonism of the tzarist government, enthusiasti- cally welcomed the march revolution. as on the volga and black sea, they too called a congress i n t i f l i s . although they were one of the poorer groups they were able to collect enough funds to establish a german hlghschool (oberrealschule) i n helendorf by the f a l l of ?. parallel to the activities i n the mother colonies were those activities of the colonists i n siberia. in slav- gorod there was a congress called whieh decided on the found- ation of a german teachers' training school. the school was ready for its opening by the f a l l of .' however this great enthusiasm for the purpose of re- establishing their former status as a self-determined group, was of short duration. the eight months from march u n t i l october were not long. the october revolution and i t s con- sequences brought even more destructive elements to the c o l - onies. the colonies were exposed to the anarchism of either the retreating and resisting imperial forces or the approach- ing troops of the new regime. schleuning, op_. c i t . , pp. - . stach, op_. c i t . . pp. - . iii* october revolution and self-determination the attitude towards the new soviet regime was one of resistance. only the poorer landless elements became f o l - lowers of the bolshevist system as they expected land from ft the new government. the colony of balzer on the volga show- ed the greatest resistance towards the bolshevists. this re- sistance resulted in an armed uprising against the invading red forces. even after the october revolution of i when the bolshevists were dominating the volga c i t i e s , the "cent- r a l committee" which was elected during the period of the provisional government was s t i l l r e s i s t i n g . this committee called the warenburg conference in february of as a pro- test against the formation of local soviets i n the town. but with the increasing power of the local commun- i s t s , the "central committee" was crushed and replaced by the "commissariat of the volga germans". the commissariat had the task of preparing for the coming congress of the soviets stumpp, op. c i t . , p. . schleuning, op_. c i t . . p. . "nemcev povolzja a.s.s.r.", bol'sha.la sovetskaja enslk- lopedlia. vol. , o.g.j.z., r.s.f.s.r., moskva, , pp. - . this article states that the volga germans were predominantly ardent followers of the communist idea, and that their contribution to the cause of the revolution was great. the article goes on to describe the heroic p a r t i c i - pation of volga german regiments against the invading troops of denikin and kolchak. langhans-ratzeburg, op_. c i t . , p. . of the volga colonies and that of carrying out the decrees of the soviet regime. preparation having been completed, the f i r s t soviet congress of the volga germans was summoned to saratov by june of . it was only in october of at the second congress that the "autonomous workers' commune of the volga germans" was proclaimed. this was i n accordance with the soviet national policy which secured the right of self-determination to a l l the peoples of the u.s.s.r. now a l l questions pertaining to economy, administration and cult- ure were under the jurisdiction of the elected "soviet cong- ress" of the autonomous workers' commune of the volga ger-. mans.^ the treaty of brest-lltovsk even secured the right to the volga germans to emigrate to germany. german govern- ment o f f i c i a l s arrived on the volga to organize this emigra- tion, but the collapse of germanyin made a quick end to ik this beginning. in , a "zentralkbraitee der deutschen aus russland" was founded in germany. the organization un- dertook the task of assisting the colonists to emigrate to overseas countries. ^ gross, e., a.s .s .r. nemcey povolz.la. izdanije "nemgos- izdata", pokrovsk, , p. a.s.s.r. der wolgadeutschen. op. c i t . , pp. - . ik gross, op. c i t . , pp. - . "zentralkomitee der deutschen aus russland", per ausland- deutsche. jabrg. , no. , stuttgart, ?, pp." -^- ?. it was only by that the autonomous workers' commune was able to exist as a self-contained economical unit. at that time i t was raised to the level of an "auton- omous republic", as part of the large russian socialist fed- eration of soviet republics. the republic was divided into fourteen counties and had a national composition of: germans.......... ... . $ russians . $ ukranians . $ others . $ the black sea colonist as contrasted to the volga colonist had a different phase of development. following the treaty of brest-litovsk the ukraine was occupied by the german forces, so that the "central committee" founded dur- ing the provisional government i n odessa was able to function u n t i l the end of the german occupation, i.e. november of . after the collapse of germany and the subsequent re- treat of the troops from the ukraine, the new soviet regime was able to paralyse the activities of the "central committee" i n odessa. however the colonies around odessa resisted the soviet regime with an armed uprising and were able to main- tain their resistance for a period of two weeks. ''' for details of administration see: langhans-ratzeburg, op. c i t . , and gross, op_. c i t . schleuning, op_. cit.., pp. - . contrary to the volga germans, autonomy never was granted to the black sea germans for reasons of t e r r i t o r i a l distances between the settlements. however they were organ- ized into "national districts" of which there were seventeen i n the entire u.s.s.r. administratively they belonged to the particular province in which they were located. most of them were named after leading german colonists such as, karl leib- knecht d i s t r i c t near odessa, ernst thailmann d i s t r i c t i n the donetz area, and rosa luxemburg d i s t r i c t near dnepropetrovsk, etc. iv. economic aspects the four years of war, the october revolution f o l - lowed by the c i v i l war and the growing anarchism brought ec- onomical disaster to russia. the constant occupation by either the soviet forces or the resisting tzarist troops caused almost a complete impoverishment of the colonies by . in addition to the existing impoverishment, russia was destined to endure i n the greatest crop failure in its history. according to ivan herasimovich, the once so f e r t - i l e s o i l near mariupol returned only . of the original seed sown, and as a result, by the winter of - ^ of the german colonists were subject to the great famine which was kolarz, walter, russia and her colonies. george philip and son limited, london, , p. , according to informa- tion from: bartels, bernhard, die deutschen bauern suedruss- land, moscow, . accompanied by mass starvation and epidemics. the conditions amongst the volga colonists were no less severe. the s t a t i s t i c s below manifest the austerity of the crop failure and the subsequent drop i n population i n . amount of agricultural products exported from the area of the a.s.s.r. of the volga germans to other areas of russia in .. million pud. in .. million pud. in million pud. in million pud. population of the area of the a.s.s.r. of the volga germans in .... , persons. in . . . . . . . . . , persons. in . .. , persons. the loss of , people in the area was due to starvation and dessertion into other areas of russia. through the immediate help of the international red cross and church organizations, as well as relatives abroad, conditions were alleviated by . also the new russian herasimovich, ivan, holod na ukra.llnl. vidavnitstvo 'ukrajinske slovo", berlin, , pp. - . gross, op_. c i t . . pp. - . ibid. economic policy which guaranteed private enterprise at the beginning of the »s helped to overcome this d i f f i c u l t time and many were again on their way to prosperity. but by the coming of collectivization was de- f i n i t e . this i n turn meant the loss of land which was by no means compatible with the materialistic mind of the colonist. the expected economic i n s t a b i l i t y and the intensified fear of a possible revival of the year of , again motivated the lust to wander in the colonist. this period marked the second great migration overseas which lasted u n t i l when the soviet government completely stopped the emigration of russian citizens. after various i l l e g a l ways were con- trived to leave russia. the period of collectivization also marked the ex- pulsion of rich colonists (kulaks) from the colonies. the majority of these then moved into the c i t i e s . thus by the a.s.s.r. could record the existence of collective farms. ten years later » # of e l l farms were incorporated into kolkhoses of sovkhoses (state-owned farms). in addl- . tion the soviet encyclopedia records a tremendous upswing i n industry and mechanization in the a.s.s.r. of the volga ger- m a n s . s i m i l a r statements i n regard to collectivization can be made about other german populated areas. only amongst the a.s.s.r. der wolgadeu t s che n. op. c i t . , pp. - . for d e t a i l see "nemcev povolzja a.s.s.r.", op_. cjlt., germans in siberia was collectivization introduced later. it remains to mention that the famine of found a recurrence'in - , when the crop failure and addi- tional taxes deprived the people of russia of their daily bread. at the close of the decade people had been reconciled with their fate of being collective farmers and conditions were generally improved. it was world war ii which marked ah end to this period. v. religion in the colonies soon after the october revolution of the two lutheran consistorlums i n leningrad and moscow were d i s s o l - ved. however the lutheran seminary i n leningrad was s t i l l < functioning u n t i l « from among forty pastors which served one hundred and f i f t y lutheran colonies on the volga, only fourteen remained by . sixteen retired and the rest fled abroad. similar actions were undertaken against the catholic hierarchy. many priests including joseph a. kessler, bishop of the diocese of tyraspol, were able to leave russia before measures were undertaken against them. the catholic seminary i n saratov was dissolved in and property confiscated. schleunlng, op_. c i t . . pp. - . gross, op_, c i t . , p. . before the war each of the thirty-nine catholic settlements had one priest and one cantor. by there were nine vac- ancies. ? although s t a t i s t i c a l information is not available for the colonies i n the ukraine and other areas, one can as- sume a similar situation i n regard to religious matters. re- l i g i o n as a whole was banned from the school and so were the teachers of religion. isolated and without leadership, the individual pastors carried on with their work u n t i l when most of them became victims of the great purges of - in soviet russia. churches were closed and often transformed into dance or recreation halls. a vivid propaganda against the church as an institution was carried on by the younger generation who were members of the "society of the godless". their main organs of propaganda were the german weekly maga- zines j "die trommel - published in the a.s.s.r. of the vol- ga germans, "die trompete" - published i n the ukraine, and "neuland" antlreligioese zeltschrif der sowjetdeutsche - pub- lished i n the ukraine. the literature published in the soviet union in re- gard to the colonists' attitude towards such measures i s gross, op. c i t . , p. . schleuning, op_. c i t . . p. . strikingly contradictory when compared with the literature published abroad. in the soviet publication of e. gross, he stipulates that by the colonist had developed a negative attitude toward the church due to the enlightenment by the revolution and partly by the corrupted clergy themselves. johannes schleuning states exactly the opposite in his german publication. in spite of the intimidation practiced by the soviet government the majority of the settlers remained ar- dent followers of their religion. it was after a l l their deeply rooted belief that had kept and served them during their historic period i n russia. ° vi. german national schools and culture according to the soviet constitution a l l people of the u.s.s.r. had the right to national schools: article . citizens of the u.s.s.r. have the right to education. this right is ensured by universal and compulsory elementary education; by free education up to and including the seventh grade; by a system of state stipends for students of higher educational establish- ments who excel in their studies; by in- struction i n schools being conducted i n the native language, and by the organization i n the factories, state farms, machine and tractor stations, and collective farms of free vocational, technical and agronomic training for the working people. gross, op. c i t . , p. . schleuning, op., c i t . , p. . constitution of the u.s.s.r.. american russian institute, new york, , p. . i n p r e - r e v o l u t i o n a r y r u s s i a t h e r u s s i a n l a n g u a g e w a s t h e o n l y o f f i c i a l l a n g u a g e a n d t h e p r i n c i p a l m e a n s t o d e n a t i o n a l i z e t h e n o n - r u s s i a n p o p u l a t i o n . a c c o r d i n g t o t h e s o v i e t n a t i o n a l p o l i c y , t h e s o v i e t g o v e r n m e n t h a d n o s u c h i n t e n t i o n s . o n t h e c o n t r a r y i t g r a n t e d e n t i r e l i n g u a l a u t o n o m y a n d i t p r o m o t e d t h e d e v e l o p m e n t o f e d u c a t i o n i n t h e i r l a n g u a g e a n d l i t e r a - f o r t h e g e r m a n s i n t h e s o v i e t u n i o n t h i s m e a n t o n l y a c o n t i n u a t i o n o f w h a t h a d b e e n p a r t l y s t a r t e d d u r i n g t h e p r o v i s i o n a l g o v e r n m e n t , w h o h a d a l s o g r a n t e d t h e n a t i o n a l s c h o o l s t o i t s p e o p l e . i n a l l t h e c o l o n i s t s ' s c h o o l s w h e t h - e r l o c a t e d i n t h e a . s . s . r . o f t h e v o l g a g e r m a n s o r i n g e r m a n n a t i o n a l d i s t r i c t s , g e r m a n b e c a m e t h e l a n g u a g e o f i n s t r u c t i o n . t h e l a n g u a g e o f a d m i n i s t r a t i o n i n t h e c o l o n i e s w a s a l s o g e r - m a n . s i m u l t a n e o u s l y w i t h t h e i n t r o d u c t i o n o f g e r m a n , t h e f o u n d a t i o n o f m o r e h i g h s c h o o l s , t e c h n i c a l s c h o o l s a n d h i g h e r e d u c a t i o n a l i n s t i t u t i o n s s t a r t e d i n t h e g e r m a n c o l o n i e s . f o r t h e p u r p o s e o f c o m b a t i n g t h e g r e a t l a c k o f g e r m a n t e a c h e r s , k o h n , h a n s , n a t i o n a l i s m i n t h e s o v i e t u n i o n . g e o r g e r o u t l e d g e & s o n s l t d . , l o n d o n , , p p . - . f o r m a n y p e o p l e , e s p e c i a l l y t h e n o m a d s , w h o h a d n e v e r h a d a w r i t t e n l a n g u a g e t h e l a t i n a l p h a b e t w a s a d o p t e d . a n d f o r t h e f i r s t t i m e t h e i r f o l k l o r e w a s w r i t t e n d o w n . l a t e r i n > w h e n t h e s o v i e t g o v e r n m e n t i s s u e d t h e d e c r e e o n o b l i g a - t o r y t e a c h i n g o f r u s s i a n i n a l l n o n - r u s s i a n s c h o o l s , a r e v i - s i o n o f t h e a l p h a b e t w a s n e c e s s a r y . s i n c e i t w o u l d m e a n t h e l e a r n i n g o f t w o a l p h a b e t s , t h e u s e o f t h e l a t i n s c r i p t w a s s t o p p e d a n d r e p l a c e d b y t h e c y r i l l i c a l p h a b e t . s e v e r a l p e d a g o g i c a l i n s t i t u t e s w e r e e s t a b l i s h e d . o n e o f t h e i n s t i t u t e s w a s a f f i l i a t e d w i t h t h e u n i v e r s i t y o f s a r a t o v , t h e o t h e r w i t h t h a t o f o d e s s a . ^ b e f o r e w o r l d w a r i , t h e r e w e r e o n l y s e v e n h u n d r e d a n d s e v e n t y - o n e t e a c h e r s i n t h e a r e a o f t h e a . s . s . r . o f t h e v o l g a g e r m a n s . i n t h e n u m b e r i n - c r e a s e d t o t h r e e t h o u s a n d , t h r e e h u n d r e d a n d t w e n t y - s i x . t h u s t h e g r e a t c a m p a i g n t o l i q u i d a t e i l l i t e r a c y h a d b e c o m e r e a l i - z a t i o n . t h e c u l t u r a l a c t i v i t i e s r e c e i v e d s i m i l a r a t t e n t i o n b y t h e s o v i e t g o v e r n m e n t . e s p e c i a l s t r e s s w a s p l a c e d o n t h e f o u n d a t i o n o f n a t i o n a l t h e a t r e s . " t r a v e l l i n g p l a y g r o u p s " , a s t h e y w e r e k n o w n , w e r e f o u n d e d a n d t h e m o s t n o t a b l e w a s t h e " d e u t s c h e s w a n d e r t h e a t e r " i n t h e u k r a i n e . i n l a r g e r g e r m a n t o w n s m u s i c s c h o o l s w e r e e s t a b l i s h e d , w i t h e v e n a c o n s e r v a - t o r y b e i n g c a l l e d t o l i f e i n m a r x s t a d t ( k a t h e r l n e n s t a d t ) o n t h e v o l g a . l i b r a r i e s a n d n a t i o n a l m u s e u m s w e r e f o u n d e d . a s c i e n t i f i c a s s o c i a t i o n f o r r e s e a r c h i n t o t h e n a t i o n a l c u l t u r e a l s o c a m e into e x i s t e n c e . t h e g e r m a n v o l g a r e p u b l i c b e c a m e t h e c u l t u r a l c e n - t e r o f a l l t h e g e r m a n s i n t h e u . s . s . r . d u r i n g t h e s o v i e t r e - g i m e . a l l t h e g e r m a n s c h o o l - b o o k s w e r e p r i n t e d i n p o k r o v s k . ( e n g e l s ) , c a p i t a l o f t h e a . s . s . r . o f t h e v o l g a g e r m a n s , a f t e r t h e r e p u b l i c r e c e i v e d i t s o w n p u b l i s h i n g h o u s e i n . m a n y s c h l e u n i n g , o p _ . c i t . . p . . a . s . s . r . d e r w o l g a d e u t s c h e n . o p . c i t . , p . . german papers and magazines (periodicals) were also issued. notable were the following: . unsere wlrtschaft. an illustrated weekly for the enlight- enment of the rural population i n matters of husbandry, technics and culture. . revolution und kultur. a magazine i n publication since . . naehrichten, a magazine and organ of the government of the a.s.s.r. . selt bereit and . rote fahne, were papers for the youth and were sent out to the distant german settlements i n the soviet union. . deutsche zehtral zeltung. printed i n moscow. . zur neuen schule t a periodical for teachers printed in moscow. from amongst the o f f i c i a l h i s t o r i c a l publications by germans i n the soviet union, some were the works of: . eartels, b., die deutschen bauern i n russland. moscow, . . . " . schmidt, d., tudien ueber geschlchte der wolgadeutschen i t e l l . pokrovsk, . the publications by the volga german, george dinges and by the russian, victor schirmunski, were of great lingu- i s t i c and f o l k l b r i s t i c importance. both men completed their studies i n germany. dinges was appointed director of the "wolgadeutsches zeritralmuseum" and later in director of the "research institute for german dialectics" on the volga. he was f i n a l l y made rector of the newly founded "deutsche kuhn, op_. c i t . , p. . gross, op_. c i t . . p. . pe&agogische hochschule" in the capital of the volga germans. his work was devoted to the compilation of the volga german dialects, the folklore, the creation of a dictionary, and the f i r s t language atlas of the volga area.^ victor schirmunski was a professor of germanics and since had been head of the department of folklore and art at the university of leningrad. he devoted his research to the studies of the german colonies in northern russia, ukraine, crimea and the caucasus. his f i r s t publication was die deutschen kolonlen in der ukraine. moscow, . in his second book, volkskundllche fox»schungen in den deutschen siedlungen der sow.jet union, he treats dialects, folksongs, and history - a l l in a similar manner. numerous articles of his were also published i n the german periodical "teuthon- i s t a " . they were remarkable for the systematic treatise of the development of the new mixed dialects among the germans i n russia. the conference of german teachers of the soviet union decided in that the gothic script which was used i n germany at the time should no longer be used i n soviet schools. this attitude of abolishing a l l traces of germany was carried on to such an extent that the teachers' assembly recommended the simplification of german spelling. their kuhn, op., c i t * . p. . ibid. aim for this was; the provision of a proletarian german lang- uage which shall he intelligible to a l l , clear, concise, and natural.^° with the promotion of research into the colonists' past, the granting of entire lingual autonomy, and the en- couragement of national culture, one should actually expect a close tie with the motherland. germany could have offered much at this time especially since the germans i n russia had not maintained the same cultural l e v e l . they were a few de^ cades behind i n progress of the people i n germany. such ties with germany were not maintained nor tolerated by the soviet regime. germany could not serve as an example to the germans in the soviet union. no school-books were to be imported from germany. only books printed i n the republic of the a.s.s.r. of the germans were to be used i n german schools. it was therefore, the aim of the soviet regime to create a communist german people within the u.s.s.r. with no cultural association with germany. the culture being bestow- ed on them i n their native language was thus to be a: culture national i n form, above a l l in language, but supra-national, socialist, or proletarian in essence.^ no secret was made of this aim, for j. v. stalin already said up.kohh. op. o l t . . pp. - . kl ibid, p. . in : the period of the dictatorship of the pro- letariat and of the building of socialism i n the soviet union is the period of the flowering of the national c i v i l i z a t i o n , which while intrinsically socialist are national i n form.** in the soviet government had recognized that no matter how closely the party had been supervising the ex- ecution of the soviet national policy i t had created and en- couraged "local and linguistic nationalism" by the very fact that l i n g u i s t i c autonomy had been granted to the minority groups. to combat this phenomena the soviet authority issued a decree on march th, , on "obligatory teaching of russian in a l l non-russian national schools".^ this measure was carried to such an extent that i n schools of german national d i s t r i c t s , russian became the lan- guage of instruction and german was taught as a foreign lang- uage. thus the national was deprived of the very essence which made him a member of that national group, namely of his language.**** the consequences of fnis policy were soon for detailed account see stalin, j. v., " p o l i t i c a l re- port to the th congress of the communist party of the sov- iet union, july ". vsesoluznala kommunistlcheskaia partla (b), new york city workers' library publishers, . kolarz, op., c i t . , pp. - . it i s this decree of and i t s practical application which is a striking contradiction to article of the con- stitution of the u.s.s.r. this a r t i c l e secures the right of national schools for a i r people of the u.s.s.r. apparent - notably amongst the olty germans who numbered ab- out , i n russia. they were distributed as follows: moscow - , , leningrad - , , saratov - , , and odessa - , .^ in time the student began to master the russian language. russian papers and books were his only sources for reading. the german papers and periodicals had ceased pub- l i c a t i o n . no cultural contact was maintained with germany for reasons as stated above. popular russian songs were more appealing to the student than the "obsolete" folksongs of his people. if he wished to be impressive, he spoke russian to his fellow member. these and other,reasons are a l l signs that the younger generation was rapidly losing the cultural niveau of an isolated language island and was readily drawing from russian culture. the extent to which some of the city germans had been assimilated into russian ways is seen from the quotation below. a report on the repatriated germans from the soviet union during world war ii in a salzburg camp (austria) states: there are many among them who can no longer speak german, but now are learning the ger- man language with enthusiasm....^ from the above presentation we can conclude that during the - boelltz, op_. c i t . , p. . schechtman, joseph b . , european population transfers - . oxford university press, new york, , p. , according to the "salzburger zeitung", april th, . period of the soviet regime the germans i n russia had ma- tured as an isolated language i s l a n d . ^ they had reached their f i n a l state of development - that i s the formation of a substantial city group. once this city group had been formed the minority group no longer remained isolated for it then drew rapidly from non-natlonal culture and was thus on the border-line of assimilation. see introduction for walter kuhn's theory of the devel- opment of an isolated language island, supra. chapter iv resettlement and repatriation during world war ii i . the eve op world war ii the outbreak of world war ii caused the soviet gov- ernment to undertake similar actions as the tzarlst's did during world war i. both wars brought a drastic change i n the colonist's position as citizens of russia, the d i f f e r - ence, however, is that world war ii and the subsequent policy caused by i t not only brought a resettlement about but they were expelled from the family of the soviet people. they disappeared from a l l ethnigraphical and s t a t i s t i c a l refer- ences of the ethnic composition of the u.s.s.r. the position of the germans i n the u.s.s.r, con- stantly fluctuated with the soviet-german foreign relations at the close of the *s. the soviet-german relations had grown so tense that any day war could be expected and thus the germans in the soviet union were treated as associates of the post-war soviet encyclopedia has completely ignored the existence of germans i n russia either past or present. in contrast, the encyclopedia of » devotes ten pages to a long h i s t o r i c a l description of the a.s.s.r. of the volga germans. it praises their achievements and contributions to the construction of socialism i n the u.s.s.r. germany. during this time they had lost f u l l status as sov- iet citizens. officers of colonist descent were dismissed from the red army as unreliables. for similar reasons the colonists had not been drafted into the army since , i n spite of the compulsory military training which existed i n the u.s.s.r. the great purges of - also heavily affected the german group i n russia. although they affected the russ- ian just as much as the non-russian, the latter suffered pro- portionately more as the purges were directed against the intelligentzia - whose number was limited. the victims were of two kinds. the f i r s t group included people who had champ- ioned the colonist cause during the tzarist regime, the se- cond and much smaller group were the people who were raised i n the bolshevik s p i r i t and had become the leaders of the group during the soviet regime. examples of the second group were prime minister welsch and president luft of the a.s.s.r. of the volga germans. both these men were responsible for previous purges but they were arrested in october, . from the above factors one can conclude that the germans did not occupy a favorable position i n russia at the eve of world war ii. close watch was held on them as the german army crossed the russian border. from that moment the germans i n russia were considered unreliables. kolarz, op_. c i t . , p. . ii. liquidation of the volga german republic the evacuation of the volga germans and with i t the liquidation of the a.s.s.r. of the volga germans, was caused by the pressure of the german army against moscow. another cause was the intention of making kuibyshev, north-east of the republic, the residence of the soviet government and the administration center of the volga-ural defense region. in order to carry out this project, safety measures had to be undertaken against the sympathizing volga germans. the de- cree of august th, , i n which the fate of the volga germans was sealed, accused the volga germans of sabotage and espionage. although the soviet government had dealt with them since on a purely class basis, no differentiations i n this respect were made i n the decree. neither were the members of the communist youth league nor the party members excluded from deportation. the s t a t i s t i c s below w i l l show proportionately the number of communist members as compared to the national composition of the a.s.s.r. i n .^ total . germans russians' others population , ..... , ...... , ..... , party members.. .... , .. the decree announcing the deportation of the entire volga german population reads as follows: edelman, maurice, how russia prepared. penguin books inc., new york, , pp. - . kohn, op_. c i t . , p. . according to reliable information received by military authorities, there are thousands and tens of thousands of diversionists and spies among the german population of the volga region who are prepared to cause ex- plosions i n these regions at a signal from germany. no germans ( l i v i n g in the volga d i s t r i c t s ) ever reported to soviet author- i t i e s the presence of such great numbers of diversionists and spies. therefore, the german population of the volga regions are covering up enemies of the soviet people and the soviet power. if diverslonlst acts were to take place under orders of germany by german diversionists and spies i n the volga german republic or neighboring regions and there were bloodshed, the soviet govern- ment, would be forced according to martial law to adopt measures of reprisal against v. the entire german population. in order to avoid such undesirable occurrences and to f o r e s t a l l serious bloodshed, the presidium of the supreme council of the ussr has found i t necessary to resettle the entire german population of the volga regions un- der the condition that the resettlers are allotted land and given state aid to settle in new regions. resettled germans w i l l be given land in the novo-slbirsk and omsk dis- t r i c t s , the altay region, the kazakstan re- public and neighboring l o c a l i t i e s r i c h in land. in connection with this, the national defense council is instructed to resettle as soon as possible a l l volga germans, \*ho w i l l be given land estates i n new regions. the decree was soon followed by i t s execution, for already at the end of august, : a mournful procession of refugees f i l l e d the roads leading to the railway stations of the middle volga, four hundred thousand of them carrying bedding, dragging domestic animals, the women weeping, a l l with the bitterness on their faces of those who have schechtman, op_. c i t . , p. , according to the "new york times", september th, . "been driven from their homes they were german refugees, the german settlers of the german autonomous volga republic, expelled by decree of the soviet government to s i - beria.° l i t t l e authentic information is available about the fate of the volga germans and that of the , siberian germans who had founded their s i s t e r colonies at the turn of the century. however the existence of a number of german collective farms bearing names as rosa luxemburg, progress and arbeiter were o f f i c i a l l y confirmed i n when over two doz- en german collective farmers and tractor drivers of the omsk province were awarded medals for excellent work by the supreme soviet. iii. black sea colonies under german occupation as the advancing german army approached the german settlements i n the ukraine, many of them were evacuated with the retreating red army. in places where time did not permit evacuations of the entire settlements only male persons were affected. in this manner close to , germans in the ukraine were evacuated by the soviet authority. the black sea germans which were not evacuated by the soviet authorities, remained l i v i n g i n german occupied edelman, op_. c i t . , p. . kolarz, op., c i t . , p. . ibid, p. . ukraine, crimea and north caucasus, where they enjoyed a p r i - vileged position under the german authorities.- this was con- trary to the indifferent attitude towards the colonists by the german occupational forces i n . during world war i i they showed great concern in the germans of ukraine as a re- sult of the national socialist policy. there remained about , persons of the roughly , people before the war. due to their privileged po- sition they were soon able to establish their private farms and businesses as contrasted to the russian population, who were not permitted to do so. constructions of every sort were undertaken and there was no thought of ever leaving their set- tlements. within a short period, with the help of the german authorities who were anxious to see a strong, healthy group of germans, they were well on their way to prosperity. the german group of , i n the romanian annexed transnistria, the area between the rivers dniester and bug, had grown especially prosperous. although the territory was annexed by romania, the germans were under the protection and administration of the german "volksdeutsche mittelstelle " , which had i t s seat i n landau the center of the german this was an organization which was concerned with germans abroad and founded for the purpose of carrying out national socialist policy which was "the unification of a l l germans". it thus supervised the repatriation of german groups such as the baltic and bessarablan germans, and the education of the newly gained germans i n the national socialist s p i r i t . colonies. the territory's revival was not limited only to the economic f i e l d , for education received similar attention. as many times before, german schools were founded i n the c o l - onies and a german highschool i n odessa. there were also two teachers* seminaries established, one i n prlshib, the other i n selz. in spite of the lack of priests, religion found a similar revival i n the colonies. it was of great importance and the main concern of the volksdeutsche mittelstelle, that the younger generation was trained i n the s p i r i t of national socialism. for this purpose, youth leaders from germany were sent to distant russia where they organized the german youth, p a r a l l e l to the organization of the hitler youth i n germany. several youth training camps were set up for the purpose of training lead- ers from amongst the colonists. as " f u l l " germans, they were also drafted into the german army. similar a c t i v i t i e s were carried on i n a l l german colonies, while occupied by the german forces. only the ger- man retreat of - terminated this revival. contrary, to expectation, the german authorities were faced with the sudden decision of repatriating the entire german population from their occupied t e r r i t o r i e s . as previously the baltic, the bessarabian and the bukovina germans were repatriated, now, the entire population was to be resettled to germany too. the settlement area selected for these repatriated germans were the most eastern provinces of germany. iv. repatriation from the german occupied territory prior to the mass repatriation of the black sea group in ^ , the german authorities had resettled some , germans, mainly city dwellers from the area of lenin- grad. in - a second group was resettled - that of , persons from the area of schitomir and , persons from the north caucasus. both groups were transferred to the gen- eral gouvernemente (german occupied territory) of poland and warthegau, the german annexed province from poland.^° the f i r s t mass transfer of the volksdeutsche from the ukraine started i n the f a l l of when the german army started i t s rapid retreat and simultaneously evacuated the german population. this retreat affected the germans, from the crimea, mariupol and melitopol, as well as urban dwellers from zaporozhe and nlkolaev. between the f a l l of and the spring of march, , , persons were on their march towards germany from this area. the second group of , , which went on their journey, were the germans from the area of dniepropetrovsk - from both sides of the river dnieper. the third group, largely rural dwellers comprising a total of , , l e f t wolhynla between october, , and a p r i l , of . . schechtman, op_. c i t . , pp. - , according to the "ost- deutscher beobachter", july rd, . ibid, pp. - , according to the "ostdeutscher beobach- ter". : the last and largest group was that of transnistria, amounting to a total of , persons, who l e f t their homes between march and a p r i l , . this transfer was the least organized one as the rapidly advancing russian forces caused chaos and panic among the concentrated masses at the crossing point on the dniester. in addition to this, the roads were blocked by the retreating romanian and german troops. many of them had covered as much as , miles with horse and wa- gon and after a period of twelve or more weeks they f i n a l l y reached their place of destination which was the warthegau. but hardly had they found accomodation i n the numer- ous transit camps, then they again had to move on westwards into germany. the red army stood at the gate of germany and the breakdown of germany was obvious. in this manner the great resettlement scheme of the third reich was a complete failure. the plan was to bring home a l l germans to germany, and especially to form a solid block of germans against the slavic peoples with the germans who had withstood assimila- tion i n previous times i n other countries. the refuge from the warthegau i n was an indiv- idual private task.• unorganized, every one fled on his own means and i n every direction into germany. as germans from abroad they were recognized by the authorities of hitler, but schechtman, op_, c i t . , pp. - . according to the "ost- deutscher beobacht e r*"," ju ly rd, . as germans who had been separated and isolated from germany for over one hundred years they were not f u l l y accepted with- i n germany by the average german. deeply disappointed about the "journey home to the reich", coupled with the desire for one's own home, caused some to contact the soviet repatriat- ing authorities which not seldom resulted i n a transfer back to the soviet union.^ their hope to return to their former homes was only a mere i l l u s i o n . contrary to the mennonite group who were well organ- ized and attended by unrra, later iro (international refugee organization), the remainder, including lutherans and catho- l i c s , were dispersed a l l over germany as farm helpers and i n other occupations awaiting contact with their relatives and friends across the atlantic. the period starting after world war ii u n t i l the present time, marked the third immigration period into canada by germans from russia. such contacts were made by russian-germans i n the french, american and english occupied zones. russian-germans had been repatriated from the russian occupied zone in ^ . part ii russian-germans in canada chapter v immigration into canada i. canadian immigration policy in brief according to the british north american act the laws affecting immigration came under the jurisdiction of the do- minion government. however under the same act, the l e g i s l a - ture of each province may pass laws which shall be in accord with any law of the dominion government. the basis for immigration and colonization of west- ern canada was the land act of which provided free grants of homesteads. this system, which was so effeotive i n the u.s.a., enabled the immigrant to purchase other do- minion lands i n addition to the free grants. due to poor transportation f a c i l i t i e s this policy did not live up to i t s expectations. the migration to the west consisted largely of canadians from eastern canada. angus, h. f., "canadian immigration: law and i t s admini- stration" , american journal of international law, the ameri- can society of international law, washington, , pro. - . england, robert, the colonization of western canada, p. s. king & son ltd., london, , p. jt. in , any railway company was able to obtain land north of the canadian pacific* railway if tracks were built and the area settled by them within a period of five years. but again, most of the companies failed to live up to their obligations and brought few or no settlers to the area. it was not u n t i l i that a new immigration policy directed the colonization of the west. it was in that year that the energetic clifford sifton became minister of the in- terior under s i r wilfrid laurier government. the previous policy of granting land as payment to railway companies for the construction of railway tracks, was abolished. in this way the government was again able to dispose over large.areas of land and grant settlers one quarter of a section as home- steads. the keyword of clifford sifton's colonization policy was "settle". the immigrant was to be kept in the area, his l i v i n g conditions were to be made tolerable, and he was to bv supplied with railway f a c i l i t i e s . ^ arrangements were made . with shipping companies, such as the north atlantic trading company, to bring i n european farmers. a net of recruiting agents was set up a l l over europe. many of them had to carry on their work secretly as european countries, especially russia, prohibited immigration of their subjects. in.this england, op. c i t . . pp.. - . .k dafoe, john w., clifford sifton i n relation to his time, the macmillan company canada limited, toronto, , pt>. - . manner the prairie population was increased to , , per sons i n the years to .^ the post-war immigration was undertaken on a l i m i t - ed scale as immigration fluctuated with the prosperity of canada. no.limitations were set i n regard to immigrants from perferable countries. some immigrants were allowed from non-preferable countries and such were the immigrants from russia. the task of bringing i n immigrants from non- preferable countries, such as.russia, was given to the r a i l - way companies. the lutheran immigration board and the catho l i e immigration aid society were religious organizations which worked in conjunction with the railway companies and helped to cover costs of transportation.^ with the coming of the depression in , a defin- ite change occurred i n the immigration policy of the domin- ion. an order-in-council dated march, , states: prom and after the th of march and u n t i l otherwise ordered, the landing i n canada of immigrants of a l l classes and oc- cupation i s hereby prohibited except as here- inafter provided: the immigration officer i n charge may permit to land in canada any immigrant who otherwise complies with previous of the im- migrant act, i f i t is shown to his satis- faction that such immigrant i s : . a b r i t i s h subject entering canada directly or indirectly from great britain england, op_. c i t . , pp. - . ibid, p. . or commonwealth countries, who has s u f f i - cient means to maintain himself u n t i l em- ployment is secured. . a united states citizen entering canada from the u.s. who has sufficient means to maintain himself u n t i l employ- ment is secured. . the wife or unmarried child under eighteen years of age of any person legal- l y admitted to and residing in canada, who i s in a position to receive and care for his dependent. . an agriculturalist having s u f f i - cient means to farm i n canada.? this policy had almost completely stopped immigration of central europeans during the years of depression. this im- migration which had been reduced to minor proportions r e v i t - alized after the second world war. the following steps have been taken by the canadian government in regard to immigra- tion policy since world war ii: a. the barriers against b r i t i s h sub- jects, and u.s. citizens had been re- duced to the bare minimum of good health and the absence of subversive p o l i t i c a l views. b. the l i s t of admissible relatives of legal residents of canada has been extended to include everyone closer than a cousin,.. ... it also includes persons engaged to marry the residents who make application for their admission. g. special provision has been made for the entrance of , persons who are not otherwise admissible from the displaced per- sons camps of europe. (each of these per- sons when established in canada may then ap- ply i n turn for the admission of his or her relatives. angus, op_. c i t . , pp. - . keenleyside, h. l., canadian immigration policy. univer- sity of b r i t i s h columbia, vancouver, , pp. - . it was the canadian government which took the i n i t - iative amongst overseas countries i n finding a solution to the war refugees in europe. u n t i l march, , canada has admitted more d.p.'s than a l l other non-european countries combined. great d i f f i c u l t i e s have been encountered i n carrying out this task especially i n regard to transporta- tion. for the most part of the "beaverbrae", a convert- ed german war vessel, was the only ship which brought refug- ees from germany to canada. later conditions were improved as three more iro ships were aiding transportation. other persons are admitted since an order—in-coun- c i l of june, , under the following terms: the person must satisfy the minister that he is a suitable immigrant and i s not undesirable owing to his peculiar customs, habits, etc. this act particularly opened the p o s s i b i l i t y of german c i t i - zens to immigrate to canada freely and has continued up to the present time. ii. immigration into canada - it was economical and p o l i t i c a l reasons which caused the emigration of colonists from russia between the years of and l . the economical cause was the shortage of land. the canada year book. dominion bureau of statistics, king' printer and controller of stationary, ottawa, , p. . friedemann, wolfgang g., german immigration into canada. the ryerson press, toronto, , p. . there was not sufficient land in the original colonies to support the large colonist families and although sister c o l - onies were formed there was an extensive number of landless towards the end of the nineteenth eentury. in there began a gradual abolishment of the colonists privileges which constituted the p o l i t i c a l cause for emigration. it was in this year that their self-government was discontinued and the colonies were incorporated into the general russian admini- strative system. the above action on the part of the russian govern- ment did not yet disturb the colonist. however the imperial ukas of july, , which proclaimed the coming military ser- vice to russian citizens, caused a general dissatisfaction amongst the colonists. this ukas especially affected the re- ligious reformed groups as military exemption was one of the basis of their creed. already in i i, the mennonites sent a delegation to petersburg to petition for exemption from military service. not awaiting a reply from the imperial government, they prepared for emigration.^ for the other religious groups, the ukas was also sufficient to consider emigration as the conditions in the russian army at the time were unendurable and the term of service lasted from ten to see section on economics, chapter ii, supra. see section on administration, chapter ii, supra. quiring, walter, russlanddeutsehe suchen elne hejlmat, verlag: helnrich schneider, karlsruhe, , pp. - . fifteen years. although the catholics and lutherans were not as organized as the mennonites, they were just as eager to leave russia. the mennonites had requested information about emi- gration to canada and from a l e t t e r dated by the b r i t i s h consul zohrab i n berdjansk to earl granville, british foreign secretary, we read the following regarding the colonists' re- action to the ukas: a period of ten years is granted by this ukas to the germans, dating from i t s issue, to elect whether they submit to i t s conditions or quit the country......that part which marks military service obliga- tory becomes law i n while the clause which makes the conscription compulsory on a l l classes w i l l come into force i n further i n the consul's l e t t e r we read: .....from what i have been able to learn, i doubt not the departure of the mennonites would rapidly be followed by that of ger- mans of other denominations who are now, i am informed, watching the course pursued by the mennonites with the object of following i t i f successful. ^ following the above reasons for emigration was the definite russification policy which has been described pre- viously i n part i. similar causes for emigration prevailed amongst the volga germans. in addition, the russification policy coincided with the years of drought in - on ik corell, ernst, "mennonlte immigration into manitoba", the mennonite quarterly review, vol. , goshen, indiana, july, , pp. - . the volga, which resulted in a mass migration overseas.^ the causes for emigration of the russian-german lu- therans and catholics before world war i, can be summarized as follows: . land shortage amongst the volga and black sea germans. . the ukas of which stipulated military ser- vice for the germans. . the russification of schools and the abolishment of self-government. k» the fear of war after the russo-japanese war of . . the letters from colonists in america which praised the country. . the propaganda of the u.s.a. and canadian immi- gration agents. . the granting of free homesteads by the u.s.a. and canada which was satisfying to the colonists' urge for land. . the definite preparation for emigration by the mennonites had its effect on a l l other religious groups. * » « • * an exact summary of emigration from russia to the americas as to their numbers as well as origin i s practical- l y impossible to compile at the present time. in most cases the early settlers did not keep any records nor were r a c i a l origin and nationality kept distinct at the ports of entry. bonwetsch, op_. c i t . , p. . i t i s c e r t a i n h o w e v e r , t h a t t h e g r e a t b u l k o f e m i g r a n t s f r o m r u s s i a w e r e d i r e c t e d t o n o r t h a m e r i c a . ^ a t t h e c l o s e o f t h e n i n e t e e n t h c e n t u r y t h e c l i m a t i c a n d e c o n o m i c c o n d i t i o n s o f t h e c a n a d i a n p r a i r i e s w e r e n o t a p p e a l i n g t o t h e a v e r a g e w e s t e r n e u r o p e a n . b u t t h e s e v e r y s a m e c o n d i t i o n s w e r e o f g r e a t a p p e a l t o t h e g e r m a n f r o m r u s s i a , w h o w a s r e p r e s e n t a t i v e o f a l a n d - h u n g r y c o l o n i z e r . h e w a s a c c u s t o m e d t o a h a r d l i f e a n d p o s s e s s e d l i t t l e c u l t u r - a l d e m a n d s . t h e f i r s t g e r m a n s f r o m r u s s i a t o i m m i g r a t e a n d s e t - t l e i n c a n a d a , w e r e t h e m e n n o n i t e s . t h e y f o u n d e d a c l o s e d s e t t l e m e n t i n m a n i t o b a b e t w e e n t h e y e a r s t o w i t h a t o t a l o f c l o s e t o , m e m b e r s . a l t h o u g h i m m i g r a t i o n o f c a t h o l i c s a n d l u t h e r a n s i n t o t h e u . s . p r a i r i e s h a d a l r e a d y t h e t a b l e b e l o w c o m p i l e d b y w a g n e r , g e o r g , a n d m a i , r i c h a r d , d e u t s c h e u e b e r l a n d u n d m e e r . v e r l a g d e r b u c h g e - m e l n d e , b o n n , , p . , s h o w s t h e d i s t r i b u t i o n o f g e r m a n s f r o m r u s s i a i n o v e r s e a s c o u n t r i e s , a c c o r d i n g t o s t a t i s t i c s o f : c a n a d a , u . s . a , m e x i c o . . , b r a z i l , p a r a g u a y . . , u r u g u a y ..... , a r g e n t i n a ... , t o t a l . . . . . l e i b b r a n d t , g e o r g , " t h e e m i g r a t i o n o f t h e g e r m a n m e n n o - n i t e s f r o m r u s s i a t o u . s . a . a n d c a n a d a , - " , t h e m e n n o n l t e q u a r t e r l y r e v i e w , v o l . , g o s h e n , i n d i a n a , , o p . - . started i n ,^ it was the mennonite group which had suc- cessfully established itself and thus proved the good farm p o s s i b i l i t i e s of the canadian prairies. it i s then due to their economic success that directed the immigration of other religious denominations to the canadian prairies, especially saskatchewan. an immigration agency already existed in odessa on the black sea before which provided prospective immi- grants with assistance and information regarding immigration. the agency mistier of bremen had a representative i n odessa who provided tickets from odessa to winnipeg at the cost of one hundred and nine r u b l e s . t h e immigrants journey to canada was mainly through hamburg, antwerp and bremen. the emigration of the catholics and lutherans was never really a mass migration as i t was with the mennonites who arrived in canada by the hundreds. the lutheran and catholic emigration took place rather i n small groups of five to ten families and whose f i n a l destination was the canadian prairies as i t was for many others. saskatchewan became the sallet, richard, "russlanddeutsche siedlungen i n den vereinigten staaten von amerika", jahrbuch der deutsch amerl- kanlsohen hl torlschen gesellschaft von i l l i n o i s . vol. , chicago, , pp. - , gives an intensive presentation of the lutheran and catholic immigration into the u.s.a. metzger, h . , qeschichtllcher abrlss ueber die st. peters- pfarrel zu kronau. the western printers association ltd., reglna, saskatchewan, , p. . center of their settlements. although the immigration and with i t the foundation of settlements was most active i n the f i r s t decade of the twentieth century, nevertheless there were many settlements founded prior to clifford siftori's immigration policy which started i n . according to abele, the f i r s t german cath- olics from russia arrived in and settled near regina. the date , however, seems to be i n contrast to the chron- ological development of the emigration of the germans from russia. german catholics from the south of russia'are trace- able i n saskatchewan since the 's. they had founded the colonies of josephstal - , st. peter - (near bal- g o n l ) , new kronau (kronau) - , davln - , and vibank - , a l l south of regina. at .the same time many settled i n the at that time s t i l l small town of regina. in spite of hardship, as w i l l be discussed later, the influx into these the term "settlement" or "colony" i n part ii, does not indicate a closed settlement, but rather a certain farm d i s t r i c t . the name of the post office, railway station, or town which was founded later, was applied to the entire d i s - t r i c t . abele, paul, festschrift zur .jaehrlgen jubllaemsfeier der gruendung der st. pauls-kirohengemelnde in vibank. sask.". . june. . the western printers association ltd., regina, , p. . metzer, ojo. c i t . . p. . abele, op_. c i t . , p. . c o l o n i e s c o n t i n u e d . i t w i l l a l s o b e s e e n t h a t n u m e r o u s o t h e r c o l o n i e s w e r e f o u n d e d b y t h e g e r m a n c a t h o l i c s f r o m r u s s i a . a s u r v e y i n r e g a r d , t o o r i g i n s h o w s t h a t t h e y a l l c o m e f r o m t h e g e r m a n c o l o n i e s n e a r o d e s s a o n t h e b l a c k s e a . t h e c a t h o l i c s f r o m b e s s a r a b i a a n d t h e c r i m e a a r e l e s s r e p r e s e n t e d a s t h e y w e r e a l r e a d y s m a l l e r i n n u m b e r s t h a n t h e c a t h o l i c s o n t h e b l a o k s e a . t h e f i r s t g r o u p o f l u t h e r a n s f r o m t h e b l a c k s e a s e t - t l e d i n s a s k a t c h e w a n i n i n b e r e s l n a a n d h o f f n u n g s t a l n e a r l a n g e n b u r g . t h e y w e r e f r o m b e s s a r a b i a . a n o t h e r g r o u p o f l u t h e r a n s f r o m r u s s i a s e t t l e d i n a l b e r t a i n i n t h e s e t t l e m e n t o f h e l m t h a l i n t h e r a b b i t h i l l s n e a r t h e r a i l w a y s t a t i o n n i s k u . t h e r e w a s a l s o a s e t t l e m e n t f o u n d e d w e s t o f w e t a s k i w i h . i n . h s i n c e t h e r e w a s a t e n d e n c y t o s e t t l e w i t h p e o p l e o f t h e s a m e f a i t h , w e f i n d t h e l u t h e r a n s f r o m r u s s i a s e t t l e d w i t h o t h e r l u t h e r a n s f r o m p o l a n d a n d b u k o v l n a . e x a m p l e s o f t h e f o r e g o i n g a r e l a n g e n b u r g a n d e d e n w o l d i n s a s k a t c h e w a n . i n a d d i t i o n t o n u m e r o u s s e t t l e m e n t s , l u t h e r a n s h a v e e x t e n - s i v e l y s e t t l e d i n t h e w e s t c a n a d i a n c i t i e s . s t a r t i n g w i t h , a s t r o n g e m i g r a t i o n w a s n o t i c e - a b l e i n w o l h y n l a . t h e s e c o l o n i s t s a r r i v e d a n d s e t t l e d p r e - d o m i n a n t l y i n t h e u . s . s t a t e s o f m i c h i g a n , w i s c o n s i n a n d s e e t a b l e i v nebraska. ^ since they also emigrated to canada into the province of alberta. the f i r s t community founded by them was i n wetaskiwln. leduc was founded i n by wolhynian baptists. ltitherort, bashaw and e hers l i e were founded by wolhynlans i n the 's. the colonies of bruderheim, new sarepta and bruderfeld were founded by wolhynian hutterites. wolhynian germans are also traceable i n saskatchewan since - namely i n regina, rostern, yorkton. yellow grass was founded by them in . they have further exten- sively settled i n kipling, lemberg, lipton and mossbank. since wolhynlans began to settle i n the neighborhood of the mennonlte settlements i n manitoba - i n gretna, morris, brown, morden, friedensfeld near steinbach. they have fur- ther settled east of winnipeg where they have founded gruen- wald and thalberg. the volga german immigrants were fewer i n number than that of german immigrants from other areas of russia. their emigration was directed mainly to the u.s. where they settled i n the states of nebraska, kansas, colorado and i l l - i n o i s . nevertheless they also found their way to canada. as many of their kinsmen i n the u.s., they too had a tendency sallet, op_. c i t . , p. . lehmann, heinz, das deutschtum i n westkanada. verlag junker und duenhaupt, berlin, , p. . sallet, op. c i t . , p. . ? t o s e t t l e i n c i t i e s . i n s u c h a m a n n e r t h e f i r s t v o l g a c o l - o n y w a s f o u n d e d i n o n t h e r i v e r s i d e i n c a l g a r y . l a t e r a r r i v a l s s e t t l e d i n t r o c h u , b e l s e k e r , a n d d u f f i e l d i n a l b e r t a ; n e a r g r u e n w a l d i n m a n i t o b a ; a n d l a t e r i n t h e f i r s t d e c a d e o f t h e t w e n t i e t h c e n t u r y i n s t . j o s e p h ' s c o l o n y a n d i n t h e d r y b e l t o f s a s k a t c h e w a n . t h e y c a m e p r e d o m i n a n t l y f r o m t h e c o l - o n i e s o f n o r k a , j a g o d n a j a , p o l j a n a , k o l b , p r e u s s , b r a b a n d e r , s c h i l l i n g a n d a l e x a n d e r d o r f o n t h e v o l g a . p r i o r t o c l i f f o r d s l f t o n ' s i m m i g r a t i o n p o l i c y c o m i n g i n t o e f f e c t , m r . e u g o c a r s t e n s i n h l a a n n u a l r e p o r t o n i m m i - g r a t i o n a n d c o l o n i z a t i o n f o r t h e y e a r , s t a t e s t h e f o l l o w - i n g r e g a r d i n g t h e i m m i g r a t i o n o f g e r m a n s f r o m r u s s i a : i m m i g r a t i o n o f g e r m a n s f r o m r u s s i a h a s f a l l e n o f f d u r i n g t h e p a s t s e a s o n , w h i c h i t h i n k m a y p a r t l y b e d u e t o c a u s e s a r i s i n g f r o m t h e p a r t i a l f a i l u r e o f c r o p s l a s t y e a r i n t h e n e w s e t t l e m e n t s i n a l b e r t a , b u t m a i n - l y f r o m r u s s i a h e r s e l f h a v i n g o p e n e d n e w l a r g e t e r r i t o r i e s f o r s e t t l e m e n t , t o w h i c h s h e i s a n x i o u s t o d i r e c t h e r e m i g r a t i o n a n d t h e c o n s e q u e n t r e l a x i n g o f s o m e o f t h e o p - p r e s s i v e l a w s w h i c h i n t h e p a s t c h i e f l y i n - d u c e d t h e g e r m a n c o l o n i s t s t o l e a v e r u s s i a . s h o u l d s h e c o n t i n u e t o i m p r o v e h e r a t t i t u d e t o w a r d s h e r g e r m a n c o l o n i s t s w e m a y n o t l o o k f o r a l a r g e i n c r e a s e i n i m m i - g r a t i o n f r o m r u s s i a , a l t h o u g h t h i s y e a r ' s f a v o u r a b l e c r o p t h r o u g h o u t t h e g e r m a n s e t - t l e m e n t s w i l l n o d o u b t b e t h e m e a n s o f b r i n g i n g t o u s t h e f r i e n d s o f o u r g o o d a n d n u m e r o u s r u s s i a n - g e r m a n s e t t l e r s , w h o h a v e i n t h e p a s t y e a r b e e n h e l d b a c k b y l e h m a n n , o p _ . c i t . , p . . table iv colonies founded by buss i an-germans by compiled from the "summary statement" in the annual report of the department of the interior for the year '. no. . printed by s. e. dawson, printer to the queen's most excel- lent majesty, ottawa, , pp» - . name of colony name of nearest number of railway station settlers landshut langenburg, sask. . beresina langenburg, sask hoff enthal. .langenburg, sask.. . new kronau . balgonl, sask. . davin balgonl, sask st. peter and st. joseph,balgonl, sask yellow grass .yellow grass, sask. leduc leduc, alberta. wetaekivin, red deer lake, bears h i l l , , etc wetaskiwin, alberta..... . . , rabltt h i l l s . edmonton, alberta. . unfavourable reports. # * # # • in the f i r s t decade of the th century, when clifford sifton's policy had become a realization, the a r r i - val of germans from russia was at i t s peak. among the new comers this time, there were also germans from the caucasus, crimea and siberia. numerous new colonies were founded by them and many settled i n the established colonies. however, immigration was and remained an individual task. they a r r i - ved i n small groups of a few families and often individuals who had escaped military service.^ since most of the immi- grants were not prosperous, their travelling expenses were subsidized by relatives or friends who had been successful i n canada. the canadian authorities also allowed them credit for travelling expenses as they allowed them similar credit to obtain farm equipment. to complete the immigration picture before world war i, we have to mention the extensive influx from the u.s.a. although immigration from the u.s. had taken place before annual report of the department of the interior for the year ot no. .""printed by s. e. dawson, printer to the queen's most excellent majesty, ottawa, , p. . pdchard sallet reports that this practice was assumed to such an extent that the colony of kassel i n the black sea area which had a population of , was unable to present men for draft i n . this phenomenon was more acute during the russo-japanese war i n - . , i t led a l l other countries i n immigration to canada between the years of and with a total of , . immigrants. the national composition of these immigrants, i n addition to english-speaking, was germans, scandinavians, and others of non-english speaking races. the attraction of these settlers was again^the cheap land which was no longer available i n the u.s. each person was allowed to take up a homestead i n western canada at a cost of ten dollars and a so-called "pre-emption claim" for three dollars an acre . a large number of these immigrants were germans from russia who had previously settled in south and north dakota, montana and other states. among them were also some immigrants of the second generation. they were a great asset to canada as they brought tfith them experience and training i n agricultural pur- suits i n north america. many of them disposed over land or other property before emigrating to canada. sallet records an individual case where a black sea german sold his land at mcclusky, north dakota, which amounted to , acres and moved to morse, saskatchewan with a steam plough. there he bought new cheaper land. the immigrants from the u.s. had an average of $ , per person. dillingham, w. p., the immigration situation i n canada. the immigration commission (u.s.a.), washington government printing office, washington, , p. . sallet, op_. c i t . , p. . dillingham, op. c i t . , p. . sallet, op_. c i t . , p. . the colonies given below were either founded or pre- dominantly settled by lutherans or catholics from russia in the f i r s t decade of the th century. in saskatchewan the settlement of the st. peter's colony east of saskatoon had started i n and st. joseph's colony west of saskatoon in - . amongst them were the russian-german catholics who had previously settled in the u.s. we find them partic- ularly i n the latter colony. extensive advertising in russia resulted i n : a large influx of russian-germans during - into the tramping lake - macklin, eastern part of the st. joseph's colony. further settle- ments were founded by german catholics in saskatchewan at odessa - - , allan - , holdfast - , and selz - . these settlers came exclusively from the black sea. kendal was founded i n by catholics who were mostly from the u.s. settlers from the azov sea area founded the catholic colony of claybank i n . ? bllllmun was founded between and by black sea germans. lutherans from bessarabia settled i n melville, kip- l i n g and zorra i n . since they also settled i n the dawson, c. h., group settlement. macmillan company of canada, toronto, , pp. - . gerein, frank, history of odessa. - . western printers association ltd., regina, saskatchewan, , p. . -lehmann, op_; c i t . , p. . i l l dry belt of south saskatchewan in st. bonnells, mceachern, eatonla, and bateman. wolhynla germans settled in morse, saskatchewan. among the settlers in alberta who had founded the catholic colony near spring lake i n , were many black sea germans who had emigrated from the dakotas and minnesota. freudental near carbon i n alberta was founded i n by lu- therans from the u.s., but who had formerly come from the black sea. the settlement is named after their colony near odessa. in manitoba further german farm d i s t r i c t s were founded near moosehorn, camper, grahamdale and friedfeld be- fore . immigration continued u n t i l world war i but very few new colonies were founded i n the last three years before the war. to alleviate the colonists beginning i n their newly adopted country, the railway companies and the religious or- ganizations, such as the "catholic settlement society", d i r - ected them to the established colonies. further assistance by the immigration department in cooperation with the various churches was offered to the immigrants and can be seen from the following quotation: the canadian steamship manifest con- . tains among other inquiries a question re- lative to the religion of the immigrant... sallet, oj>. c i t . , p. . lehmann, op_. c i t . . p. . ko dawson, op., c i t . , p. . ...the information, i t is stated, is gath- ered not "because the government lays any stress upon religious belief or makes i t i n any sense a test of the admissibility of the immigrant, but largely i n order to assist the churches i n work among those newly ar- rived. a l i s t of arriving immigrants, class- i f i e d by their religious belief, and their destinations, is furnished to the head of any religious denomination requesting the same. such church o f f i c i a l s are enabled i n this way to notify church authorities i n different l o c a l i t i e s of the a r r i v a l of such immigrants, and i t is said that much good results, not merely i n putting the new im- migrants into better social surroundings, but also i n the way of helping them to se- cure work.^- the d i f f i c u l t i e s i n compiling the exact number of catholic and lutheran immigrants before world war i have a l - ready been partly mentioned. although the canadian census does not exactly present the number of immigrants, with which i am concerned, nevertheless the s t a t i s t i c s below w i l l reveal an overall picture of the same. number of total germans in western canada * . , . , • , -• . , dillingham, op. c i t . . p. . census of canada. . vol. i, population. printer to the king's most excellent majesty, ottawa, , table . provinces manitoba saskatchewan.... alberta. b r i t i s h columbia total... in reality the total number of germans must have been higher as many germans from eastern europe (especially germans from russia) have definitely confused r a c i a l origin and national- i t y and have stated their nationality father than,racial or- i g i n in the census. heinz lehmann, who made the f i r s t survey of a l l germans in canada, claimed that of the total germans in western canada before world war i the german from russia comprised the greatest proportion. on the basis of available material i n regard to the origin of the german pre-war immi- grants, he arrived at the composition as stated below. origin of germans in western canada^ germans from russia ........ ,** # germans from romania % germans from austro-eungary ... ..... # . germans from germany ...... ., % germans from the u.s.a.. .. # germans from ontario, and other countries . # the preceding presentation of colonies and their statistics is by no means complete, neither are the settle- ments exclusively founded by the people mentioned. presented are rather the colonies predominantly founded by.either the one or the other group, such as by catholics from the black sea or by wolhynla germans who are of lutheran f a i t h . the d i f f i c u l t y i n tracing the settlers origin as well as the k lehmann, op_. c i t . , p. . definite group who had founded the colony, is created by the fact that a colony was usually settled by people of the same f a i t h but who had come from different countries. in this manner we have the colony of vibank, saskatchewan, which was f i r s t settled by black sea germans. however i n the same year catholics from banat, romania also settled there. exactly the same phenomenon occurred with the lutheran settlers - such as i n the colony of edenwold we find germans from buko- vlna, dobrudsha, south russia and many other places. in spite of the various origins of the settlers, their common langu- age, f a i t h and equal cultural niveau was sufficient to shape a unified community. iii. second immigration - the outbreak of world war i ceased the immigration of russian-germans into canada. an exception were , hut- terites who immigrated from the u.s. during the war. not be- lieving i n supporting a war, they conflicted with the u.s. authorities, which resulted i n their emigration.^ the conditions amongst the colonists i n russia f o l - lowing world war i and the revolution have already been the hutterites, as the mennonites, have founds their o r i - gin i n the anabaptist movement of the th century. they are named after the founder of the sect, jacob huter, who was burned at the stake i n i n insbruck. persecuted, they emigrated to bohemia and later into russia. as military ser- vice became obligatory i n russia, they emigrated to the u.s. i n & . they d i f f e r from the mennonites only i n their com- munal possessions. d i s c u s s e d i n c h a p t e r i i i . t h e p o l i t i c a l a n d e c o n o m i c a l r e a - s o n s t h a t l e d t o t h e i r e m i g r a t i o n b e f o r e t h e w a r , w e r e n o w e v e n m o r e f o r c e f u l . t h e d e v a s t a t i o n o f t h e c o l o n i e s d u r i n g t h e c i v i l w a r , w h i c h l e d t o t h e g r e a t f a m i n e o f , c o u p l e d w i t h t h e a t t i t u d e t o w a r d t h e n e w r e g i m e i n c i t e d e v e r y o n e t o e m i g r a t i o n . l a t e r i n t h e *s t h i s u r g e w a s s t r e n g t h e n e d b y i n c r e a s e d t a x e s a s w e l l a s t h e p r a c t i c a l e x e c u t i o n o f t h e c o l l e c t i v i z a t i o n p o l i c y i n t h e u . s . s . r . a s i n p r e v i o u s t i m e s t h e m e n n o n i t e s w e r e a g a i n t h e o n l y e f f i c i e n t g r o u p t o u n d e r t a k e a n o r g a n i z e d e m i g r a t i o n . t h e y h a d a l r e a d y s e n t a d e l e g a t i o n t o c a n a d a i n i n o r d e r t o i n v e s t i g a t e i m m i g r a t i o n o p p o r t u n i t i e s . ^ t h e c a t h o l i c s a n d l u t h e r a n s w e r e d i s o r g a n i z e d a n d l a c k e d l e a d e r s h i p a t t h e v e r y m o m e n t w h e n m a t t e r s o f i m m i g r a t i o n b e c a m e m o s t c o m p l i - c a t e d i n r u s s i a . t h e i m m i g r a t i o n i n t o c a n a d a w a s f u r t h e r c o m p l i c a t e d a s c a n a d i a n i m m i g r a t i o n a d j u s t e d i t s e l f t o t h e e c o n o m i c c y c l e . i n a d d i t i o n r u s s i a w a s o n e of t h e " n o n - p r e - f e r r e d " c o u n t r i e s f r o m w h e r e t h e n u m b e r o f i m m i g r a n t s w a s t o b e l i m i t e d . i n v i e w o f t h e f a c t t h a t a n e x t e n s i v e n u m b e r o f f a r m e r s i n s a s k a t c h e w a n w e r e o f g e r m a n d e s c e n t , c o m i n g f r o m r u s s i a , p o l a n d , r o m a n i a , g e r m a n y p r o p e r , e t c . , t h e g e r m a n c a n a d i a n s o c i e t y o f s a s k a t c h e w a n a s k e d i n a m e m o r a n d u m t o h a v e p r e f e r e n c e g i v e n t o g e r m a n i m m i g r a n t s , i r r e g a r d l e s s o f l e h m a n n , o p _ . c i t . , p . . origin. this petition was to he applicable to immigrants who otherwise f u l f i l l e d the immigration requirements. the memor- andum was .supported by a l l german organizations and as such was presented for consideration to the royal commission of colonization and settlement i n saskatchewan. it i s not known to what extent this exceptional document influenced further immigration of germans from eastern europe. however, the canadian government came: to an agreement with the cana- dian national and canadian pacific railways to bring i n a num- ber of agriculturalists from russia. strict medical as well as c i v i l inspection was to be carried out. no financial as- sistance was offered to this movement by the canadian govern- ment. the required valid passport by the canadian govern- ment, created further d i f f i c u l t i e s for the russian-germans. on and after the th february, , it shall be necessary as a condition to per- mission to land in canada, that every im- migrant shall be i n possession of a valid passport issued in and by the government of the country of which such person i s a subjeot or citizen, such passport to be presented within one year of the date of i t s issue. meanwhile the urge to emigrate amongst the colonists, had "auslanddeutschtum", der auslanddeutsche. jahrg. , no. , deutsches ausland instltut, stuttgart, , pp. - . england, op_. c i t . . pp. - . england, robert, the central european immigrant i n cana- da. the macmillan company of canada ltd., toronto, , v. p. . grown stronger for the new economic policy period was over and they faced collectivization at the end of the *s.^ the u.s.s.r., however, was not too eager to lose its subjects. to curtail this sudden urge to leave the country, the russian government demanded a fee of rubles from every adult per- son that received a passport.^ in the hope to achieve a solution to their problem, there began an instinctive movement without leadership to moscow. they were represented from a l l parts of russia. the main movement reached catastrophic measures by september of , for nearly thirteen thousand colonists had gathered i n moscow.^ they were weeks and months awaiting their emigra- tion documents. a direct immigration from moscow to canada was not permitted by canadian authorities i n spite of the ur- gent request of the religious organizations. a long negoti- ation between german and u.s.s.r. authorities resulted f i n a l - l y i n the immigration of , persons to germany. settlement i n over populated germany was excluded right from the start. the accommodation offered i n the three camps of prenzlau, quiring, op., c i t . . p. . schoeneich, hans. die lhr helmatland verilessen. verlag von phllipp reclam jun., leipzig, , p. . no o f f i c i a l number of the assembled colonists i n moscow was ever published. schoeneich, op. c i t . . p. , speaks of , , quiring, op., c i t . , p. , of , , and per aus- landdeutsche. of , . quiring, op. c i t . , p. . hammerstein and moelln was to be temporary u n t i l immigration to an overseas country was secured. the religious composition of persons i n these camps was » mennonites, , luther- ans, catholics, and advent lets. -* the expenses of the refugees were partly carried by the german government and the organization "brueder in not" (brothers i n need). this organization was initiated by president von hindenburg, for the purpose of defraying the ex- penses for the refugees. more than , marks were c o l l - ected. a considerable amount was repaid by the german r e l i g - ious organizations i n north america.^ when f i n a l l y i n emigration from russia became an impossibility, the colonists turned to other methods of escaping from russia. as early as , individuals crossed the border into manchuria. but when i n collectivization was also obvious in siberia, the number of refugees increas- ed. walter quiring speaks of a dramatic escape of a whole village across the amur river into manchuria. by night the entire settlement of schumanovka near the amur crossed the "russlanddeutsche bauern auf der wanderung", der ausland- deutsche. jahrg. , no. , deutsehes ausland instltut, stuttgart, , pp. - . "russlanddeutsche bauern auf der wanderung", der ausland- deutsche, jahrg. , no. , deutsehes ausland instltut, stuttgart, , pp. - . it shall be remembered that several german colonies were founded near the amur and ussurl rivers. frozen river. safely with f l f t y - s l x f u l l y packed sledges, they arrived in manchuria. similar escapes were also record- ed from turkestan into china. in such a manner , refu- gees had gathered i n harbin, manchuria, by the f a l l of . amongst these refugees were mennonites, lutherans, catholics, baptists and others.^ with a few exceptions these refugees emigrated via marseille to south america, as did the lutheran group, or ar- rived i n germany. by the f a l l of , a total of , russian-german refugees had assembled i n germany. according to religious denomination, these were - , mennonites, , lutherans, catholics, baptists, and advent- i s t s . since the majority of the refugees were of the men- nonlte f a i t h , bishop david toews of rosthern, saskatchewan, became the spokesman of a l l the refugees. however due to the r i s i n g unemployment i n , premier andersen of saskatchew- an as well as the premier of alberta declined immigration of the entire group. an agreement was reached whereby only re- latives of well established citizens were to be permitted en- trance into canada. ? as a result, , immigrated to bra- z i l , , to paraguay, and , to canada. prom among the quiring, op_. c i t . . pp. - . "russlanddeutsche bauern auf der wanderung", per ausland- deutsche. jahrg. , no. , deutsches ausland institut, stuttgart, , pp. - . , ^ there were only about lutherans and catholics. a further group of who did not satisfy the medical o f f i c - ers, remained in germany and were settled in the province of mecklenburg. included i n the total of the russian-german immi- grants into canada between the world wars were over , mennonites.- the number of catholics and lutherans had con- siderably decreased i n comparison to their pre-war immigra- tion. in spite of the interest and effort by the lutheran and catholic immigration societies, who have done good work i n linking up the new comers with communities of the same faith, they were unable to bring into canada more than , catholics and lutherans. ° outstanding i n devoting their ef- forts to the catholic and lutheran immigration, were father c. a. kierdorf, . m. i.., who travelled to europe twice for this purpose,** and director harms of the lutheran college i n saskatoon. alone their effort was not sufficient, for a un- i f i e d organization amongst the catholics and lutherans i n russia was missing and on the whole, however, they did not quiring, op_. c i t . , p. . "wanderungswesen", der auslanddeutsche. jahrg. , no. / , deutsches ausland institut, stuttgart, , p. . lehmann, op., c i t . , p. . "rundschau", per auslanddeutsche. jahrg. , no. , deutsches ausland institut, stuttgart, , pp. - . u t i l i z e the emigration opportunities before the u.s.s.r. re- stricted i t to n i l . most of them deceived themselves when the new economic policy (nep) was introduced i n i n re- gard to the free enterprise that was allowed. later when they realized that this was only for a transitlonary period, i t was too late. the russian restrictions of emigration co- incided with the coming of the depression i n canada when im- migration was reduced to an insignificant number. table v presents the increase and decline of immi- gration from russia. it w i l l be noted that u n t i l the canadian statistics did not make any distinction between ra- c i a l origin and country of birth. the s t a t i s t i c s of germans of r a c i a l origin would have no relation to the proper number of russian-germans since that would include germans from eastern europe and germany proper, therefore they are not pre- sented. the figures given are the total number of immigrants born i n russia, which definitely includes the germans. from these subtract the figures of the russians by r a c i a l origin, which then would leave the estimated number of immigrants of german origin. however, we must again include germans i n the figure given for russian nationality and r a c i a l origin as the germans have confused their r a c i a l origin with their national- i t y . this figure is the closest estimation which can be made from o f f i c i a l s t a t i s t i c s available. new colonies were not founded by russian-germans be- tween the wars as some of the immigrants were directed to the table v immigration from russia for the years - this table has been compiled according to canadian census figures for the years of to from the canada year books, dominion bureau of s t a t i s t i c s , king's printer and controller of stationary, ottawa, of the following years: - p. , - p. , - pp. - , - - pp. - , and - p. . immigrant arrivals immigrant arrivals of year born in russia russian racial origin . , * . . . . . , , . . , . . , , - , . , • . , . , . , established communities. only a limited number found their way to the newly opened territory of the peace river. a l - though the majority of the new comers were farmers, only a few of them became rural dwellers for i t was b r i t i s h subjects and those who had resided i n canada for five years, who were allowed to buy government lands.^ this resulted i n an ex- tensive settlement of the new comers in the c i t i e s where they became engaged i n seasonal work. iv third immigration into canada - after world war ii the third and perhaps the last immigration period of russian-germans into canada started in and has continued u n t i l the present time.. it had been mentioned already that their refuge from the warthegau during the winter of - to western germany was an individual private task. unorgan- ized, they arrived i n western germany from where their fore- fathers had emigrated to russia one hundred and f i f t y years ago. their arrival marked the end of the history of the russian-germans for they no longer form a unified group or community. dispersed, without contact with each other, they were to be found i n every corner of germany. the position of the russian-germans i n post-war ger- many can only be understood i n conjunction with the general refugee situation. the staggering number and the sudden "wanderungswesen", der auslanddeutsche. jahrg. , no. , deutsehes ausland instltut, stuttgart, , p. . influx of uprooted refugees from the eastern provinces of germany had an unsettling effect on the natives of western germany. the lack of accommodation for a l l of them constit- uted the most pressing and at the same time the most complex problem of post-war germany. the natives looked upon the im- poverished refugees as undesirable intruders, especially upon those who came from outside of germany. coupled with the at- titude of the natives was the mass unemployment, which was at its height, and made an indefinite stay i n germany for them unendurable. a return to russia, where they expected to be branded as traitors, was excluded. nevertheless the deep d i s - appointment i n germany, the uncertain future, caused some to contact the russian repatriation commission in western ger- many, which functioned u n t i l ^ . their desire to return to their former homes, which they expected, only remained a hope. repatriation i n occupied russian territory of russian-germans, who were de jure s t i l l u.s.s.r. citizens, was unquestionably carried out to the f u l l e s t extent. as the volga germans, they too were transported to siberia and central asia. being accustomed to deprivation, the remainder of the russian-germans did overcome the depressing f i r s t two years of post-war germany easier than those refugees of east- ern germany, who were used to a secure and well established existence. many were employed as farm helpers and in other employment, awaiting anxiously the contact with their r e l a - tives in america. and relatives they all,had, for at some k time or another a relative had immigrated to an overseas country. it was again the economic insecurity arid the desire for one's home that caused the universal urge to immigrate to america. an o f f i c i a l statement of the numbers of russian-ger- mans in western germany was never issued by the german auth- o r i t i e s . nor was there an organization of russian-germans that kept close s t a t i s t i c s of their numbers. there remains to mention, however, the aiding offices which were founded for the purpose of distribution of carritas gifts donated by their kinsmen abroad. of the , russian-germans repat- riated, an estimated number of , resided i n west ger- many before immigration started to canada. by most of them had established contact with their relatives i n america and had already improved their ma- t e r i a l position as they received generous gifts from abroad. an immediate emigration to overseas countries was however not yet possible. being refugees of german descent, they did not f a l l under the status of displaced persons and were thus ex- cluded from any material assistance by the united nations re- l i e f and rehabllation administration (unrra). at the foundation of the unrra, the function of which is mere material assistance to refugees, a difference of opinion occurred as to what countries and people assist- ance should be given. the viewpoint of the u.s.a. was that any assistance should he denied to people who were members of the german nation as far as they were not victims of the na- tionalist socialist regime. this decision was of importance as the succeeding organization of the international refugee organization (iro) pursued then the same policy. according to the statute of the iro, i t i n the main distinguished two groups of refugees - a) those refugees whose nations were members of the united nations and b) those refugees who were of german r a c i a l origin, who were usually members of german minority groups from eastern european countries. the l a t t e r group did not f a l l under the jurisdiction of the iro.^ it shall be noted that i n addition to material assistance the iro offered protective service as well as assistance for im- migration to overseas countries. since however, the majority of the german refugees had relatives i n canada who were most willing to defray the immigration expenses, the canadian christian council for re- settlement of refugees was founded i n - . the organiza- tion's task was to aid i n locating and processing overseas, approved immigrants who were refugees i n occupied territories of austria and germany, but who did not come within the man- date of the iro. the group concerned with, as said, were a l l german refugees from eastern european countries, who because of events could not return to their former countries. canada institut fuer besatzungsfragen, das dp - problem. verlag j. c. b. mohr (paul siebeck), tueblngen, , p. . was thus not only the f i r s t country to grant admittance to displaced persons but also the f i r s t country to bring i n ger- man refugees. the cccrr was a voluntary organization and consisted of the following membersj the catholic immigration aid society, the canadian mennonite board of colonization, the german baptist colonization and immigration society, the canadian lutheran relief, the suedeten committee, and the latvian relief fund of canada. the work of the council was handled i n exactly the same manner as for approved immigrants coming within the man- date of the irq. for this purpose a screening camp was est- ablished i n hanover. the screening in this camp was r e s t r i c - ted to german nationals. the prospective immigrant not only had. to satisfy the usual immigrant requirements but i n addi- tion had to have close relatives i n canada who were able to secure accommodation and employment for at least one year. further, the immigrant had to be an agriculturalist. thus only rural dwellers i n canada were enabled to bring their re- latives to canada. later i n an order—ln-councll was passed (as already indicated), which enabled others who had no relatives i n canada to immigrate to this country. there i s , however, a group of russian-germans i n germany who are either people in good position or unfit for immigration for reasons of health and age. the canada year book. , op_. c i t . . p. . according to the canadian census of , canada granted admission to , displaced persons between a p r i l , ^ , and march, . this number included , immi- grants who had close relatives l i v i n g i n canada and , immigrants were admitted under the general displaced person movement. the german immigrants were also included i n the canadian statistics as displaced persons. among them were , of german r a c i a l o r i g i n . ^ the number, however, seems to be too low for we receive a different composition accord- ing to table vi when attempting to compile the number of russlan-german immigrants. it must be kept i n mind when c a l - culating, that the confusion of r a c i a l origin and nationality was s t i l l apparent amongst the russian-germans. we thus have i n table vi a total of , immigrants born i n russia as compared to , immigrants of russian ra- c i a l origin. in the" total of r a c i a l origin we can with cer- tainty assume that there are a substantial number of germans included. to derive at an approximate number of russian-ger- man immigrants, we subtract the t o t a l of r a c i a l origin from the total born i n russia and allow a few thousand for others born i n russia such as the ukranians, the remainder undoubt- edly comprises the number of russian-german immigrants i n can- ada. this number would then be somewhat over , . the canada year book. dominion bureau of s t a t i s t i c s , king's printer and controller of stationary, ottawa, , p. . . as a l l the immigrants had to be farmers their place of destination was usually a rural d i s t r i c t , however they never f u l l y settled there. they lacked the means to obtain their own farm and the city offered better opportunities i n seasonal work. as a consequence the majority settled in the c i t i e s . table vi total immigration prom russia according to country op birth and racial origin table compiled from the canada year books. dominion bureau of statistics, king's printer and controller of stationary, ottawa, of the years, - pp- - , - - pp. - , and - p. . immigrant arrivals immigrant arrivals op year born in russia . russian racial origin .. . ... . . . . . . . . , . ; ... , . . . . . . . , . . . . . . . . . . . . . , . . , ..... . . . . . , . . . . . . . ... , total .. . .... . . chapter vi statistics and distribution of russian-germans in canada i statistics of russian-germans in canada the d i f f i c u l t y i n compiling the exact number of russian-germans i n ganada has been mentioned i n several cases. it shall be mentioned once more i n greater detail, for i t i s important to know why the o f f i c i a l number, calculated from the canadian census, i s far below their actual number. since the canadian census l i s t s the canadian residents according to racial origin, as such the person has to state the r a c i a l origin of the ancestors, i.e. that of the ancestral immigrant to canada. (a statement such as "canad- ian" or "american" is not acceptable for r a c i a l origin). theoretically then we should be able to compile the exact num- ber of any minority group i n canada - whether assimilated or not. in reality we receive a.different picture. only there where r a c i a l origin and country of birth and with it nation- a l i t y coincide, such as among german immigrants from germany proper, can we exactly state their s t a t i s t i c s . lehmann, op. c i t . , p. . the s t a t i s t i c s for other minority groups, such as the russian-germans, can never he f u l l y calculated. the russian-germans as well as other germans from eastern-euro- pean countries have for reasons as stated below often not distinguished r a c i a l origin and nationality. this phenomen- on occurred either unconsciously due to confusion of r a c i a l origin and nationality or intentionally due to the attitude prevalent toward the german nationals during the world wars. this fact i s manifested i n the drastic example of the mennonites from russia of whom , are l i s t e d under russian r a c i a l origin i n the census of . this occur- rence was not only prevalent amongst the mennonites but just the same amongst the catholics and lutherans, for the census of states that , persons were of russian r a c i a l or- lgin^ and , persons spoke russian as their mother tongue.** the great difference between the preceding two f i g - ures can be explained i n the following manner. it is unlike- l y that the difference of , had been f u l l y assimilated. instead we subtract from the difference the , mennonites l i s t e d under russian r a c i a l origin, allow a few thousand for assimilated russians and ukranians born in russia, the census of canada. . vol. , population, printer to the king e most excellent majesty, ottawa, , table , p p . - . ibid, table , pp. - . ibid, table , p. remainder would then undoubtedly comprise german catholics and lutherans from russia that stated nationality rather than r a c i a l origin. this argument i s actually applicable as stat- ed above to any minority group i n canada whose racial origin does not coincide with their former nationality. since the 's the canadian census l i s t s the can- adian residents under mother tongue in addition to the pre- vious l i s t i n g of r a c i a l origin, country of birth, and nation- a l i t y . canada and south africa are the only two non-european countries that l i s t their population according to such de- tailed information. due to this detail and especially the l i s t i n g of mother tongue, one should be enable to derive at a better judgement of a minority group i n canada i n respect to the number of the group as well as their extent of assim- i l a t i o n . due to the transitionary period i n the assimilation process, the r e l i a b i l i t y of the figure for mother tongue i s questionable. in a group as the russian-germans who are de- f i n i t e l y i n the process of assimilation, we find several ca- tegories from a point of view of language: . those who s t i l l speak their mother tongue fluent- ly and speak very l i t t l e english. . those who speak german and english equally well. . those who s t i l l understand but do not speak ger- man anymore. kloss, heinz, and reimann, katherine, statistlsches hand- buch der volksdeutschen in uebersee. vertrauliche schrtften- reihe uebersee, publlkatlonsstelle stuttgart-hamburg, stutt- gart, , pp. - . this fact is further complicated as german appears i n two forms - standard german and the dialectic german. so that many who do only speak a dialect do not state i t but rather state english as their mother tongue. prom the above, one can see that a person f a l l i n g i n one of the categories is of- ten confused as to what to state as their mother tongue. to derive, however, at an approximate number of russian-german lutherans and catholics i n western canada, one may best calculate this figure, from the s t a t i s t i c s on r e l i g - ious denominations. german catholics and lutherans in western canada provinces lutherans catholics manitoba . , , saskatchewan , . . . . , alberta ?, , b r i t i s h columbia........ , . . total. , ... • , one may safely apply heinz lehmann's estimated percentage, which i s that $ of the total number of germans i n western canada are russian-germans,''' to the total number of german lutherans and catholics in western canada. this then would result i n the approximate number of , russian-german lutherans and , russian-german catholics i n western census of canada. . op. c i t . , table , pp. - . lehmann, op. c i t . , p. . canada. in conclusion, neither o f f i c i a l statements nor p r l - o vate estimates such as heinz lehmann's or george wagner's, who estimated the russian-germans in canada at , , give an exact number of the russian-germans i n canada for reasons as stated above. ii distribution of the russian-germans in canada it shall be remembered that the colonists settled i n russia according to religious denomination, forming at the same time a solid block of closed settlements averaging from one thousand to five thousand people i n a colony. upon arr- i v a l of the russian-germans i n north america, this system of settlement was only maintained by the mennonites i n manitoba. but even they have abandoned this.system at present. another attempt to form regular closed settlements after the pattern of the old settlements i n russia was further tried by the black sea germans i n the dakotas, and by volga germans i n kansas. richard sallet also mentions that even the weekly markets, as they practiced i n russia, had temporarily become a custom. an attempt by lutherans and catholics to settle i n western canada according to the pattern of settlement in russia i s not known. due to the system of homesteads this wagner, georg and mai, richard, op. c i t . , p. . this includes a l l religious denominations. p a t t e r n h a d t o b e a b a n d o n e d . t h e r e w a s h o w e v e r a t e n d e n c y t o a c q u i r e a h o m e s t e a d a d j a c e n t t o a k i n s m a n . n e v e r t h e l e s s t h e d e c i s i v e m e a s u r e t o t a k e u p a h o m e s t e a d i n a f a r m d i s t r i c t w a s a g a i n d e t e r m i n e d , a s p r e v i o u s l y i n r u s s i a , b y r e l i g i o u s d e n o m i n a t i o n . i n t h i s m a n n e r s e v e r a l f a r m d i s t r i c t s w e r e f o u n d e d - a n e x a m p l e o f w h i c h i s t h e s t . . p e t e r ' s c o l o n y , a l a r g e a r e a e a s t o f s a s k a t o o n , w h i c h i s a l m o s t e x c l u s i v e l y s e t t l e d b y c a t h o l i c s . b e c a u s e r e l i g i o n p l a y e d t h e d e c i s i v e r o l e i n s e t t l e m e n t , a c l e a r - c u t p i c t u r e a s t o t h e c o u n t r y o f o r i g i n o f t h e s e t t l e r s w a s n o t m a i n t a i n e d . t h e f i r s t s e t t l e m e n t s a s s u m e d a f o r m o f t h e s o - c a l l - e d " s c a t t e r e d ' s e t t l e m e n t s , w h i c h r e s u l t e d f r o m t h e h o m e s t e a d s y s t e m . t h e h o m e s t e a d e r s u s u a l l y f o l l o w e d t h e r a i l w a y l i n e s o r w h e r e t h e t r a c k s w e r e e x p e c t e d t o b e l a i d i n t h e n e a r f u - t u r e . t h e n a m e o f t h e n e a r e s t p o s t o f f i c e o r r a i l w a y s t a t i o n w a s o r d i n a r i l y a p p l i e d t o t h e e n t i r e f a r m d i s t r i c t . w h e r e s u c h w e r e n o t p r e s e n t , t h e n a m e o f a c o l o n y i n r u s s i a , f r o m w h e r e p a r t o f t h e s e t t l e r s c a m e , w a s a d o p t e d . s e v e r a l c o l - o n i e s p o p u l a t e d b y r u s s i a n - g e r m a n s h a d u n d e r g o n e c h a n g e s o f n a m e n o t a b l y d u r i n g w o r l d w a r i . e x a m p l e s w e r e e l g i n h e l m c h a n g e d t o y o u n g , k a t h e r l n e n t a l t o k r o n a u , s c h u l t z t o p r e l a t e , a n d s p e y e r t o l e a d e r - a l l l o c a t e d i n s a s k a t c h e w a n . l i t t l e v o l g a w a s c h a n g e d t o s u n d e n c e i n a l b e r t a . o n l y l a t e r w e r e t h e n u m e r o u s p r a i r i e t o w n s f o u n d e d c l o s e t o a r a i l w a y s t a t i o n . t h e b e g i n n i n g o f s u c h a t o w n s t a r t e d w i t h t h e b u i l d i n g o f a s c h o o l a n d c h u r c h w h i c h p l a y - e d a d o m i n a n t r o l e i n t h e e a r l y s e t t l e m e n t s . a t t h e s a m e t i m e a g e n e r a l s t o r e w a s b u i l t i n t h e t o w n t h a t b e c a m e t h e s u p p l y c e n t e r o f t h e e n t i r e d i s t r i c t . t h e a c t i v i t i e s o f t h e d i s t r i c t w e r e c o n c e n t r a t e d a r o u n d t h e t o w n . t h e p o p u l a t i o n i n c r e a s e d a s f a r m e r s r e t i r e d , l e a v i n g t h e i r f a r m s t o t h e c h i l d r e n , a n d s e t t l i n g t h e m s e l v e s i n t h e t o w n , ( i n r e a d i n g t h e r e m a i n d e r o f t h i s c h a p t e r , p l e a s e c o n s u l t m a p i i i . ) a p r o v i n c e o f m a n i t o b a - l u t h e r a n s e t t l e m e n t s b e s i d e s t h e c o l o n i e s o f t h e m e n n o n i t e s w h i c h w e r e f o u n d e d b e t w e e n a n d e a s t o f t h e r e d r i v e r , t h e r e w e r e o n l y l u t h e r a n s e t t l e m e n t s f o u n d e d b y r u s s i a n - g e r m a n s i n m a n i t o b a . r u r a l c a t h o l i c s e t t l e m e n t s w e r e n e v e r f o u n d e d i n t h i s p r o v i n c e . a n i n s i g n i f i c a n t n u m b e r o f c a t h o l i c s f r o m r u s s i a s e t t l e d i n w i n n i p e g a n d b e l o n g t o t h e s t . j o s e p h ' s p a r r i s h t h e r e , w h i c h i s s e r v e d b y t h e o b l a t e f a t h e r s . l u t h - e r a n s h a v e s e t t l e d i n t h e a r e a o f b e a u s e j o u r , g r e e n b a y a n d g o l d e n b a y , w h i c h a r e e a s t o f w i n n i p e g . f u r t h e r s e t t l e m e n t s w e r e f o u n d e d n o r t h - e a s t o f w i n n i p e g i n b r o k e n h e a d , g r u e n w a l d , t h a l b e r g a n d f i s h l a k e . o t h e r l u t h e r a n s h a v e s e t t l e d e a s t o f w i n n i p e g a n d s o u t h o f t h e w i n n i p e g r i v e r i n w h i t e m o u t h , o l d - e n b u r g , a n d w i n n i p e g f a l l s . t h e s e t t l e m e n t o f t h e s e c o l o n i e s w a s s t a r t e d b y w o l h y n l a g e r m a n s i n i . l a t e r , l u t h e r a n s f r o m o t h e r a r e a s i n r u s s i a , s e t t l e d i n t h e s e c o l o n i e s t o o . l e h m a n n , o p . c i t . , p p . - . north-west of winnipeg, german lutherans have set- tled i n moose horn, neuheim and grahamdale along the railway line leading to gypsumville. the settlement began in and lasted u n t i l world war i. the settlers were again pre- dominantly from wolhynla. other wolhynla germans have set- tled in the v i c i n i t y west of the manitoba lake and have founded several german farm d i s t r i c t s . the f i r s t settlers however came from galicla in » only i n have luther- ans from russia settled in the area. close to the saskatchewan border a german farm d i s - t r i c t was founded i n hy the name of friedfeld on the railway line of dauphin. the settlers were again immigrants predominantly from wolhynla. near grandview another settle- ment was founded at the turn of the century by black sea ger- mans from the area of molotchna and by wolhynla germans. the city of winnipeg had , persons of german racial origin according to the census of , of which , s t i l l gave german as their mother tongue.^ half of the , could be classified as russian-germans. in a german society (deutsche vereinigung) was already founded for the purpose of assisting and advising the entire german lehmann, op. c i t . , pp. - . census of canada. . op. c i t . , table , p. . ibid. i m m i g r a n t p o p u l a t i o n . ^ t h e v a r i o u s r e l i g i o u s i m m i g r a t i o n a i d s o c i e t i e s h a d t h e i r h e a d q u a r t e r s i n w i n n i p e g a f t e r t h e w a r a n d s t i l l d o a t t h e p r e s e n t t i m e . b u t t h e i r f i r s t s t r o n g o r g a n i z a t i o n , a s i t w a s i n t h e r u r a l d i s t r i c t s , w a s t h e c h u r c h . i n , p a s t o r h . c . s c h m i e d e r a r r i v e d i n w i n n i p e g a n d f o u n d e d t h e f i r s t g e r m a n l u t h e r a n c o m m u n i t y i n w e s t e r n c a n a d a - t h e s t i l l - p r e s e n t " e v a n g e l ! s c h l u t h r a s c h e n d r e l e i n l g - k e i t s k i r o h e " . ^ - t h e c a t h o l i c s , t h a t a r e f e w e r i n n u m b e r s , a r e m e m b e r s o f t h e s t . j o s e p h ' s c h u r c h w h i c h w a s f o u n d e d i n - , a n d a r e a t t e n d e d b y t h e o r d e r o f t h e o b l a t e f a t h - e r s . t h e n u m b e r o f r u s s i a n - g e r m a n c a t h o l i c s i n t h e p a r r i e h h o w e v e r a r e l i m i t e d . o n t h e w h o l e t h e g e r m a n s i n w i n n i p e g h a v e t a k e n u p t h e i r r e s i d e n c e i n t h e n o r t h e n d o f t h e c i t y . b p r o v i n c e o f s a s k a t c h e w a n c a t h o l i c s e t t l e m e n t s t h e o l d e s t c a t h o l i c s e t t l e m e n t a r e a i n s a s k a t c h e w a n f o u n d e d b y r u s s i a n - ^ g e r m a n s i s l o c a t e d e a s t a n d s o u t h - e a s t o f r e g i n a . t h e a r e a i s p o p u l a t e d b y a p p r o x i m a t e l y , g e r m a n s a n d c o m p r i s e s t h e c o l o n i e s o f b a l g o n i , q u ' a p p e l l e , k r o n a u ( s t . p e t e r ' s c o m m u n i t y ) , v i b a n k , o d e s s a , k e n d a l , a n d s e d l e y . a n n u a l r e p o r t o f t h e m i n i s t r y o f a g r i c u l t u r e . . n o . , p r i n t e r t o t h e o j u e e n ' s m o s t e x c e t l e n t m a j e s t y , o t t a w a , , p . . r u c c l u s , m . , " d e u t s c h e v a n g e l l s c h e . a r b e i t i n k a n a d a " , d e r a u s l a n d d e u t s c h e . j a h r g . , n o . , d e u t s e h e s a u s l a n d i n s t l t u t , s t u t t g a r t , , p p . - . the o l d e s t settlement i s the colony of j o s e p h s t a l east of regina. the settlement s t a r t e d i n near b a l g o n l and was named a f t e r a colony i n r u s s i a , from where p a r t of the s e t t l e r s came. the colony was f i r s t mentioned i n the an- n u a l report of the m i n i s t r y of a g r i c u l t u r e i n . this colony has a p o p u l a t i o n of n i n e t y - f i v e s o u l s , w i t h the exception of one russian f a m i l y they are a l l germans and speak the german language. i n another s m a l l e r colony east of j o s e p h s t a l was found- ed near south qu'appelle. i n the annual report of the de- partment of the i n t e r i o r f o r the year we read: this colony was s t a r t e d i n and has s t e a d i l y i n c r e a s e d on account of nearness of a r a i l w a y s t a t i o n . there are probably three hundred f a m i l i e s , eighteen hundred s o u l s i n the d i s t r i c t . f i v e schools have been e s t a b l i s h e d and the d i s t r i c t i s gen- e r a l l y s u c c e s s f u l , many of them i n c r e a s i n g t h e i r holdings i n land by purchase. i n - the f i r s t s e t t l e r s a r r i v e d i n davln and kronau. the l a t t e r colony was named a f t e r a settlement i n the black sea area from where p a r t of the s e t t l e r s o r i g i - nated. i n three other c o l o n i e s were founded by catho- l i c s from the black sea, south of b a l g o n l , between the davln and kronau s t a t i o n s . the c o l o n i e s k a t h e r i n e n t a l , rastadt, annual report of the m i n i s t r y of a g r i c u l t u r e . . no. , p r i n t e r t o the queen's most e x c e l l e n t majesty, ottawa, , p. . annual report of the department of the i n t e r i o r . . p a r t i i , no. , p r i n t e r t o the klngti" most e x c e l l e n t maj- e s t y , ottawa, , p. . a n d s p e y e r r e c a l l n a m e s i n t h e b l a e k s e a a r e a f r o m w h e r e t h e s e t t l e r s c a m e . t h e y a r e c o m p r i s e d i n t o t h e s t . p e t e r ' s c o m - m u n i t y . r e v . h . m e t z g e r p r e s e n t s a d e t a i l e d a c c o u n t o f t h e s e t t l e m e n t o f t h i s a r e a i n h i s p a m p h l e t w h i c h w a s w r i t t e n i n i n h o n o r o f t h e t h a n n i v e r s a r y o f t h e f i r s t s e t t l e r s . i n t h e c o n s t r u c t i o n o f t h e n e w c h u r c h i n r a s t a d t w a s u n - d e r t a k e n , w h i c h w a s c o m p l e t e d i n . t h e f i r s t s c h o o l d i s - t r i c t w a s e s t a b l i s h e d i n r a s t a d t i n w h i c h r e s u l t e d i n t h e c o n s t r u c t i o n o f a s c h o o l i n * h o w e v e r , b y , t h e s a m e w a s t o o s m a l l a n d w a s r e p l a c e d b y a n e w s c h o o l w h i c h w a s c o n s t r u c t e d c l o s e t o t h e c h u r c h . i n t h e s a m e m a n n e r s c h o o l d i s t r i c t s w e r e e s t a b l i s h e d i n t h e o t h e r t w o c o l o n i e s a t t h e t u r n o f t h e c e n t u r y . ® s o u t h - e a s t o f t h e s t . p e t e r ' s c o m m u n i t y f a r m d i s - t r i c t o n t h e m a n y b o n e g r e e k , t h e s t . p a u l ' s c o m m u n i t y o f v i b a n k w a s f o u n d e d i n b y g e r m a n s f r o m t h e b l a c k s e a a r e a . a t t h e s a m e t i m e , h o w e v e r , c a t h o l i c s f r o m t h e b a n a t a n d g a l - l o l a h a v e s e t t l e d i n t h e a r e a . t h e i n f o r m a t i o n a b o u t t h e s e t t l e m e n t a n d d e v e l o p m e n t o f t h e v i b a n k d i s t r i c t i s o b t a i n e d f r o m a p a m p h l e t w r i t t e n f o r t h e th j u b i l e e o f t h e f o u n d a - t i o n o f t h e s t . p a u l ' s p a r r i s h . b y t h e a r e a a r o u n d v i - b a n k h a d e s t a b l i s h e d s e v e n s e h o o l d i s t r i c t s . t h e e c o n o m i c p r o g r e s s o f t h i s a r e a w a s f a v o r a b l e e s p e c i a l l y a f t e r t h e r a i l w a y s t a t i o n w a s c o m p l e t e d i n . i t i s t h e n t h a t t h e m e t z g e r , o p . , c i t . . p . * town of vibank began i t s development. several stores, which were the supply center for the entire d i s t r i c t were founded i n the following years. in the school and church were transferred from the open prairie into the newly founded town. in course of time vibank has further increased i n respect to business activities as well as construction of new homes for retired farmers. the most notable construction i n the town was that of the holy family convent of the ursa- line order i n , which houses approximately forty s i s t e r s . the sisters are extensively of russian-german descent and are engaged i n teaching. at the turn of the century the settlement area east of vibank was further expanded and resulted i n the foundation of the colonies of odessa and kendal. the l a t t e r colony was again named after the colony i n south russia. the settlers came predominantly from russia but had settled f i r s t i n the u.s.a. before they moved to canada i n . in a recent pub- l i c a t i o n by rev. f. gerein, d.d., commemorating the th an- niversary of the a r r i v a l of the f i r s t settlers and the th anniversary of the founding of the holy family parrish, we the name of the town of vibank has no bearing to the or- i g i n of i t s settlers. the name is derived from the german word "viehbank" meaning a cattle market place. as the term "viehbank" without "eh" produces i n english, as well as i n german, the same sound the two letters were dropped and re- sulted i n the present spelling of "vibank". abele, op. c i t . . p. . nave an intensive account of the settlement and history of odessa. the f i r s t settlers of the odessa d i s t r i c t arrived i n , however, the peak of settlement was reached i n and , when about sixty families had taken up homesteads i n the area. south of odessa a small catholic mission was founded under the name of blumenfeld. however owing to i t s location and size the members were assigned to the parrishes of odessa, sedley and vibank. the development of the town of odessa started only after the completion of the regina-brandon railway - as i t was with the town of vibank. in a new school d i s t r i c t was established i n the town in addition to the three dis- t r i c t s already existing in the area. the present school in odessa i s served by the ursallne sisters. the most notable event i n the town is the recent completion of the holy family church under the energetic leadership of the present pastor, rev. f. gerein, d.d. the name of the d i s t r i c t of odessa has undergone some interesting changes. until the d i s t r i c t was known as sibel plains after the f i r s t school in the area. in i t assumed the name of the newly founded post office, magna. in some circles the d i s t r i c t was also known as moser valley. finally in the present name of odessa was glv- en to the town. jm gerein, pp. c i t . , p. . ikz the above described, settlement d i s t r i c t s , east of regina, are divided into seven catholic parishes which are members of the regina archdiocese. they are a l l served by diocesan priests. in these parishes a number of lutherans from south russia have established themselves - notably in kronau, davin and vibank. north-west of langenburg, the catholic community of landshut was founded i n the 's. the settlers came pre- dominantly from south russia and bavaria. in the south of saskatchewan the colony of maryland was founded by catholics from the banat. however, they were soon joined by catholics from the south of russia. the settlers were from the colony of landau in the black sea area. a smaller colony by the name of landau was founded south of maryland. in the colony of marienthal was founded close to the american border. the settlers came from russia, the u.s. and romania. further west of marienthal, homesteads were taken up by germans, which led to the foundation of jakobsberg i n . s t i l l further west, the colony of berg- feld was founded by germans from the black sea. a larger settlement, the colony of claybank, was founded i n the south of the province i n by germans from the azov sea. ger- mans from other countries have settled in the area after the war. the settlers of german origin number about six hundred lehmann, op_. c i t . , pp. - . persons. their school i s served by ursaline sisters. north-west of reglna, the colony of holdfast was founded between and . the settlers again came pre- dominantly from the black sea area i n russia. germans from banat have also settled i n the area. the f i r s t church was constructed i n for the close to one thousand persons of the colony. late i n - a larger church was built close to the station. south-east of saskatoon, two other colonies were founded close to the railway station of allan. the settlers arrived predominantly from the u.s. and the south of russia. the farm d i s t r i c t s of allan and selz have a population of ap- proximately one thousand settlers. selz is named after a colony i n the south of russia from where the settlers o r i g i - nated. the religious service is received from the oblate fathers. the economic development i n the two farm d i s t r i c t s was extremely favorable in the f i r s t years of settlement and i t is reflected i n the construction of three churches, sever- a l schools, and two recreation h a l l s . here too, the ursaline sisters served as teachers. south of the south saskatchewan river another large settlement area called happyland was founded by black sea germans. the influx into this area, which i s partly dry belt, started i n - . part of the settlers had resided i n dobrudscha (romania) for several years without f u l l y settling there. bessarabian germans have settled near by and founded the community of krasna. further colonies were founded in this area by black sea and dobrudscha germans. these colon- ies are prelate, leader, lancer, josephtal, new london, rosen- thal, rastadt, richmond, blumenfeld, speyer and liebenthal. the area was generally not as successful as others owing to drought,and many moved to b r i t i s h columbia. spiritually the settlers are looked after by the oblate fathers. ursaline sisters teach i n the schools. at one time as many as five hundred families lived i n this area. in - , german catholics from the area of od- essa i n russia founded the colony of billimun in the dry belt of saskatchewan. this colony had an extremely d i f f i c u l t start as i t was more than f i f t y miles away from the nearest railway station. # * # • * at the turn of the century the st. peter's colony, the most solid closed german catholic community, was founded east of saskatoon. the colony comprises f i f t y townships set- tled by catholics. there are only a few lutherans scattered in the c i t i e s of the colony. the origin of this larger c o l - ony was due to the immigration and colonization policy of the catholic clergy. when the stream of settlers poured across lehmann, op_. c i t . , p. . the border to settle in canada, the benedictine fathers **" be- came aware of a new mission. their aim was to direct the catholic settlers into one farm area as a solid block of cath- olics to maintain their f a i t h . it was prior bruno doerfler, o.s.b., who set out to seek for new land for the german set- tlers in . it was the present st. peter's colony that was selected. more than , german farmers had settled i n this area and were comprised into twenty-six parishes. the name of the parish applied to the whole farm d i s t r i c t - not- ably; st. oswald, st. gregor, st. anthony, engelsfeld, st. anna, st. george, st. bernard, st. joseph, st. john, st. au- gustine, st. scholastlca, st. michael, st. leo, lady of mt. carmel, st. bruno, and st. bonlfaee. the settlement started i n by germans from the u.s., who were generally settlers of some means. later, ger- mans from russia also settled in the area. the "catholic settlement society" was founded under the presidency of mr. lange in order to promote colonization into the colony. when boniface wimmer, o.s.b., landed i n america in sept- ember of , he had only a few students and a strong w i l l to transplant the benedictine order into the new world. ten years later the abbey of st. vlnzenz i n pennsylvania was founded and became so strong that the new abbey of st. john was founded near st. cloud on the mississippi as well as the monastery at cluny, i l l i n o i s . it was the monastery at cluny, that was transplanted to the st. peter's colony in saskat- chewan, and unertook the s p i r i t u a l guidance of the colony. wagner, georg and mai, richard, op_. c i t . . pp. - . "rundschau", og. c i t . , pp. - . at the same time the german american land company was found- ed which entered into an agreement whereby a block of land amounting to f i f t y townships was reserved. other land was bought from the government and i n turn sold to the new set- t l e r s . by a l l free homesteads had been settled. after the usual drawbacks of a new settlement, pro- sperity came to the colony. as i n previous settlements, here too, the "scattered" settlement form prevailed. concentrated settlements were found only around the churches and later i n the various towns founded near the railway stations. as.. everywhere, the railway became the impulse to a l l economical progress* in this manner the city of humboldt became the ec- onomic center of the colony because of i t s function as a railway divisional point. it has a population of , persons and ranks f i f t h among the towns of saskatchewan. an imposing town h a l l , a new $ , skat- ing-rink, schools, churches, a large hospital, and a courthouse are the outstand- ; ing buildings i n the community. seventy- five business units draw trade within a ra- dius of miles. out of the seventy-five business units, eighteen are operated by germans. this proportion holds true throughout the colony. muenster, six miles east of humboldt, i s the eccles- i a s t i c a l center of the colony. the small monastery of cluny, ? dawson, op_. c i t . , pp. - . ibid, pp. - . i l l i n o i s was transplanted to muenster by the benedictine or- der and there they b u i l t a cathedral as well as a college. but, muenster never f u l f i l l e d the expectations of the order to become the commercial as well as religious center. hum- boldt, as mentioned, became the undisputed commercial center?^ the religious guidance of the entire colony was l a i d upon the benedictine order by a papal declaration. the mon- astery grew with the colony and was elevated to an abbey in . it was further elevated to an "abbatia nullius" i n and received bishopric rights. ° we have here an examp- le of a german diocese i n canada and i n the benedictine fath- ers a true example of the followers of the orders of clster- ciensium and praemonstratensls, who were outstanding i n the colonization of eastern germany i n the th and th centuries. * # * « # the colonization of another large area by german catholics was started i n . this colony, known as st. jo- seph's colony, was located east of saskatoon comprising sev- enty-seven townships, but, i t was not solid catholic as was st. peter's colony. before a l l the land was settled in st. peter's c o l - ony, mr. lange, president of the "catholic settlement society" dawson, op., c i t . . p. . lehmann, op_. c i t . , p. . had explored for land for another colony.^ this time the order of the oblate fathers became interested in this colon- ization and the "catholic colonization society" was founded for the purpose of settling the area. the f i r s t settlers ar- rived in . the largest part of the settlers came from the south of russia and from the volga area. many of them had previously settled in the u.s.a. a large settlement of germans from the states has been located in the tramping lake d i s t r i c t , it is expected their num- bers w i l l be augmented this f a l l by a thous- and families, and as they have sold their land i n the u.s. they come equipped with mo- ney, good knowledge of the modern ways of farming and are inclined to be t h r i f t y and industrious. germans from germany proper and from the banat also settled there. the russian-germans arrived predominantly i n i o - and settled i n the western part of the colony. the economic development i n this colony was not as favorable as in st. peter's. the development of trade cent- ers shows the same trend of change as i n st. peter's colony, that i s from church village to commercial railway center. but as none of the main railway lines ran through the colony, the colony has not developed a center like humboldt. the dawson, op. c i t . , p. . annual report on immigration of the department of the interior. . part ii, government printing bureau, ottawa, , p. . dawson, op. c i t . , p. . commercial centers of this colony are kerrobert, wilkie, biggar and macklin. these centers are a l l located on the bor- ders of the colony. the settlers are s p i r i t u a l l y guided by the oblate fathers and reside in the following communities; leipzig, handel, revenue, tramping lake, scott, kerrobert, salvador, denzil, grosswarder, st. peter, and macklin. the sisters of the notre dame order teach i n the highschools of leipzig, re- venue, tramping lake, and macklin. there are some lutheran communities within st. joseph's colony and are located in luseland and wilkie. since , owing to crop failure, o many settlers of the st. joseph's colony have migrated to british columbia. lutheran settlements in , the oldest russian-german lutheran s e t t l e - ment was founded in lahdshut near langenberg. lutherans from other countries also settled there simultaneously with the black sea germans. hoffnungstal was founded by germans from bessarabia and galicia. bereslna was also founded i n by bessarablan and wolhynian germans. the colonies of rurtnymede and togo were founded i n and respectively by volga germans. these colonies dawson, op., c i t . , p. . lehmann, op. c i t . , p. . are located east of yorkton and close to the manitoba border - with a settlement of close to three hundred persons. the settlers of togo had for some time resided in the u.s. and winnipeg before f i n a l l y settling i n togo. in the f i r s t germans arrived i n melville from bessarabia. by world war i this d i s t r i c t had been settled by a substantial group of german lutherans. wolhynla germans settled i n lipton i n . in wolhynla germans settled near gansen, volga germans i n prairie rose, and others in kandahar, south of q u i l l lake. the three colonies form one lutheran parish.-' in , at the same time when the catholic colonies of allan and selz were founded, the lutheran colony of eigen- heim (young) was settled by black sea germans. the luther- an colony of luseland, located i n the center of the catholic community of st. joseph's colony, began i t s settlement i n by lutherans from the u.s. as well as volga germans. north-west of the mennonite settlement of rosthern, the f i r s t settlement of silvergrove began i n by settlers who came from germany proper. however, i n i h- , the main settlement was started by black sea germans and by ger- mans from the wolhynla. lehmann, pp. c i t . , p. . ibid, p. . lutherans have settled and founded a few colonies i n the south-east part of the province. neu-norka was founded by volga germans - which fact is manifested by the colony's name. the settlers began to arrive as early as . yellow grass was founded south-east of regina by wolhynla germans. the f i r s t settlers arrived i n and immediately before world war i the greatest bulk of immigrants had arrived i n the area. the f i r s t lutherans settled i n flowing wells i n and they came from the volga area in russia. just prior to world war i about thirty families settled in the area and they too were volga germans. in - volga germans as well as wolhynla germans settled east of herbert and other volga germans settled near the railway station of morse be- tween - . fi the city of regina the germans i n the city of regina have settled pre- dominantly i n the eastern section of the town. the majority of them are catholics and are members of either st. mary's parish or the l i t t l e flower parish. those of lutheran f a i t h mostly belong to the "lutherisohen dreleingkeitsgemeinde". since , the community i s a member of the american-luther- an church. others also belong to the ngnadengemeindeh, which i s the missouri synod. according to the census of , re- gina had , germans, of whom , stated their mother lehmann, op_. c i t . , p. . tongue as german. half of the , are russian-germans. the number of germans i n the city increases as the farmers retire and settle i n the city. c the province of alberta catholic settlements from the previous section one can see that the cath- olics have settled predominantly i n the province of saskat- chewan. only very few colonies of catholics from russia were founded i n alberta. the colony of friedensthal i n the peace river d i s t r i c t was settled by germans from germany proper and by black sea germans. a number of catholic colonies were founded i n near grassy lake by black sea germans. these colonies never had a german priest and so are at present a l - most completely assimilated. the colony of rosenheim, which i s a s i s t e r colony or rather a continuation of saskatchewan's st. joseph's colony, was settled i n . there were many russian-germans amongst the settlers. the colony i s named after a colony on the vol- ga river i n russia. a number of lutherans and catholics from the black sea area settled i n the dry belt area north-east of medicine hat prior to . in this area the original catholic colony census of canada. . op. c i t . , table , pp. - . of schuler i s to be found. the colony consisted of forty f a - milies. in the early years the colony did not have a priest and so i t has in course of time been converted to the various religious sects which are predominantly found i n the area. lutheran settlements in a german colony was founded south of dunmore in the south-east of the province. the settlers moved furth- er north in - due to repeated drought. the russian- germane amongst these settlers founded a colony i n the rabbit h i l l s by name of heimthal, which was west of the railway sta- tion of nlsku. the colony of lutherort was founded by wol- hynla germans i n - north of nlsku. russian-germans settled west of wetaskiwln i n . these settlers came from the colony of alt-schwedendorf i n the south of russia.^ wolhynla germans settled south-east of wetaskiwln and founded the colony of bashaw. >in rus- sian-germans from the black sea area, previously residing i n the u.s., immigrated to the colony of preudental near drum- heller. the colony i s named after the settlement in russia. the cities of edmonton and calgary the germans i n edmonton are predominantly of the lu- theran f a i t h . religiously they belong to the missouri synod uo lehmann, op_. c i t . . p. . and the majority of them are engaged as laborers. the census of l i s t s , germans in the city of edmonton, of whom , stated their mother tongue as german. as mentioned before, volga germans settled i n calgary in in the sec- tion of bouville. they have founded the riverside community. the census of shows the german population of calgary to be , , of whom , gave their mother tongue as german. d the province of b r i t i s h columbia the germans i n british columbia are very few com- pared to the numbers of them in the prairie provinces. be- tween the world wars, many germans from the prairie provinces moved to b r i t i s h columbia due to crop failures. they settled notably i n the okanagan valley - rutland and kelowna - and are predominantly of the catholic f a i t h . further, russian- germans of lutheran f a i t h have settled i n summerland. how- ever solid settlements as i n the prairies, were never founded. direct immigration to british columbia before world war i and during the depression was very seldom the case. this has on- l y occurred since world war ii. in vancouver there are at present two lutheran communities and one catholic community which have a substantial number of russian-germans as members. census of canada. . op. c i t . , table , p. , ibid, p. . chapter vii economic, social, and cultural development the presentation of these aspects i n this chapter are not exclusively applicable to russian-germans. a d i s t i n - guishable difference i n regard to economic, social, and cult- ural development between russian-germans and other eastern european germans cannot always be effected as they were a l l at one cultural l e v e l . they had to undergo similar forces and were faced with the same barriers in the early days of settlement. the only difference that may be pointed out was their origin of country or the dialect spoken. but their common f a i t h and cultural niveau was stronger and brought a- bout a unified community already i n the early days. thus whatever i s said i s applicable also to other or rather to the entire community, unless special mention is made. i economic development the largest proportion of russian-german immigrants i n canada were farmers. this professlon was generally main- tained upon settlement for to gain land was one of the prim- ary causes for their immigration. the majority of the arriv- als were poor. the l i t t l e money they had received for their property i n russia was mostly consumed by their travelling expenses. the russian-germans, who had resided in the u.s. for sometime and migrated into the canadian prairies at the turn of the century, possessed large sums of money, i n add- i t i o n they were familiar with the north american farming me- thods. their start was thus considerably easier than of those who had come directly from russia. the land acquired at a cheap rate by the early set- tlers was i n many cases at a great distance from the railway lines. they settled there because of the f e r t i l i t y of the. s o i l and i n the hope of receiving a railway station in the near future. it was the long distance from the railway sta- tion that provided the greatest d i f f i c u l t y to the settlers. for days they were on the road to and from the railway station with their supplies which consisted of construction materials, provisions, farm implements, and household goods. their f i r s t necessary farm implements were mostly acquired through credit that was readily provided by the railway companies. an example that holds true for a l l pioneering i n the prairie provinces is the information of the russian-german, mrs. u l l r i c h , about the beginning of the settlement of young (eigenheim): with how much great hope we l e f t our old homeland and how much disappointment we had to experience.....vast unpopulated areas on- l y bushland the majority built huts made of earth, grass, and water. (a method r-- used extensively in the south of russia where lumber was not readily available.) shingles for the roof had to be obtained miles further north. a few men under- took this journey, following the marks of the surveyors as there were no roads yet.l the f i r s t yields of the farmers were often so low that the farmers had to look for additional income. this additional income was obtained either by working on another farm or by working on the railway section. to earn a l i t t l e cash money they cut and hauled hay to indian head, qu'appelle and even to regina some of the younger men hired out to farmers who had settled earlier near the main line of the c.p.r. at wages of about seventy-five cents a day. the d i f f i c u l t i e s of the earlier settlers were furth- er complicated by the climatic conditions of the prairie pro- vinces. the prairie blizzards i n the winter which often lasted for several days, were unbearable obstacles. often the l i t t l e cottage which was half built into the ground was snowed i n and had to be dug out by the neighbor. in the summer the extreme hot weather provided equal d i f f i c u l t i e s , as prairie fires were not a rare event. to overcome a l l these obstacles and make an exist- ence possible in the early days, a strong character of im- measurable endurance was demanded by the p r a i r i e . the type of people were to demand l i t t l e i n cultural nourishment. it lehmann, op_. c i t . , p. - . gereln, op_. c i t . , p. s. was thus the eastern european, or their ancestors before, who had been well versed i n colonization and therefore more read- i l y suited for the canadian prairies than the western european. the higher the cultural standard the greater were his d i f f i - culties to adopt the land as his new home. as pointed out i t was mostly the land-hungry eastern european that selected the prairie and has become successful i n the course of time. justifiably we may attribute to them their share i n exploring and cultivating the vast areas of western canada. each set- t l e r i n his own way by overcoming the obstacles as presented, f u l f i l l e d his task as a pioneer. the settlement according to their f a i t h , kinship, and the assistance they gave one anoth- er, made the beginning considerably easier - i n fact only the early community l i f e , primitive and simple as i t was, made i t possible to endure conditions. no matter how strong the desire was to return (to their former homes amongst the pioneers, the realization of this dream was seldom carried out. the great distance and the lack of means excluded the desired journey. they became reconciled with their destiny of being pioneers. after about one to two years of settlement they began with the foundation of a church around which the community l i f e was to be center- ed. simultaneously with the church, the school found i t s or- igin, which received the nature of a "church school" as the pastor acted as the only teacher. with the completion of these two institutions, the community was f u l l y established and a greater sense of security and importance prevailed am- ongst the settlers. the primitive conditions of living, however, remained unchanged for several years to come. only after five to six years of settlement were the settlers abandoning their f i r s t accommodations, i.e. the huts, and were constructing their f i r s t wooden and more elaborate homes. the dispensation of their f i r s t years was accepted for the hope of a better future. real prosperity and economic expansion i n general came with the completion of the various railway lines. we can safely say that the history of western canada i s also the history of the prairie farmers i n canada. the crop failure to which the farmers had to submit affected the whole of western canada. they were usually caused by the dry summers and early frosts and snow before the harvest was completed. crop failures were further often caused by the lack of knowledge of the farming methods of north america and the pursuance of european methods of husbandry. their efforts were f i r s t really rewarded during world war i when the prairie farmer recorded a miraculous yield. this enabled them to defray their debts and improve their farm implements as well as the expansion of their land possessions. relative prosperity was continued u n t i l . during this time the farmers began to speculate with their land - each one was to expand on credit. this phenomena found i t s end i n the collapse of the stock market i n . the period after world war i, as we have seen, marked the second immigration of russian-germans. homesteads, how- ever, were by that time ohly available i n the north of the prairies where transportation was s t i l l inadequate. it was therefore preferred to obtain land i n the older colonies mostly on credit. successive crop failures coupled with the low prices of wheat prevented these people from f u l f i l l i n g their obligations and as expected they lost their possessions. later immigrants i n the 's were never able to obtain land. they started out as farm helpers and as many farmers, they, too, joined the great influx into the cities at the height of the depression where they had to depend on r e l i e f . this per- iod also caused an extensive migration to b r i t i s h columbia where they settled in the okanagan valley and other areas. others sought a better future in the u.s. in many cases it was only with the assistance of the government and the generous help from other eastern provinces of canada that the farmers were able to remain on their farms. although the information obtained by rev. p. gerein i n his history of odessa refers only to conditions of the period i n odessa, i t may be safely applied to many other areas. .....other communities especially in ontario, shipped carloads of vegetables, f r u i t s , f i s h and numberless bundles of clothes for d i s - tribution here. fortunately, the governments and railways cooperated for transportation, for the l o c a l people could not have paid i t . . ...feed for the stock, clothes for the child- ren, food for the family, - everything had to be sought from government r e l i e f o f f i c i a l s . the coming of world war ii, that created greater em- ployment p o s s i b i l i t i e s and raised the prices of farm products, revived prosperity again i n the communities. prosperity con- tinued u n t i l when the prairies again were haunted by successive crop failures. however the extent of these f a i l - ures are by no means a p a r a l l e l to previous times. the farm- ers s t i l l consider themselves prosperous and well-to-do c i t i - zens. the early years of suffering and deprivation were well rewarded• the canadian immigration policy after world war ii directed the settlers to the rural d i s t r i c t s of western can- ada. the immigrant had to be a farmer by profession and re- main on the farm for at least one year before migrating to other places. at present, none of these immigrants have re- mained on the farm. a survey i n the v i c i n i t y of regina where many russian-germans had arrived after world war ii, has shown that they took permanent residence i n the larger c i t i e s where they are engaged predominantly i n seasonal work. their beginning i n canada was by far more favorable than that of their relatives who had immigrated before and after world war i. due to post-war expansion they were able to obtain well- paid jobs. being accustomed to a well economized household gerein, op., c i t . , p. !?• that is prevalent amongst the russian-germans, they were able to save large sums of money that would serve as a down-payment for their own home. the "newcomers that have settled in re- gina, for example, have at present, with the exception of a few single individuals, f u l l y paid for the newly acquired v houses or are close to the completion of their payments. it i s due to this great opportunity to acquire one's own home within a short period, that the newcomer often does not under- stand the hardship the early settlers had to encounter. ii religion the invariable importance of religion i n the history of the russian-germans has been referred to on previous oc- casions. as i n russia so i n canada, religion received the greatest consideration by the immigrants in selecting their place of settlement. in canada, too, the church remained the only organization of the russian-germans i n the early years. even prior to the turn of the century, the import- ance of religion was recognized by canadian immigration auth- o r i t i e s , for a l i s t of arriving immigrants classified by their religious beliefs and their destinations was furnished to ther head of any religious denomination i f the same was requested. such church o f f i c i a l s were thus enabled to notify church auth- orities i n different l o c a l i t i e s of the a r r i v a l of such k see chapter v for direct quotation, supra. immigrants. indeed not long after the a r r i v a l of a group of german immigrants, church o f f i c i a l s , usually german-speaking, became frequent v i s i t o r s . religious services were held i n primitive conditions i n the home of one of the settlers. the appointment of a permanent pastor to a farm d i s t r i c t after about one to two years of settlement resulted i n the founda- tion of a parish as well as the construction of a church building. due to the homestead system the existence of a s o l - id populated settlement was absent. as a consequence, the church was to be located i n the middle of the d i s t r i c t , i.e.' often i n the middle of the open p r a i r i e . when possible, the nearest railway station was preferred. later at the turn of the century, which marked the foundation of numerous prairie towns,- the church was moved into town. with the foundation of a parish, the establishment of a community was completed for the church choir and church school were simultaneously inaugurated. as the pastors were german, the service, the church administration and school were a l l maintained i n german. thus, the pastors became, as they did i n russia, the strongholds i n preserving the german lang- uage. the fathers of the benedictine and oblate orders were s t i l l born i n germany as were the pastors of the lutheran groups; the american lutheran church and the manitoba synod. see chapter vi for foundation of the prairie town, supra. very few of these old churches are s t i l l i n use. they were replaced by larger and more elaborate churches. consequently, both lutherans and catholics brought religion to their communities i n the german tongue. this practice pre- vailed u n t i l world war i. in communities which were not at- tended by german-speaking pastors, a more rapid assimilation was noticeable. such was the case with the settlement of grassy lake in southern alberta. a roman.catholics the s p i r i t u a l guidance and organization of the cath- o l i c germans i n the prairies was vigorously carried out by the order of the oblate and benedictine fathers, as well as the numerous diocesan priests. the diocesan priests have at present a substantial number of russian-german descendants in their ranks. other religious as well as school services were rendered notably by the ursaline sisters and the sisters of the "armen schulschwester". a unified organization of the.german catholics was maintained i n the "volksverein fuer die deutsch-canadischen katholiken", a society which was founded i n i n the st. joseph's church i n winnipeg. the "volksverein... had spread to the entire prairies and had established chapters i n a l l the larger catholic communities. the membership of the "volksverein..." had reached a number of , persons prior to world war ii. the society's original purpose was to pro- mote cultural aspects i n the community. p o l i t i c a l l y the "volksverein,,•" favored the liberal party, as the catholics traditionally and s t i l l do. in the 's, however, i t was attempted to exert p o l i t i c a l influence upon the provincial governments - notably i n respect to the maintenance of the german tongue in schools. in the * the "volksverein..." again resumed the nature of a cultural organization, which resulted i n the fam- ous annual gatherings known as "kathollkentagenw. the nature of these gatherings manifested itself i n an article of a ger- man newspaper published i n germany, the "kolinische volks- zeitung" of november th, . in i t the "volksverein...h was accused of not sufficiently emphasizing the german cause: the general "catholic days" i n regina missed the deeper emphasis on the cause of the ger- man catholics. a few points were mentioned only vaguely i n the debates. ...no real de- sire for german subjects i n schools were demanded. the meeting of the christian school trustees avoided the use of the german lang-* uage and continued their discussion primarily i n the english tongue. the "yolksverein..was also very active i n matters of immigration under the leadership of r. kierdorf, o.m.i. in , between the th and th of june, there was a gen- eral meeting of the "vblksverein..." under the presidency of f. j. hauser i n connection with the celebration of the th jubilee of the foundation of the st. peter's colony. at this meeting i t was decided that a special effort be made to assist the immigration of russian-germans to canada, due to the lehmann, op_. c i t . . p. . conditions i n russia which became continually worse. since the conditions were such as they were, no notable results of this effort were obtained. hatters of immigration were car- ried out by the catholic immigration aid society after world war ii. the coming of world war ii paralyzed the activities of the "volksverein.. .". the society was completely dissolv- ed as were many other german organizations. after world war ii, the "volksverein..." was not revived nor are there any indications that such w i l l occur i n the future. the active members and leaders of the pre-war group are scattered and the younger generation are not interested i n any segregated organization. the functions of the "volksverein..." are con- tinued i n organizations such as the holy name society, the catholic men's club, and the catholic youth organization, none of which are segregated organizations. due to the substantial number of german catholics i n the province of saskatchewan and the great number of canadian- born german priests, i t has been the constant desire of the older immigrants to see one of the german priests appointed to a higher catholic clergy position such as bishop. the re- alization of this desire was recently f u l f i l l e d when bishop klein, a descendant of a russian-german black sea family, was "rundschau", op_. c i t . . pp. - . see section on societies, i n f r a . appointed bishop of the diocese of saskatoon. the older gen- eration looked upon this event with sentiment and satisfaction, for i n this appointment they saw the recognition of their equality with the anglo-canadian group. a request for information i n regard to o f f i c i a l ger- man parishes i n the catholic dioceses of the prairie provinces has shown that there are no such parishes. the catholic church discourages national parishes (canon ) and prefers that they be t e r r i t o r i a l . however, billngualism i s s t i l l the most common practice i n parishes where the german population is i n the majority. this holds true especially i n the rural d i s t r i c t s of the p r a i r i e s . b lutherans although the lutheran church of canada found i t s or- i g i n in germany there are, at present, no ties with that country. its membership, too, is not limited only to that of german nationals but also includes a substantial number of scandinavians. we thus may no longer consider the lutheran church of canada the "german national church'' as i t is often called. the lutheran church's present relation with germany is only i n the use of the german lutheran bible. the f i r s t german lutheran community i n western can- ada was founded i n the "evangelisch-lutherische dreleinig- see section on press for catholic papers, infra. keitsklrche* in by pastor h. c. schmleder, who had a r r i - ved from germany expressly for this purpose. several other pastors followed him and i n the "evangellsch-lutherische synode" of manitoba and of other provinces was founded. later the synods of missouri and ohio, separately carried out exten- sive missionary work in western canada. among the pastors were many s t i l l born i n germany, which resulted in the pre- sentation of the service i n german* later, pastors born i n the u.s. or canada have received their training i n american seminaries and prefer the english language i n presenting their s e r v i c e . the above three mentioned synods comprise a l l the german lutherans in western canada. each of the synods has i t s own college; the, manitoba synod has a college i n saska- toon, sask.; the ohio synod has a college i n regina, sask.; and the missouri synod has a college i n edmonton, alberta. the manitoba synod also has a theological seminary a f f i l i a t e d with i t s college. the pastors of the ohio and missouri synods receive their theological training i n the seminaries in the u.s. each of the synods also has i t s own youth organization as well as a synodal church paper. examples of the paper are the "synodalboten" and the "canadisch-lutherische kirchen- b l a t t " . due to the existence of three synods, a certain ruccius, op_. c i t . , pp* - . see section on press for lutheran papers, i n f r a . rivalry amongst them is unavoidable. but, pastor m. ruccius sees no harm i n this, for in this manner even the most distant lutherans are included in lutheran worship.• the lutheran immigration aid society was very active in matters of immigration after world war i and world war i i . particularly active i n this organization, was director harms of the lutheran college in saskatoon. ** « * * * # while the earlier german pastors, both lutheran and catholic, were the preservers of the german tongue and german habits, i t i s the present younger generation of pastors that were born in canada and received their training i n the english tongue, that are the greatest link for assimilation. pacing reality, i . e . that the younger generation of german descent no longer speak the german tongue, the pastors themselves pre- fer the usage of the english tongue. chureh choirs that at one time exclusively sang i n german, have gradually adoped the english hymn. it is here that the pastor often meets with disagreement from the older german generation who were accus- tomed to the german hymn. but i t i s the insight of the pastor and his recognition of the fact that the community should ruccius. op. c i t . . pp. - . "russlanddeutsche bauern auf der wanderung", op., c i t . , jahrg. , no. , pp. - , and jahrg. , no. , pp. - . become f u l l y canadian, that makes him the undisputed leader of the community. as such, he sets the standards and directs his parlshoners toward becoming f u l l y canadian. i l l education according to the british north american act, educa- tion f e l l under the jurisdiction of the provinces. to pre- sent a complete treatment of the educational development of every province i n western canada, would lead us far from our present purpose. recorded below, are only the forces that had an immediate bearing on the germans and consequently on the russian-germans. the education of the children of the russian-gorman immigrants before the turn of the century i n the prairies was carried out by the local pastors or by other individuals with some advanced education. in the manitoba school act of , we read: where ten of the pupils speak the french language (or any language other than english) as their native language, the teaching of such pupils shall be conducted i n french (or such other lang- uage .....). this clause made the existence of the bilingual school poss- ible u n t i l when the bilingual system was abolished. many objections were raised by governmental o f f i c i a l s i n regard to sissons, c. ., bl-lingual schools in canada. j. m. dent & sons ltd., toronto, , pp. - . the lack of properly trained teachers that were able to teach under the bilingual system. the german lutherans and espec- i a l l y the mennonites made extensive use of this system as long as i t existed. the abolishment of the bilingual system dur- ing world war i caused considerable dissatisfaction particu- l a r l y amongst the mennonites as the german tongue is insepar- able from and the only spoken medium for their religion. contrary to manitoba, saskatchewan and alberta never adopted the bilingual system. the two provinces had s u f f i c - ient time to learn the defect that can be caused by the b i - lingual school system. instead the two provinces permitted separate schools by law. however, the ministry reserved the right to regulate the training and examination of the teachers of such separate institutions. text books were also author- ized by the provincial departments of education. religious instructions were confined to the last half hour of the day. a provision for private and parochial schools was also made in the two provinces. both german lutherans and catholics made use of this opportunity. from amongst the lutherans, the missouri synod was most active i n founding private country schools. in this manner, the german schools of stony plain, edmonton, and wetaskiwln were founded. these schools, too, had to submit to an annual inspection by a regular school in- spector and prove that i t s standards were equal to those of of the public schools.. as a matter of fact many german communities established private schools rather than public schools. thus they were able to teach german as much as they liked i n their schools and otherwise escape irksome regu- l a t i o n s . the foundation of private schools had its limitations i n that financially the institutions had to be supported from private sources, i.e. the parents of the pupils. at the same time, the parents were not exempt from the usual school tax. as a result of this situation, private schools were only pos- sible where there was a solid population of the same ethnic group. this was the case in the st. peter's colony i n sask- atchewan. the bilingual schools i n manitoba were gradually dissolved as were the private schools i n alberta and saskat- chewan, leaving only a few exceptions. ? the importance of education as a medium for assimi- lation of the non-anglo-canadian group was pointed out as early as world war i by several educational authorities. b i - lingual and private schools in which the mother tongue was emphasized was a direct barrier to the future assimilation of this particular group into canadian l i f e . we must begin with the community and because the non-english settler is bound by customs and habits of the old country l i f e , we must start our work with the children. sissons, op_. c i t . , p. . lehmann, op., c i t . , p. . england, op., c i t . , p. . after world war i, the public schools became the re- gular schools i n the german populated d i s t r i c t s . the original half hour of religious instruction i n the mother tongue was f i n a l l y abolished i n saskatchewan i n * the german cath- o l i c newspaper "der katholik" of , records that the sask- atchewan provincial government passed a law whereby religious instructions were to be taught only i n the english language. the occasion for the enactment of this law was apparently due to the inquiry of a german school d i s t r i c t as to whether re- ligious instructions may be presented in the german tongue. during the time of the liberal government i n saskatchewan, matters of language usage for religious presentation remained untouched as religious instruction was not considered a part of the school curriculum. the conservative government which prohibited the use of the german tongue, based i t s authority on paragraph of the school act which stated that english, with the exception of french, should be the only language of instruction. the conservative government interpreted the school act to include religious instruction as part of the school curriculum. the "volksverein..." was outraged and made a general appeal to a l l germans to combat this arbitrary in- terpretation of the law. ^ with the exception of the above mentioned case, eng- l i s h as the language of presentation in schools was peacefully "auslanddeutschtum", per auslanddeutsche. jahrg. , no. , peutsches ausland instltut, stuttgart, , pp. - . accepted i n the german d i s t r i c t s . the parents themselves re- cognized the importance of the language of their adopted coun- try and i t s usefulness i n the future of their children as can- adians, with the adoption of english, the mother tongue became neglected. german, as spoken by the russian-germane, was a dialect which had not progressed with the times. having been educated i n english, the generation born in canada no doubt recognized the limitations of their mother tongue. thus they have become reluctant to speak the same. it i s not surprising to hear so many say, "yes, i speak german but i t is what i have learned from my parents - a dialect", when asked whether they speak german. as the dialect was abandoned and english adopted, the younger generation assumed a new culture which has led to their absorption into canadian l i f e . after a tour- ing priest noted some twenty years ago that i n st. peter's colony, german culture and language were disappearing, abbot gertken of muenster, saskatchewan replied, "it is natural. it must come, what of i t . " the great possibility for higher education was by no means ignored. in a l l walks of l i f e today, we find the can- adian-born descendants of russian-german immigrants. the sta- t i s t i c s i n table vii, although limited to the d i s t r i c t of odessa, are typical for many other russian-german settlements, and do not d i f f e r from any other ethnic group in canada. dawson, op_. c i t . , p. . table vii odessa village school attendance taken from gerein, prank, history of odessa, - . west- ern printers association ltd., regina, saskatchewan, , appendix iii, p. . year viii grades ix x xi xii ... . . . * • . . . . . . . . » •»»< . . . . . . . « . . • » « • « . . - . . . . . . . •.. . • • . . . ...< ... . . . . •. .. < >. . . . . . . . . . . • . . . • ••••••• • • • • • * . . . * * >.. • • • • . . . » • . . . . . . . . . . • ••• »«••-•' * • • . . . . • . . . . . . . . . . . . . . . . ...... . . . ..» * - * . . .. ?. . . . . . . . . . . . . . > . < . . • . . i » • • * a • • • * • • . . . . . . . . . . . . . . . . » * * . . . . ( . . . . i . . . • • • • • • • • j? • • • . . . . . . . . . . ( . . . . i . . . • • • •« • • • • * • . . . . . . . . .•.•• *.' . . . . . • • • * • • • . . . . . . . . . . . . . . . . . . . . . . . *• > • • . • > * * * v # * * . . . . . . . . ... . . . . . . . » ».« •• • * *« . . . . . . . . . . . . . . . . . . . . . . . . . •. * * < • . . * . * • • o • • • < . . . . . . . ..• .. . » . . . *• • • • •« . . . graduates from odessa schools priests. * . . . deacons sisters nurses . student nurses . university degrees teachers. iv press and literary publications soon after the arrival of the f i r s t german settlers i n western canada, the news-weekly "der nordwestern" was founded i n winnipeg i n . the paper also published a yearly calendar. before the publication of the german news- paper "der courier", the "der nordwestern" was considered the leading paper i n western canada. it was subscribed to by both lutherans and catholics although i t had a lutheran flavoring. the number of i t s present subscribers is about , . in , the german news-weekly "der courier" was founded in regina, saskatchewan. for a short duration during world war i, the weekly was issued i n english. under the en- ergetic editorship of b. bott, the paper gradually assumed the leading position amongst the german papers i n western canada. a position which i t s t i l l maintains. under b. bott, the "der courier" was e d i t o r i a l l y roman catholic. this i s understand- able as bott was also editor of the catholic paper "der kath- olik" from ~to . the subscription l i s t for "der courier" both past and present i s as follows: - , j - , ; and - , . the number of subscribers has increased i n recent years due to the new influx of ger- man immigrants. as the "der nordwestern", the "der courier" i s also subscribed to by both lutherans and catholics. other religiously independent newspapers were founded before world war i; "der deutsch-canadier" in calgary, alberta and the "alberta herold" i n edmonton. due to the lack of f i - nances, the publication of the two papers was discontinued before the outbreak of world war i. the publication of the "alberta herold" was resumed after world war i, however i t was again unable to subsist and amalgamated with the "der cour- i e r " . the "college freund" was notable amongst the r e l i - gious papers and was published by the manitoba synod seminary i n saskatoon sinoe * it has been absorbed by the "synod- alboten" since . the missouri synod has published the following since the »s; the "canadisch-lutherischen kirch- enblatt", "uneere kirche", and the "der lutherlsche missionar" which was later issued as the "der lutherlsche herold". an exclusive catholic paper was the "westkanada" which was founded i n and which ceased publication with the coming of world war i. the paper was considered the or- gan of the order of the oblate fathers (omt). since then, the oblate fathers publish the "der marienbote" i n battleford, saskatchewan. its present subscribers number , . accord- ing to the estimate of the editor, bernhard von fischbach, o.m.i., there are about , russian-germans on the subscrip- tion l i s t . the "der katholik" which existed from to lehmann, op,, c i t . , p. . kloss, heinz, "materialen zur gesehichte der deutsch- kanadischen presse", per auslanddeutsohe. jahrg. , deutsehes ausland instltut, stuttgart, , pp. - . had as many as , subscribers. another notable cath- o l i c paper was the "st. petersbote" published by the order of the benedictine fathers (osb), of muenster, saskatchewan. the f i r s t paper was published february th, . the paper was f i r s t printed i n winnipeg, later i n muenster. between and the paper was issued i n english. in a p a r a l l e l to the "st. petersbote" the "st. peter messenger" appeared. later it was changed to the "prairie messenger". at pre- sent, only the "prairie messenger" is published in english. numberous other german papers started publication but were unable to exist for a long period of time as subscrip- tions were very low. the present existing german papers in canada are exclusively read by the older generation - or re- cent immigrants who are not well versed in the english tongue. although some of these papers are on a relatively high edit- o r i a l level, they are weeklies and thus bring belated news. #. # # * « almost nothing has been published i n the l i t e r a r y f i e l d by the entire russian-german lutheran and catholic group i n canada. their publications have been restricted to a few articles that have appeared in the "der courier" and the "der nordwestern". other publications have been h i s t o r i c a l sket- ches of individual colonies. the most recent and notable has kloss, op., c i t . . p. . been that of a russian-german descendant, rev. frank gerein, d.d., entitled history of odessa. the booklet contains a de- tailed description of the colony of odessa, saskatchewan which was founded by russian-germans. a. f. wanner, a black sea german, published several articles and two pamphlets entitled untergehendes volk and volk auf dem wege. both pamphlets con- tain a short historical review of russian-german colonies i n the black sea area as well as a few short stories, the settings of which are the german colonies i n russia. aus deutschen kolonlen im kutschurganer geblet i s a notable publication of johannes brendel. it contains a detailed description of l i f e i n the kutchurgan german settlement and a l i s t of the original settlers. his second work is a collection of russian-german folksongs i n the u.s.a. and canada. v. german societies in western canada the f i r s t german organization i n western canada was founded as early as . the. "deutseher vereinigung" was organized i n winnipeg for the purpose of assisting and advis- ing newly-arrived immigrants. ^ later, the "bund deutseher vereine" was organized which incorporated several small organ- izations in manitoba. at the turn of the century, the "edel- weiss" society was founded i n edmonton and later the "bund der deutschen i n alberta". at the same time, the "deutsch annual report of the ministry of agriculture. . op. c i t . , p. . kanadischer provincial verband" waa founded i n saskatchewan ^ numerous other local organizations were founded, however these predominantly represented the german elements from germany proper. the church remained the only form of organization a- mongst the russian-germans a,s i t had in russia, only after world war i, when the activities of the german societies reached their peak, did the russian-germans begin to be active i n the same. during world war i the organizations ceased their a c t i v i t i e s . after world war i, the organizations were again revived. the german periodical "der auslanddeutsche" of , reported that the "deutsch-kanadlscher national verband" was founded i n alberta. in edmonton, the canadians of german or- igin were united, irregardless of religious and p o l i t i c a l views, for the purpose of acting amongst the german elements and promoting participation in cultural and p o l i t i c a l l i f e . it also undertook to urge a l l germans who were qualified, to apply for their citizenship. it promoted the german tongue amongst the younger generation. in , the edmonton chap- ter of the "deutsch-kanadlscher...." had , members. ^ in other provinces, a revival similar to that of a l - berta took place after world war i. the "deutsch-kanadlscher lehmann, op. c i t . , p. * "auslanddeutschtum", der auslanddeutsche. jahrg. , no. , deutsehes ausland instltut, stuttgart, , p. . bund" of manitoba was founded and included several smaller or- ganizations such as the "deutsche sprachverelnigung", " t. jo- sephs verein" and the "deutseher hllfsverein". in saskatchew- an, the "deutsch-kanadlscher verband" of saskatchewan was revived i n i n addition to the "volksvereih der deutsch- kanadlschen katholiken". the province of b r i t i s h columbia a l - so participated i n the foundation of german clubs after world war i. the "alpen verein" has survived up to the present time. although there was a chapter of the nsdap i n b r i t i s h columbia, the remainder of the german organizations s t r i c t l y adhered to their cultural and recreational purposes, a unified organization of a l l the germans i n canada was never achieved. the organizations were limited to the individual provinces. the a c t i v i t i e s were climaxed in every province by a yearly f e s t i v a l which was usually held i n the capital of the province. the programs of such festivals, known as the "deutsche tage", consisted of various contests i n singing and folk-dancing i n their native dress. with the onset of world war ii, a l l german cultural activities and german organizations ceased to function. a revival of the organizations is not noticeable, although there are smaller local groups in vancouver, regina, and winnipeg. these groups are concerned purely with recreation and sports activities and consist mainly of the recently arrived german immigrants, who are the most active members. unified p o l i t i c a l influence was never exercised by the german lutherans and catholics in western canada. the number of representatives i n provincial parliaments is.very low i n proportion to the total number of germans i n western canada. the relatively low educational standard of the ger- man immigrant from eastern europe, the language d i f f i c u l t i e s and their conservative nature, have kept them away from any notable p o l i t i c a l a c t i v i t i e s . they have not even shown part- icipation i n local administration. the russian-germans have been especially reluctant i n this respect. however, i n a few cases where a solid population of russian-germans has been present, they have succeeded in sending their representative to the provincial parliament - for example, anton buck, who was m.l.a. for south qu'appelle i n saskatchewan. in general, the germans in western canada and for that matter the russian-germans have favored the liberal party federally. recent inquiries i n alberta and saskatchewan how- ever, have shown that there i s a tendency to vote for the present provincial governments. there have been several persons of influence, the most outstanding being lieut. gov. g. uhrich and several provinc- i a l representatives. these people, however, have been ger- man and not russian-german. chapter viii adjustment and assimilation in canada it w i l l be the theme i n this concluding chapter to establish to what extent the russian-german immigrants and their descendants have become adjusted to and assimilated i n the canadian way of l i f e . some twenty-five years ago, robert england stated: in the sense i n which i t i s applied by many, there is no such thing as assimilation. if i t be taken to mean sufficient similarity of mental outlook to make cooperation feasible, that i s about a l l we can do. we can never make a german an anglo-saxon any more than we can make an englishman i r i s h . as time as this statement may be, i t i s also true that i t i s not the object of canadian policy to make anglo-saxons of the immigrants. it is the object to make them and their children canadians. otherwise, who then would be called canadian? we have noted that the average russian-germans were a rural people, f u l l of enormous working i n i t i a t i v e . their spiritual l i f e was exhausted in religion. religious a c t i v i - ties were brisk. their literature consisted of the bible, calendars and hymnbooks. their periodicals and papers were england, pp. c i t . , p. . devoted to religious purposes. the church was the only form of organization; the clergy was their leader. education was on a low niveau. there were scarcely any well educated people among them, thus there was no s p i r i t u a l contact with their motherland, nor any deeper knowledge of i t s culture. yet in essence they were germans in as much as they had preserved their language and fostered a culture of their own. as such they lived i n russia and continued to do so after their ar- r i v a l i n canada. in canada, we have further witnessed that with econ- omic success the formation of a social strata had started, which manifested i t s e l f in the formation of numerous prairie towns. the influx into bigger c i t i e s of those who had accum- ulated a certain amount of wealth, and of those who had f a i l e d as farmers, was not a rare occurrence. with this influx and with the russian-german immigrants who had remained in the city after their a r r i v a l in canada, the nucleus of a russian- german city group was established. in this manner, the russian-germans came to live side by side with f u l l canadians and the influence of the latter was soon apparent. the cul- tural value of the surrounding people and their language was learned and borrowed. as expected this process of borrowing proceeded with greater rapidity i n the cities than i t did i n the scattered prairie settlements. in spite of this influence kuhn, op. c i t . , pp. - . that raised the general cultural standard of the adult russ- ian-german immigrant, he nevertheless only became adjusted to the canadian way of l i f e . he s t i l l has preserved many of his old habits and the dialect s t i l l serve him as his main lang- uage. a comparison of the newly arrived russian-german immi- grants with those of the pre-war era, reflect clearly the purely canadian outlook of the latter. it is to this l a t t e r group to whom we may apply the above quotation by robert england in respect to assimilation. but i t is the children of those, who had at one time exhausted their s p i r i t u a l energy exclusively i n religious ac- t i v i t i e s , that have turned to worldly oultural aspects. re- ligious pamphlets become replaced by p o l i t i c a l and cultural reading. whether i n the city or out in the p r a i r i e , educa- tion and culture became elevated i n the course of time. they drew rapidly from canadian culture. the attendance of higher educational institutions by descendants of russian-germans i s not a rare occurrence any longer. the standard demanded by those that have been born and educated in canada does not d i f f e r in any respect from any other canadian's. it is to these russian-german descendants that we may safely say that they have been f u l l y integrated and assimilated into the can- adian way of l i f e . a comparison of the. russian-german group i n canada to their period in russia, exhibits that already the second generation i n canada has with extreme rapidity undergone the process of assimilation. in russia, where the group resided for over one hundred years, they faced assimilation only du- ring the period of the soviet regime. the settlements i n russia were self-contained and on the whole solidly populated by their own group, thus a preservation of habits and langu- age was more favorable than i n canada. in canada, the exist- ence of scattered settlements and its greater contact with the surrounding population made a preservation of their na- tional characteristics less possible. however, the deeper forces of assimilation in canada were the lack of cultural leaders of the group and the lack of national feeling especially amongst the younger generation. their forefathers had l e f t germany for russia some one hundred years ago - this even prior to their migration into canada. very l i t t l e had been preserved that was german and that was handed down from generation to generation. a deeper know- ledge of german culture was never apparent among the genera- tion born in canada. these socially elevated russian-german descendants have even consciously, as pointed out i n the pre- vious chapter, abandoned their mother tongue, for i t was known to them only i n a dialectic form. they never f e l t as germans and they had l i t t l e i n common with germany. their participation in world war ii was done so without any senti- ments. the success of their fathers i n their newly adopted country caused an unconscious affirmation for canada amongst the younger generation. finally, this rapid and peaceful assimilation is ex- pressed i n the attitude of the russian-germans themselves. its essence i s expressed in the simple yet true and v i t a l l y important statement formulated by pfefferi in the loss of their national characteris- t i c s , they do not see an adjustment to a foreign nation, only a stripping off of old habits of the 'old world . they believe i n doing the same as the other nationals i.e. to create out of so many national groups a real new nation. they believe i n forming a new type, such as americans, canadians, aus- tralians, etc. for the sake of their child- ren's future, they became f u l l citizens in their new homeland. thus they are willing, with heaven and the new earth, to adopt the language of their new homeland, and forsake habits and customs that were once so dear. pfeffer, karl heinz, "deutsche volksgruppe und angel- saechslche buergerliche ge sells c h a f f , auslanddeutsche volks- forechung. jahrg. , bd. , ferdinand enke verlag, stuttgart, , p. . bibliography this bibliography contains only the literature which has been used in the research for this thesis. it includes books, periodicals, magazines, encyclopedias, etc. these have been l i s t e d alphabetically according to author, other- wise according to the t i t l e of the book or a r t i c l e . abele, paul, festschrift zur jaehrlgen jubllae'msfeler der gruendung der st. pauls-klrchengemelnde i n vibank. sask., june th. . western printers association ltd., regina, saskatchewan, . anderson, j.t.m., the education of the new-canadian. j.m. dent & sons ltd., london & toronto, . anger, h., die deutschen i n slblrlen. ost-europa verlag, berlln-koenigsberg, . angus, h.f., "canadian immigration: law and i t s administration american journal of international law, vol. , published by the american society of international law, washington, . annual report of the department of immigration and coloniza- tion. to . to . printer to the king's most excellent majesty, ottawa, to , to i . annual report of the department of the interior for the year . n . t . printed by s..e. dawson, printer to the queen's most excellent majesty, ottawa, . annual report of the department of the interior. . part ii no. , printer to the kingts most excellent majesty, ottawa, . annual report of the ministry of agriculture. & . no. ' and no. , printer to the queen's most excellent majesty, ottawa, & i . annual report on immigration of the department of the interior. part ii, to , to , government printing bureau, ottawa, to . a.s.s.r. der wolgadeutschen. polltlsch-oekonomlscher abriss. peutecher staatsverlag, engels, o\ atlas of canada. department of the interior, canada, * atlas of canada. department of the interior, canada, , "auslanddeutschtum", per auslanddeutsche. jahrg. , no. , deutsehes ausland instltut, stuttgart, , p. . "auslanddeutschtum", der auslanddeutsche. jahrg. , no. , deutsehes ausland instltut, stuttgart, , pp. - . "auslanddeutschtum". per auslanddeutsche. jahrg. , no. , peutsches ausland instltut, stuttgart, , pr>. - . bauer, g., geschlchte der deutschen ansledler an der- wolga selt der elnwanderung nach russland bis zur elnfuehrung der allgemeinen wehrpfllcht - . selbstverlag. saratov, . beratz, g., pie deutschen kolonlen an der unteren wolga i n lhrer entstehung und entwicklung. im ost-europa verlag, berlin, . bier, f. and schick, a., aus den leindenstagen der deutschen wolgakolonlen. pruck der l.g. wittichschen hofbuch- druckerei, parmstadt, . boelitz, otto, pas grenz und auslanddeutschtum. seine geschlchte und seine bedeutung. pruck und verlag von r. oldenbourg, muenchen und berlin, . bonwetsch, gerhard, geschlchte der deutschen kolonlen an der wolga. verlag von i. engelhorns nachf, stuttgart, . brendel, johannes, aus deutschen kolonlen im l£utschurganer geblet. ausland und helmat verlags aktlengesellschaft, stuttgart, . buettner, k., pie auswanderung aus wuerttemberg. geographlsche studien reihe a, hefft / , kohlhammer verlag, stuttgart, . the canada year book. to . pominlon bureau of sta- t l s t l c s , king's or queen's printer and controller of stationary, ottawa, to . canadian department of mines and resources, rational topo- graphic series. survey and mapping branch, ottawa, . census of canada, . vol. , population, printer to the king's most excellent majesty, ottawa, . census of canada. . vol. , population, printer to the king's most excellent majesty, ottawa, . constitution of the u.s.s.r.. american russian institution, new york, . dafoe, john w., clifford sifton i n relation to his time. the macmillan company of canada limited, toronto, . dawson, c.h., group settlement. ethnic communities i n western canada, the macmillan company of canada limited, toronto, . dawson, c.h. and younge, eva r., pioneering i n the prairie provinces: the social side of the settlement process. the macmillan company of canada limited, toronto, o. dawson, c.h. and murehie, r.w., the settlement of the peace river country, the macmillan company of canada limited, toronto, . deutsches ausland institut, per wanderweg der russlanddeutsoh- en, w. kohlhammer verlag, stuttgart, , pillingham, w.p., the immigration situation in canada. the immigration commission (u.s.a.), washington government printing office, washington, . edelman, maurice, how russia prepared. penguin books inc., new york, . england, robert, the colonization of western canada. p.s. king & son ltd., london, . england, robert, the central european immigrant in canada. the macmillan company of canada limited, toronto, . friedemann, wolfgang g., german immigration into canada, the ryerson press, toronto, . gerein, frank, history of odessa. - . western printers association ltd., regina, saskatchewan, . gibbon, john murray, canadian mosaic. the making of a north- ern nation. mcclelland and stewart ltd., toronto, . arose, e., a.s.s.r. nemoev povolzja. izdanije "nemgosizdata", pokrovsk, . handbuch des dentschtums im auslande, adressbuch der deutschen auslandschulen. dietrich reimer (ernst bohsen), berlin, i o ". hedges, james b., building the canadian west. the land and colonization policies of the canadian pacific railway. the macmillan co., new york, . herasimovich, ivan, holod na ukra.llni. vidavnitstvo "ukrajln- ske slovo", berlin, . herbermann, c.g., and pace, e., "tiraspol diocese", the catholic encyclopedia. robert appleton company, new york, . institut fuer besatzungsfragen. das dp - problem. verlag j.c.b. mohr (paul siebeck), tuebingen, . keenleyside, h.l., canadian immigration policy. publication of the university of british columbia, vancouver, . kessler, joseph aloysius, geschlchte der dloezese tyraspol. verlag von rev. george aberle, dickinson, north dakota, . klaus, alexander, unsere kolonlen. verlag odessaer zeitung, odessa, . kloss, heinz, "materlalen zur geschlchte der deutsch-kanad- ischen presse", der auslanddeutsche, jahrg. , deutsches ausland institut, stuttgart, , pp. - . kloss, heinz and reimann, katherine, statistlsches handbuch der volksdeutschen i n uebersee. vertraullche bc'hrlfteh- relhe uebersee, publlkat onsstelle stuttgart-hamburg, stuttgart, . kohn, hans, nationalism i n the soviet union. george routledge & sons ltd., london, . kolarz, walter, russia and her colonies. george philip and son limited, london, . krimm, herbert, das antlitz der vertrlebenen. verlag von j.f. steinkopf, stuttgart, . kuhn, walter, deutsche sprachlnsel-forschung, geschlchte. aufgaben. verfahren. verlag: guenther wolff, plauen . vogtl., . langhans-ratzeburg, manfred, die wolgadeutschen. ihr staats- und verwaltungsre cht in vergangenhelt and gegenwart. im ost-europa: verlag, berlin w. und koenigsberg, . lehmann, heinz, das deutschtum i n westkanada. verlag junker und duenhaupt, berlin, . lehmann, heinz, kanada, volksdeutsche ahende. heft , verlag volkhund fuerdas deutschtum im ausland, berlin, * lehmann, heinz, zur geschlchte des deutschtums in kanada, ausland und helmat verlags aktiengesellschaft, stuttgart, v v: '.' • leibbrandt, georg, die deutschen kolonlen i n cherson und beasarablen. ausland und heimat verlags, aktiengesell* •; schaft, stuttgart, . leibbrandt, georg, "the emigration of the german mennonites from russia to u.s.a. and canada,' - ", menno- nlte quarterly review, vol. , goshen college, goshen, indiana, , pp. - l . loebsack, georg, elnsam kaempft das wolgaland, r. voeigtlaeder verlag, leipzig, . luther, arthur, "deutsche dichtung i n russland", der ausland- deutsche . jahrg. , no. , deutsehes ausland instltut, stuttgart, , pp. - . matthals, frledrich, die deutschen ansledlungen in russland. verlag von hermann fries, leipzig, . mende von, gerhard, die voelker der sowjetunlon. rudolf schneider veriag "reichenaut~l "^ metzger, h., geachlchtllcher abriss ueber die st. peters- pfarrel zu kronau. western printers association ltd., regina, saskatchewan, . morton, a.s. and martin, c , history of prairie settlement - dominion lands policy. the macmlllan company of canada ltd., toronto, . "nemcev povolzja a.s.s.r. " , bol'sha. a sovetska. a enslklopedl a. vol. , moskva, o.g.j.z., r.s.f.s.r., , pp. - . neufeld, gerda, elnwanderung in kanada nach dem krlege dissertation, friedrich-wilhelms unlversltaet, berlin, . ottawa government, special report on the foreign born popu- lation. ottawa government printing bureau, ottawa, . pfeffer, karl heinz, "deutsche volksgruppe und angelsaechslche buergerliche gesellschaft", auslanddeutsche volksfors c h - ung. jahrg. , bd. , ferdinarel enke verlag, stuttgart, , pp. - . pfeffer, karl heinz, "zur erforschung des kanadischen peutsch- tums", deutsehes archly fuer landes - u. volksforschungi jahrg. , no. / , verlag von s. hirzel, leipzig, , pp. - . ponten, josef, im wolgaland, deutsche verlags-anstalt, stuttgart & berlin, stuttgart, . ponten, josef, die vaeter zogen qus, deutsche verlags-anstalt, stuttgart & berlin, .stuttgart, . quiring, walter, russlanddeutsche suchen elne helmat, die deutsche elnwanderung i n den paraguaylschen chace., verlag* heinrich schneider, karlsruhe, . quiring, walter, "die russlanddeutschen fleuchtllnge in china", der wanderweg der russlanddeutschen. deutsehes ausland instltut, stuttgart, , "op. - . "racial origins and nativity"of the canadian people", census monograph no. , reprinted from vol. of the census of , ottawa, , p. . rennikov, a., zoloto relna, nemcakh v rossli. petrograd, . ruccius, m., "peutsch-evangellsche arbeit in kanada", per auslanddeutsche. jahrg.. , no. , peutsches ausland i n s t i t u t e , stuttgart , pp. - . "rundschau", per auslanddeutsche. jahrg. , no. , deutsehes ausland instltut, stuttgart, , pp. - . "russlanddeutsche bauern.auf der wanderung", per ausland- deutsche, jahrg. , no. , pp. - , no. , pp. - , no. , pp. - , peutsches ausland in tit'ut, stuttgart, . sallet, richard, "russlanddeutavche sledlungen i n den vereinlg- ten staaten von amerlka", jahrbuch der peutsch amerlkan- lschen hlstorlschen gesellschaft von i l l i n o i s . vol. , chicago, , pp. - . schechtman, joseph b., european population transfers. - . oxford university press, new york, . schleuning, johannes, in kampf und todesnot. bernard u. graefe, berlin-charlottenburg , . schoeneich, hans, die lhr helmatland verllessen. wege und schicksale deutseher auswanderer, verlag von phillpp reclam jun., leipzig, . schuenemann, g., das lied der deutschen kolonisten in russland, verlag r. oldenbourg, huenchen, i . slssons, c.b.. bl-llngual schools in canada. j.m. dent & sons ltd., toronto, . stach,.jakob, das deutschtum in slblrlen mlttelaslen und dem fernen osten von selnen anfaengen bis in die gegenwart, kohlhammer verlag, stuttgart, . stalin j. v., " p o l i t i c a l report to the th congress of the communist party of the soviet union, july. ", vsesoluznala kommunls cheskala partia (b), new york city workers library publishers, new york, . strieker, wllhelm, die deutschen bauern in suedrussland. deutsche landbuchhandlung gmbh, berlin, , stumpp, karl, die deutschen kolonlen im schwarzmeergebiet. dem fruehen neu-(sued) russland. ausland und heimat verlags aktlengesellschaft, stuttgart, . timlin, mabel f., does canada need more people. oxford univer- sity press, toronto, . verband deutseher verelne im auslande e. v., wlr deutsche in der welt, kommissionsverlag verlagsanstalt otto stollberg, berlin, , , , , . wagner, georg, and mai, richard, deutsche ueber land und meer. verlag der buchgemeinde, bonn, . "wanderungswesen", der auslanddeutsche. jahrg. , no. , deutsches ausland institut, stuttgart, , p. . "wanderungswesen", der auslanddeutsche. jahrg. , no. / , deutsches ausland institut, stuttgart, , p. . wanner, a.f., untergehendes volk. im selbstverlag erschienen, vancouver, . wehrenalp von, erwin barth, deutsche i n uebersee. luehe & co., leipzig, . wimmer, hermann, die deutschen i n russland, verlag von b.g. teubner, leipzig, . "wolgadeutsche republik", per grosse brockhaus. f.u. brock- haus, vol. , leipzig, , p. . k woltner, m., daa wolgadeutsche blldungswesen und die ruaslsche schulnolltik. kommissionsverlag otto harrassowitz, leipzig, , "zentralkomitee der deutschen aus russland", der ausland- deutsche. jahrg. , no. , deutsches ausland institut. stuttgart, , t>p. - . a. s. s./?. of the volga germans (map i) p l a c e of orib.ntskti on • g e r m a n s e t t l e m e n t s (only main settlements me n ~tl gn£d ) saratov %mahten vrg < f \ r r i \ \a//£scnhu£:l o.r hano ""x \ n / i / colonies in the black sea area (maph) a places of orientation • mother colonies o mennonite colonies • s i s t e r colonies c s-f » " - , i mherson i s / k i x %krohsgarte.m \ (dn/spropetrovsk} \ c.xateria/os lav mqaybacsk ..vr &er rf \vr -+ncudorf i v . i . \hortitza district • massel* gnao&nfelo + . eresam, district district schlamgendorf < mnnof. cjpftlschib district [lostsroorf u t- schweoenoorf gvclpea/c scha&oi odessa "at£a -alba lerson melitopol taurien erdtansk a zoi/ / a • • » black sea evpatori, kronenta sevastopol crimea.; • neil. br una/ , "zurichtal. rosea/tal prieioewal. \lta a, £qvt« caucasus, alexanderdorf • %marl£nf£ui el/sa £thtal ^t/fllff vkatherinenfelo* ^ ahfai£fi/fel helemendorf^ file:///hort alberta saskatchewan (mapju) russ- german colonies in viest. canada a places of orientation o catholic colonies • lutheran colonies • reformed colony {edmonton \luth£fio#t he/mthal \ a wetask/inja/ % bashaw silvergrove rosenheim i \st. joseph's colon y^ saskatoon, st peter's colony w/lkiew^ revenue® [tramping lake brmn ohum o\qt omuewster v > 'quill lakes fpeudental a drummell e/f leigcnheimtmmtf** calgary manitoba / / / \ ypsumvillje \ > r\(jnn ymede )\toqo \ a h iqleaoer q prelates < v oholopast hoffnun stal* \ melville % upton% \ friedfeld gran owe w \ndshut moo&ehorn %neuh£im _ % graham dale tasnaq rimer langenburg bekesina lancer schuler o herbert % ̂ • morse regina imedicine hat lethbrjbul a grassy lake * q&algonie&osephstal) ^ go" "- peter's community >flow,a, w£li_s hronado q ovibank c^vs / w t f o ^kendal , . - j brok^nheai grupnvi/lo v fcy fj» ^nwtemolfth pish lah thal erg ^ golden elay ^ oldenbeaq beausejour «l randon iinnipeq \ ^yellow grass o&illimun \ *neu-norkk t morris marienthal bergfelbo jakoasbe_f{t$ q — omar yland olandau is te van \ file:/// ypsumvillje file:///ndshut the genetic basis of fsgs and steroid-resistant nephrosis by martin r. pollak studies of mendelian forms of focal segmental glomerulosclerosis (fsgs) and nephrotic syndrome have provided new insights into the mechanism of these diseases. congenital nephrotic syndrome and familial forms of fsgs form a spectrum of podocyte diseases of varying severity and age of onset. mutations in both nephrin gene (nphs ) alleles lead to congenital nephrosis, podocyte foot process effacement, and loss of slit-diaphragm structure. mutations in both podocin gene (nphs ) alleles lead to a wide range of human disease, from childhood- onset steroid-resistant fsgs and minimal change disease to adult-onset fsgs. dominantly inherited mutations in actn , the �-actinin- gene, can lead to a slowly progressive adult-onset form of fsgs. in addition, fsgs is observed as part of several rare multisystem inherited syndromes. here we review recent progress in understand- ing the genetic basis of fsgs in humans. © elsevier inc. all rights reserved. the role of genetic factors in the de-velopment of focal segmental glomeruloscle- rosis (fsgs) in humans has become increasingly apparent in recent years. genetic studies also have helped strengthen the notion that glomerular vis- ceral epithelial cell (or podocyte) disorders lead to a spectrum of clinical presentations, from congen- ital nephrotic syndrome (cnf), to minimal change disease (mcd), and fsgs. here we review recent progress in the understanding of the role of genetic factors in these related disorders of podocytes. mendelian disease studies of mendelian forms of disease have pro- vided (and will continue to provide) some of the most novel insights into the mechanisms of human disease. clinicians have observed familial aggre- gation of proteinuric disease for some time, though recognition of familial nephrosis has not been widespread. for over half a century, there have been scattered reports in the medical literature of familial nephrosis. four siblings with nephrotic syndrome were described in a report. pathol- ogy showed minimal change disease in some chil- dren, fsgs in others. the absence of disease in the parents suggested recessive inheritance. additional scattered reports of both single-generation and multigeneration disease have continued to appear in the case literature. - of course, familial disease need not be inherited—multiple members of a fam- ily may be exposed to the same environmental insults. however, recent studies of mendelian dis- ease have begun to clarify the clinical spectrum of the group of disorders that make up familial fsgs and familial nephrotic syndrome (table ). studies involving genetic manipulations in mice have iden- tified additional genes involved in regulating the normal podocyte phenotype and in the develop- ment of fsgs. in the past several years, novel proteins have been identified in childhood forms of nephritic syndrome using purely positional ge- netic approaches. genetics congenital nephrotic syndrome of the finnish type, or cnf, is a geographically widespread dis- ease characterized by the development of severe nephrosis in utero and autosomal-recessive inher- itance. affected neonates have on the order of to g/d proteinuria and typically die from com- plications of the nephrotic syndrome at a young age unless nephrectomy and renal transplantation are performed. without renal transplantation, mor- tality is essentially %. typical problems in- clude infection, growth retardation, prematurity, and the development of renal insufficiency. cnf presents neonatally but is present prenatally. par- ents of cnf infants (and therefore obligate het- erozygotes) have no apparent phenotype, though prenatal proteinuria is detectable in a substantial fraction of heterozygotes before birth. subsequent to mapping the cnf gene to chro- mosome q by a means of a genome-wide linkage analysis, the cnf gene nphs was cloned by positional methods. , nphs spans kb of genomic dna and contains exons. nephrin, the gene product, is a -kd protein containing a fibronectin iii–like domain, immunoglobulin c motifs, and a single transmembrane segment. nephrin localizes to the slit diaphragm in the podo- from the renal division, brigham and women’s hospital, louis pasteur ave, boston, ma. address reprint requests to martin r. pollak, md, renal divi- sion, brigham and women’s hospital, louis pasteur ave, boston, ma . e-mail: mpollak@rics.bwh.harvard.edu © elsevier inc. all rights reserved. - / / - $ . / doi: . /snep. . seminars in nephrology, vol , no (march), : pp - cyte. - nephrin appears to play a role in regu- lating signaling pathways. localization to signal- ing domains known as lipid rafts has been shown recently. , most of the congenital nephrotic syndrome in finland is caused by specific nphs mutations, fin major (the deletion of nucleotides – leading to a frameshift) and fin minor (encoding a premature termination signal at amino acid ). a growing list of disease-associated mu- tations includes missense, splicing, and truncation mutations. - some nephrin mutations have been shown to cause defective trafficking of the pro- tein. in addition to the high prevalence in fin- land, nphs mutations are frequent in mennonites from lancaster county, pennsylvania. eight per- cent of the groffdale conference mennonites carry a specific altered nphs allele. the incidence of cnf is in live births in this group. the identification of nphs has improved the antenatal diagnosis of cnf. prenatal proteinuria and elevated �-fetoprotein levels are observed in fetuses both heterozygous and homozygous for nphs defects, making �-fetoprotein levels a poor screening tool. in finland, where mutations account for % of disease, testing for these alleles can provide an inexpensive and highly sen- sitive screen. mice homozygous for targeted disruption of nephrin have neonatal nephrosis. - nephrin knockout mice initially have normal-appearing podocytes, despite abnormal appearing slit-dia- phragms, suggesting that nephrin’s primary role in the kidney is in slit diaphragm function rather than in podocyte development. recessive fsgs fuchshuber et al described a form of nephrosis characterized by recessive transmission, early on- set, resistance to steroid therapy, and rapid pro- gression to end-stage kidney failure. the majority of the affected children showed an fsgs pattern on renal biopsy examination, though some showed mcd. the gene for this recessive form of fsgs was mapped to chromosome q - and sub- sequently cloned. , nphs , the responsible gene, encodes podocin, a amino acid integral membrane protein. podocin is homologous to sto- matin family proteins and to mec- , part of the caenorhabditis elegans mechanosensing appara- tus. podocin localizes to the slit-diaphragm and has been shown to interact directly with neph- rin. , , , the relatively small number of nphs exons ( ) facilitates mutational analysis of human dna. several recent reports have helped define the spec- trum of nphs -associated disease. many of the disease-associated mutations create truncated pro- teins, suggesting that disease results from a loss of function of nphs . - most affected individuals in these reports presented with disease in early childhood. r q appears to be a common dis- ease-causing variant, and has been observed in several families without recent common ancestors. r x seems to be particularly common in arab- israeli children with steroid-resistant nephrosis. our data suggests that an r q variant, common in the general population, can cause late-onset fsgs when it occurs together with a second mu- tant (and probably more severe) allele. podocin mutations underlie disease in a sizable fraction of both familial and nonfamilial instances of child- hood-onset recessive fsgs. fuchshuber et al found nphs mutations in % of such families. other studies suggest that nphs mutations cause disease in % to % of children with sporadic steroid-resistant nephrotic syndrome. , recent reports suggests a podocin-nephrin inter- action at a protein-protein and at a genetic level. direct physical interactions between the proteins have been shown. , human data also suggest a genetic interaction. koziell et al have reported that the presence of a single nphs may modify table . identified nonsyndromic fsgs/ns genes disease locus inheritance gene protein mim number* study congenital nephrotic syndrome q . autosomal recessive nphs nephrin kestila et al steroid-resistant-ns q - autosomal recessive nphs podocin boute et al fsgs q autosomal dominant actn �-actinin- kaplan et al * mendelian inheritance in man number. martin r. pollak the course of nphs -associated congenital ne- phrosis. recessive and steroid-resistant nephrotic syndrome (ns) is genetically heterogeneous. fuchshuber et al identified one large family un- linked to the chromosome q locus in their report of locus identification. our unpublished data also suggests heterogeneity in recessive disease. ge- netic heterogeneity in human disease is not surpris- ing, given the existence of several recessive loci for ns in mice. dominant fsgs autosomal-dominant forms of fsgs typically present later and are more slowly progressive than recessive forms. - mutations in actn , encod- ing �-actinin- , cause a slowly progressive form of disease with dominant inheritance, nonnephrotic proteinuria, and renal insufficiency. the pen- etrance of actn -associated disease is high but not %: in these families, several individuals carry disease-associated mutations but have no proteinuria or renal insufficiency. actn is one of �-actinin genes. these genes encode biochemically similar, highly homologous proteins. the �-actinins form approximately -kd head-to-tail homodimers. actn is the only actinin expressed significantly in the human glomerulus. the actn mutations identified in fsgs families are all missense and increase the affinity of the encoded protein to actin filaments. �-actinin/actin affinity affects mechanical proper- ties of actin gels, suggesting that these mutations may alter the mechanical properties of the podo- cyte. this form of disease appears to be rare compared with nphs - and nphs -associated nephrosis. actn mutations appear to explain only a frac- tion of dominant fsgs. another locus on chromo- some q has been reported. most families do not show evidence of linkage to either the chro- mosome q (actn ) or this q locus. it remains unknown whether disease in most of these families is caused by inherited podocyte defects. syndromic fsgs fsgs and related podocyte disorders also are seen as part of well-defined inherited syndromes. the spectrum of disease seen with wt mutations is the best studied of these disorders. the wt transcription factor was cloned on the basis of its role in the development of wilms tumor. , frasier syndrome and denys-drash syndrome are related and overlapping syndromes caused by mu- tations in wt . - both syndromes are character- ized by glomerular disease and the development of male pseudohermaphroditism. frasier syndrome is caused by donor splice mutations in intron of wt . an fsgs pattern is seen on renal biopsy examination. frasier syndrome can present as fsgs in ,xx females in association with go- nadal malignancy. , wt mutations are not a significant cause of glomerular disease in the ab- sence of other genitourinary features. denys- drash syndrome is defined by diffuse mesangial sclerosis on renal biopsy examination, genitouri- nary tumors, and pseudohermaphroditism. a dif- ferent spectrum of mutations is seen in denys- drash syndrome, most commonly within exon of wt . , nail-patella syndrome generally is regarded as a disease of the basement membrane rather than the podocyte, though it is probably both. affected in- dividuals typically show nephropathy, as well as dysplastic nails, and absent or hypoplastic patellae. an altered glomerular basement membrane typi- cally predominates on histologic analysis, the glomerulopathy is variable and can present as ne- phrotic syndrome. defects in the lmx b tran- scription factor are responsible for disease. , lmx b helps control the transcriptional regulation of matrix proteins by the podocyte as well as the podocyte genes cd ap and nphs . - a variety of other inherited syndromes are associated with an increased frequency of fsgs. for example, char- cot-marie tooth disease and galloway-mowat syndrome are both inherited neuropathies in which nephrosis and/or fsgs are seen with increased frequency. , secondary fsgs the role of human fsgs and ns genes in ac- quired disease is a subject of ongoing investiga- tion. some studies have reported increased nephrin expression in animal models of disease, others have reported decreased expression in other mod- els. - results from human studies have not yet provided a clear picture of the nature and role of nephrin expression in acquired glomerulopa- thies. , fsgs genetic basis clinical spectrum of disease different defects in the podocyte lead to differ- ent clinical presentations. further elucidation of the molecular mechanisms of these diseases are required to fully understand these differences. disease caused by defects in nphs , nphs , and actn forms a spectrum from prenatal-onset, to childhood-onset, to adult-onset disease. in addi- tion, the disease severity caused by defects in any one of these genes is quite variable as well. it is unclear if the difference between fsgs and ns genes has to do simply with the severity of the resulting podocyte defect, or if fsgs genes perturb a different biologic pathway than ns genes. inter- estingly, one recent report observed that patients with defective nphs alleles and a third muta- tion in nphs showed a congenital fsgs pheno- type. some genes (such as nphs ) may encode proteins whose major (or sole) function is to main- tain the glomerular filtration barrier, whereas others encode proteins that function primarily to establish or maintain the normal podocyte archi- tecture (such as actn ). defects in genes that alter the filtration barrier also may alter the podo- cyte’s production of glomerular basement mem- brane matrix proteins, leading to variations in glomerulosclerosis. sporadic fsgs what causes most cases of fsgs and mcd? a significant fraction of sporadic fsgs in children is caused by nphs mutations. however, a greater fraction still remain unexplained by defects in known genes. likely, complex combinations of genetic and environmental factors contribute to the development of much of this disease. for example, it has been suggested that parvovirus infection is associated with the development of fsgs. , hu- man immunodeficiency virus infection also is as- sociated with an fsgs-like lesion. although purely speculative, it may be the case that some moderately frequent variants in podocyte proteins alter the response of these cells to an altered t-cell repertoire. implications prenatal and presymptomatic diagnosis is possi- ble for inherited diseases with known genetic bases. the practical value of such testing depends on the specifics of the disease. as noted earlier, prenatal testing for specific identification of cnf- associated nphs alleles already has been shown to be a useful clinical tool. the use of nphs testing to determine response to treatment still needs to be verified. the value of genetic testing for other forms of fsgs or ns will depend on the frequency of these forms of disease and their im- plications for response to specific treatments. at present, genetic testing for fsgs and ns genes remains primarily a research tool, rather than a clinical test. in the next several years, testing for at least some of these genes likely will evolve into useful clinical tools. as with other forms of inher- ited kidney disease, care must be taken to avoid using an affected relative as a renal transplant donor. because the familial pattern of inheritance may not always be obvious in inherited fsgs, clinicians should take particular care. as a practi- cal matter, at the present time, the best method for ensuring this is to be certain that the potential donor has absolutely no microalbuminuria in mul- tiple repeated measurements. does the human variation in the renal response to primary insults (such as diabetes, hypertension, reflux) involve common differences in genes that regulate podocyte structure and function? varia- tions in some genes may be involved in the heri- table response to podocyte injury, whereas other variations may cause altered podocyte function directly. progress in the genetic and biologic un- derstanding of inherited podocytopathies will con- tinue. ultimately, we may come to regard much of the ns/fsgs group of diseases as a collection of inherited defects in the podocyte, the immune sys- tem, and genes involved in the response to injury. references . werner m: handbuch der erbbiologie. . vernier rl, brunson j, good ra: studies on familial nephrosis. j dis child : , . die konstitutionelle bereitschaft zum nephrosesyndrome. helv paediatr acta : - , . tejani a, nicastri a, phadke k, et al: familial focal segmental glomerulosclerosis. int j pediatr nephrol : - , . conlon pj, butterly d, albers f, et al: clinical and pathologic features of familial focal segmental glomeruloscle- rosis. am j kidney dis : - , . moncrieff mw, white rh, glasgow ef, et al: the fa- milial nephrotic syndrome. ii. a clinicopathological study. clin nephrol : - , . mehls o, scharer k: familial nephrotic syndrome. monatsschr kinderheilkd : - , . faubert pf, porush jg: familial focal segmental glomer- martin r. pollak ulosclerosis: nine cases in four families and review of the literature. am j kidney dis : - , . rapola j: congenital nephrotic syndrome. pediatr neph- rol : - , . srivastava t, whiting jm, garola re, et al: podocyte proteins in galloway-mowat syndrome. pediatr nephrol : - , . mannikko m, kestila m, holmberg c, et al: fine map- ping and haplotype analysis of the locus for congenital ne- phrotic syndrome on chromosome q . . am j hum genet : - , . kestila m, lenkerri u, mannikko m, et al: positionally cloned gene for a novel glomerular protein—nephrin—is mu- tated in congenital nephrotic syndrome. mol cell : - , . lenkkeri u, mannikko m, mccready p, et al: structure of the gene for congenital nephrotic syndrome of the finnish type (nphs ) and characterization of mutations. am j hum genet : - , . holzman lb, st. john pl, kovari ia, et al: nephrin localizes to the slit pore of the glomerular epithelial cell. kidney int : - , . holthofer h, ahola h, solin ml, et al: nephrin localizes at the podocyte filtration slit area and is characteristically spliced in the human kidney. am j pathol : - , . ruotsalainen v, ljungberg p, wartiovaara j, et al: neph- rin is specifically located at the slit diaphragm of glomerular podocytes. proc natl acad sci u s a : - , . schwarz k, simons m, reiser j, et al: podocin, a raft- associated component of the glomerular slit diaphragm, inter- acts with cd ap and nephrin. j clin invest : - , . huber tb, kottgen m, schilling b, et al: interaction with podocin facilitates nephrin signaling. j biol chem : - , . simons m, schwarz k, kriz w, et al: involvement of lipid rafts in nephrin phosphorylation and organization of the glomerular slit diaphragm. am j pathol : - , . patrakka j, kestila m, wartiovaara j, et al: congenital nephrotic syndrome (nphs ): features resulting from different mutations in finnish patients [in process citation]. kidney int : - , . beltcheva o, martin p, lenkkeri u, et al: mutation spectrum in the nephrin gene (nphs ) in congenital nephrotic syndrome. hum mutat : - , . koziell a, grech v, hussain s, et al: genotype/pheno- type correlations of nphs and nphs mutations in nephrotic syndrome advocate a functional inter-relationship in glomerular filtration. hum mol genet : - , . aya k, tanaka h, seino y: novel mutation in the nephrin gene of a japanese patient with congenital nephrotic syndrome of the finnish type. kidney int : - , . liu l, done sc, khoshnoodi j, et al: defective nephrin trafficking caused by missense mutations in the nphs gene: insight into the mechanisms of congenital nephrotic syndrome. hum mol genet : - , . bolk s, puffenberger eg, hudson j, et al: elevated frequency and allelic heterogeneity of congenital nephrotic syn- drome, finnish type, in the old order mennonites. am j hum genet : - , . patrakka j, martin p, salonen r, et al: proteinuria and prenatal diagnosis of congenital nephrosis in fetal carriers of nephrin gene mutations. lancet : - , . rantanen m, palmen t, patari a, et al: nephrin trap mice lack slit diaphragms and show fibrotic glomeruli and cystic tubular lesions. j am soc nephrol : - , . putaala h, soininen r, kilpelainen p, et al: the murine nephrin gene is specifically expressed in kidney, brain and pancreas: inactivation of the gene leads to massive proteinuria and neonatal death. hum mol genet : - , . hamano y, grunkemeyer ja, sudhakar a, et al: deter- minants of vascular permeability in the kidney glomerulus. j biol chem : - , . fuchshuber a, jean g, gribouval o, et al: mapping a gene (srn ) to chromosome q -q in idiopathic nephrotic syndrome confirms a distinct entity of autosomal recessive nephrosis. hum mol genet : - , . boute n, gribouval o, roselli s, et al: nphs , encoding the glomerular protein podocin, is mutated in autosomal reces- sive steroid-resistant nephrotic syndrome. nat genet : - , . huang m, gu g, ferguson el, et al: a stomatin-like protein necessary for mechanosensation in c. elegans. nature : - , . roselli s, gribouval o, boute n, et al: podocin localizes in the kidney to the slit diaphragm area. am j pathol : - , . palmen t, lehtonen s, ora a, et al: interaction of endogenous nephrin and cd -associated protein in mouse ep- ithelial m- cell line. j am soc nephrol : - , . frishberg y, rinat c, megged o, et al: mutations in nphs encoding podocin are a prevalent cause of steroid- resistant nephrotic syndrome among israeli-arab children. j am soc nephrol : - , . fuchshuber a, gribouval o, ronner v, et al: clinical and genetic evaluation of familial steroid-responsive nephrotic syndrome in childhood. j am soc nephrol : - , . wu mc, wu jy, lee cc, et al: a novel polymorphism (c c�t) of the nphs gene identified in a taiwan chinese family. hum mutat : - , . wu mc, wu jy, lee cc, et al:. two novel polymor- phisms (c t�c and c a�g) in exon of nphs gene identified in taiwan chinese. hum mutat : , . caridi g, bertelli r, carrea a, et al: prevalence, genet- ics, and clinical features of patients carrying podocin mutations in steroid-resistant nonfamilial focal segmental glomeruloscle- rosis. j am soc nephrol : - , . karle sm, uetz b, ronner v, et al: novel mutations in nphs detected in both familial and sporadic steroid-resistant nephrotic syndrome. j am soc nephrol : - , . conlon pj, lynn k, winn mp, et al: spectrum of disease in familial focal and segmental glomerulosclerosis. kidney int : - , . mathis bj, kim sh, calabrese k, et al: a locus for inherited focal segmental glomerulosclerosis maps to chromo- some q : rapid communication. kidney int : - , . vats a, nayak a, ellis d, et al: familial nephrotic syndrome: clinical spectrum and linkage to chromosome q . kidney int : - , . kaplan jm, kim sh, north kn, et al: mutations in fsgs genetic basis actn , encoding �-actinin- , cause familial focal segmental glomerulosclerosis. nat genet : - , . wachsstock dh, schwartz wh, pollard td: affinity of �-actinin for actin determines the structure and mechanical properties of actin filament gels. biophys j : - , . winn mp, conlon pj, lynn kl, et al: linkage of a gene causing familial focal segmental glomerulosclerosis to chromo- some and further evidence of genetic heterogeneity. genom- ics : - , . haber da, buckler aj, glaser t, et al: an internal deletion within an p zinc finger gene contributes to the development of wilms’ tumor. cell : - , . gessler m, poustka a, cavenee w, et al: homozygous deletion in wilms tumours of a zinc-finger gene identified by chromosome jumping. nature : - , . pelletier j, bruening w, kashtan ce, et al: germline mutations in the wilms’ tumor suppressor gene are associated with abnormal urogenital development in denys-drash syn- drome. cell : - , . mctaggart sj, algar e, chow cw, et al: clinical spec- trum of denys-drash and frasier syndrome. pediatr nephrol : - , . barbaux s, niaudet p, gubler mc, et al: donor splice- site mutations in wt are responsible for frasier syndrome. nat genet : - , . klamt b, koziell a, poulat f, et al: frasier syndrome is caused by defective alternative splicing of wt leading to an altered ratio of wt � kts splice isoforms. hum mol genet : - , . demmer l, primack w, loik v, et al: frasier syndrome: a cause of focal segmental glomerulosclerosis in a ,xx female. j am soc nephrol : - , . denamur e, bocquet n, mougenot b, et al: mother-to- child transmitted wt splice-site mutation is responsible for distinct glomerular diseases. j am soc nephrol : - , . denamur e, bocquet n, baudouin v, et al: wt splice- site mutations are rarely associated with primary steroid-resis- tant focal and segmental glomerulosclerosis. kidney int : - , . schumacher v, scharer k, wuhl e, et al: spectrum of early onset nephrotic syndrome associated with wt missense mutations. kidney int : - , . simila s, vesa l, wasz-hockert o: hereditary onycho- osteodysplasia (the nail-patella syndrome) with nephrosis-like renal disease in a newborn boy. pediatrics : - , . dreyer sd, zhou g, baldini a, et al: mutations in lmx b cause abnormal skeletal patterning and renal dysplasia in nail patella syndrome. nat genet : - , . chen h, lun y, ovchinnikov d, et al: limb and kidney defects in lmx b mutant mice suggest an involvement of lmx b in human nail patella syndrome. nat genet : - , . morello r, zhou g, dreyer sd, et al: regulation of glomerular basement membrane collagen expression by lmx b contributes to renal disease in nail patella syndrome. nat genet : - , . morello r, lee b: insight into podocyte differentiation from the study of human genetic disease: nail-patella syndrome and transcriptional regulation in podocytes. pediatr res : - , . miner jh, morello r, andrews kl, et al: transcriptional induction of slit diaphragm genes by lmx b is required in podocyte differentiation. j clin invest : - , . rohr c, prestel j, heidet l, et al: the lim-homeodo- main transcription factor lmx b plays a crucial role in podo- cytes. j clin invest : - , . chance pf, fishbeck kj: molecular genetics of charcot- marie-tooth disease and related neuropathies. hum mol genet : - , . cohen ah, turner mc: kidney in galloway-mowat syndrome: clinical spectrum with description of pathology. kidney int : - , . luimula p, ahola h, wang sx, et al: nephrin in exper- imental glomerular disease. kidney int : - , . luimula p, sandstrom n, novikov d, et al: podocyte- associated molecules in puromycin aminonucleoside nephrosis of the rat. lab invest : - , . yuan h, takeuchi e, taylor ga, et al: nephrin disso- ciates from actin, and its expression is reduced in early exper- imental membranous nephropathy. j am soc nephrol : - , . bonnet f, tikellis c, kawachi h, et al: nephrin expres- sion in the post-natal developing kidney in normotensive and hypertensive rats. clin exp hypertens : - , . bonnet f, cooper me, kawachi h, et al: irbesartan normalises the deficiency in glomerular nephrin expression in a model of diabetes and hypertension. diabetologia : - , . patrakka j, ruotsalainen v, ketola i, et al: expression of nephrin in pediatric kidney diseases. j am soc nephrol : - , . doublier s, ruotsalainen v, salvidio g, et al: nephrin redistribution on podocytes is a potential mechanism for pro- teinuria in patients with primary acquired nephrotic syndrome. am j pathol : - , . tanawattanacharoen s, falk rj, jennette jc, et al: par- vovirus b dna in kidney tissue of patients with focal seg- mental glomerulosclerosis. am j kidney dis : - , . moudgil a, nast cc, bagga a, et al: association of parvovirus b infection with idiopathic collapsing glomeru- lopathy. kidney int : - , . klotman pe: hiv-associated nephropathy. kidney int : - , martin r. pollak wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ untitled review article copyright © the canadian journal of neurological sciences inc. this is an open access article, distributed under the terms of the creative commons attribution licence (http://creativecommons.org/licenses/by/ . /), which permits unrestricted re-use, distribution, and reproduction in any medium, provided the original work is properly cited. saskatchewan movement disorders program ali h. rajput, alex rajput abstract: we review the saskatchewan movement disorders program, which started in and has had the dual goals of patient care and research. the clinics are structured to collect research-worthy data including videos, longitudinal follow-up, and autopsy studies of patients seen in the clinics. at every clinic visit, the patient is evaluated by one or both authors. a total of % to % of the deceased come to autopsy. frozen half-brain and formalin-fixed remnants from autopsy are preserved in our laboratories. patients not seen in our clinic are not included in research, which makes it different from brain banks. so far, cases have come to autopsy. so far, there have been collaborating scientific teams from canada, the united states, europe, and japan. the collaborators are not charged for access to our resources. this program offers a unique opportunity to study multiple aspects of movement disorder patients seen in clinical practice. rÉsumÉ: movement disorders program de la saskatchewan. nous avons revu le movement disorders program de la saskatchewan établi en . son but est double, soit les soins aux patients et la recherche. les cliniques sont structurées de telle sorte que des données de qualité soient générées à des fins de recherche, incluant des vidéos, sur le suivi à long terme et l’autopsie de patients suivis à la clinique. À chaque visite à la clinique, le patient est évalué par l’un des auteurs ou par les deux. une autopsie est effectuée chez % à % des patients qui décèdent. des demi-cerveaux congelés provenant d’autopsies et des tissus conservés dans la formaline sont également conservés dans nos laboratoires. les patients qui ne sont pas suivis à notre clinique ne sont pas inclus dans notre recherche, contrairement aux banques de cerveaux. À ce jour, autopsies ont été réalisées et équipes de recherche du canada, des États-unis, d’europe et du japon ont collaboré avec nous. aucun frais n’est exigé des collaborateurs pour avoir accés à nos ressources. ce programme offre une opportunité unique d’étudier les multiples aspects des troubles du mouvement rencontrés en pratique clinique. keywords: brain function, essential tremor, movement disorders, neuropathology, parkinson disease doi: . /cjn. . can j neurol sci. ; : - introduction and history ali rajput joined the neurology faculty at the university of saskatchewan in july and alex rajput joined in . for the first years of this history, the term “i” means ali rajput and the subsequent term “we” means both neurologists. i came to the university of saskatchewan in july on a one-year contract. in late september, i informed the department head that i was looking for a position elsewhere after my contract expired. he asked me to wait for two weeks before making the final decision as he was going to the united states and wanted to talk to me on his return. while there, he died suddenly. a new department head was appointed, and i went to inform him about my decision. the department head was highly distressed because there were not many neurologists in canada at that time. during that meeting, i made a commitment to stay one more year in saskatoon. during that year ( ), i met my future wife. soon after we were married, our family circumstances changed and the decision to move was postponed. movement disorders were of clinical interest to me during my neurology training. like most chronic neurological diseases, treatment options for parkinson disease (pd) were very limited. major breakthrough in , ehringer and hornykiewicz reported marked striatal dopamine loss in parkinsonism. one year later, birkmayer and hornykiewicz reported pd patients who improved in a dose- dependent fashion on intravenous levodopa (ld). those two articles were published in german and the intravenous use of the drug had limitations for ongoing treatment of pd. a brief report of oral ld producing improvement in pd was presented by dr. andré barbeau at the international congress of neurology in rome in , but received little attention. in , cotzias et al reported dramatic improvement of pd motor symptoms on a large dose of oral d-l dopa. most cases received g or more—up to g/day. soon ld became available to some experts, but it was expensive. there were many seriously disabled parkinsonian presented as donald calne lecture for parkinson society canada, montreal may , . from the saskatchewan movement disorders program, neurology division, university of saskatchewan and saskatoon health region. correspondence to: ali rajput, university of saskatchewan, royal university hospital, div of neurology, hospital dr., saskatoon, saskatchewan, canada s n w . email: ali.rajput@saskatoonhealthregion.ca received october , . final revisions submitted december , . https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at mailto:ali.rajput@saskatoonhealthregion.ca https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core patients in every community who needed urgent treatment. there was no dose-finding study of ld, and the neurologists used the dose that they felt comfortable with. impetus for the university of saskatchewan movement disorders program in early , dr. a. barbeau visited the university of saskatchewan and presented his own observations and the work of cotzias’s group. he informed us that he was organizing a multi- center ld drug trial in canada, but that saskatoon was not included. at that time, the university of saskatchewan had three full-time neurologists—the third largest number of academic neu- rologists at a canadian university. i asked my senior colleagues why we were not considered for the ld trial. i felt that our patients deserved the best available treatment as much as anyone else in canada; they suggested that i consider providing that treatment. start of special clinics and research in , ld was not approved for general use by canadian physicians; therefore, i needed approval from health canada to use the drug. health canada asked for evidence that i would also be pursuing research. i produced a research protocol and the permission to use ld was granted. the requirement by health canada made it necessary for my special clinics and research be carried out simultaneously. the clinics were started in saskatoon in , and because of patient requests we started similar monthly clinics in regina in . initially i had to import ld powder from the united states. the royal university hospital pharmacy prepared -mg ld cap- sules (without charge) and the medication was sold to patients at cost. several north american neurologists were already using the drug and i was in the second wave of specialists to use ld. in the early years, we admitted patients to the hospital to start ld treatment. during hospitalization, other staff—nurses, occupa- tional therapists, physiotherapists, psychologists, and physicians- in-training—became interested in the new treatment and helped perform detailed patient evaluations. our movement disorders clinics in the s and early s included pd cases because many of those patients needed urgent treatment; however, soon i started seeing patients with other movement disorders. it was anecdotally known that essential tre- mor (et) patients improved on alcohol but it had never been studied systematically; the effect of alcohol on action tremor in other disorders was also unknown. with the help of occupational therapists, i conducted a clinical pharmacology study. we observed that a small quantity of oral alcohol improved action tremor in the majority of et cases as well as in other disorders. , basic scientists and clinician scientist teams the three essential ingredients to pursue research are: ( ) appropriate topics to study; ( ) material (resources); and ( ) proper methods. basic scientists are trained in highly specialized methodology that they use to answer scientific questions. clin- icians have many questions like: what is it? what caused it? how does it evolve? what is the best treatment? these different ques- tions require different methods to provide answers. teams con- sisting of clinicians and basic scientists are therefore an ideal combination for research. my research was based on many questions requiring special tools to provide answers; thus, i nee- ded expert collaborators using specific methodology but had to provide them with adequate material. with time, many questions were also raised by the collaborators, which in turn needed our resource to answer. start of low-dose ld therapy ld had created much publicity and optimism in physicians, patients, and families. before the start of the movement disorder clinic saskatchewan (mdcs), some saskatchewan patients had travelled to other provinces and the united states for treatment with ld. expenses of the physician and hospital services outside the province were the responsibility of patients, unless they sought prior written approval from the provincial government. when patients that had their ld treatment initiated outside canada reapplied for an out-of-province return visit, the government directed them to my clinic. thus i saw patients who were already receiving ld. based on observations in those cases and my own early experience, i recognized that the large doses of ld used by most neurologists at the time produced early and sometimes dis- abling dyskinesias. i pondered the benefit and adverse effects profile and concluded that in some pd cases, the quality of life on ld was not much better than the untreated disease. my observa- tion on dyskinesias was confirmed by others at a symposium organized by barbeau in val david, quebec, in . therefore, on my own, i decided to use a lower dose of ld (up to g, the equivalent mg levodopa/carbidopa). we hospitalized the patients for slow titration and monitored the side effects. our patients had slower improvement, but at the end of several months they were doing as well as those on the higher ld dose and had fewer side effects. one adverse effect of ld was postural hypo- tension, which was the topic of an early clinical pathological study. low-dose ld has remained standard practice at the mdcs. in , we published a -year experience. dyskinesia and motor response fluctuations were between % and % compared with those reported on higher ld dose. we also found that dementia was not related to the duration of ld therapy (figure ). at every mdcs patient visit, we used the newly described webster motor symptom measurement scale and global dis- ability scale described by hoehn and yahr. when the unified parkinson’s disease rating scale became available in , we started using that. the differences between the older. , and new scales were small and we could successfully convert old data to the new scale for publications. what should i study and how do i do that? in the late s and early s, two main topics of pd research were: ( ) clinical observations on ld therapy and ( ) biochemical studies of pd brains. i was just getting started when, in , one new york group reported patients treated with ld. naturally, their data would be more credible than the obser- vations i could report on a much smaller number of patients. dr. hornykiewicz pioneered the biochemistry in pd brains, which proved vital for future developments, but many more questions needed to be answered. we had neither the brain material nor the expertise for such studies. i had to also consider the local realities. there was a major mismatch between my research interest and the institutional le journal canadien des sciences neurologiques volume , no. – march https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core situations. there were no funds for clinician-driven research, no manpower dedicated to support research, no special equipment for such studies, and no culture of clinician-driven research at the university of saskatchewan. we had no natural advantage to study movement disorders, based on population ethnicity or the occupa- tion in the province. my job involved full-time teaching and clinical service with no protected time for research. because i was unknown and from an unknown institution, i had to produce high-quality work that my peers would consider worthy of publication. i realized that my research needed to progress beyond the clinical observations on the patients and had to settle on topics that were important but were not attractive to larger and faster research teams. i recognized that some such studies could be pursued in saskatchewan. to do that, i needed the support of other experts; however, i had nothing special to offer to attract well-known collaborators. the research topics that i could tackle also required a long time to study. because research was my choice, i had to find my own way to pursue it. there was also a lingering doubt in my mind whether pd research was a good academic career option. in , poskanzer and shwab. had reported that most pd cases were consequent to the von economo encephalitis epidemic of - s and pos- tulated that when the population exposed to that epidemic passed away, pd would come to a natural end. it was published by a reputable group from a highly prestigious institution (harvard), so we had to pay attention. taking advantage of the local situation and building alliances my first major support came from my future wife, karla. before we got married, i told her that my salary was only $ , per year (the lowest for neurologists in canada), but i could earn three times that amount in private practice. she asked me, “do you like what you do?” i said yes. she responded, “do not worry; we will make do”. she has done that for more than years. although she has been my longest and unwavering supporter—she worked in my laboratory as a volunteer for three years and as an employee for the next years—her name does not appear on our papers. the low salary was a mixed blessing because there was no pressure to generate large clinical billing income. the fees were (and still are) based on seeing a new or a return-visit patient and are significantly lower for a return visit. in my case, the fee structure did not matter and i decided to follow patients at inter- vals of my choice and spend as much time as i needed to perform clinical assessments that could be used for future research. when i could afford it, my first investment was a super movie camera. anyone who could look through the lens and press the button took the video and every patient who consented had a movie made. many patients had movies made before and on ld treatment. soon after that, i purchased a super movie projector. as the news of ld treatment for pd spread, invitations for lectures started to come and i never turned down an opportunity. the local media were very generous and showed the movies as part of public service. after a lecture to nurses’ alumni of the saskatoon city hospital, a lady said she wanted to work with me. i thanked her and told her that i had no money to pay her, to which she responded, “did i ask you for money?” she was my first research assistant and her two sons, who were land surveyors, helped us free of charge to do a major study on the environmental cause of pd. following a lecture to the kinsmen’s club of sas- katoon in , i joined them for lunch. after the lunch, their executive members asked if they could borrow my film. they wanted to show the film to other provincial chapters to establish a foundation for the handicapped. the privacy regulations were not stringent at that time and without much thought i agreed to loan figure : adapted from rajput et al, neurology . the canadian journal of neurological sciences https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core them the film. they established a highly successful annual charity event called telemiracle saskatchewan. the first telemiracle was organized in with me and a dopa-responsive dystonia patient, whose film was used to motivate formation of the foun- dation, as special guests. (my children, aged six and four, got their own thrills from meeting the sesame street actor, bob mcgrath, and even had their picture in the local newspaper.) early collaborating scientists my first effort to enlist scientific collaboration was to ask dr. bohdan rozdilsky, the neuropathologist at the royal university hospital, to perform autopsies on my patients. he was trained by dr. olszewski (of steele-richardson-olszewski fame), who was on our faculty in the s. dr. rozdilsky was a thorough neu- ropathologist and a very nice man; together, we produced some articles. the first few autopsies were done on patients who had died in the hospital. later, we decided to perform an autopsy on every patient if the family consented. that was a major undertaking in a large province of more than , square kilometers ( , square miles) but only one million population. we devised a plan such that patients/families would experience the least hardship. patients interested in autopsy study for research would sign the declaration of desire for autopsy study form (figure ). a copy of the form was provided to each family member and to the family physician. the patients also signed a more detailed consent approved by the university of saskatchewan bio-ethics board allowing storage and use of brains for research. the final decision for autopsy was always made by the next-of-kin after death of the patient. using local pathologists to perform brain autopsy was not suitable and frequently there was no local pathologist; therefore, it was decided to transport the body to saskatoon for autopsy to ensure uniformity of the autopsy procedure. we concluded early on that for most of the movement disorders, one-half of the brain was sufficient for pathological studies and the other half could be frozen for future research. the autopsy had to be done within hours of death to prevent major biochemical changes. the need for autopsy could arise at any time; therefore, i had to be available around the clock to arrange that. initially, it took me a figure : this form is provided to patients to decide on autopsy for research. a copy is provided to each family member and the family physician. le journal canadien des sciences neurologiques volume , no. – march https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core long time to get an autopsy organized, but the procedure has been streamlined—a typical autopsy now takes between to hours of neurologist’s time (though at times up to hours). outside collaborators we are a small institution and there was limited neurosciences expertise to study human brains. in , dr. o. hornykiewicz had moved to clarke institute in toronto, and by the mid- s we established collaboration with his team. dr. s. kish was his postdoctoral fellow and later a faculty member. we collected frozen half-brains in our freezer locally; when there was a suffi- cient number of specimens, they were shipped to toronto. i was also collecting cerebrospinal fluid and urine samples from pd patients untreated and on ld treatment. in , my freezer was accidentally unplugged, resulting in the loss of more than cerebrospinal fluid samples, several dozen urine samples, and about ten frozen half-brains—irreplaceable specimens. i was already a tenured full professor and research was not part of my job requirement. devastated by the loss, i opted to discontinue this research. after three to six months of soul searching, i decided to give it one more try. we made arrangements to have our freezers connected to the emergency power of the royal university hospital and to the hospital security alarm system. with the new arrangement, i had to be available / for any freezer mishap. there were several occasions when i had to come to the hospital at night or over the weekend to relocate frozen brains. after that, we started to keep all frozen half-brains in saskatoon and sent brain samples to toronto for specific research projects only. by the mid- s, we had a sufficient number of frozen brains in saskatoon to pursue several large studies. by then, dr. hornykiewicz had returned to vienna. in , while attending a meeting in vienna, i asked dr. hornykiewicz to recommend someone who could help us process the frozen brains for research. he said, “would you like me to come to saskatoon and do it for you?” before i could say yes, he said, “i know you do not have money; you do not have to pay me.” that was far more generous than i had expected. soon he was appointed distinguished professor of brain disorders research at the university of sas- katchewan with no salary or stipend. he came to saskatoon once or twice a year for approximately a week at a time. he dissected the frozen brains and guided us in research. he could dissect brains for only three days per visit and approximately three new brains each day. together with dr. hornykiewicz and his toronto and new vienna team, we have published more than high- impact articles. our first collaborative study was published in . dr. c. pifl of the vienna team is our new collaborator and together we have recently published a groundbreaking paper on the pathogenesis of pd. dr. alex rajput joined the college of medicine faculty in . the next time dr. hornykiewicz came to saskatoon, he spent the entire visit providing hands-on training to alex. all the frozen brain dissections are now performed by dr. alex rajput. with that development, our options to collaborate increased substantially. sabbatical leave the cohort hypothesis (of pd and its relation to von econ- omo encephalitis infection) was stuck in my mind. when i could not convince anyone else to study that, i took a one-year sabba- tical leave ( - ) to study the epidemiology of pd in rochester, mn. they had previously reported two incidence studies from to . if the cohort hypothesis were correct, it was expected that the incidence of pd would start to decline by the late s. using the same methodology as in the previous studies, i decided to study the incidence of pd in rochester between and . our study showed no decline in the incidence of ps; thus, the cohort hypothesis was put to rest. the sabbatical leave experience was wonderful academically but financially disastrous. my salary was reduced by % and we had to maintain two residences—saskatoon and in rochester for part of the year. the canadian dollar went down to cents and interest rates climbed to more than %. my host and mentor, dr. len kurland, was very generous to me and our family. mayo also helped me analyze my own clinical data, which by now were voluminous. i pursued an analytic epidemiology study to identify environ- mental cause(s) of pd. it was like looking for a needle in a hay- stack—because clinical onset of pd is later in life, one has to consider numerous environmental factors. i decided on having a smaller haystack for the search. we included only those patients that had pd onset by age years and further restricted the environmental consideration to the first years of life (because at age children can leave home). twenty-one early-onset pd patients in saskatchewan were identified; all except one were born and raised in small communities or on a farm and they had all consumed well water for the first years of life. we decided to analyze the well water from those locations. most old wells were not operational, so we identified the nearest functioning wells. water samples were collected and compared with saskatoon tap water—there was no difference. we sent those water samples to dr. w. langston in california for possible - methyl - - phenyl - , , , -tetrahydro pyridine (mptp) or related substance, but none was identified (unpublished). saskatchewan is a major agricultural province where herbi- cides and pesticides have been used for as long as they have been commercially available in canada. we did not find an association between the use of any of the herbicides or pesticides and higher incidence of early onset pd. considering my limited resources, i did not pursue population epidemiology further. the second phase of research the two phases of our research are arbitrary because there is much overlap. the dividing line for me was excluding the cohort hypothesis; i could now focus on clinical and pathological studies of movement disorder brains. by contemporary standards, we had devised a new model of research that had a distinct set of needs. this model was dictated to a considerable extent by the local circumstances. we had major weaknesses, but there were several strengths as well. there was a need for research support at multiple levels, especially because our research was based on human subjects. the major clinical focus was longitudinal follow-up of the mdcs patients and autopsy studies of their brains. that required strong patient/ family/public involvement. saskatchewan was the home of the cooperative movement that started during the depression years. in , saskatchewan became the first canadian province to the canadian journal of neurological sciences https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core introduce general tax-funded universal health care system, and i wanted to capitalize on that public spirit. personally, i needed to go beyond the usual duties of a physician—to lead by example. building the trust and support of the public required different skills than the practice of medicine; we have succeeded at that and much credit goes to the people of saskatchewan. funding funding for clinician-driven movement disorders research in canada is mainly from local private sources. the researchers procure funds with their own efforts. a lot of our work was done on “please and thank you,” much personal unpaid time, and sig- nificant in-kind support from the hospital. in spite of that, we still needed funds to pay our small dedicated research staff, and for equipment and consumables. saskatchewan does not have many wealthy people who could make large donations. some patients/ families offered small amounts of money for special clinics and research. i was not sure how to handle those funds and consulted a senior colleague; he recommended against personally handling any donations. four of my patients/friends and i applied for a registered charity status and in we received approval for the saskatchewan parkinson’s disease foundation (spdf). the pri- mary stated objective in the application was to raise funds for special clinics and research. anyone who wanted to donate towards my work was directed to the spdf. the donations were usually small. i observed early on that i would prefer receiving one dollar from a million people as opposed to a million dollars from one person (million-dollar single donations were not forth- coming anyway). the donors of one dollar i hoped would be able to give another dollar the following year. the large number of small donors also started to identify with our program and con- tinued to support it in many other ways, notably in getting the brain autopsies. the spdf contributed financially to the running of special clinics and research, from those donations. the spdf was subsequently renamed as parkinson’s society saskatchewan. in the early s, a group of patients/families organized an annual curling tournament in regina to support our clinics and research. soon, another group organized a golf tournament in regina with the same objectives. those two events have been held regularly for more than years and have raised millions of dollars for the program. both are strictly volunteer-run events. some other smaller provincial groups have organized independent fundraising events to support our work. we have received money from multicenter drug trials (including some funded by the national institutes of health in the united states); all funds left over from the drug studies were kept for other research and the special clinics. even after i (ali) retired from my position at the university of saskatchewan in (when mandatory retirement at the university of saskatchewan was still in place), i did not take residual research funds for myself. we have received research grants from parkinson’s society canada and small amounts from the international essential tremor foundation and from canadian institutes of health research joint grants. in , an anonymous donor established a one million dollar trust for the movement disorders research and later donated $ , more. our model of program funding is similar to that at other major movement disorders programs in canada. since my (ali) retirement from the university, the provincial government has provided financial support towards movement disorder clinics. additional collaborations after dr. alex rajput was trained in processing the frozen brains in , the number of collaborators has increased. so far, we have had different collaborating teams from canada, the united states, europe, and japan. we will not go over the con- tributions made by all of them and instead will restrict our com- ments to two major canadian teams that are currently active. quebec city – laval university group in , dr. paul bédard, professor of neurology, laval university, quebec city, visited saskatoon for the canadian congress of neurological sciences. paul was pursuing high- quality work on a primate model of mptp-induced parkinson syndrome (ps). the mptp model has served well for studies of major motor features of ps, but does not fully represent the naturally occurring disease. i asked paul to consider enlarging his scope of work to include studies of human movement disorder brains and later that year i invited him as a visiting professor to the university of saskatchewan. we showed him our setup and he was convinced that we could develop a useful collaboration. he recommended inclusion of his younger colleague, dr. thérèse di paolo, who had done considerable work on mptp monkeys. she visited saskatoon the following year and our collaboration began. she introduced us to her younger colleague, dr. frédéric calon. all three of them have honorary adjunct professor appointments at the university of saskatchewan. this collaboration has pro- duced more than ten very high-quality papers. they have studied pd brains including ld-induced dyskinesia. our recent paper in brain on the gabaergic system in et brains was chosen as one of the ten best scientific developments in the province of quebec in . we should note that quebec is a powerhouse for neurosciences research in canada. our collaboration continues with drs. calon and di paolo, but unfortunately dr. bédard is no longer active. mayo clinic jacksonville, fl/university of british columbia in , i (ali) was introduced to dr. matthew farrer who was pursuing genetic studies of pd at the mayo clinic, jacksonville, fl. we invited him to saskatoon and quickly realized that we would benefit from each other’s expertise. dr. farrer and his team, including dr. c. vilariño-gűell, moved to the university of british columbia in . our university of british columbia collaboration team has enlarged and now includes two leading movement disorders and positron emission tomography scan experts, drs. jon stoessl and silke cresswell. together, we have published more than articles dealing with the genetics of movement disorders and more recently with functional imaging (positron emission tomography). we have reported on the lrrk gene mutation with autopsy verification in one pd family; inter- estingly, the pathology showed a tauopathy with no evidence of lewy bodies. dr. farrer and his group have identified dnajc mutation in a large multi-incident mennonite family from saskatchewan, with autopsy verification of lewy body pd. this observation has the potential to significantly enhance our understanding of the pathogenesis of pd. there are several other articles accepted or in the pipeline. le journal canadien des sciences neurologiques volume , no. – march https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core students and future scientists as the research in movement disorders at the university of saskatchewan progressed, several students worked with me dur- ing the summers. even students joining our program for a short time have been able to present and publish articles based on our resources. some of them now occupy prominent academic posi- tions in canada and the united states. notable in that group are drs. ryan j. uitti and alex rajput. ryan started working with me in the summer after his first year of medical college and then continued to be involved throughout his medical college years and beyond. he graduated in and is now professor of neurology at the mayo clinic, jacksonville, fl. dr. alex rajput started working with me in the summer when he was years old and i paid him from my own pocket. my motive was more personal than academic—i wanted to know where my son was so he would not be bored and get into trouble. he did his neurology training at the university of iowa and moved back to saskatoon in as he was on a j visa in the united states. he needed a postgraduate year- of residency training to qualify for the frcp(c) neurology examination and following that he did a one year movement disorder fellowship in saskatoon. he had an offer for a position at the university of saskatchewan but was seriously considering moving back to iowa. i did not want to get involved in that decision nor did i participate in his appointment to the faculty at the university of saskatchewan. once he was here, i asked dr. hornykiewicz to train him in the methods of frozen brain dissection in . alex also did special training in on the rotenone rat model of pd at emory university, atlanta, in dr. j. timothy greenamyre’s laboratory. in our laboratory, the mortality in those animals was high and we determined that early death was associated with brain hemorrhage. we concluded that this model was not suitable for our research. dr. alex rajput is now the director of the saskatchewan movement disorders program, including the clinics, research, and all related laboratories. main components of saskatchewan movement disorders program there are two inseparably linked components: ( ) clinical services for saskatchewan patients and ( ) research. that dual objective was the foundation of this program in . the data collected in the clinics are not driven by any one research protocol but are research-worthy. the clinical data are regularly used in conjunction with videos, pathology, biochemistry, and genetics information in our research. longitudinal follow-up of the patients is a major feature of the mdcs. all saskatchewan resi- dents carry general tax-supported health care insurance and access to mdcs is equal to all provincial residents. there is a provincial plan to support drug costs. clinical data every patient seen at the mdcs is regarded as a potential candidate for inclusion in research studies. the clinics in saska- toon and regina are identical. at every clinic, there are two or three support staff members assisting the clinicians. video recordings are made on all consenting subjects at and rarely on consenting family members who may be of research interest. after initial mdcs assessment, a brochure outlining the disorder, the nature of the disease, and management options is provided. the expected outcome is discussed with the patient/family. those discussions are not restricted by time. patients are provided with our office telephone numbers, and have an unlimited access to the two (ahr/ar) neurologists between clinic visits. we (ahr, ar) answer our patients’ telephone calls, and considerable neurologist time is spent on the telephone with patients. we are interested in knowing of changes in the patient’s status; when appropriate, we initiate treatment changes that may include phone calls or faxes to the patient’s pharmacy—that information is entered into the patient record and used for patient care and research. at an opportune time, we ask patients to consider if they wish to have an autopsy be done after death (figure ). we prefer to give that form to the patient/family to take home and discuss with family members before signing. if the patient is comfortable and intends to proceed with the autopsy, the form is signed and returned to us. there is no expense to the family and the body is not disfigured for viewing. they are also assured that regardless of the decision on autopsy, there would be no impact on the ongoing care. in case the patient is not comfortable with the declaration,he or she is asked to write “no” on the form and return it to us. once a patient has said “no,” we do not ask again for autopsy declaration. in those cases where the patient has declared the desire to have an autopsy, a copy of the signed form is provided to each family member and to the family physician. patients that sign the declaration also sign consent for use of brain tissue for research and allow us access to their clinical information from all sources. if we come across a suitable normal control subject, we offer a similar autopsy option. autopsy procedure typically a call comes to the neurologist from a family mem- ber, nursing home, or hospital personnel that the patient has died and the family wishes to have an autopsy performed for research. the two of us (ahr, ar) are on / call (figure ). we make autopsy arrangements with the family, care home, funeral home, morgue attendant, etc. and are available from the time of initial call until the body is released back to the funeral home. autopsies are performed in saskatoon. the cost of transporting the body to and from saskatoon is our responsibility. saskatchewan is a large geographical area so there can be long distances to transport the body. we also pay for the time of extra morgue attendants when they are needed after hours. the average immediate cost for body transport and the autopsy procedure is now approximately $ , . in rare situations, for patients that have died out of pro- vince we are grateful to have received support from local neuropathologists. between % and % of our parkinson’s patients and a smaller percentage of et cases come to autopsy. the decision to have an autopsy performed rests with the next-of-kin; there are rare examples in which the patient did not sign the declaration but the family decided on autopsy. on other occasions, patients not seen at mdcs also come to autopsy. a call would come at night indicating that someone in a nursing home who had pd has died, but neither the caller nor the neurologist is certain if the patient was ever evaluated at the mdcs. the autopsy will proceed and when we discover later that the patient was never seen in our clinic, the brain is not used for research because of lack of our own clinical information. some normal controls not seen at the mdcs also come to autopsy. the canadian journal of neurological sciences https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core immediately after removal, the brain is divided at midline into two halves. half is frozen at − °c for future studies and the other half is fixed in formalin for pathology studies. (there is no parti- cular side that is chosen when the brain is grossly normal. for those cases in which there is a known structural lesion, that hemisphere is fixed in formalin.) the neuropathologist produces a detailed report that is attached to the patient’s clinical record and a copy is sent to the next-of-kin, with an offer to discuss the diagnosis. figure shows summary of saskatchewan movement dis- orders program. information and material storage figure shows different laboratories where patient records and material are stored. videos made with older technology need updating. there are more than patient videos and some patients have had several videos. one member of our staff is responsible for the video library. the videos are updated regularly to ensure compatibility with the most recent technology and catalogued. as noted previously, the freezers are connected to the hospital auxiliary power and the alarm system monitored by royal uni- versity hospital security department. the two of us (ahr, ar) are on / call for any freezer mishap. figure : flow chart of saskatchewan movement disorders program operations. figure : pictures of saskatchewan movement disorders program storage of patient records and research material. (a) filing cabinet containing hard copies of patient clinical records. (b) − °c freezers. currently there are nine freezers. (c) cardboard boxes, each containing half-frozen brain from a patient. each box has patient identification at four places—two with only the number and two with name and number. (d) formalin-fixed remains of the brain tissue after pathology has been completed. (e) paraffin blocks and glass slides stored in our laboratory. (f) video library. le journal canadien des sciences neurologiques volume , no. – march https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core each frozen brain is kept in a separate box. the frozen brains are dissected (by ar) in another special room and only one brain is brought to that room at a time. the formalin-fixed tissue and paraffin blocks are being used for research with increasing frequency as new investigative tools become available. one member of our staff has the primary responsibility for the brain tissue storage laboratories, though other members are familiar with that. major movement disorders studied at mdcs the disorders studied at mdcs are those prevalent in the saskatchewan population. the three most common disorders in our clinic population are parkinsonism, et, and dystonia (mostly focal or segmental). figure shows the latest autopsy count and the broad diagnostic groups. in some cases, a final pathology report was not available at the time of this article’s preparation. most of our collaborations are based on deidentified frozen half- brains. numbered brain tissue samples are provided to the collaborators. our resource is not a brain bank since we started publishing human brain studies, interest in this field has increased. several institutions are now pursuing studies of movement disorder–autopsied brains. each program uses the strategy appropriate to the local circumstances and each has its own strengths and weaknesses. following are the common models of such programs. . patients receiving a certain drug treatment regimen are enrolled in research; thus, they are evaluated by the researchers at regular intervals using specific research protocol and autopsy studies are performed. the patients, however, are cared for by their own physicians. the strength of such programs is that research- specific data are collected prospectively. the weakness is that only the specially selected cases are included and the clinical data collected by treating physicians are heterogenous. . studies based on individuals from defined communities who express a desire to have autopsy studies for research. - strengths of such programs are that patients are periodically evaluated in detail by movement disorders experts. they can collect large amounts of detailed data and a large number of autopsied brains, including control brains for research. the autopsy can be obtained soon after death and expert patholo- gists study every brain. the weaknesses are that the cases included are all elderly and not representative of the general population. , and in many cases the medical care is provided by other physicians. . national parkinson’s disease brain bank. brains from all parts of the country are forwarded to a centralized brain bank. the strength is that a large number of brains can be collected. the weaknesses are that there are many (more than ) physicians including neurologists and geriatricians who look after these patients and collect the clinical data. the autopsies are performed locally at multiple sites, thus there is a lack of uniformity of the clinical data and the brain harvesting. pd w/wo other dx psp w/wo other dx msa w/wo other dx et w/wo other dx cbd w/wo other dx als w/wo other dx controls ad w/wo other dx other normal diseased autopsies autopsies frozen frozen formalin formalin paraffin paraffin cases with tissue available used as controls total number of autopsies with pathology report and/or tissue available (july ) number of cases seen in our clinic (alex or ali ) number of cases not seen in our clinic figure : summary of autopsy studies performed at saskatchewan movement disorders program and available samples. pd = parkinson disease; psp = progressive supranuclear palsy; msa = multiple system atrophy; et = essential tremor; cbd = corticobasal degeneration; als = amyotrophic lateral sclerosis; ad = alzheimer disease. the canadian journal of neurological sciences https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core . national essential tremor repository in the united states. - neurologists—mostly movement disorders experts from across the country—provide the brains from their own patients. the strengths are that a large number of et brains are available for research and there is very good team of neuropathologists that study those brains. the weaknesses are that the patients are looked after by many different neurologists and the autopsies are performed at multiple sites before the tissue is transported to the central repository. . our program is based on our own clinical practice of movement disorders. for research, we include patients that we (ahr, ar) have evaluated at the mdcs. our cases include a representative sample of the provincial population—all ages and all forms of treatment. the autopsies are done at one centralized location. all patients are looked after by us (ahr, ar), which ensures consistency of the clinical data. the treatment regimen is fully documented and the autopsy procedure is standardized. all patient records including videos and brain material are pre- served in our laboratories. research is based on movement disorder patients seen in our clinic and controls. the main weaknesses are that it is a slow process to collect large number of brains and the clinical data are not based on any specific research protocol. over the years, we have collected several hundred brains from patients with diverse movement disorders (figure ) and the clinical data are of adequate quality to complement other major research studies. , , - after visiting saskatoon, dr. andres lozano, professor and head of neurosurgery, university of toronto, called it a “safety deposit—world heritage site unmatched anywhere.” dr. horny- kiewicz observed, “i consider that collection the most valuable in the world. there is nothing else like it, and i know about every such lab. he collected the whole thing in saskatoon very patiently, and now it is unique. he has very rare material and has meticulous records of the patients.” to distinguish from a brain bank, we call our resource the brain safety deposit. selected work of the saskatchewan movement disorders program for space reasons, we cannot comment on most of our articles and will exclude the epidemiological studies noted previously. we briefly describe some of our work in chronological order to illustrate the evolution of the research over time. . . specificity of tremorilytic effects of alcohol and propranolol. improvement of et after an alcoholic drink has been anecdotally known for a long time and that infor- mation was passed by the neurologists from one generation to the next, but it was never established scientifically. this was first ever literature report on systematically studied effect of oral alcohol on the et. . . relative efficacy of alcohol and propranolol in action tremor. this was the first published study on the effect of oz ( ml) oral alcoholic on the action tremor in several different disorders. we reported on cases, including with et and with pd. action tremor improved minutes after oz of alcohol ingestion in % of et and % of pd cases; action tremor of some other rare disorders also improved. the blood alcohol levels did not correlate with the tremor benefit. more patients improved on propranolol than with a single alcoholic drink. to our knowledge, this is the only study on the effect of oral alcohol in action tremor in multiple disorders. the symptomatic benefit of alcohol on action tremor is neither specific nor restricted to et. . . dysautonomia in parkinsonism: a clinicopathological study. autonomic dysfunction in pd was recognized by early s, but the anatomical basis of that was unknown. most pathology studies were limited to brain and the spinal cord. this study included eight patients that had detailed intra- arterial blood pressure assessments in supine and upright positions, and the autopsy study included the brain, spinal cord, and the sympathetic ganglia. the orthostatic hypotension correlated with the sympathetic ganglia pathology—neuronal loss and lewy body inclusions. this is the only study to our knowledge that looked histologically at central as well as the peripheral autonomic nervous system for the autonomic dysfunction in pd. . . receptor basis for dopaminergic supersensitivity in parkinson’s disease. this included normal controls, untreated pd, and ld-treated pd patient brains. the dopamine receptors were supersensitive in the untreated pd and the sensitivity declined after treatment with ld. this is one of the earliest studies, if not the earliest study of its kind. . . reversible drug-induced parkinsonism. drug induced parkinsonism has been well known since the s, but there were no pathological studies to determine the underlying mechanisms of parkinsonian manifestation. this was a clinical and pathological study of two cases. on neuroleptics, each patient manifested parkinsonism. at autopsy, each case had pathological evidence of premotor pd. the neuroleptic stress needed to unmask parkinsonism was inversely related to the underlying pd pathology. . . chronic low dose levodopa therapy . high dose of ld was a common practice in the s- ’s. we observed that this resulted in early onset of dyskinesias in many cases and decided to use a lower dose of ld. this was a -year clinical study of cases on low dose— g or less plain ( mg ld/ carbidopa)/day. low-dose ld was effective and resulted in considerably lower incidence of dyskinesia and motor response fluctuations. , compared with most literature reports. those observations were confirmed years later by olanow et al. our practice of using lower dose resulted in lower drug costs, less common need for medical service for ld complications, and a better quality of life for patients. . . levodopa efficacy and pathological basis of parkinson syndrome. ld was known to be effective in most pd cases, but the information was based on clinical observations. some patients in those studies likely included other variants of ps. this is a -year clinicopathological study of cases. it shows that all pd patients receiving an adequate ld dose improve, all patients with substantia nigra (sn) restricted pathology also improve, and % of multiple system atrophy cases have some benefit on ld. this is the first published autopsy verified report on ld efficacy in ps. . . accuracy of clinical diagnosis in parkinsonism—a prospective study. this was the first study comparing clinical diagnosis with autopsy verification in parkinsonism. at the first visit, a neurologist correctly diagnosed pd in %, whereas at the final assessment before death, diagnosis by a movement disorder neurologist was accurate in % (as le journal canadien des sciences neurologiques volume , no. – march https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core verified by brain histological studies). this article was very well-received and was considered the best original article in the canadian journal of neurological sciences in . in , adler et al reported a virtually identical accuracy rate— % of the initial and % of the final clinical diagnosis accuracy. thus, predicting the pathology, based on the clinical diagnosis of pd, has remained unchanged for more than two decades. our study helped include clinical diagnostic inaccuracy when considering pd case selection for drug trials. . . significance of parkinsonian manifestations in essen- tial tremor. tremor is the major manifestation in both pd and et, but resting tremor is considered characteristic of pd. there is no widely available biological marker to clinically distinguish between those two disorders. in this clin- icopathological study of nine et patients, three ( %) had resting tremor as part of the natural evolution of et. this was first pathologically confirmed report on the presence of rest- ing tremor in et patients. we also recommended that in a well-established et case, all three parkinsonism motor fea- tures—resting tremor, bradykinesia, and rigidity (preferably asymmetrical)—must be present before making the additional diagnosis of ps. . . prognostic significance of the onset mode in parkin- sonism. it was widely known that parkinsonian cases have different modes of motor onset, but the reasons for that were not known. this clinicopathological study of autopsied patients over years showed that most patients with tremor onset had pd, whereas the postural instability and gait diffi- culty onset was most common in multiple system atrophy and progressive supranuclear palsy. the prognosis is most favorable in the tremor onset cases. . . dopa-responsive dystonia: pathological and bio- chemical observations in a case. dramatic and sustained response on a small dose of ld is well-known in dopa- responsive dystonia. this was a detailed clinical, pathologi- cal, and brain biochemical study of a -year-old woman who died after years of dystonia symptoms. she had marked improvement on ld initiated at age years and died in an automobile accident at age . the number of pigmented substantia nigra neurons was normal, but there was a marked reduction in the neuronal pigmentation. there was marked reduction in striatal dopamine levels. this patient was sub- sequently reported in a genetic study showing gch gene mutation as the first example in a caucasian subject. her brother, who had mild symptoms from childhood but did not come to medical attention until age years with mild fea- tures of parkinsonism and dystonia, has responded very well to a small dose of ld. . . is levodopa toxic to human substantia nigra?. toxicity of levodopa to the human sn was vigorously debated based on laboratory studies, especially after dopamine agonist drugs became available. we reported five cases including two autopsies. in one patient, a total of kg (plain ld) was used over years without evidence of nigral damage. this was the first pathologically verified study to show that levodopa is not toxic to human sn. we have now collected ld-treated autopsied cases that have normal sn (unpublished). . . timely levodopa (ld) administration prolongs survi- val in parkinson’s disease. there was an ongoing debate if ld increased life expectancy in pd; however, it could not be verified because all the contemporary pd patients are treated with ld and untreated controls needed for comparison are not available. this clinical study included cases observed over years. cases were divided into those with delayed access to ld at first assessment at mdcs ( to the end of ) with those having unrestricted access to ld (if needed) at first assessment ( and later). to our knowledge, this is the only study comparing pd patients that had highly restricted access to ld with patients that had unrestricted ld access. the survival in parkinsonism remains shorter than expected, but it has increased significantly since unrestricted access to ld. survival benefit, however, is restricted to those that receive ld therapy before onset of postural instability (stage hoehn and yahr, or modified hoehn and yahr stage . ). we also noted that epidemiological studies comparing pd survival with the general population that start from the retrospectively identified pd onset date artificially inflate pd survival. such survival comparisons should start from the date of pd patient entry in the study (i.e. first visit). . . clinical-pathological study of levodopa complica- tions. ld motor complications are known to increase with longer duration of treatment; however, most studies are based on clinical observations of heterogenic ps cases that have different responses to ld. this was a -year study of autopsied lewy body pd cases. the most common ld motor complication was dyskinesia. cumulative incidence of dys- kinesia (observed at some time during the course) over the -year study interval was %, of wearing-off % and of on-off %. to our knowledge, this is the only study based on autopsy-verified pd cases on this subject. . . human brain dopamine metabolism in levodopa- induced dyskinesia and wearing-off. some pd patients on long-term ld treatment develop wearing off but no dyski- nesia, whereas others on comparable ld dose/duration manifest dyskinesia but no wearing off. the reason for that difference was not known. this study compared nine pd brains of cases with different ld motor complication profiles followed over years with four neurologically normal control brains. this is the first autopsy study to show that patients with wearing-off metabolize dopamine more rapidly than the patients with dyskinesia. . . essential tremor course and disability: a clin- icopathological study of cases. et patients have a vari- able course—in some cases there is no significant progression and in others the symptoms worsen with time. in autopsied et cases seen at mdcs over years, we observed pro- gressively wider anatomical sites of tremor involvement and increasing functional disability with time. the risk of devel- oping pd in the et cases was comparable to that in the general population. this is the first autopsy study of long- itudinally followed autopsied et cases. . . globus pallidus dopamine and parkinson motor sub- types: clinical and brain biochemical correlation. some pd patients manifest dominant tremor, whereas others have dominant bradykinesia and rigidity, and many more have equal severity of those motor features. there was no expla- nation for those clinical differences. this study of eight pd cases that had different motor subtypes (determined when the entire clinical course of disease was considered) and five normal control brains found striatal dopamine loss was more the canadian journal of neurological sciences https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core pronounced in the akinetic-rigid compared with tremor dominant cases. in the globus pallidus interna, dopamine loss was the most pronounced in the akinetic-rigid and the least in the tremor-dominant cases. these data indicate that akinetic- rigid cases have a more widespread pathology than the tremor dominant cases. . . course in parkinson’s disease subtypes: a -year clinicopathological study. having established that the akinetic-rigid cases have more advanced pathology, we chose to determine the course of disease in different pd motor subtypes. this study included autopsied pd cases seen at mdcs during years. motor subtypes were based on the entire course of disease. the outcome was most favorable in those who had tremor-dominant and the worst in akinetic rigid cases. this is the longest followed autopsy-verified study of pd motor subtypes reported to date. . . significance of cerebellar purkinje cell loss to patho- genesis of essential tremor. the pathological basis of et remains unknown but some studies. - reported that cere- bellar purkinje cell (pc) loss was the specific pathology in a large majority of et cases. this study of seven et, six tremor-dominant pd and two normal control brains, found no difference in pc counts between et, pd, and normal con- trols. literature evidence supporting that pc loss is not spe- cific to et and the conclusion was discussed. because some criticized the study due to small numbers, in we reported on autopsy cases including et, pd, and normal control brains. the pc counts were done by a neuro- pathologist blinded to the clinical diagnosis. it revealed that the pc counts were marginally higher in the et cases com- pared with the control groups. a recent large, independent study has confirmed our observations. it is concluded that pc loss is not the pathological basis of et. . . defective dentate nucleus gaba receptors in essential tremor. this study of et, pd, and control brains first time showed reduced gaba receptors in the dentate nucleus in et cases. . . dnajc mutation in parkinson disease. this study reports on a large multi-incident mennonite family with three autopsy-confirmed lewy body pd that had dnajc mutation. the first case was seen nearly years before publication, but took this long to evaluate other family members and for some affected persons to come to autopsy. other seemingly unrelated persons from four different families of mennonite ancestry were identified; all but one family can trace their roots to the chortitza mennonite colony of the ukraine. the dnajc mutation leads to toxic gain of function resulting in impaired endosome transport. this observation furthers our understanding of the pathogenesis of pd. . . is parkinson’s disease a vesicular dopamine storage disorder? evidence from a study in isolated synaptic vesicles of human and nonhuman primate striatum. the molecular mechanism of onset and progression of pd pathology remains unknown. this study included six pd, four normal control brains, and seven mptp treated and eight normal control monkey brains. there was markedly reduced dopa- mine vesicular uptake and binding in the human pd, but not in the mptp-treated monkey brains. this abnormality is therefore specific to pd. this observation improves our understanding of the pathophysiology of pd and reinforces that despite the usefulness of the mptp model of pd, it does not represent fully what is going on in human pd. what made our research model successful? compared with most other centers, we did not have any special advantages of funding, equipment, manpower, or technical skills. we believe the success of our research program can be attributed to the following. . fully integrated clinical and research programs since it was started in . a large number of cases can be studied because the program includes all movement disorders seen at the mdcs. we follow the patients longitudinally, make videos on all consenting subjects, and perform autopsies wherever possible. all patients are evaluated at each visit by the same two neurologists, ensuring consistency of the clinical data. . a realistic plan, taking into account the local circumstances. . building a long-term sustainable research program. it has several components and each involves successful integration of multiple individuals. . slow but patient. in the earlier years, many of my (ali) contemporaries “appeared to be flying in supersonic jets, while i was walking.” . hard work. in the earlier years, i (ali) took virtually no holidays and the research was done over the weekends and evenings. although there are many other examples of extra- ordinary efforts by saskatchewan movement disorders neu- rologists, one that is easy to understand is the availability. one of us (ahr) has been on / autopsy call for years and emergency freezer call for years, whereas the other (ar) has been on each of those calls for years, without financial or academic reward. . the support of many others, including the hospital personnel, who have contributed significantly to this program in their own ways. . saskatchewan public support. saskatchewan people are prob- ably the most generous anywhere, when the term “generosity” is used in a broad sense. not only has the public raised large sums of money from many small donations to support this work, they have also helped collect research-worthy data and many families authorized autopsy on their loved ones—even when there was no possibility of any gain to the family. . cost-effectiveness. not counting the many voluntary functions performed by thousands of saskatchewan people and neuro- logists over the years, this program has so far cost more than $ million. the cost was bearable as it was spread over a long period. there is an african saying: “if you want to go quickly, go alone; if you want to go far, go together.” together, the sas- katchewan public, neurologists, and our collaborators have indeed traveled far—starting from nothing to being what is considered by some experts in the field as the best program of its kind. future our efforts were dictated by circumstances, and circumstances change with time. the future of this program depends on the new local realities—the desire of the new local expert neurologists in le journal canadien des sciences neurologiques volume , no. – march https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core this field and the institution to pursue this model of research. if handled properly, the future of the program is bright. we have one of the best resources and have the mechanism in place for ongoing replenishment. this program can expand to include many other aspects of pd, et, and dystonia and also include other movement disorders. foreseeable needs we are not likely to receive a multimillion dollar donation or to have a very large neurosciences manpower or technological superiority over other major centers. this research program is anchored to patient care and specialized research-worthy clinical data collection. those functions are performed by the specialty trained neurologists. by the standards of this institution, it is a fairly large program. the demands on our (ahr, ar) time are numerous and we are frequently the bottleneck for the collabora- tive studies. we appreciate the patience of our colleagues. the program has reached a point that the two of us, with one (ahr) retired from the university (though spending more than % of his time on research), cannot take full advantage of the available opportunities. there are many research options we cannot pursue because of a lack of medical manpower. there is a need for three fulltime academic movement disorder neurologists if we wish to realize the full potential of this program. appropriate recognition and support for the multiple tasks which neurologists perform is vital in order to attract and retain movement disorders experts. those who can contribute locally with specialized clinical or imaging assessments as well as basic science research support are also needed. new collaborators that bring state-of-the-art expertise to take advantage of our unique resource are welcome. we are highly optimistic about the continuing public generosity; however, there is a need for a more sustained and reliable funding source. acknowledgements we are grateful to greystone golf classic, regina curling classic, and royal university hospital foundation for the major financial support of the saskatchewan movement disorders program. disclosures ali rajput has received honoraria from and been a guest speaker at parkinson society canada. alex rajput received research support from greystone golf classic, regina curling classic, and royal university hospital foundation. references . ehringer h, hornykiewicz o. distribution of noradrenaline and dopamine ( -hydroxytyramine) in human brain: their behaviour in extrapyramidal system diseases. klin wochenschr. ; : - . . birkmayer w, hornykiewicz o. the effect of l- , -dihydroxy- phenylalanine (= l-dopa) on akinesia in parkinsonism. wiener klinische wochenschrift. ; : - . . cotzias gc, van woert mh, schiffer lm. aromatic amino acids and modification of parkinsonism. n engl j med. ; : - . . rajput ah, jamieson h, hirsh s. specificity of tremorilytic effects of alcohol and propranolol. clin res. ; : . . rajput ah, jamieson h, hirsch s, quraishi a. relative efficacy of alcohol and propranolol in action tremor. can j neurol sci. ; : - . . markham ch, diamond sg. evidence to support early levodopa therapy in parkinson disease. neurology. ; : - . . rajput ah, rozdilsky b. dysautonomia in parkinsonism: a clinicopathological study. j neurol neurosurg psychiatry. ; : - . . rajput ah, stern w, laverty wh. chronic low dose therapy in parkinson’s disease: an argument for delaying levodopa therapy. neurology. ; : - . . ahlskog je, muenter md. frequency of levodopa-related dyskine- sias and motor fluctuations as estimated from the cumulative lit- erature. mov disord. ; : - . . webster dd. critical analysis of disability in parkinson’s disease. mod treat. ; : - . . hoehn mm, yahr md. parkinsonism: onset, progression, and mor- tality. neurology. ; : - . . fahn s, elton rl, updrs development committee. unified parkinson’s disease rating scale. in: fahn s, marsden cd, calne d, et al., eds. recent developments in parkinson’s disease, nd ed. florham park (nj): macmillan healthcare information, . p. - . . rajput ah, voll a, rajput ml, robinson ca, rajput a. course in parkinson’s disease subtypes: a -year clinicopathological study. neurology. ; : - . . poskanzer dc, schwab rs. cohort analysis of parkinson’s syn- drome evidence for a single etiology related to subclinical infec- tion about . j chronic dis. ; : - . . lee t, seeman p, rajput ah, farley ij, hornykiewicz o. receptor basis for dopeminergic supersensitivity in parkinson’s disease. nature. ; : - . . pifl c, rajput a, reither h, et al. is parkinson’s disease a vesicular dopamine storage disorder? evidence from a study in isolated synaptic vasicles of human and nonhuman primate striatum. j neurosci. ; : - . . rajput ah, offord kp, beard cm, kurland lt. epidemiology of parkinsonism: incidence, classification, and mortality. ann neu- rol. ; : - . . rajput ah, uitti rj, stern w, laverty w. early onset parkinson’s disease in saskatchewan - environmental considerations for etiol- ogy. can j neurol sci. ; : - . . rajput ah, uitti rj, o’donnell d. metal concentration in drinking water and parkinson’s disease and controls. can j neurol sci. ; : . . rajput ah, uitti rj. paraquat and parkinson’s disease. neurology. ; : . . calon f, rajput ah, hornykiewicz o, bedard pj, dipaulo t. levodopa-induced motor complications are associated with alterations of glutamate receptors in parkinson’s disease. neuro- biol dis. ; : - . . paris-robidas s, brochu e, sintes m, et al. defective dentate nucleus gaba receptors in essential tremor. brain. ; : - . . rajput a, dickson dw, robinson ca, et al. parkinsonism, lrrk g s, and tau neuropathology. neurology. ; : - . . vilarino-guell c, rajput a, milnerwood aj, et al. dnajc mutations in parkinson disease. hum mol genet. ; : - . . allen al, luo c, montgomery a, rajput ah, robinson ca, rajput a. vascular pathology in male lewis rats following short-term, low-dose rotenone administration. vet pathol. ; : - . . hely ma, morris jgl, rail d, et al. the sydney multicentre study of parkinson’s disease: a report on the first years. j neurol neurosurg psychiatry. ; : - . . shill ha, adler ch, sabbagh mn, et al. pathologic findings in prospectively ascertained essential tremor subjects. neurology. ; : - . . adler ch, beach tg, hentz jg, et al. low clinical diagnostic accuracy of early vs advanced parkinson disdease: a clinicopathologic study. neurology. ; : - . . beach tg, sue li, walker dg, et al. the sun health research institute brain donation program: description and experience, - . cell tissue bank. ; : - . the canadian journal of neurological sciences https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core . shill ha, adler ch, beach tg, et al. brain biochemistry in autop- sied patients with essential tremor. mov disord. ; : - . . hughes aj, daniel se, kilford l, lees aj. accuracy of clinical diagnosis of idiopathic parkinson’s disease: a clinico-pathological study of cases. j neurol neurosurg psychiatry. ; : - . . hughes aj, ben-schlomo y, daniel se, lees aj. diagnosis of pd. reply. neurology. ; : . . louis ed, faust pl, vonsattel j-p, et al. neuropathological changes in essential tremor: cases compared with controls. brain. ; : - . . louis ed. essential tremors: a family of neurodegenerative dis- orders? arch neurol. ; : - . . axelrad je, louis ed, honig ls, et al. reduced purkinje cell num- ber in essential tremor: a postmortem study. arch neurol. ; : - . . rajput ah, rozdilsky b, rajput a, ang l. levodopa efficacy and pathological basis of parkinson syndrome. clin neuropharmacol. ; : - . . rajput ah, rozdilsky b, ang l, rajput a. significance of parkin- sonian manifestations in essential tremor. can j neurol sci. ; : - . . rajput ah, fenton me, birdi s, et al. clinical-pathological study of levodopa complications. mov disord. ; : - . . rajput ah, rozdilsky b, hornykiewicz o, shannak k, lee t, see- man p. reversible drug-induced parkinsonism: clinicopathologic study of two cases. arch neurol. ; : - . . rajput ah. factors predictive of the development of levodopa- induced dyskniesia and wearing-off in parkinson’s disease. mov disord. ; : . . olanow cw, kieburtz k, rascol o, et al. factors predictive of the development of levodopa-induced dyskinesias and wearing-off in parkinson’s disease. mov disord. ; : - . . rajput ah, rozdilsky b, rajput a. accuracy of clinical diagnosis in parkinsonism - a prospective study. can j neurol sci. ; : - . . rajput ah, rajput a. accuracy of parkinson disease diagnosis unchanged in decades. neurology. ; : - . . rajput ah, pahwa r, pahwa p, rajput a. prognostic significance of the onset mode in parkinsonism. neurology. ; : - . . rajput ah, gibb wrg, zhong xh, et al. dopa-responsive dystonia: pathological and biochemical observations in a case. ann neurol. ; : - . . furukawa y, shimadzu m, rajput ah, et al. gtp-cyclohydrolase i gene mutations in hereditary progressive and dopa-responsive dystonia. ann neurol. ; : - . . rajput ah, fenton me, birdi s, macaulay r. is levodopa toxic to human substantia nigra? mov disord. ; : - . . rajput ah, uitti rj, rajput a, offord kp. timely levodopa (ld) administration prolongs survival in parkinson’s disease. parkin- sonism relat disord. ; : - . . rajput ah, fenton me, di paolo t, sitte h, pifl c, hornykiewicz o. human brain dopamine metabolism in levodopa-induced dyskinesia and wearing-off. parkinsonism relat disord. ; : - . . rajput a, robinson ca, rajput ah. essential tremor course and disability: a clinicopathological study of cases. neurology. ; : - . . rajput ah, sitte h, rajput a, fenton me, pifl c, hornykiewicz o. globus pallidus dopamine and parkinson motor subtypes: clini- cal and brain biochemical correlation. neurology. ; : - . . rajput ah, rajput a. significance of cerebellar purkinje cell loss to pathogenesis of essential tremor. parkinsonism relat disord. ; : - . . rajput ah, robinson ca, rajput ml, robinson sl, rajput a. essential tremor is not dependent upon cerebellar purkinje cell loss. parkinsonism relat disord. ; : - . . symanski c, shill ha, dugger b, et al. essential tremor is not associated with cerebellar purkinje cell loss. mov disord. ; : - . le journal canadien des sciences neurologiques volume , no. – march https://www.cambridge.org/core/terms. https://doi.org/ . /cjn. . downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /cjn. . https://www.cambridge.org/core outline placeholder introduction and history major breakthrough impetus for the university of saskatchewan movement disorders program start of special clinics and research basic scientists and clinician scientist teams start of low-dose ld therapy what should i study and how do i do that? taking advantage of the local situation and building alliances figure adapted from rajput et�al, neurology . early collaborating scientists figure this form is provided to patients to decide on autopsy for research. outside collaborators sabbatical leave the second phase of research funding additional collaborations quebec city ; laval university group mayo clinic jacksonville, fl f;university of british columbia students and future scientists main components of saskatchewan movement disorders program clinical data autopsy procedure information and material storage figure flow chart of saskatchewan movement disorders program operations. figure pictures of saskatchewan movement disorders program storage of patient records and research material. major movement disorders studied at mdcs our resource is not a brain bank figure summary of autopsy studies performed at saskatchewan movement disorders program and available samples. selected work of the saskatchewan movement disorders program what made our research model successful? future foreseeable needs acknowledgements acknowledgements missense models [gustm(e a)sly, gustm(e q)sly, and gustm(l f)sly] of murine mucopolysaccharidosis type vii produced by targeted mutagenesis shunji tomatsu*†, koji o. orii*†, carole vogler‡, jeffrey h. grubb*, elizabeth m. snella*, monica a. gutierrez*, tatiana dieter*, kazuko sukegawa†, tadao orii†, naomi kondo†, and william s. sly*§ *edward a. doisy department of biochemistry and molecular biology and ‡department of pathology, saint louis university school of medicine, st. louis, mo ; and †department of pediatrics, gifu university school of medicine, gifu , japan contributed by william s. sly, september , human mucopolysaccharidosis vii (mps vii, sly syndrome) results from a deficiency of �-glucuronidase (gus) and has been associ- ated with a wide range in severity of clinical manifestations. to study missense mutant models of murine mps vii with phenotypes of varying severity, we used targeted mutagenesis to produce e a and e q, corresponding to active-site nucleophile re- placements e a and e q in human gus, and l f, corre- sponding to the most common human mutation, l f. the e a mouse had no gus activity in any tissue and displayed a severe phenotype like that of the originally described mps vii mice carrying a deletion mutation (gusmps/mps). e q and l f mice had low levels of residual activity and milder phenotypes. all three mutant mps models showed progressive lysosomal storage in many tissues but had different rates of accumulation. the amount of urinary glycosaminoglycan excretion paralleled the clinical se- verity, with urinary glycosaminoglycans remarkably higher in e a mice than in e q or l f mice. molecular analysis showed that the gus mrna levels were quantitatively similar in the three mutant mouse strains and normal mice. these mouse models, which mimic different clinical phenotypes of human mps vii, should be useful in studying pathogenesis and also provide useful models for studying enzyme replacement therapy and targeted correction of missense mutations. knock-in mice � point mutation � cre-loxp mucopolysaccharidosis type vii (mps vii or sly syndrome)is a mucopolysaccharide storage disease resulting from a deficiency of �-glucuronidase (gus, ec . . . ) ( ). in mps vii, chondroitin sulfate, dermatan sulfate, and heparan sulfate are only partially degraded and accumulate in the lysosomes of many tissues, leading to cellular and organ dysfunction. mps vii has also been reported in canine, murine, and feline species. human patients with mps vii display a wide range of clinical severity, and � different mutations have been found in the gus gene ( – ). around % of these are point mutations. l f accounts for � % of mutant alleles. this mutation was first identified in a mennonite family ( ), and then observed in other populations. most patients homozygous for l f have a mild phenotype. this mutation is interesting because cells from l f patients have � % of normal gus activity, but expres- sion of the l f cdna in cos cells produced nearly as much enzyme activity as the wt control cdna ( ). characterization of human gus protein by x-ray crystallog- raphy and homology comparisons among several species sug- gested r , e , and e as active-site residues ( ). e was identified as the active-site nucleophile of the human enzyme ( , ). recombinant e a human gus had no catalytic activity, but the e q gus showed . % of wt activity ( ). one severely affected mps vii patient with a null mutation at this residue, e k, has been identified (s.t. and w.s.s., unpublished observation). the original mps vii (gusmps/mps) mice with a -bp deletion in exon have morphologic, genetic, and biochemical character- istics similar to those of mps vii patients ( , ). the features of this murine model, with a known and uniform genetic constitution, made it attractive for studying experimental ther- apies for lysosomal storage disorders. missense mutant mouse models allow functional analysis of specific amino acid replace- ments. we used targeted mutagenesis to produce three such models of mps vii: e a, e q, and l f. the e residue in exon was selected because it was implicated as an active-site nucleophile ( , ). differences in residual activity between recombinant e a and e q were noted in vitro and raised the possibility that the e q mutation might provide a milder form of mps vii than e a ( ). the l f mutation was selected because the homologous human mutation, l f, was the most prevalent mutation among mps vii patients and was usually associated with a mild phenotype. these mice provided the opportunity to explore (i) how the residual enzyme activity level measured in vitro correlates with phenotype, (ii) how glycosaminoglycan (gag) storage corre- lates with the individual mutations, and (iii) how phenotypes in mild and severe murine models correlate with those of human patients who have mps vii caused by similar mutations. materials and methods site-directed mutagenesis and targeting vector construction. re- combinant phage clones containing the gus locus were isolated from an svj mouse genomic dna library (stratagene). the � . -kb fragment and � . -kb fragment of the murine gus gene (containing exons – and exon , respectively) were subcloned into the pbs vector. the mutations (underlined) were introduced into the appropriate fragments by using the following mutagenic primers: for e a in exon , �-ccgattatc- cagagcgcgtatggagcagacgcaatc- �; for e q in exon , �-ccgattatccagagccagtacggagca- gacgcaatc- �; and for l f in exon , �-atcacgat- tgccatta aca acacatttacccctcatacc- �. the e a, e q, or l f point mutation and the indicated additional base changes created new bstui, rsai, or msei restriction sites, respectively. the presence of each point muta- tion was confirmed by sequence analysis of exons – . the ppnt-lox vector, generously provided by shinji hirotsune (national human genome research institute, national insti- tutes of health, bethesda), was modified to contain a � phos- phoglycerine kinase neor cassette f lanked by loxp sites and a � thymidine kinase (tk) cassette and was named ppnt-loxp . the � . -kb xhoi–noti fragment of the murine gus gene was introduced at noti�xhoi-digested sites of the ppnt-loxp vec- abbreviations: mps vii, mucopolysaccharidosis type vii; gag, glycosaminoglycan; gus, �-glucuronidase; es, embryonic stem. §to whom correspondence should be addressed. e-mail: slyws@slu.edu. – � pnas � november , � vol. � no. www.pnas.org�cgi�doi� . �pnas. d o w n lo a d e d a t c a rn e g ie m e llo n u n iv e rs ity o n a p ri l , tor. next, the . -kb xhoi–sali fragment containing exons – was added between the tk and neor genes to create the complete targeting vector. the final construct contained . and . kb of � and � homology of the gus gene, respectively, with each point mutation (fig. ). homologous recombination in embryonic stem (es) cells and gener- ation of germ-line chimeras. the targeting vector ( �g) was linearized with noti and introduced into the �sv-derived es cell line rw (incyte genome systems, st. louis; � cells) by electroporation ( v and �f) in a bio-rad gene pulser. after h, the cells were placed under positive�negative selection with �g�ml g (gibco�brl) and �m ganciclovir (syntex chemicals, boulder, co) for days. colonies resistant to double selection were isolated and analyzed by pcr and southern blot. the methodology for screening is provided in supporting methods and fig. , which are published as supporting information on the pnas web site, www.pnas.org. two independent, targeted es clones were injected into c bl� j blastocysts, and chimeric males were backcrossed for germ-line transmission to c bl� j females. the f mice were crossed with mice expressing cre enzyme to remove the neor gene ( ). the resultant neo-excised heterozygous mice were mated to produce homozygous mutant mice. genotyping was performed by pcr analysis of dna obtained by tail biopsies at days and confirmed by assaying the gus activity. the resultant homozygous mice with e a, e q, or l f point mutations were named gustm(e a)sly/tm(e a)sly [or gustm(e a)sly], gustm(e q)sly/tm(e q)sly [or gustm(e q)sly], and gustm(l f)sly/tm(l f)sly [or gustm(l f)sly], respectively, following the nomenclature recommended by the jackson laboratory (www.informatics.jax.org�mgihome�nomen�table.shtml). northern blot analysis and rt-pcr. total cellular rna was isolated from tissues of homozygous mps vii mutants, heterozygotes, and wt mice by using a guanidinium�phenol solution (rna- stat- , tel-test, friendswood, tx). twenty micrograms of rna from each source was denatured in formaldehyde- containing buffer and electrophoresed. the rna was trans- ferred to nylon membranes (amersham pharmacia) and prehy- bridized at °c. blots were hybridized overnight at °c with p-labeled mouse gus cdna probes. mrna was also analyzed by rt-pcr followed by diagnostic restriction enzyme digestion and analysis on agarose gels (see supporting methods and fig. , which are published as supporting information on the pnas web site). western blot analysis. tissues were dissected and homogenized immediately (by a brinkmann polytron homogenizer for sec at °c) in vol of homogenization buffer ( mm tris�hcl, ph . � mm nacl� mm pmsf). samples containing �g of protein were analyzed by sds�page under reducing conditions as described ( ). the polypeptides were electronically trans- ferred to immobilon-p membranes (millipore). after transblot- ting, the polypeptides were immunostained by using polyclonal rabbit anti-mouse gus antibody followed by incubation with goat anti-rabbit igg (sigma) coupled with peroxidase. the peroxidase activity was visualized by using a chemiluminescent substrate. lysosomal enzyme assays. gus and two other lysosomal enzymes, �-galactosidase and �-hexosaminidase, were assayed f luoro- metrically by using -methylumbelliferyl substrates as described ( – ). tissues were dissected and homogenized immediately (by a brinkmann polytron homogenizer for sec at °c) in vol of homogenization buffer ( mm tris�hcl, ph . � mm nacl� mm pmsf). gus assays on dilutions of wt tissue extracts were done for h, and on mps vii [gustm(e a)sly, gustm(e q)sly, and gustm(l f)sly] extracts for h. assays of other lysosomal enzymes were incubated for h. units were nmol hydrolyzed per h, and activity was expressed as units�mg protein, as determined by micro-lowry assay. analysis of gags. to determine the �g of gags per mg of urinary creatinine, we measured urine with , -dimethylmethylene blue ( – ). creatinine was measured by mixing �l of a -fold diluted urine sample with �l of saturated picric acid (sigma) and �l of . m naoh. absorbance at nm was read after min and compared with a standard. pathology. multiple tissues from six of each of the mps vii mouse strains [gustm(e a)sly, gustm(e q)sly, and gustm(l f)sly], – months of age, were studied morphologically as described ( ). tissues were evaluated for the extent of lysosomal storage. alterations in the three strains were com- pared with each other and with the original mps vii model (gusmps/mps). long bones from the gustm(e a)sly, gustm(e q)sly, and gustm(l f)sly mice were radiographed as described ( ). results generation of gustm(e a)sly, gustm(e q)sly, and gustm(l f)sly knock-in mice. to introduce each point mutation in the gus gene in mouse es cells, we designed a targeting vector with a total of . kb of homologous genomic sequence (fig. ). the mutation was cotransferred with neo f lanked by two loxp sites through homologous recombination in es cells. after selection with g and ganciclovir, doubly resistant clones were screened for homologous recombination by pcr followed by southern blot- ting with a � external probe. of clones screened for each mutation by pcr, e a, e q, and l f were homologous recombinant clones. the presence of the introduced point mutation in the targeted clones was analyzed by pcr amplification followed by restriction enzyme digestion (see supporting methods and fig. ). thirteen of ( %) clones contained the e a mutation (bstui digestion), of ( %) clones contained the e q mutation (rsai digestion), and fig. . targeted mutagenesis of the gus gene. the structure of the endogenous gene, the targeting construct, the homologous recombinant allele, and the neo-excised allele are presented schematically on successive lines. filled rectangles represent exons and the neomycin resistance gene. the open rectangle indicates the tk gene. the striped bar over the wt allele represents the probe used for southern blots. abbreviations for restriction enzymes are: r, ecori; s, sali; x, xhoi. the r with superimposed x indicates the ecori site that was destroyed during the construction of the targeting vector by in vitro mutagenesis without any effect on the consensus splicing sequences. tomatsu et al. pnas � november , � vol. � no. � g en et ic s d o w n lo a d e d a t c a rn e g ie m e llo n u n iv e rs ity o n a p ri l , three of ( %) clones contained the l f mutation (msei digestion). targeted es cells containing each mutant allele were in- jected into c bl� j blastocysts, and chimeric males were obtained, followed by germ-line transmission of the mutant allele (f ). f offspring heterozygous for each of the three mutations were independently intercrossed with c bl� j mice to generate f homozygous mice that were �sv � c bl� j hybrids. this strategy generated mice heterozygous for the mutation, with the expected mendelian segregation (w t and mutant, : ) at birth. phenotype of the mps vii missense mutants. homozygous e a mps vii mice, herein referred to as gustm(e a)sly mice, were not distinguishable phenotypically from heterozygous and ho- mozygous wt littermates at birth but could easily be identified by the time of weaning. they had shortened faces and were slightly smaller. as they aged, their growth retardation, short- ened extremities, and facial dysmorphism became more prom- inent (fig. a). the gustm(l f)sly and gustm(e q)sly mice could not be distinguished from wt mice until at least months of age. their dysmorphism increased slowly with age, but as adults, it was less severe than that seen in the gustm(e a)sly mice. fig. a shows the adult phenotype of the three mps vii mutant mice and that of a normal wt mouse. radiographic analysis of the long bones from gustm(e a)sly, gustm(l f)sly, and gustm(e q)sly mice showed skeletal dyspla- sia similar to that seen in the previously described mps vii gusmps/mps model and in humans with mps vii. radiographs comparing the upper extremities of mutant and normal mice are presented in fig. b. the long bones were shortened, broad, and sclerotic. the most severe alterations were seen in the gustm(e a)sly mice. the c olon ies of gust m ( e a ) s l y, gust m ( e q ) s l y, and gustm(l f)sly mice were maintained by brother-sister matings, genotyped by pcr analysis of genomic dna, and confirmed by enzymatic analysis of extracts of tail samples for gus activity. homozygous offspring from these colonies were analyzed for biochemical, morphological, and histopatholog- ical phenotypes. in more than offspring from each mutant line, crosses between heterozygotes produced progeny with a distribution at weaning of % ���, % ���, and % ��� for the gustm(e a)sly mice; % ���, % ���, and % ��� for the gustm(e q)sly; and % ���, % ���, and % ��� fig. . morphological and radiographic phenotypes of the gustm(e a)sly, gustm(e q)sly, and gustm(l f)sly mice. (a) a -month-old female gustm(e a)sly mouse (far left) is smaller and has dysmorphic features compared with a normal female mouse (far right) of the same age. female, -month-old gustm(l f)sly (second from left) and gustm(e q)sly (second from right) mice have milder dysmorphic features compared with gustm(e a)sly mice, although they are easily distinguishable from a normal mouse at this age. the affected mice all have small heads with blunted noses, short limbs, and a hobbled gait, but differ in clinical severity. (b) radiograph of the scapulae and upper extremities of gustm(e a)sly (far left), gustm(l f)sly (second from left), gustm(e q)sly (second from right), and normal (far right) mice. the long bones of the -month-old female gustm(e a)sly mouse (far left) were shortened, broad, and sclerotic com- pared with the bones of a normal female mouse of the same age (far right). female gustm(l f)sly (second from left) and gustm(e q)sly (second from right) mice have similar but milder abnormalities. fig. . tissue levels of enzyme activity and gags in gustm(e a)sly, gustm(e q)sly, and gustm(l f)sly mice. (a) gustm(e a)sly mice have no residual gus activity in any tissue. gustm(e q)sly mice have . – . % of control level residual activity in liver, kidney, brain, and spleen; gustm(l f)sly mice have � . % activity in liver and kidney and . – . % in brain and spleen. control gus levels were , , , and units�mg in liver, kidney, brain, and spleen, respectively. (b) gustm(e a)sly mice show a higher secondary elevation in �-galactosidase (�-gal) and �-hexosaminidase (�-hex) activity compared with gustm(e q)sly and gustm(l f)sly mice. (c) gustm(e a)sly, gustm(e q)sly, and gustm(l f)sly mice all have significant elevations in urinary gags com- pared with b or mixed background mice. gustm(e a)sly mice have a higher elevation than gustm(e q)sly and gustm(l f)sly mice. � www.pnas.org�cgi�doi� . �pnas. tomatsu et al. d o w n lo a d e d a t c a rn e g ie m e llo n u n iv e rs ity o n a p ri l , for the gustm(l f)sly. only the gustm(e a)sly offspring have reduced survival in the neonatal period, comparable to that reported in the original mps vii gusmps/mps mice ( ). biochemical phenotype of the gustm(e a)sly, gustm(e q)sly, and gustm(l f)sly knock-in mice. the homozygous gustm(e a)sly mice showed the profound deficiency of gus reported in the original fig. . histopathology of the gustm(e a)sly (left), gustm(l f)sly (center), and gustm(e q)sly (right) mice. (a) the liver from a -month-old gustm(e a)sly mouse has sinus-lining cells (arrowhead) distended by lysosomal storage. smaller vacuoles affect hepatocytes and pericanalicular distribution (arrow). (b) the liver from a -month-old gustm(l f)sly mouse has small vacuoles in the kupffer cells and few vacuoles in the hepatocytes. (c) the liver from a -month-old gustm(e q)sly mouse has only small vacuoles in the kupffer cells. (d) renal tubular epithelial cells (arrow) in the kidney of a -month-old gustm(e a)sly mouse contain very large cytoplasmic vacuoles representing lysosomal storage. glomerular visceral epithelial cells (arrowhead) and interstitial cells also have storage, although their cytoplasmic vacuoles are smaller than those seen in the tubular epithelial cells. gustm(l f)sly (e) and gustm(e q)sly (f) mice have very little lysosomal storage in renal tubular epithelial cells and glomerular epithelial cells. (g) vacuolar storage (arrow) is apparent in the meninges overlying the cortex of gustm(e a)sly mice. meninges of gustm(l f)sly (h) and gustm(e q)sly (i) mice show minimal storage. (j) the cornea of a -month-old gustm(e a)sly mouse is altered with fibrocytes (arrow) and endothelial cells (arrowhead) distended with cytoplasmic vacuolization. cornea of gustm(l f)sly (k) and gustm(e q)sly (l) mice have much less storage in stromal and endothelial cells. (toluidine blue, cm � . �m.) tomatsu et al. pnas � november , � vol. � no. � g en et ic s d o w n lo a d e d a t c a rn e g ie m e llo n u n iv e rs ity o n a p ri l , mps vii mice ( ) (fig. a). both the gustm(e q)sly and gustm(l f)sly mice had residual enzyme activity, between . % and . % of normal controls, depending on the tissue measured. the gus activities in the gustm(e q)sly and gustm(l f)sly mice were - to -fold higher than the background levels found in gustm(e a)sly mice. secondary elevations of other lysosomal enzymes, including �-galactosidase and �-hexosaminidase, were noted in most of the tissues of - to -month-old mice (fig. b). in gustm(e a)sly mice, the �-galactosidase level was - to -fold higher than that of normal controls. secondary elevation of �-galactosidase and �-hexosaminidase enzyme activities in tis- sues tended to increase as the mice aged. accumulation of urinary gags. urine was collected from gustm(e a)sly, gustm(e q)sly, gustm(l f)sly, and wt mice. the level of gags in urine from gustm(e a)sly mice was -fold higher than that in normal control mice, whereas the levels from gustm(e q)sly and gustm(l f)sly mice were increased -fold (fig. c). there were no overlapping values between those three mutants and the wt mice. murine gus mrna transcript and expression of murine gus protein. northern blot analyses on total rna isolated from liver of gustm(e a)sly, gustm(e q)sly, gustm(l f)sly, and gus�/� litter- mates showed the presence of a . -kb gus transcript in similar amounts in all mice. transcripts f rom gustm(e a)sly, gustm(e q)sly, and gustm(l f)sly mice were amplified by rt- pcr and sequenced. sequencing showed no alterations except the introduced nucleotide alterations. digestions with bstui, rsai, and msei distinguished the mutant alleles and the normal allele as described (see fig. ). tissues of liver, kidney, spleen, and brain from gustm(e a)sly, gustm(e q)sly, gustm(l f)sly, and normal control mice were homogenized to analyze the expression of the murine gus protein. a single band with the expected mr of the murine gus protein ( kda) was detected by the anti-mouse gus antibody in multiple tissues of mutant mice (data not shown). histopathology of the gustm(e a)sly, gustm(l f)sly, and gustm(e q)sly knock-in mice. the gustm(e a)sly mice had abundant lysosomal storage in liver, kidney, leptomeningeal cells, and cornea (fig. ) and also in spleen, neurons, and retinal pigment epithelium (not shown). the amount and extent of storage was similar to that of the original mps vii gusmps/mps mice ( , ). in the gustm(l f)sly mice, storage was similar in distribution although less extensive. there was very little storage apparent in the brain and spleen in most of the gustm(l f)sly mice, correlating with the presence of residual gus activity in these tissues. gustm(e q)sly mice had much less storage in renal tubular epithelial cells and hepatocytes than the other two strains, which correlated with their higher residual levels of gus in these two tissues. the bone, articular surface, and synovium of the limb joints also differed in severity of histopathology among the gustm(e a)sly, gustm(l f)sly, and gustm(e q)sly mice (see fig. , which is pub- lished as supporting information on the pnas web site). discussion the original gusmps/mps mps vii mouse has a -bp deletion in exon and produces only � of normal levels of gus mrna ( , , ). these mice have many biochemical, pathological, and phenotypic similarities with mps vii pa- tients with a severe phenotype. the majority of patients with human mps vii have different missense mutations that contribute to the broad range of clinical phenotypes. e has been identified as the active-site nucleophile of the human gus gene ( , ). for this reason, we targeted e (the residue homologous with e in human gus) to produce a missense mutation conferring a null mps vii mouse pheno- t ype caused by an enz y matically inactive gus. the gustm(e a)sly mice exhibit a clinical phenotype characterized by facial dysmorphism, growth retardation, behavioral deficits, systemic bone deformities, and shortened extremities, features ver y similar to those obser ved in the original gusmps/mps mouse. the gustm(l f)sly and gustm(e q)sly mice both show milder clinical phenotypes, detectable residual enzyme activity, less elevation in urinary gag excretion, and less severe histopathol- ogy. in addition, females have the ability to carry a pregnancy to term and produce viable pups, whereas the gustm(e a)sly mice cannot. they also have reduced perinatal mortality compared w ith the e a mut ant mice. gust m ( e a ) s l y /� � gustm(e a)sly/� matings produce fewer than the expected % ��� mice at wean ing. however, the percent age of gustm(l f)sly/tm(l f)sly and gustm(e q)sly/tm(e q)sly mice at weaning did not differ significantly from %. although facial dysmorphism and radiographic features gradually became ap- parent in the mice homozygous for gustm(e q)sly and gustm(l f)sly mutations by – months of age, the mice were larger and appeared healthier during a longer period of their life. the increased viability and fitness of fetuses and newborn pups, the increase in pups surviving to weaning age, and a milder phenotype as adults indicate how much benefit a small amount of residual enzyme can provide. the lysosomal storage in liver, spleen, and kidney was less in age-matched gustm(l f)sly and gustm(e q)sly mice than in gustm(e a)sly mice. quantitative excretion of urinary gags was also less than in age-matched gustm(e a)sly mice. secondary elevation of other lysosomal enzymes was observed in all three mutant strains. however, the lower elevation of �-galactosidase in gustm(l f)sly and gustm(e q)sly mice than gustm(e a)sly mice shows how sensitive this enzyme is as a secondary marker of gag accumulation. it is for this reason that �-galactosidase is a valuable marker for following the response to enzyme replacement therapy ( ). we have not identified the mechanism underlying the residual gus activity produced by the e q but not the e a knock-in allele. in vitro expression studies also showed that cells expressing human e q (or mouse e q) had detectable levels of gus activity ( ). several factors could explain this residual activity. glutamate (e) and glutamine (q) residues are similar amino acids and differ only in one additional amino group on glutamine. the chemical differ- ence, including composition, polarity, and molecular volume, between e and q is minimal, whereas the chemical difference between e and a (alanine) is greater ( ). possibly, q has a low level of activity as a nucleophile ( ), whereas a has none. also, enzymatic or nonenzymatic conversion of q to e by in vivo deamidation could also contribute ( ). the higher levels of e q activity in liver and kidney compared with other tissues favor this explanation. the l f mutation in murine mps vii led to a milder phenotype, as has been seen with many human mps vii patients homozygous for the orthologous (l f) mutation. in vitro expression studies showed that overexpression of gus cdna containing the l f mutation resulted in – % of the gus activity of the w t cdna ( ). however, the fibro- blasts from human mps vii patients homozygous for the l f mutation revealed only . – % of enzyme activity. the discrepancy between the mps phenotype, which was consis- tent with the low level of activity in cells from patients, and the much-higher-than-expected level of gus activity generated by transient expression has been seen in other mutations of the human gus gene ( , ). however, the l f mutation is the most extreme example. it has been suggested that overexpres- sion of mutant monomers could, by mass action, drive the folding reaction or the assembly into tetramers, which achieve a more stable conformation once formed ( ). whether one can � www.pnas.org�cgi�doi� . �pnas. tomatsu et al. d o w n lo a d e d a t c a rn e g ie m e llo n u n iv e rs ity o n a p ri l , exploit this possibility to test chemical chaperones to drive unstable mutant monomers into stable, active tetramers in mice (or patients) is an interesting therapeutic question ( , ). the l f mps vii mouse allows us to test this hypoth- esis. in addition, all three of the missense murine models of mps vii reported here should be useful for developing other strategies for treating lysosomal storage disorders, such as chimeric oligonucleotide-directed gene repair ( ). m. rafiqul islam, yanhua bi, and christopher c. holden provided valuable technical assistance. this work was supported by national institutes of health grants gm and dk (to w.s.s.). . sly, w. s., quinton, b. a., mcalister, w. h. & rimoin, d. l. ( ) j. pediatr. , – . . tomatsu, s., sukegawa, k., ikedo, y., fukuda, s., yamada, y., sasaki, t., okamoto, h., kuwabara, t. & orii, t. ( ) gene , – . . tomatsu, s., fukuda, s., sukegawa, k., ikedo, y., yamada, s., yamada, y., sasaki, t., okamoto, h., kuwahara, t. & yamaguchi, s. ( ) am. j. hum. genet. , – . . shipley, j. m., klinkenberg, m., wu, b. m., bachinsky, d. r., grubb, j. h. & sly, w. s. ( ) am. j. hum. genet. , – . . wu, b. m. & sly, w. s. ( ) hum. mutat. , – . . vervoort, r., lissens, w. & liebaers, i. ( ) hum. mutat. , – . . wu, b. m., tomatsu, s., fukuda, s., sukegawa, k., orii, t. & sly, w. s. ( ) j. biol. chem. , – . . vervoort, r., islam, m. r., sly, w. s., zabot, m. t., kleijer, w. j., chabas, a., fensom, a., young, e. p., liebaers, i. & lissens, w. ( ) am. j. hum. genet. , – . . islam, m. r., vervoort, r., lissens, w., hoo, j. j., valentino, l. a. & sly, w. s. ( ) hum. genet. , – . . vervoort, r., buist, n. r., kleijer, w. j., wevers, r., fryns, j. p., liebaers, i. & lissens, w. ( ) hum. genet. , – . . vervoort, r., gitzelmann, r., bosshard, n., maire, i., liebaers, i. & lissens, w. ( ) hum. genet. , – . . rafiqul, i. m., gallegos arreola, m. p., wong, p., tomatsu, s., corona, j. s. & sly, w. s. ( ) prenatal diagn. , – . . vervoort, r., gitzelmann, r., lissens, w. & liebaers, i. ( ) hum. genet. , – . . jain, s., drendel, w. b., chen, z. w., mathews, f. s., sly, w. s. & grubb, j. h. ( ) nat. struct. biol. , – . . wong, a. w., he, s., grubb, j. h., sly, w. s. & withers, s. g. ( ) j. biol. chem. , – . . islam, m. r., tomatsu, s., shah, g. n., grubb, j. h., jain, s. & sly, w. s. ( ) j. biol. chem. , – . . birkenmeier, e. h., davisson, m. t., beamer, w. g., ganschow, r. e., vogler, c. a., gwynn, b., lyford, k. a., maltais, l. m. & wawrzyniak, c. j. ( ) j. clin. invest. , – . . sands, m. s. & birkenmeier, e. h. ( ) proc. natl. acad. sci. usa , – . . marth, j. d. ( ) j. clin. invest. , – . . laemmli, u. k. ( ) nature , – . . wagner, t. e., hoppe, p. c., jollick, j. d., scholl, d. r., hodinka, r. l. & gault, j. b. ( ) proc. natl. acad. sci. usa , – . . glaser, j. h. & sly, w. s. ( ) j. lab. clin. med. , – . . peterson, g. l. ( ) anal. biochem. , – . . bjornsson, s. ( ) anal. biochem. , – . . whitley, c. b., ridnour, m. d., draper, k. a., dutton, c. m. & neglia, j. p. ( ) clin. chem. , – . . poorthuis, b. j., romme, a. e., willemsen, r. & wagemaker, g. ( ) pediatr. res. , – . . vogler, c., birkenmeier, e. h., sly, w. s., levy, b., pegors, c., kyle, j. w. & beamer, w. g. ( ) am. j. pathol. , – . . soper, b. w., pung, a. w., vogler, c. a., grubb, j. h., sly, w. s. & barker, j. e. ( ) pediatr. res. , – . . sands, m. s., vogler, c., kyle, j. w., grubb, j. h., levy, b., galvin, n., sly, w. s. & birkenmeier, e. h. ( ) j. clin. invest. , – . . grantham, r. ( ) science , – . . robinson, n. e. & robinson, a. b. ( ) proc. natl. acad. sci. usa , – . . tamarappoo, b. k. & verkman, a. s. ( ) j. clin. invest. , – . . frustaci, a., chimenti, c., ricci, r., natale, l., russo, m. a., pieroni, m., eng, c. m. & desnick, r. j. ( ) n. engl. j. med. , – . . kren, b. t., bandyopadhyay, p. & steer, c. j. ( ) nat. med. , – . tomatsu et al. pnas � november , � vol. � no. � g en et ic s d o w n lo a d e d a t c a rn e g ie m e llo n u n iv e rs ity o n a p ri l , untitled noradrenergic neuronal development is impaired by mutation of the proneural hash- gene in congenital central hypoventilation syndrome (ondine’s curse) loı̈c de pontual ,{ , virginie népote ,{ , tania attié-bitach ,{ , hassan al halabiah , ha trang , vincent elghouzzi , béatrice levacher , karim benihoud , joëlle augé , christophe faure , béatrice laudier , michel vekemans , arnold munnich , michel perricaudet , françois guillemot , claude gaultier , stanislas lyonnet , michel simonneau and jeanne amiel ,* unité de recherches sur les handicaps génétiques de l’enfant inserm u- , and département de génétique, hôpital necker-enfants malades, paris, france, service de physiologie, inserm e , and cic inserm , hôpital robert debré, paris, france, umr cnrs, igr, villejuif, france and nimr, mill hill, uk received august , ; revised and accepted september , congenital central hypoventilation syndrome (cchs, ondine’s curse) is a rare disorder of the chemical control of breathing. it is frequently associated with a broad spectrum of dysautonomic symptoms, suggesting the involvement of genes widely expressed in the autonomic nervous system. in particular, the hash- –phox a–phox b developmental cascade was proposed as a candidate pathway because it controls the development of neurons with a definitive or transient noradrenergic phenotype, upstream from the ret receptor tyrosine kinase and tyrosine hydroxylase. we recently showed that phox b is the major cchs locus, whose mutation accounts for % of cases. we also studied the proneural hash- gene and identified a heterozygous nucleotide substitution in three cchs patients. to analyze the functional consequences of hash- mutations, we developed an in vitro model of noradrenergic differentiation in neuronal progenitors derived from the mouse vagal neural crest, reproducing in vitro the hash–phox–ret pathway. all hash- mutant alleles impaired noradrenergic neuronal development, when overexpressed from adenoviral constructs. thus, hash- mutations may contribute to the cchs phenotype in rare cases, consistent with the view that the abnormal chemical control of breathing observed in cchs patients is due to the impairment of noradrenergic neurons during early steps of brainstem development. introduction congenital central hypoventilation syndrome (cchs, ondine’s curse, mim ) is a life-threatening disorder characterized by persistent hypoventilation during sleep, beginning in the neonatal period and requiring life-long ventilatory assistance ( ). while the pathophysiologic mechanisms underlying cchs remain elusive, several lines of evidence suggest that genetic factors are involved (occurrence in siblings, concordant monozygotic twins and rare vertical transmission) ( ). changes in the integration of afferent inputs from central and peripheral chemoreceptors in the brainstem are the most likely disease mechanisms. in addition, most cchs patients present a broader defect of the autonomic nervous system ( ), including hirschsprung disease ( – % of cases, haddad syndrome, mim ) ( ), a malformation of the enteric nervous system that has been ascribed to a mutation at the ret receptor tyrosine kinase locus. in mice, the ret signaling pathway, which involves the sequential expression of the mash , phox, ret and th genes, is responsible for the development of all *to whom correspondence should be addressed at: département de génétique, hôpital necker-enfants malades, , rue de sèvres, paris cedex , france. tel: þ ; fax: þ ; email: amiel@necker.fr { the authors wish it to be known that, in their opinion, the first three authors should be regarded as joint first authors. human molecular genetics, , vol. , no. – doi: . /hmg/ddg human molecular genetics, vol. , no. # oxford university press ; all rights reserved a t u n ive rsite d e m o n tre a l - b ib lio th e q u e s - a cq u isitio n s (p e rio d iq u e s) o n a u g u st , h ttp ://h m g .o xfo rd jo u rn a ls.o rg d o w n lo a d e d fro m http://hmg.oxfordjournals.org transient or permanent noradrenergic derivatives ( , ). we recently showed that phox b is the major disease-causing gene in both cchs and haddad syndromes, with an autosomal dominant mode of inheritance and de novo mutations at the first generation ( ). cross-regulation of the phox and mash- genes has been shown in mice ( , ); moreover, newborn mash- þ/� heterozygous mice show an impaired ventilatory responses to hypercarbia ( ). we therefore regarded the human ortholog of mash (hash- ), which encodes a tissue-specific basic helix–loop–helix transcription factor, as an additional candidate gene for cchs. we identified a heterozygous nucleotide substitution of the hash- gene in three patients. the functional consequences of hash- mutations were studied using a novel in vitro model of noradrenergic differentiation based on neuronal progenitors derived from the mouse vagal neural crest and reproducing in vitro the hash–phox–ret pathway. forced expression of each of the mutant hash- alleles induced the impairment of noradrener- gic neuronal development. we conclude that, at least in some cases, heterozygous hash- mutation may contribute to the cchs phenotype by modifying noradrenergic neurons during early steps of brainstem development, and that the hash- gene is tightly involved in the formation of the neuronal network for autonomous control of ventilation in human. results hash- heterozygous nucleotide substitutions we screened the single coding exon of hash- for nucleotide variations in a series of cchs patients (fig. ). we obtained an abnormal sscp pattern in three cases. direct dna sequencing showed a c to a transversion at nucleotide , resulting in a proline to threonine substi- tution at amino acid position (p t), in a female patient with isolated cchs. two in-frame deletions of five ( – del nt, a –a del) and eight ( – del nt, a –a del) alanine codons in a -residue polyalanine tract, were identified in female patients with cchs and haddad syndrome respectively (fig. a). both the p t and the a –a del mutations were inherited from the healthy father (fig. a), while the mother of the patient with the a –a del mutation was not available for study. the hash- mutations are located in regions highly conserved across mammalian ash genes as shown by clustal w analysis (fig. b). these data suggest that these protein domains are functionally relevant. accordingly, none of the hash- gene mutations was detected in a panel of control chromosomes. interestingly, a de novo mutation of phox b (polyalanine expansion of seven alanines) was found in the patient harboring the p t mutation of the hash- gene, whereas direct sequencing of the three exons of phox b showed no variation in the other two cases. indeed, all cchs patients described in this series have been tested for the ret, gdnf and phox b genes ( ). hash- expression in early human development we further investigated the possible involvement of hash- mutations in the cchs phenotype by studying the pattern of expression of hash- in early human development (fig. ). consistent with the wide spectrum of afferent nervous system (ans) dysfunction observed in cchs patients and the pattern of expression in mice ( , ), hash- is expressed in both the central nervous system (mesencephalon, rhombencephalon, spinal cord; fig. a, b and e–h), and the peripheral nervous system (cells lining the dorsal aorta, presumed to be neural crest-derived precursors of the sympathetic ganglia, fig. c and d) from carnegie stage . at carnegie stage , hash- expression was detected in the presumptive enteric nervous system, from the esophagus to the rectum (fig. e–h) and in the adrenal medulla (fig. i and j). functional analysis of hash- mutant alleles we investigated the effects of the hash- mutated alleles on their transcriptional activity by means of a luciferase assay. p cells were co-transfected with hash- alleles (þ/� e ) and the luciferase gene under the control of the delta promoter. the transcriptional activities of the p t and a -a del alleles were similar to that of the control, regardless of whether the e cofactor was present (data not shown, available on request). we then overexpressed the wild-type and mutant hash- alleles, and assessed the functional consequences for the differentiation of the noradrenergic lineage, using the phox– ret signaling pathway and the tyrosine hydroxylase (th) phenotype as markers ( , ). we demonstrated that undiffer- entiated vagal neural crest progenitor cells, isolated from e mouse embryos, may be engaged in noradrenergic differentia- tion, and then sequentially produce phox a, ret, and th, thereby reproducing the mouse mash- molecular cascade (fig. a). interestingly, no alternative lineage was obtained, as almost all thþ cells were derived from phox a-expressing neurons. we then showed that it was possible to reproduce the catecholaminergic differentiation pathway, h after the forced expression of hash- by recombinant adenoviruses (fig. b and c). all the infected cells ( %) were transduced with the hash- adenoviral constructs (fig. ), as shown by gfp production (fig. b). the overexpression of wild-type hash- resulted in the differentiation of . � % (n¼ ) of neural crest cells into postmitotic noradrenergic derivatives, as shown by phox a production (data not shown). these values are similar to those previously reported for retroviral forced expression ( ). we investigated the functional consequences of hash- gene mutations for the noradrenergic lineage (fig. b). all mutated forms of hash- tested led to a significant decrease ( – %) in the number of neuronal derivatives of the noradrenergic lineage, as shown by phox a production (fig. b). in particular, only . � . % (p < . ) of neural crest progenitors differentiated to give a noradrenergic phenotype using the a –a del hash- mutant construct, whereas . � . % and . � . % of cells produced phox a when the p t and a –a del hash- mutant alleles, respectively, were used (p < . ; fig. b). discussion taking advantage of the well-characterized specification of catecholaminergic neurons derived from the vagal neural crest human molecular genetics, , vol. , no. a t u n ive rsite d e m o n tre a l - b ib lio th e q u e s - a cq u isitio n s (p e rio d iq u e s) o n a u g u st , h ttp ://h m g .o xfo rd jo u rn a ls.o rg d o w n lo a d e d fro m http://hmg.oxfordjournals.org ( ), we recapitulated in vitro the molecular cascade involved in the early steps of noradrenergic determination. in that system, we used a forced expression of wild-type and mutant hash- to test the functional relevance of mutated hash- alleles identified in cchs patients. we showed a significant decrease in the number of noradrenergic neurons generated after expression of mutant hash- alleles. however, this is a limited effect considering that patients are heterozygotes for the hash- mutated allele as opposed to our experimental model. nevertheless, subtle consequences on the noradrenergic neuronal development could be expected with hash- gene mutations lying outside of the bhlh domain of the protein. moreover, the hash- mutations were located in highly conserved regions of the protein, although not involved in the basic helix–loop–helix consensus motives ( ). together with the expression pattern of hash- in the developing human embryo, these results cope well with the phenotype of heterozygous mash- þ/� mice ( ). these data also suggest that variant hash- alleles may contribute to the cchs phenotype. however, hash- gene mutations are neither necessary (most patients do not have a hash- gene variant), nor sufficient for cchs to occur (carriers have no phenotypic expression). this observation is reminiscent of the findings in isolated hirschsprung disease in the mennonite population, where endothelin b receptor (ednrb) mutations are neither necessary nor sufficient for the disease to occur and act in conjunction with a yet unknown hypomorphic ret allele ( ). the question as to whether hash- acts as a modifier of phox b, and/or a disease-causing autosomal dominant gene with incomplete penetrance remains unresolved. figure . hash- gene mutations and phylogenetic analysis of hash- proteins. (a) hash- gene mutations. sscp results and mutated sequences are illustrated for the three individuals whose pedigrees are shown directly above. (b) clustal w alignment of the human hash- protein and its mouse, drosophila and c. elegans orthologs. the residues mutated in cchs patients are indicated by arrows. note the conservation of the basic, helix , loop and helix amino acid domains between the four species studied. human molecular genetics, , vol. , no. a t u n ive rsite d e m o n tre a l - b ib lio th e q u e s - a cq u isitio n s (p e rio d iq u e s) o n a u g u st , h ttp ://h m g .o xfo rd jo u rn a ls.o rg d o w n lo a d e d fro m http://hmg.oxfordjournals.org polyalanine repeats are common in transcription factors but their normal function is largely unknown. expansions of polyalanine tracts in transcription factors, including de novo phox b polyalanine expansions in cchs, have been shown to be responsible for disease in several malformation syndromes in humans ( , ), whereas contractions have not been reported thus far. polyalanine contractions may therefore act as hypomorphic alleles. as the cchs phenotypes of patients with phox b and hash- mutations are undistinguishable, our data suggest that any mutation affecting the hash- –phox developmental pathway is likely to impair the development of neurons of the figure . hash- gene expression in developing human embryos. slides stained with hematoxylin-eosin (a, c, e, g, i) and dark-field illumination of the hybri- dized adjacent sections (b, d, f, h, j) on day (carnegie , a–d), and day (carnegie , e–j). parasagittal sections showing weak hash- expression at carnegie stage and strong expression of this gene at carnegie stage in mesencephalon (mes), rhombencephalon (rh), and the dorsal area of the spinal cord (sc) (arrowheads, a, b and e–h, respectively). from carnegie stage , expression was detected in cells to the side of the dorsal aorta (arrow, d). hash- expres- sion was also detected in the intestine, from the foregut (arrow, f) to the hindgut (arrow, h), and in the adrenal medulla (arrow, j) at carnegie stage . ad, adrenal gland; ao, aorta; go, gonad; meta, metanephros; mes, mesencephalon; meso, mesonephros; e, esophagus; re, rectum; rh, rhombencephalon; sc, spinal cord. human molecular genetics, , vol. , no. a t u n ive rsite d e m o n tre a l - b ib lio th e q u e s - a cq u isitio n s (p e rio d iq u e s) o n a u g u st , h ttp ://h m g .o xfo rd jo u rn a ls.o rg d o w n lo a d e d fro m http://hmg.oxfordjournals.org figure . in vitro culture model of mouse vagal neural crest cells to analyze the hash- –phox b/phox a cascade controlling. (a) experimental design; ncscs were isolated from e . mouse embryo neural tubes (nt). ec, ectoderm; som, somite; end, endoderm; nc, neural crest. (b) transcription-factor cascade controlling the ret and tyrosine hydroxylase (th) lineage of neural crest cells (ncscs). cells cultured in the presence of diffusible embryonic mesodermic factors retain the capacity to generate catecholaminergic derivatives, as shown by neurofilament (nf ) and th production, recapitulating the mash –phox b– phox a–ret pathway as in vivo (lower arrow). conversely, ncscs cultured in medium containing serum (fcs medium) remain multipotent and retain their proliferative abilities (upper arrow). (c) sequential expression of the mash –phox a–ret–th gene pathway, studied in cultured ncscs by immunohistochemistry (first row), peripherin staining (per, second row), merged immunohistochemistry and peripherin staining (merged, third row) and in situ hybridization (phase, fourth row), from day to day (d –d ). the mash (d ), phox a (d ), ret (d ) and th (d ) are shown in red fluorescence; the peripherin (d –d ) and neurofilament (nf , nf, d ) are shown in green fluorescence. (d) temporal expression of the mash –phox a–ret–th gene pathway during ncscs culture, from day (d ) to day (d ). the expression timing of mash , phox a, ret and th are indicated by solid bars. peripherin and nf (nf ) are consistently expressed from d to d . human molecular genetics, , vol. , no. a t u n ive rsite d e m o n tre a l - b ib lio th e q u e s - a cq u isitio n s (p e rio d iq u e s) o n a u g u st , h ttp ://h m g .o xfo rd jo u rn a ls.o rg d o w n lo a d e d fro m http://hmg.oxfordjournals.org noradrenergic lineage and the resulting defect may modify the respiratory network in the brainstem and periphery. materials and methods patients a series of patients fulfilled the inclusion criteria for diagnosis of cchs namely: (i) hypoventilation, hypoxemia and hypercarbia during quiet sleep on polygraphic respiratory recording; with (ii) no cardiac, pulmonary, neuromuscular, eeg or cerebral mri abnormality ( ). haddad syndrome was diagnosed in cases ( %, five long segment hscr, two short segment hscr, four unknown). the histological criteria for hscr were: (i) absence of enteric plexuses with histological evaluation of the aganglionic tract; and (ii) strong histochemical staining of acetylcholinesterase in nerve fibers. blood samples were obtained with informed consent and dna was extracted according to standard protocols. we screened the coding sequence of the hash- gene by single-strand conformation polymorphism (sscp) analysis and/or direct dna sequencing. the pcr products were heated for min at �c, loaded onto a hydrolink mde gel figure . functional analysis, indicating a decrease in the number of noradrenergic neuronal derivatives obtained from ncscs after forced expression of the three mutated forms of hash- , with respect to the wild-type. (a) hash- adenovirus constructs for the production of both green fluorescent protein (gfp) and wild- type or mutated forms of hash under cytomegalovirus (cmv) promoter control. (b) left panel: representative samples of infected ncscs h after infection with adenoviruses producing the wild-type (wt) and mutant (p t, a –a del, a –a del) forms of hash- . gfp was detected by its green fluorescence and phox a was detected by staining with fast red. a typical phox a-positive cell is indicated by a white arrow; a typical phox a-negative cell for is indicated by a white arrowhead. right panel: percentage of phox a positive cells, illustrating the decrease in the number of noradrenergic derivatives obtained from ncscs after infection with the mutant hash- retroviral constructs (p t, a –a del and a –a del). human molecular genetics, , vol. , no. a t u n ive rsite d e m o n tre a l - b ib lio th e q u e s - a cq u isitio n s (p e rio d iq u e s) o n a u g u st , h ttp ://h m g .o xfo rd jo u rn a ls.o rg d o w n lo a d e d fro m http://hmg.oxfordjournals.org (bioprobe), and subjected to electrophoresis at w. the gel was then dried and placed against a x-ray film for h. if an abnormal sscp pattern was observed, direct dna sequencing was performed by the fluorometric method, for both strands (big dyeterminator cycle sequencing kit, applied biosystems, warrington, uk). in situ hybridization in human embryos human embryos and fetal tissues were collected from legally terminated pregnancies in agreement with french law and ethics committee recommendations. tissues were prepared as previously described ( ). a bp pcr fragment correspon- ding to hash- exon was amplified from human genomic dna with a t extension (taatacgactcactagggaga) added to both primers to generate the sense and antisense probes. probes were labeled with [ s]utp and purified as pre- viously described ( ). tissues on slides were dehydrated, placed against biomax mr x-ray film (amersham) for days, and immersed in kodak ntb emulsion for weeks at þ �c. developed and toluidine blue-counterstained slides were analyzed with dark- and bright-field illumination. no hybridiza- tion signal was detected with the sense probe (data not shown). construction of adenoviral plasmids adenoviral plasmids were constructed using the adeasy system ( ). polyalanine tract contractions and the control hash- coding sequence were amplified by polymerase chain reaction with the primer, tctagacgcatggaaa- gctctgccaa, and the primer, gtcgactcagaacc- agttggtgaagtcga, using genomic dna from controls or patients. pcr-derived fragments were checked by sequen- cing and subcloned into the pad-track cmv vector, using the xbai–sali restriction sites. pad-track cmv vectors were used to produce viruses that could be tracked by following gfp fluorescence. adenoviral plasmids were generated by homologous recombination in electrocompetent e. coli bj , according to the manufacturer’s instructions (stratagene). adenoviral plasmids were then cut with paci and viral stocks were produced in qbi- a cells. mouse neural crest culture neural crest cells were cultured as previously described ( ). neural tubes were microdissected from swiss mouse (iffa credo) embryos on day of gestation. somites and surrounding tissues were removed to obtain neural tube segments corresponding to the first seven somites of the vagal region. these segments were then plated on fibronectin-coated glass coverslips ( mg/ml, boehringer roche) and cultured for days in dmem (life technologies) supplemented with % fetal calf serum (abcys) and iu/ml penicillin/streptomycin (life technologies), at �c, in a humidified atmosphere containing % co . infection of primary cultures of neural crest cells we tested various levels of multiplicity of infection (moi) and decided to use plaque-forming unit (pfu), which gave % infected neural crest cells. neural crest cells (nccs) were cultured for days, infected on day and fixed h later. acknowledgements we thank bert vogelstein for adenoviral constructs, and frances goodman and jean-françois brunet for helpful discussions. h.a. was recipient of an ifro fellowship. v.n. was partly supported by a fondation pour la recherche médicale fellowship. this work was supported by grants from eurexpress, hmr (hoechst-marion-roussel), the european community ( - ), fondation pour la recherche médicale, and association française contre les myopathies- inserm (maladies rares). references . gozal, d. ( ) congenital central hypoventilation syndrome: an update. pediatr. pulmonol., , – . . amiel, j., laudier, b., attié-bitach, t., trang, h., de pontual, l., gener, b., trochet, d., etchevers, h., ray, p., simonneau, m. et al. ( ) polyalanine expansion and frameshift mutations of the paired-like homeobox gene phox b in congenital central hypoventilation syndrome. nat. genet., , – . . croaker, g.d., shi, e., simpson, e., cartmill, t. and cass, d.t. ( ) congenital central hypoventilation syndrome and hirschsprung’s disease. arch. dis. child., , – . . brunet, j.f. and pattyn, a. ( ) phox genes—from patterning to connectivity. curr. opin. genet. dev., , – . . goridis, c. and rohrer, h. ( ) specification of catecholaminergic and serotonergic neurons. nat. rev. neurosci., , – . . pattyn, a., morin, x., cremer, h., goridis, c. and brunet, j.f. ( ) the homeobox gene phox b is essential for the development of autonomic neural crest derivatives. nature, , – . . pattyn, a., goridis, c. and brunet, j.f. ( ) specification of the central noradrenergic phenotype by the homeobox gene phox b. mol. cell. neurosci., , – . . dauger, s., renolleau, s., vardon, g., népote, v., mas, c., simonneau, m., gaultier, c. and gallego, j. ( ) ventilatory responses to hypercapnia and hypoxia in mash- heterozygous newborn and adult mice. pediatr. res., , – . . guillemot, f. and joyner, a.l. ( ) dynamic expression of the murine achaete–scute homologue mash- in the developing nervous system. mech. dev., , – . . guillemot, f., lo, l.c., johnson, j.e., auerbach, a., anderson, d.j. and joyner, a.l. ( ) mammalian achaete-scute homolog is required for the early development of olfactory and autonomic neurons. cell, , – . . lo, l., tiveron, m.c. and anderson, d.j. ( ) mash activates expression of the paired homeodomain transcription factor phox a, and couples pan-neuronal and subtype-specific components of autonomic neuronal identity. development, , – . . lo, l., morin, x., brunet, j.f. and anderson, d.j. ( ) specification of neurotransmitter identity by phox proteins in neural crest stem cells. neuron, , – . . bertrand, n., castro, d.s. and guillemot, f. ( ) proneural genes and the specification of neural cell types. nat. rev. neurosci., , – . . puffenberger, e.g., hosoda, k., washington, s., nakao, k., dewit, d., yanagisawa, m. and chakravart, a. ( ) a missense mutation of the endothelin-b receptor gene in multigenic hirschsprung’s disease. cell, , – . . goodman, f.r. and scambler, p.j. ( ) human hox gene mutations. clin. genet., , – . . stromme, p., mangelsdorf, m.e., shaw, m.a., lower, k.m., lewis, s.m., bruyere, h., lutcherath, v., gedeon, a.k., wallace, r.h., scheffer, i.e. et al. ( ) mutations in the human ortholog of aristaless cause x-linked mental retardation and epilepsy. nat. genet., , – . human molecular genetics, , vol. , no. a t u n ive rsite d e m o n tre a l - b ib lio th e q u e s - a cq u isitio n s (p e rio d iq u e s) o n a u g u st , h ttp ://h m g .o xfo rd jo u rn a ls.o rg d o w n lo a d e d fro m http://hmg.oxfordjournals.org . weese-mayer, d.e., shannon, d.c., keens, t.g. and silvestri, j.m. ( ) idiopathic congenital central hypoventilation syndrome: diagnosis and management. am. j. respir. crit. care med., , – . . odent, s., attié-bitach, t., blayau, m., mathieu, m., augé,j., delezoide, a.l., gall, j.y., le marec, b., munnich, a., david, v. et al. ( ) expression of the sonic hedgehog (shh) gene during early human development and phenotypic expression of new mutations causing holoprosencephaly. hum. mol. genet., , – . . he, t.c., zhou, s., da costa, l.t., yu, j., kinzler, k.w. and vogelstein, b. ( ) a simplified system for generating recombinant adenoviruses. proc. natl acad. sci. usa, , – . . boisseau, s. and simonneau, m. ( ). mammalian neuronal differentiation: early expression of a neuronal phenotype from mouse neural crest cells in a chemically defined cultured medium. development, , – . human molecular genetics, , vol. , no. a t u n ive rsite d e m o n tre a l - b ib lio th e q u e s - a cq u isitio n s (p e rio d iq u e s) o n a u g u st , h ttp ://h m g .o xfo rd jo u rn a ls.o rg d o w n lo a d e d fro m http://hmg.oxfordjournals.org mem onite settlement in the lower fraser valley by a l f r e d henry siemens b.a., university of b r i t i s h columbia, a thesis submitted i n p a r t i a l f u l f i l l m e n t of the requirements for the degree of master of arts i n the department of geography we accept this thesis as conforming to the required standard the university of british columbia a p r i l , i abstract this study attempts to trace the historical geo- graphy of mennonite settlements in the fraser valley, to single out for analysis significant changes in their struc- ture and function and to summarize their distinctive charac- teristics by means of statistics, maps, photos and descrip- tion. a l l this is to l i f t a segment of one ethnic group out of the mosaic of the canadian population and show what has been i t s part in the shaping of the landscape of british columbia^ densely settled southwestern corner. fo obtain the necessary historical information the relatively few systematic published studies were con- sulted; but the bulk ©f the information was pieced together from interviews of pioneers, newspaper clippings, historical accounts by church o f f i c i a l s on anniversary celebrations (usually unpublished), personal knowledge of events con- cerned and other sources. much of this information was placed into i t s historical geographical context for the f i r s t time. the statistics necessary for outlining d i s t r i - bution and structure of the mennonite population came from the listings in the census of canada under the classifica- tion of religious a f f i l i a t i o n , from church records of the individual congregations, compilations in mennonite year** books of various kinds, school records as well as from estimates given by responsible people in cases where docu- mented figures were not available. the information so obtained was portrayed cartographically by means of dot maps, an isopleth map, a centrogram and a flow diagram. the centro- gram was of particular interest in that i t showed shifts in the center of gravity of the mennonite population of the fraser valley which were closely corroborated by economic and social currents within the community. the flow diagram was used to portray graphically the centrality of the settlement of clearbrook with reference to one c r i t e r i a - i t s attraction of young people into the mennonite high school located there. this was supplemented by a discussion of other oriteria of centrality for this community, which now represents the most important concentration of mennonites in the fraser valley and, indeed, i n the whole province. the actual settlement forms that have resulted from mennonite occupanoe of the land were considered after some aspects of the history of the group had been traced and i t s present situation in the fraser valley outlined. the individual holding, the small nucleatlon, the sizeable men- nonite centers of yarrow and clearbrook, as well as the urban community in vancouver were described and analysed in turn, with a view particularly toward capturing peculiar- i t i e s , ascertaining the extent of obliteration of former characteristics and finding some definite marks of the degree of acculturation experienced by the people themselves. the principal conclusions of the study are simply a substantiation of what i s known more or less accurately about the situation of other ethnic groups in our country and elsewhere. the mennonites have retained a considerable number of peculiarities up to the present time, and the expression of these in the nature of their settlement has been the main concern of this paper. the cultural and economic changes,however,that are sweeping a l l segments of the popu- lation toward farm rationalization and urbanization, are affecting them as well. in many cases the only peculiarities that persist are theological. under these circumstances a recurrence of a traditional group response such as mass migration or even traditional individual responses like the preservation of the german language in the home are d i f f i c u l t to envisage for the immediate future. .'.j in presenting t h i s thesis i n p a r t i a l fulfilment of the requirements for an advanced degree at the university of b r i t i s h columbia, i agree that the library s h a l l make i t freely available for reference and study. i further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his representatives. it i s understood that copying or publication of this thesis for f i n a n c i a l gain s h a l l not be allowed without my written permission. department of geography , the university of british.columbia, vancouver , canada. date feb. , i acknowledgements the author g r a t e f u l l y acknowledges the continuous interest, frequent advice and careful c r i t i c i s m offered throughout the preparation of this thesis by the head of the department of geography, dr. j. l. robinson, and the thesis adviser, dr. r. i. ruggles. he i s especially indebted, also, to mr. herbert klassen for allowing free access to his l i b r a r y i n abbotsford and to rev. p. r. toews of vancouver for the use of numerous books from his l i b r a r y . many people kindly contributed information and of these mr. j. c. krause of yarrow, mr. dick rempel of mission and rev. j. b. wiens of vancouver deserve special thanks. the appreciation shown by many leaders i n the community, p a r t i c u l a r l y the faculty of the mennonite educational institute, was a r e a l encouragement. table of contents chapter page i introduction .ii early history of the mennonites anabaptism ethnic o r i g i n establishment and u n i f i c a t i o n settlement on the v i s t u l a delta of poland settlement i n russia movement i n t o canada movement i n t o b r i t i s h . columbia iii physical characteristics of the fraser valley lowlands general features of the t e r r a i n climate morphology, vegetation, s o i l cover and a g r i c u l t u r a l use of mennonite settlement areas f l a t l a n d s from agassiz to upper sutnas matsqui m i s s i o n abbotsford aldergrove " surrey l u l u i s l a n d chapter page iv sequent occupance of the mennonites in the fraser valley methods of land procurement periods of settlement pioneer period post-war "boom" -present period of centralization and urbanization v a statistical delineation of the situation of the mennonites in the fraser valley . sources distributions charaeteristics of mennonite population patterns of immigration concentration _ shifts i n the center of gravity of the group the fraserview mennonite brethren church - an example study vi - intra-group movement patterns vii settlement forms farm types small non-farm nucleations prominent mennonite centers yarrow * clearbrook urban settlement i n vancouver chapter page viii conclusions bibliography appendices a. table xv b. table xvi c. table xvii d. suggestions for further research e. photographic supplement list of maps page . locations! map for mennonite settlement in poland and prussia . . . . . . . . . . . mennonite settlement in southern european russia before . . . source of migrants into british columbia . . . . . church tributary regions and the movement of the center of gravity from to . locational map of the lower fraser valley . . . a . glacial deposition in the eastern part of the lower fraser valley a . soils of the eastern part of the lower fraser valley b . loeational map - abbotsford and vicinity . . . . a . mennonites in canada . mennonites in the lower fraser valley . origin of the students attending the mennonite educational institute a . small mennonite centers in the lower fraser valley a . the structural pattern of the yarrow settlement . the structural pattern of the greendale settlement . land clearing in the olearbrook area . changes in the structural paktern of olearbrook . concentration of mennonite families in southeastern vancouver . households associated with vancouver's four mennonite churches l i s t of f i g u r e s f i g u r e f a c i n g p a g e . m e n n o n i t e b u i l d i n g s i n p r u s s i a . . . . . . m e n n o n i t e s e t t l e m e n t i n r u s s i a . " d r y - p o i n t " f a r m s . m e n n o n i t e s c h o o l s i n t h e f r a s e r v a l l e y . . b a r n t y p e s i n t h e f r a s e r v a l l e y . . . . . a b b o t s f o r d f a r m l a n d . m e n n o n i t e h o u s e s i n a b b o t s f o r d . . . . . . t y p i c a l s m a l l y a r r o w f a r m . m e n n o n i t e h o u s e s i n y a r r o w . c l e a r b r o o k a n d s u r r o u n d i n g s . v i e w s o f o l e a x b r o o k . m e n n o n i t e b u i l d i n g s i n o l e a r b r o o k . . . . o l e a r b r o o k ' s c o m m e r c i a l g o r e a & b . m e n n o n i t e c h u r c h e s . . m e n n o n i t e f a r m l a n d a p p e n d i x e a & b . g e n e r a l v i e w s o f f a r m s i n m e n n o n i t e s e t t l e m e n t a r e a s • " . s m a l l m e n n o n i t e c e n t e r s . . . . . . . p a n o r a m i c v i e w s o f y a r r o w " . c o m m e r c e a n d i n d u s t r y i n y a r r o w , . " list of tables page i mennonites i n russia ii basic climatic data iii total of mennonites i n sub-divisions of census d i v i s i o n no. - - total numbers of mennonites i n b. c., - v male-female breakdown - vi immigrants brought i n under the auspices of the mennonite board of colonization vii. origin of immigrants brought i n by mennonite board of colonization viii destinations of mennonite immigrants - - ix c l a s s i f i c a t i o n according to sex of immigrants arriving i n - x ethnic breakdown i n census division no. of b r i t i s h columbia xi congregational origin of students at the mennonite educational institute - . . . xii commercial services of yarrow - xiii industries of yarrow life xiv commercial services of clearbrook - . . . - xv dates of establishment of mennonite churches appendix i n the fraser valley a xvi a representative l i s t i n g of mennonite family appendix names as compiled from church directories of b lower fraser valley mennonite churches xvii membership totals of mennonite churches of the appendix lower fraser valley from to . . . . c chapter i introduction in the rich, mosaic of canada's population the mennonites are an intensely colourful and conspicuous part. wherever they have settled the feeling and look of that place have become distinctive. in the fraser valley of british columbia their presence i s known and their influence f e l t in a wide variety of pursuits. local residents and even visitors usually recognize, too, when passing through such places as yarrow or olearbrook, that certain features of the farm holdings, the buildings and indeed the entire nucleations are characteristically mennonite. to describe and analyse the nature and peculiarities of these settlements from a geographic point of view is the purpose of this study. the mennonites have always tended to regard them- selves as distinctive primarily on the basis of their religious beliefs, and these do set them apart sufficiently well so that reasonably accurate statistics may be compiled on this basis. outsiders have often associated them with certain cultural complexes as well, but in their own minds cultural values have always tended to be indistinguishably knitted with the religious. for them, religion has always been the point of departure and the end of every consideration regarding this l i f e or the next. this springs from a firm belief that man should in every aspect of his being allow himself to be governed by the holy scriptures, and should acknowledge himself as responsible to an almighty god. in the literature of the mennonites, particularly those groups represented in western canada, spiritual currents have usually been the first considerations dealt with in any history of the movement. devotional aspects of their l i f e are heavily stressed and repeatedly linked to quotations from the holy scriptures. economic factors are usually treated as addenda, and are often evaluated in terms of the ethics of the group. the mennonites have traditionally held the belief that frugality, industry and honesty in a l l v business dealings should be the outward manifestations of their faith. prosperity, even though diligently sought, is considered by them as a blessing of god. these deeply rooted attitudes were what made them highly desirable pioneer settlers and model citizens in whatever country they happened to take up land during the time of their european migrations. to some extent their canadian neighbors are s t i l l able to see and appreciate these qualities in them now. references have often been made by canadian men- nonite authors and speakers at various occasions to the cultural characteristics of their people, but seldom have these elements been consciously regarded as cultural. certain foods, household appointments and mannerisms are thought of as vaguely belonging to mennonitism, but the essence of mennonitism is usually considered to be religion. many s t i l l affirm that the mennonite system of private secondary educ- ation functions to preserve the use of the german language, but in view of actual teaching practises this is largely l i p - service. the preservation of the traditional mennonite religious position is being more vitally and consciously pursued. literature and music, even though extensively appreciated and developed, most often function as media of education, worship and edification. art in the form of painting, sculpture and architecture has seldom been treated imaginatively for its own sake. purely social activities have often been looked on by many within the mennonite groups we will be dealing with in this study as rather illegitimate. friendly banter, group games and other amusements seem to them to be unjustifiable unless they are an introduction to something more serious, or are at least introduced by properly pious remarks and ended by prayer. undeniably, many activities classed as "fellow- ship" have fulfilled essentially social needs within the con- gregations. this overall desire to place everything in very close relationship to one's religious beliefs is doubtlessly laud- atory on the one hand, but i t does lead now — even as i t has done ever since the beginning of the anabaptist movement — to fruitless divisions within churches on problems regarding acceptable behavior. the question remains, however, whether i t is possible to maintain the identity of a group at a l l under the pressures and leveling influences of modern existence without the cement of common religious beliefs. as more and more mennonites have moved into urban areas and as higher education has become accessible and acceptable to a growing number of their young people, new views of mennonitism have been taken, sometimes non-religious, but not necessarily anti-religious. this trend has increased as individuals have gone into endeavours other than those which the group usually expected its better-educated members to enter. in addition to the traditional theology, medicine, nursing, education, history and languages, mennonites are now seeking out such fields as commerce, sociology, political science, international studies, pure and applied sciences and many more. new and interesting views of mennonitism have also been developed by outsiders who have been keenly sym- pathetic with the aims and customs of the movement or who have seen in i t an object of worthwhile research. the excel- lent sociological study of the mennonites of manitoba by e. k. francis, the discussion of pioneer mennonite settle- ment in western canada by c. dawson and others undoubtedly were written with either or both of these motives. as mennonitism is viewed increasingly' from a non-religious or extra-group position new relationships within itself and between i t and the non-mennonite population become more apparent. in this study, as already noted, the viewpoint is geographical and the focus i s on settlement patterns. new rural and urban groupings, movements between them and the retention or abandonment of traditional features are dealt with. distinguishing characteristics of the mennonite people themselves are discussed, their distributions, relationships amongst themselves and relationships to non-mennonites — particularly i n as far as a l l of this may be areally delin- eated. conclusions are then drawn regarding a number of trends i n the community and the evidence that exists for advanced assimilation. the study ends with suggestions for further research along geographical as well as historical lines. a number of procedures useful i n a geographical study of this type have been applied. a historical geograph- i c a l analysis of settlement patterns and other conditions prevailing at significant periods i n the history of the group is undertaken. the information for this was derived from literary research and the interviewing of pioneers. data on the distribution of mennonites i n canada, and more specifi- cally i n the fraser valley, were obtained from the census of canada- and church statistics. they are portrayed carto- graphically and also diseussed i n the text. field observation during excursions and a considerable period of residence in the area provided the information for the mapping and dis- cussion of the structure and function of present mennonite settlement. photographs and sketches supplement the maps in illustrating the ideas developed. footnotes and references the census of canada- l i s t s information on religious denominations of canada in tables - of volume i. the following are examples of this type of an approach: a. h. unruh, die gesehffite der mennoniten brddergemeinde. winnipeg, christian press, ; h. j. willms, die sued-abbotsford ansiedlung. yarrow, b. c , columbia press, . e. k. francis, in search of utopia; the mennonites of manitoba. altona, manitoba, d. w. friesen, . c. a. dawson, group settlement. ethnic communities i n western canada. toronto. macmillan, , vol. vii. chapter ii early history of the mennonites anabaptism after the reformers of the early sixteenth century had made their pronouncements against catholicism and esta- blished new ehurches that soon became, in their own right, institutionalized, and involved to greater or lesser extents i n alliances with secular powers, there were those who pro- tested against an incomplete protestantism". these people became known as "anabaptists", or those who denied the efficacy of infant baptism and otherwise challenged the practises of the reformed churches. their protests brought them persecution| and i t became necessary for many to seek refuge i n neighbouring countries, wherever rulers allowed them at least some measure of religious freedom. the anabaptist movement, that had begun i n i n switzerland, gradually spread northward, down the rhine and into the netherlands. it was propagated through the work of missionaries expressly sent for that purpose, as well as through the influence of displaced'persons. the followers of menno simons, an itinerant mis- sionary and evangelist who worked throughout north central europe, were those who f i r s t became known as "mennonites". this t i t l e has since then come to be used for numerous other groups who were of similar religious persuasion, yet were of various ethnic backgrounds, and thus has replaced the term, "anabaptist" almost entirely. mennonitism, as i t was i n i t - iated i n the netherlands and northwest germany, is the chief concern of this paper — in contrast to the mennonitism that emanated directly from switzerland, austria and what is now southwest germany. the "hutterites", who live near some mennonite settlements i n the prairies and who have often been confused with mennonites, are members of a movement begun within original mennonitism by one jacob hutter in the tyrol and moravia early in the sixteenth century, and thus do not come into the area of this study. ethnic origin the ethnic origin of the mennonites who l e f t the netherlands and began a succession of migrations that at last brought them into western canada, is very d i f f i c u l t to esta- blish. the problem has been explored by many mennonite leaders, particularly during times of war when i t was highly important whether one was to be classed as german or not. a very careful study of the problem was carried out i n the years just prior to world war ii by dr. b. h. unruh of karlsruhe, germany. dr. e. k. francis, in his book on the mennonites of manitoba, concurs with him in many of his conclusions. dr. unruh points out that i t is impossible to ascertain whether the strain of mennonitism with which we are concerned here i s either german or dutch; hut that i t had i t s origin i n a thorough mixture of both elements. to establish this, he believes, one must consider where the earliest mennonite refugees, who began the later movement eastward into the delta lands of the vistula river, came from. this appears to have been friesland, a country along the northern coast of present germany, just southwest of what i s now denmark; which was the f i r s t gathering place of refugees from religious persecution i n surrounding lands. as i t hap- pened, there was a ruler there who tolerated religious dif- ferences and allowed victims of persecution to take refuge i n his realm. the refugees came from dutch territory and also from those fragmented states that must be considered as antecedent to parts of present germany. sources for the documentation of this turbulent formative period in the history of the group are very meager and hence the proportions of the dutch to the german elements w i l l probably never be f u l l y known. when opportunities for the acquisition of land i n what was to become west prussia opened up for the mennonites during the i »s, many l e f t their temporary homes and migrated eastward i n small groups. the cultural orientation of these new settlers i n the vistula delta was, during the f i r s t two hundred years of their stay there, largely toward holland and the dutch language. then a gradual shift toward the german language set in, with low german adopted as the m a p i. ~~~ a. s i e m e n s language of common intercourse and eventually high german as the language of worship and education. germanization in- creased markedly after the partition of poland i n and the allotment of the vistula delta to prussia. in time german came to be regarded as the "mother tongue", an attitude that prevails to the present day i n the settlements of the descendants of these mennonites, wherever they may be located. it i s to be expected, therefore, that i n the complex of cultural traits exhibited by these people both dutch and german features may be found in various combinations. added to this may be variants such as those supplied by the men- nonites of polish background, with their interestingly accented german. a l l have been fused into a f a i r l y unique whole under the effects of compact settlement in relative isolation and the unifying influence of strong religious ideals. the result has been an ethnic group, with i t s distinct cultural heritage and body of well developed characteristic traits. establishment and unification in the further consideration of the history of this group, particular attention w i l l be given to two periods in their successive movements and settlement: that of their establishment and unification after i n the lands of the vistula delta, and the time spent by emigres from there, and their descendants, i n russia after . during these two periods many characteristic elements were developed, including certain settlement forms - concerned here. with which we are primarily settlement on the vistula delta of poland in the years - - groups of mennonite families began to settle around danzig, elbing and konigsberg on the poorly drained, brush-overgrown deltaic lands of the vistula, i t s distributary the logat, and other smaller rivers. later their settlements were to spread up the river past marienburg, as far as the present city of torun (map ) . although poland was o f f i c i a l l y catholic in religion, some parts of i t had been affected by the reformation, and other areas had sufficiently tolerant rulers, so that a good measure of religious freedom could be offered these incoming settlers. moreover, the s k i l l s in drainage and cultivation of land below sea level that the mennonites had achieved in their former coastal homelands, together with their industrious nature and close, well-ordered social organization, made them sought after by landowners in the coastal lowlands of poland for the drainage and settlement of their lands. the fact that they had such economic contributions to make for some time persuaded many administrators to overlook differences that did arise in religious affairs. the environment that the settlers now found themselves i n was physically rigorous. the climate of the area is essentially a northerly continental one, with several months a year below °f. in mean temperature and only approximately one month with a mean over *f. a mean annual r a i n f a l l of some - inches may be expected, and a period of snowfall lasting approximately twenty days. the land i t s e l f , of course, was marshy and overgrown with tangled vegetation. such conditions made harsh demands on the settlers, and also exacted a terrible t o l l of l i f e in the f i r s t years — chiefly because of the raging "marsh fever". the mennonites facilitated the actual acquisition of the land by banding together into leasing organizations and thus contracting for land with the polish king, individual landed barons and even princes of the catholic church. these associations became the bases for village communities. they paid their rent as one unit and were held communally respon- sible for the drainage of their holdings. the land complex held by such a community was also an interesting physical entity, because i t usually occupied a separate "height" of land and was enclosed by i t s own dyke. the drainage process was a complicated one. plots of marshy bottom lands would f i r s t be dyked from the sea and then surrounded by side channels. the surface of these plots would be given a slight slope to one corner to facilitate run-off, and then windmills would be set up to pump out the water. it required the work of several generations to bring the land into full-scale cultivation. the f i r s t use of the land was usually for meadow and pastureland, supporting a dairy industry. after a period of this type of activity, eereal cultivation could be begun. the villages that were laid out on this land took a form that i s probably most accurately described as a "deich- hufendorf." this village type was a variation of the "reihendorf", derived partly from the "marschhufendorf" of the marshes of northwest germany, which had the dyke as the main thoroughfare of the village, and partly from the north- european forest tillage ("waldhufendorf"), that featured a straight central roadway and cleared plots stretching back on either side. a "reihendorf" had a typical cross-sectional sequence of a stream or eanal, a dyke with a street on top of i t , the eomplex of buildings and yard ("hof"), the fields, and then a canal at the rear boundary. eaeh family had i t s own "hof" and plot of land extending back of the waterway and dyke. deltaic lands were soon f u l l y taken up, and young couples, as well as new immigrants, began settling on scattered parcels upstream along the vistula's lowlands. they acquired these properties by purchase from individual land owners, often teutonic knights, and established on them "einzelhofe", or individual farmsteads. the buildings that were to be found on the village farmsteads as well as the isolated farms were always of a simple, solid and orderly kind. since each farmyard, built on land below sea level, had to be laid out on a raised earthern mound called a "werft" i t was kept as compact as possible. hence the house, barn and storage quarters were assembled under one roof into a "reihenhof". such a farmyard found on isolated farmsteads as well as on the village properties, stood i n contrast to those laid out earlier under the settlement schemes of the teutonic knights, i n which the various components of the farm were housed i n separate buildings. there were variations on the simple "reihenhof", however, and usually they increased in complexity with the increase i n size of the holding and the prosperity of i t s holder. a l l of them were designed, however, to provide a maximum of shelter on a minimum of "werft" surface space. the "reihenhof" appeared usually on holdings up to forty- five acres in extent. a "winkelhof" was found on farms of between - acres. it featured an "l" shaped building with i t s two wings aligned along the two sides of the "werft". on farms of over acres a "kreuzhof" appeared, with i t s cruciform building designed so that the living quarters and storage spaee ran one way and the stables crossed this at right angles. such a building reduced the distance of feed haulage to a minimum, a consideration that is s t i l l highly important i n the design of modern barns. architecturally, the private and public buildings of these people represented a sturdy, straightforward solution to their needs. the joined farm building was a simple ridged structure with visible "joints" where the house ended and the barn began. exposed gables were often faced with wood down to the level of the windows. the walls were a combination of wood and masonry, or of masonry alone. the roof was usually of thatch, w i t h a wooden ridge cap. hedges, or p i c k e t fences, a n e c e s s i t y i n a v i l l a g e community, were u s u a l l y l a i d out n e a t l y and s t u r d i l y around every "hof" (figure ). the main p u b l i c b u i l d i n g of the group, the church, was a simple ridged s t r u c t u r e of the same s t y l e and materials as the p r i v a t e homes, without a tower or other d i s t i n g u i s h i n g feature of any k i n d . this form, of course, r e s u l t e d from the d e s i r e of the group f o r utmost s i m p l i c i t y i n matters of r e l i g i o n . i t was not designed to i n s p i r e any p a r t i c u l a r emotion or to be the s e t t i n g f o r any r i t u a l , but simply to serve as a meeting house where one sang, heard a sermon and meditated on god. during the e a r l y period of residence i n the v i s t u l a lowlands the mennonites adopted c e r t a i n i n s t i t u t i o n s that were to c h a r a c t e r i z e t h e i r settlements f o r some time to come. communal f i r e insurance was organized, with the p r o v i s i o n that a premium was to be l e v i e d on every member of the a s s o c i a t i o n a f t e r a d i s a s t e r occurred to any one of the members, and t h i s to be commensurate w i t h the extent of the l o s s and the assessment of each member. later t h i s was changed to a system of r e g u l a r l y - p a i d premiums. a type of t r u s t company f o r the d e s t i t u t e and orphaned, c a l l e d a "waisenamt", probably orginated at t h i s time as w e l l . later, i t came to serve as a sort of investment agency too. communal government was by elected o f f i c e r s , i n c l u d i n g a reeve or "schultze" and h i s c o u n c i l l o r s . this was f u r t h e r developed i n russia and even figure . mennonite buildings in prussia a. a farm house including barns and living quarters in one building. b. a farm house in the shape of an "l" (winkelhof). c. a church built in l l „ d. a more pretentious church, built later than the one on picture c. from h. wiebe, das sledlungswerk niederlandischer mennonlten weichseltalm, • i i carried over into manitoba and mexico. after the partition of poland and the inclusion of the vistula delta into the province of west prussia a number of severe d i f f i c u l t i e s arose for the mennonites. the ruler, frederick ii, had formally confirmed the privileged status of the mennonites and allowed them the right of exemption from military service. in practise, however, pressures were soon exerted on them from various quarters as a consequence of these privileges. the surrounding populace resented their freedom from military service particularly. what was worse, however, was that frederick ii issued edicts in and that prohibited further acquisition of land by the mennonites. this came at a time of marked population growth and expansion within mennonite settlements. young couples, and otherwise unlanded mennonites i n large numbers began making plans for emigration. settlement i n russia during this time of unrest the invitations of catharine ii of russia, already made in and > became attractive to the landless along the vistula. a legal frame- work had been laid down by the russian government for large scale immigration. it provided a regulation of influx and support en route, laid down in great detail the economic, p o l i t i c a l and social organization under which immigrants were expected to live and, what was very important, stipulated a separation of the immigrant communities from the native i — communities. a l l this was done in a s p i r i t of "humane enlightenment" and was quite in accord with the most pro- gressive attitudes of rulers in that time. to the mennonites of poland, specific promises of religious freedom, exemption from military service and the taking of oaths, as well as grants of acres of land per family, had been made. southern european russia, where most of the incoming settlers were to find their new home, was quite an advantageous settlement site. drainage was no problem, neither was the clearing of land. the terrain was relatively f l a t , with only low rolling h i l l s in some places. steppe vegetation prevailed over most of the area to be occupied by the mennonites, and good rich chernozem and chestnut soils promised abundant crops. the climate there i s continental, having a con- siderable number of cold days every year. the number of days with a mean daily temperature of less than °f. increases from thirty i n southern european russia to ninety in the vicinity of kiev. a continental climate, of course, has many days every year that go to the other extreme in their temper- ature. in the crimea they have some ninety days i n a year that have a mean daily temperature of more than °'f. this decreases to sixty near kiev. rainfall is usually between sixteen and twenty-four inches annually and approximately forty days of snowfall may be expected. on the whole, climatic conditions were more amenable on the steppes than they had been on the vistula delta. a . s i e m e n s in , then, the f i r s t mennonite "locators" visited the ukraine. they selected a f e r t i l e plain near berislav on the dniepr, a locality somewhat similar to the delta lands they had known in poland, as the site for the f i r s t settlement (map ) . due to d i f f i c u l t i e s the russians were having with the turks in the area, however, the f i r s t actual settlement was made in on rolling, less f e r t i l e land near the chortiza river, a tributary of the dniepr. in i and succeeding years, mennonites settled on a plain near the l i t t l e molotschna river that flowed into the sea of azov. two multi-village colonies, known as chortiza and molotschna, became the largest concentrations of men- nonites in russia. other smaller settlements, such as those in the provinces of saratov and samara, along the volga, were eventually established. they were populated by immigrants from prussia who continued to come to russia in larger or smaller groups, as well as by landless people finding no place in crowded colonies in the f i r s t areas of settlement. the totals of mennonite population in russia at various times are listed in the accompanying table, which includes in i t s figures original entrants, additional immigrants and the offspring of both. the fact of a rapidly increasing population is largely responsible for expansionist tendencies, a good deal of internal'strife and the eventual emigration of large numbers of mennonites to north america. table i mennonites in russia^" , , , , , , the mennonites brought peasant ideals with them into russia, attaching themselves closely to the land, being careful to preserve i t s value and taking pride in economic stability and work well done. of course, they were also intent on the preservation of their religious position, which involved the establishment of church dominance over the government of the community and the education of the young people. certain key doctrines, such as the exhortations to avoid any violence and unnecessary involvement with a sinful "world", were to be perpetuated. almost inseparable from these religious ideals was the desire to maintain the german language and certain dutch and german cultural traits. conditions in russia for the mennonites at f i r s t were such that these things could be realized. indeed, something approaching the utopia that many mennonites envisaged was established. unfortunately inner anomalies, brotherly strife and an intense pressure on the cultivated land -- as well as upheavals in russian politics thwarted the ultimate. local government, l e f t up to the mennonites almost completely, was based on the system of the village commune, in which one representative from each landholding family had a place. the "sehultze" was the chairman of the commune, and at the same time tax collector and police judge. the chair- men of a l l village communes came together into a council representing the entire colony, as for example the colony of molotschna. an "oberschultzem presided over this council, representing i t i n dealings with the department of crown lands, under whose jurisdiction the mennonite colonies ultimately stood. in practise the more wealthy and influential members of most village communities soon placed themselves in the leadership of the church as well as the local government. the system of lay ministry allowed those who had time to spare, and prestige among the village folk, to occupy the ministerial and hence the leading positions of the church. these same men, usually land owners of the f i r s t rank, also had a strong voice i n local government. abuses, of course, could not long be kept out. furthermore, the anomaly inherent i n the situ- ation became f u l l y apparent when policing or law enforcement was necessary and the church found i t s e l f i n effect performing the function of the "world". the anabaptist tradition was a s t r i c t separation of church and state, a shunning of the "world". the result could only be a secularization of the church and eventually the emergence of reactionary groups, such as the mennonite brethren, who decried such secularization. the civic institutions upheld by the mennonites in russia were largely a carry-over from prussia. close association i n many aspects of l i f e made for common interests and communal solutions to problems. communal f i r e insurance was retained and improved. the "waisenamt" continued to pro- vide for the destitute and serve more and more as an invest- ment agency. granaries were built to store grain for times of need and disaster funds were set up. of special importance to the community were the laws the mennonites upheld amongst themselves regarding inheritance. the family tract of land was regarded as indivisible. it was usually given to the eldest son, who then paid off or provided for his siblings. this, of course, was the chief cause for the development of a growing landless class and the increasing need for daughter colonies. from the very beginning elementary schools were set up i n each village by the mennonites themselves, since they had been made responsible for their own educational f a c i l i t i e s . even though they were staffed by very poorly trained teachers these schools were nevertheless on par with similar schools anywhere in europe and eertainly superior to those of the russians. under the influence of the wealthy and progressively minded johann cornies, and the association for the promotion of education that he organized in , these schools were eventually improved. to them were added, in time, excellent secondary schools, known as "zentralschulen", which were designed chiefly to train teachers. from these a number of young people continued on in russian universities or even schools in other european countries. economically, the colonies i n i t i a l l y suffered a l l the d i f f i c u l t i e s involved in a shift from one environment to another. the farmers needed to know how to combat new pests, provide for the occasional drought and, above a l l , find the most advantageous combination of crops. general farming, with an emphasis on cattle and sheep, was practised in the early years. then, gradually, cash crops such as flax, tobaeco, fruits and vegetables were introduced. the s i l k industry promised well for a time and numerous mulberry trees were planted. with the opening of a seaport, berdiansk, on the black sea in the l 's, wheat-growing began to replace sheep, s i l k and other crops. early implements were crude, requiring very much hand labour. as soon as possible, machines were introduced. eventually a number of mennonite implement factories were established, which became the most significant industries carried on amongst the group. individual artisans in each village provided most of the hardware, tools and other goods the people needed but could not conveniently import. improvements of seeds, stocks, methods and materials proved as laborious there as amongst any other peasant group, and may be attributed largely to the energy and imagination of johann cornies and other model farmers who provided leadership during the f i r s t half of the nineteenth century in economic as well as cultural f i e l d s . eventually a considerable degree of material pro- sperity developed amongst the mennonites, which was to pro- vide a reasonably good l i f e for most of them until the disruptive forces of liberalization, war and revolution broke over the colonies and their way of l i f e . the settlement forms resulting from the mennonite way of l i f e i n russia again showed a close relationship to what had been adopted earlier i n other environments, but also included some new innovations. for the sake of security against marauding russian neighbours, i n i t i a l l y , and then also for purpose of unity in religious, economic and social affairs, close habitat, based on dutch and german forms already mentioned, with surrounding open fields modelled on the russian "mir" system, was the form of settlement used predominantly in the layout of russian mennonite colonies. even though drainage or the clearing cf forests were no longer the basic problems of agriculture, as they had been in north-central europe, the village tracts were s t i l l divided into rows of individual holdings on either side of a main street. each holding con- sisted of a total of some acres- granted to one family in permanent usufruct as well as the right of access to a common meadow at one end of the village. once a homestead had been established i t usually presented a sequence outward from the main street, of a front hedge or fence, a row of trees, a flower garden, the complex of buildings, a vegetable garden and fields, which might or might not be located immediately behind the farmyard. such a village, a "strassendorf" in the best sense of the term, stood in contrast to the encamp- ment of nomadic nogatsi tribesmen or the irregular "haufendorf" that might be found i n surrounding areas occupied by russians. numbers of mennonite villages would be strung in "paternoster" fashion along main roads, each one bearing an idealized german name such as "rosenthal" (valley of roses), "schonwiese" (beautiful meadows), "waldheim" (home in the woods), "blumenfeld" (field of flowers) or one of many others. these names reflected an intense appreciation of the beauties of a rural environment, and were, undoubtedly, wistful refer- ences to a homeland the mennonites had once known in north- central europe. they were retained by groups of the most orthodox of mennonites when they l e f t russia in the l 's to establish new colonies in manitoba, and were even taken by these same groups from there to mexico. mennonites migrating directly from russia to latin america before world war ii and those going there later as refugees out of a war-torn germany also graced many a hostile paraguayan or argentinian landscape with these nostalgic names. the buildings erected by the mennonites in russia re- sembled those they had known in west prussia (figure ). the farm buildings were again often joined under one roof, in such forms as the "reihenhof", the "winkelhof" or the "kreuzhof". figure . mennonite settlement in russia a. early farm house in chortitza. b. more modern farm house in chortitza. c. and d. mennonite churches in the molotschna colony, e. an early village school, f. a newer village school, as introduced in many villages by a progressive leader, johann cornies. g. typical mennonite village in south russia (sketch by j. h. janzen). h. mennonite operated steam mill. i . mennonite factory. from p. m. friesen, die alt-evangelische mennonltische bruderschaft in russland ( - .). . walls were usually of brick, exposed or finished in plaster; roofs were of t i l e or thatch. a l l this reflected, of course, the scarcity of wood for building purposes. architecturally, these buildings were the same simple, functional solutions to the problem of shelter that they had been i n prussia. the feature of the entire farm property that seems to have been a mark of economic status and prestige, besides the general size and excellence in the construction of the buildings, was the substantial fence or wall with i t s main gate that faced the street. classical columns, pediments and various other decorations were used to make these fronts as pretentious as possible. the village churches also were of the same simple basic pattern as they had been i n prussia, but here they were more profusely decorated, each one corresponding to the wealth and prestige of the villagers. then, as is s t i l l too often done now i n the building of mennonite churches, enhancement of the building was sought by the addition of unimaginative details. cornices, false columns, pediments over windows, buttresses, gothic and romanesque windows a l l were used in various combinations to beautify a basically monolithic building form. only seldom, as in the case of the large ornate church in the village of "einlage'% was a truncated tower added. spires were never built on russian mennonite churches. the aspect of a wide, tree-shaded main street in a typical mennonite village with substantial and scrupulously neat farmyards on either side, together with the solid schools and churches, must have been an impressive sight to russian neighbours and particularly visiting government o f f i c i a l s . movement into canada the movement of those mennonites represented i n our study, from their russian homeland into canada and particularly into british columbia, transpired in stages over a considerable period of time. the f i r s t large-scale movement out of russia into canada took place in - , but this involved mainly conservative members of the group, known as "old colony" mennonites. they l e f t russia to find new settlement areas for their growing numbers, as well as to escape the results of "russianization" policies undertaken by the government — the most important of which was the abolition of the privilege of the exemption from military service. some , of them, or approximately thirty percent of the total of mennonites in russia, l e f t during this time. of these, came to canada, and the others went to various latin american countries. few of these people or their descendants are represented in the mennonite population of the lower fraser valley. the "general conference" and "mennonite brethren" people, the chief concern of this thesis, began arriving in canada in large numbers during the 's. they were escaping the terrors of post-war and post-revolution years i n russia. the war had brought devastating army advances through the colonies. the revolution had unleashed various raiding, k i l l i n g bands who terrorized the colonies. religious freedom and the special civic privileges rooted i n the magnanimous terms of the charter given to the mennonites by the empress catharine ii had been swept away. families had been dis- persed by the banishment of many men into siberian work camps. the stable village properties had been pillaged and burnt in orgies of vented resentment by russians who had watched too long while their mennonite neighbours prospered. the only way out was emigration. in canada, mennonites were well aware of the plight of their "brethren" in russia. a "canadian mennonite board of colonization" was organized with the co-operation of a l l mennonite groups i n the country, and this body entered into negotiations with the canadian government for permission to bring these unfortunates into canada. permission was granted, with the stipulation that the settlers should remain, for a time at least, as farmers on the land. money needed to be found to finance the venture, because most of the mennonites coming from russia had been impoverished by robbery, excessive charges on every hand and a poor market in which to dispose of their holdings. the canadian pacific railway company proved willing to enter into a contract with the board of colonization to provide passage for the immigrants on a long-term loan basis. the collection of funds for the repayment of this loan, signed for by the president of the board, mr. david toews, subsequently became a very important concern of the leadership of the mennonites, but i t was duly accomplished. the movement out of russia began in the early twenties and continued as a sizeable exodus until , during which time some , mennonites entered canada. as more and more of these people l e f t russia, however, emigration permission became harder and harder to obtain, until f i n a l l y the only possibility of exit was by secret flight across the border. the headlong escape of some of the country's most stable citizens was not a good advertisement for the new order. the f i r s t stop for most of them was manitoba, where many of their "old colony" friends and relatives already lived. thus took place the superimposition}for a time,of one main strain of mennonitism upon another. those arriving during the «s became known as "russlander" and those who had been i n the country since as "kanadier".® many of the "russlander", despite war and privation, had received at ieast some education beyond the village school level, either at the mennonite high schools and normal schools, or in other schools at home and abroad. most of them, moreover, were of comparatively progressive religious persuasion. then too, they had experienced the years of turmoil in early twentieth century russia, which had brought to them the necessity for new adjustments regarding military service. education and other matters. they had accepted alternative service opportunities and had experienced a considerable degree of "russianization" in their schools and other institutions. the "kanadier", by contrast, were decidedly backward in their education, ultra-conservative in matters of faith and isolated by distances and d i f f i c u l t i e s of transportation from the settlements of the outside world. very soon mutual contempt arose between these groups, a feeling that has persisted to a great extent up to the present time. one other differentiation was perpetuated within the "russlander" group i t s e l f , and this must be elaborated upon here, for i t is apparent throughout this study. they were divided into two main religious "sub-factions", the general conference and the mennonite brethren. these two groups co-operate in matters of overseas relief work, to a limited extent in education and in some other respects. the general conference group might be regarded as slightly more conservative in religious matters than the mennonite brethren. to the outside observer there are only slight differences of doctrine and religious observance between them, but these are sufficiently important to effect a distinct separation. the present ratio within the fraser valley is estimated as roughly two-fifths general conference to three-fifths mennonite brethren.^ from their f i r s t stopover in manitoba, mennonites of both the general conference and mennonite brethren groups, moved f a i r l y soon as individual families or small groups of families, westward into saskatchewan, alberta and eventually british columbia, as well as eastward into southwestern ontario,, the pattern was always similar. a few families would move into any area where land could be bought under agreeable conditions or could be rented. others would follow, joining their friends and relatives from whom they had heard about possibilities i n the area. soon there would be a congregation, a church building, and, i f the settlement was large enough to support i t , a mennonite bible or high school. land could not usually be acquired i n completely contiguous blocks, as had been possible for the f i r s t mennonites coming into manitoba, because i t was often necessary to buy land from different individual owners. this factor and the almost universal use of the grid pattern i n land subdivision made the village form of settlement infeasible. nevertheless, one could speak of almost solid mennonite settlements, achieved by a careful buying" up or- renting of nearby plots and a gradual displacement of non-mennonlte neighbours. on the whole, i t must be realized that shifts within the mennonite population of western canada were com- prised of constant, concurrent movements of individual families and small groups, this way and that. the conditions conducive to unified mass movements•seemed to have passed for them. movement into british columbia movement into british columbia took place during and after . the triggering action was an advertisement by a certain mr. eckert in the winnipeg free press inviting settlers onto a plot of land at the present site of yarrow. the maritime climate offered relief from the harsh climatic conditions of the prairie provinces. land was available; i t was reasonably f e r t i l e , and barring the d i f f i c u l t i e s of drainage and clearing, easy to work. once a number of families were established at yarrow, and elsewhere too, others came. the volume of movement waxed and waned with economic conditions in b. c., but generally it coincided with the westward move- ment of other segments of the population. (map ) in a l l their various locations, these mennonites preserved, to a considerable extent, the old traditional attachment to the land. wherever they could they continued to farm in the extensive manner.of former times, growing cereal crops, raising cattle and the like. where i t was necessary to break away from this, however, as i t was in british columbia, they did so, showing a willingness to adapt and rationalize. they l e f t the rural environment for the urban too, where necessary. usually individual members of families, often the older g i r l s , had to go to the cities to find employment there, in order to augment the meager returns of the farm and to help repay the heavy burden of debt that rested on many a household. soon the numbers of mennonites in the cities grew source of migrants into british columbia - n m i g r a n t s o u t m i g r a n t s the width of the arrows is proportional'to the number of people involved mi ' ' i i i l j from british c o l u m b i a a t l a s of r e s o u r c e s t \ w a. s i e m e n s to such an extent that urban congregations could be esta- blished, a trend that brought with i t new conditions and problems — as w i l l be discussed later i n this study. in considering the movement of mennonites into british columbia the influx of mennonite displaced persons after must be given special mention. these people had come as refugees from communist russia, from old prussian lands ceded to the poles after the war, and elsewhere. they had been given temporary asylum i n west germany and then helped by the r e l i e f workers of the mennonite central committee to relocate in canada, latin america and the united states. usually they came as wards of relatives here, and so were quickly scattered among various settlements. they made every effort to adjust themselves rapidly to the way of l i f e i n the mennonite communities here, to learn english and to f i t into the broader canadian pattern too. very many of them soon found their way into the cities, where they took any employment that could be found until they had mastered the language and perhaps attained some professional standing. this consideration of the movement of the mennonites from country to country and finally into western canada may be concluded by noting the total number resident in british columbia's fraser valley and outlining roughly where their settlements are. in the total number of mennonites here was estimated to be approximately , . their d i s t r i - bution may be inferred from the dot map showing the census of ple ridge locational map of the lower eraser v a l l e y boundaries of major district m u n i c i p a l i t i e s m a i n h i g h w a y s p r i n c i p a l bridges principal s t r e e t s in v a n c o u v e r city z a l d e r g r o v e c a n a d a — u s . a i n t e r n a t i o n a l boundary l msgsf ' abbotsford i-ĵ (old) i [ map b a . s i e m e n s sn im is v •bq i o i ^^t' l wodd a n v a d svhd h i nt n o i l v l l l d o d i m o n n w h i jo a i i a v h o jo h i . n h i jo in w a w h i s i v i a n t /aoativ h • s i h i a i a h o y n n o d o a o n i s h qnv s m i a a i n i inodd a n t v i b svw n v m n a m h i dod noiltfhwodni ' s h dnho s n o i a v a h i do sn i a a h v i n a i b i s h i do snoiivwiawoo i n s a d a sv aw a d a v h s h i n ^ s iln nn iac do sv hv viaiix ijddv av id a e ̂ s d v w no n i v i -hq nl na\ohs si a b a n o o n v a nl i n l n n i i s i l n h ( n w canada listings for (map ) and from the map of church tributary regions for (map ) . concentrations existed near the towns of chilliwaek,h abbotsford, mission and aldergrove; i n southeast vancouver; and in the two mennonite centers of clearbrook and yarrow. the physical characteristics of each one of these settlement areas w i l l be dealt with in the next chapter, and a detailed analysis of sequent occupance, distributions, movements, settlement patterns and settlement forms w i l l follow in later chapters. footnotes and references i b , h. unruh, "dutch backgrounds of mennonite migrations of the th century to prussia," mennonite quarterly review, : - , july, . — e. k. francis, in search of utopia: the mennonites i n manitoba, altona, manitoba, d. w. friesen, . "properly, terms b u i l t upon this root should apply exclusively to groups where the r a c i a l bonds and c u l t u r a l bonds are so interwoven that the members of the group i t s e l f are o r d i n a r i l y unconscious of them, and unspeclalized out- siders tend to make no d i s t i n c t i o n between them. such groups are the l o g i c a l product of human evolution under conditions of r e l a t i v e isolation and segregation." in h. p. f a i r c h i l d , dictionary of sociology, new york, philosophical library, - , p. . a. ehrt, das mennonitentum i n russland, berlin, julius beltz, , p. . the mennonite search for a utopia i s the keynote of francis' book. francis, op. c i t . , p. . c. henry smith, the story of the mennonites, berne, indiana, mennonite book concern, , p. . francis uses these terms a number of times throughout his book. this estimate was made by rev. a. a. wiens, secretary of the b r i t i s h columbia o f f i c e of the mennonite central committee, i n an interview the author had with him i n . another estimate made by mr. wiens i n the interview referred to above. note: the name of the municipality i s spelled "chllliwhack" on some maps, as differentiated from the name of the town which is spelled without the "h". in this thesis, however, both names w i l l be spelled without the extra "h". chapter iii physical characteristics of the fraser valley lowlands the area under particular consideration in this study, the lower fraser valley, begins at hope and extends some ninety-five miles westward to the extremities of the delta of the fraser river. it is f a i r l y uniform in climate, but varies considerably in i t s array of land forms, veget- ation and soils. therefore each of the rural areas within i t that was occupied by the mennonites offered i t s f i r s t settlers, even as i t s t i l l does today, different opportunities for agriculture. general features of the terrain the valley lowlands, as we shall refer to the relatively low areas adjacent to the fraser river even though they are not one uninterrupted plain, are bounded to the north by the coast mountains, to the southeast by the skagit range of the cascades and, for our purposes, to the south by the international boundary. chilliwack mountain ( '), sumas mountain ( '), burnaby mountain ( ) and other lesser heights stand out as topographic islands in the lowlands. from agassiz through to the international boundary at huntingdon stretch the alluvial plains of the valley. they have an average altitude below and are the result of post-glacial deposition by the fraser, nooksack and chilliwack rivers. just east of abbotsford the undulating h i l l country begins, extending westward into the municipality of surrey. the hilltops are up to - ' in elevation and consist of materials deposited late i n the pleistocene epoch, which were then subjected to uplift and subsequently eroded. the recently deposited delta lands of the fraser, with an average elevation of only ' above mean sea level, begin just south- west of new westminster and extend out to the sea. climate climatically, that part of the valley where mennonites are located may be classed mostly within the "inner coast" region of the "west coast" climatic province. temper- atures here seldom go below freezing in their average minima and hover around - degrees i n their average maxima. five to six months have mean temperatures above °f., and there are some - frost free days. no month has an average of °*f. or less. a l l this assures a warm, sunny summer and a mild winter. precipitation is over f i f t y inches annually in most parts, the bulk of i t falling during the winter months. clearly this is a climate moderated in temper- ature and enriched in moisture by air circulation from the ocean. the basic climatic data for three stations in the fraser valley and for saskatoon and winnipeg are given in the table below in order to substantiate statistically the great difference between the climate from which mennonite settlers came and the one into which they went. table ii basic climatic data mean january daily minimum temperature vancouver abbotsford agassiz saskatoon winnipeg airport airport - * - to . - to (entire valley) - - mean july daily maximum temp. - ° (entire valley) mean annual total precipitation " " " " " moisture deficiency " f t mean annual n „„ snowfall " " " " " average frost- „ ^ , free period - days - days (entire- valley) british columbia, therefore, offered the mennonites a r e l i e f from the harsh continental climate of the prairies. articles in mennonite papers and special resettlement pro- motion brochures referred again and again to the mild temper- atures and the abundant precipitation to be found here. these same factors have remained highly attractive to prospective settlers as well as to "suitcase farmers" from the prairies who like to spend their winters here. morphology, vegetation, soil cover and agricultural use of mennonite settlement areas in the further discussion of the physical character- i s t i c s of mennonite settlement sites, particularly the rural ones, certain areas within the lowlands must be singled out. each site is treated with regard to i t s morphology, s o i l cover, vegetation, and agricultural use, and each of them is dealt with in turn from the eastern end of the valley to the west. it must be noted in this connection that the crops that the mennonites, and many of their neighbours, found economical on certain soils were discovered and developed largely through t r i a l and error. market conditions, of course, often overshadowed a l l else in determining what was grown. whether the use that was made of the land was optimal as far as physical potential is concerned or not is another question - one that w i l l not be explored here. flatlands from agassiz to upper somas in the chilliwack area the iee of the latest advance i s believed to nave remained in one position for a relatively long period of time, leaving behind only a thin veneer of drift. it i s possible that an arm of the sea invaded the area i n one of the intervals between ice advances and l e f t be- hind marine sediments. over these deposits the fraser built up an extensive a l l u v i a l plain that sloped gently from east to west. the natural vegetation cover in the chilliwack area, as well as i n other areas covered by monroe soils, consisted of open meadows and grasses i n spots that were subject to annual flooding. the higher ground, flooded only very occa- sionally, supported a t a l l stand of cottonwood and scattered f i r and cedar. on this low and gently undulating terrain soils of the monroe series have been developed. in the agassiz, east chilliwack, greendale and yarrow areas azonal monroe clay loam is the dominant s o i l , it has been found to be most suitable for the support of a dairy industry, but small fruits, tree fruits and crops such as hops, legumes and tobacco may also be grown economically on i t . in the yarrow settle- ment, even though i t is located on a similar s o i l as that of the chilliwack area, raspberries have been developed suc- cessfully as the main crop. this specialization probably resulted more from cultural and economic factors rather than a close adaptation to the s o i l . in the sumas area three alluvial fans, those of the fraser, chilliwack and nooksack rivers, impounded sumas lake between them. after the drainage of the lake in i t s sediments were exposed to form the coarse-textured azonal s o i l called monroe loamy sand. since this land varies in elevation from . feet below sea level to feet above i t , continuous pumping is necessary to permit the growth of grasses, hay and similar crops on the lower areas. the water table must not be allowed to sink too low in the dry season, however, because the s o i l is very porous and w i l l allow moisture to drop quickly below the reach of short-rooted plants. relatively large fields, edged by willows that grow near the drainage ditches, are characteristic of this area. in upper sumas, just north of the international boundary, post-glacial alluvium that was deposited by the nooksack river predominates. a number of low, narrow ridges, the remains of old sumas lake shorelines, run i n a northwest- southeast pattern across what i s otherwise a lowland sloping gently northward. the azonal monroe clay that has developed there supports grain, forage crops and pasture, together with some special crops such as raspberries. settlement took place in the upper sumas area early in the history of the province ( - ). farmyards were laid out on the narrow ridges to escape the periodic flooding of the adjacent lowlands. some of these holdings may s t i l l be seen when one travels along vye road (figure ). figure . "dry-point" farms these farms are located on ridges thrown up around old sumas lake. they can be viewed as one passes eastward on vye road (map ). matsqui the matsqui area remained under an ice advance for a relatively long period of time, and was eventually covered by late glacial marine s i l t s and clays as well as post-glacial alluvium from the fraser river. prominent ice contact slopes are s t i l l noticeable around the western and southern periphery of this well-defined flatland. the azonal, fine-textured soils of the ladner series that cover the area have been dyked and drained in order to lower the water table sufficiently to permit crop growth. the natural swamp forest of willow, poplar and scattered cedar and f i r , to- gether with grass vegetation on the better drained sections did not present great clearing d i f f i c u l t i e s . hay, oats and pasture, supporting a dairy industry, occupy the bulk of the open land now. specialty crops such as corn, berries, vegetables and others are also in evidence. mission north of the town of mission, where a considerable scattering of mennonites are located, farmland has been cleared on the gentler slopes and small f l a t areas of what is very h i l l y terrain. the natural vegetation was a luxuriant growth of f i r , cedar, hemlock, alder, maple and birch, with many varieties of shrubs and a dense growth of bracken. heavily eroded and uplifted interglacial material forms the basis for zonal soils of the alderwood series. small fruit culture and a limited dairy industry are carried on by farmers who, in many cases, devote only a part of their working time to their farms. abbotsford the undulating uplands of the abbotsford area were built up of pitted outwash to the west of the ice lobe covering chilliwack and sumas, and to the south of that covering matsqui. zonal soils of the lynden series developed here. lynden s i l t proved especially suitable for small fruit and vegetable production. after the luxuriant timber and bush which was i t s natural climax vegetation was cleared and larger fields cultivated,dairying could be carried out suc- cessfully as well. lynden gravelly s i l t has excessive drainage through a porous substratum and therefore the vegetation on i t suffers i n mid-summer dry seasons. the greatest expanse of this type of s o i l may be found around north clearbrook road. the forest growth that existed there at the time of the arrival of the f i r s t mennonites was a second growth of f i r , alder, cedar, maple and poplar. this was easier to clear than the land to the south, around huntingdon road, where there were many large stumps besides a similar second growth. it was found that on this s o i l strawberries and vegetables that mature before the onset of the summer dry season do quite well. poultry is a profitable pursuit as long as the price structure remains favorable. actually the area was, from the very start, of a marginal value for most cultivated crops. much of i t has now been taken up for urbanization by the expanding periphery of clearbrook. aldergrove a large extent of undulating terrain around the town of aldergrove and east of i t , where many mennonite farm- steads are located, i s made up of a thick deposit of vashon drift. on i t have developed the rich agricultural soils of the whatcom series. a heavy second growth of alder, maple, f i r and birch covered a l l of i t when the settlers moved in. stumps of the original climax forest of douglas f i r , hemlock and giant cedar were large and frequent. clearing costs, therefore, were heavy, which delayed settlement a good deal. wherever cleared the s o i l has proved suitable for mixed farming and special fruits and vegetables as well. among the small fruits the strawberry seems the most adaptable, as has been demonstrated i n the coghlan d i s t r i c t . surrey mention must be made here as well of the surrey upland, even though most of the mennonite settlers here have followed main occupations other than farming ever since they f i r s t came into the area. older deposits of the antecedent stream of the present fraser, isostatically raised and then eroded, make for a very h i l l y terrain. a layer of impervious boulder clay often lies too near the surface to permit proper cultivation and subsoil drainage. vegetables, berries and other small crops can be grown, poultry and fur-bearing animals raised — a l l of which are suitable to the needs of the part- time farmer. lulu island the last of the settlement areas to be mentioned here, lulu island, originally offered considerable opportunity for farming, and some mennonites settled there. the island i s part of the recent delta of the fraser and hence rises only some - feet above mean sea level. its soil is of the azonal ladner clay variety. after the land was dyked and drained by means of open ditehes i t was possible to carry on dairying on the large acreages and the culture of vegetables and small fruits on smaller holdings. here too, much of the farming carried on in early years, and certainly now, i s of a part- time nature. in a l l of these areas the mennonites attempted to choose the most advantageous sites available, to make the best use of resources at hand and to settle in a manner best suit- able to the circumstances. this willingness to adapt to an agricultural economy different from most others that they or their ancestors had known, as well as the willingness event- ually to enter an urban environment, characterized the fraser valley mennonites generally and sometimes made their settle- ment units d i f f i c u l t to differentiate from those of the non- mennonites around them. a description of the physical charac- teristics of their settlement sites i s therefore only a des- cription of localities they found to be most advantageous for household and community development and does not necessarily reflect their predilection for a particular type of settlement sh +. footnotes and references - british columbia natural resources conference, british columbia atlas of resources, vancouver, smith's lithography, , pp. - . compiled from: ibid., pp. - ; meteorological division, department of transport and the division of building research, national research council, climatological atlas of canada, ottawa, queen's printer, , p. ?; john d. chapman, the climate of british columbia, reprint from the proceedings of the f i f t h british columbia natural resources conference, victoria, b. c., king's printer, . information received in an interview with dr. w. h. mathews in . c. c. kelley and r. h. spillsbury, soil survey of the lower fraser valley, department of agriculture, technical bulletin , ottawa, queen's printer, , p. . note: a l l references to other s o i l types are taken from the same source. g l a c i a l d e p o s i t i o n in t h e e a s t e r n p a r t o f t h e l o w e r f r a s e r v a l l e y l e g e n d map a s i e m e n s f r o m c soils of the e a s t e r n part of the lower f r a s e r valley c.kelley ond r.h. spilsbury, soil survey of the lower froser v o l l e y , ottawa, department of agriculture, . si s o i l t y p e s e v e r e t t g r a v e l l y sandy l o a m — a monroe clay lynden g r a v e l l y loam ly « l ' . e r w o o d sandy loam ^_ l y n d e n gravelly silt loam ^ alderwi silt loam , »a lynpef.' silt l o a m — jr[[ whatcom silt loam w monroe l o a m y s a n d fjl l a d n e r clay- l monroe loam ^ m i x e d p r o f i l e mx m o n r o e c l a y l o a m — — ' jj_ peat p a r e a s of m e n n o n i t e s e t t l e m e n t ( r e f e r to m a p s ft ic) a r e a s with a l t i t u d e s over ft. [pjrmh q j mi a s i e m e n s m a p chapter iy sequent occupance op the mennonites in the fraser valley in response to the attractions of southwestern british columbia's climate, and to an offer of land, mennonites began to move into the lower fraser valley i n . they had suffered through droughts and hard winters * in the prairie provinces and looked forward to the long frost-free seasons, abundant, well-distributed r a i n f a l l and mild temperatures they had been told prevailed on the west coast. the advertisement of a certain mr. c. eckert, car- ried i n the winnipeg free press prairie farmer early in had offered settlement opportunities in the yarrow area. there had been reports, too, of possibilities in upland areas around abbotsford. offsetting these attractions were known drainage problems affecting such low-lying areas as yarrow and greendale and heavy timber and stump stands such as those around abbotsford. methods of land procurement most mennonites who took up land in the fraser valley during the early years of the establishment of mennonite communities procured tracts in one of three ways. the f i r s t and very interesting way involved the already mentioned mr. eckert, who, together with mr. e. a. crain, owned sizeable tracts near agassiz and the l i t t l e railroad station of yarrow. mr. eckert acted somewhat in the role of a "locator" for many mennonite farmers. with his help and general good w i l l toward mennonites, born out of earlier associations with the group in eastern canada and the united states, the yarrow settlement was able to get under way. he sold the original tracts on long-term credit, furnished the f i r s t building materials for the farmsteads, procured agricultural machinery and then waited long and patiently for repayment — in so doing, becoming the revered patron of the community. the municipal and provincial governments also had a hand in locating the mennonites in the fraser valley, in matsqui municipality had specifically reserved a tract near the present clearbrook settlement for these people. later i n the same year i t offered for sale at public auction two sections of land in the abbotsford area between the international boundary and huntingdon road (map ) . this was an opportunity open to a l l , but i t was a special chance for the mennonites who might now acquire adjacent tracts and again settle together i n a block. only a few of the mennonites present at this auction, however, availed themselves of this opportunity because they had expected the minimum price per acre to be $ . when actually i t turned out to be $ . . many soon realized what a mistake they had made in not buying the land even at this price, since they ended up paying more for the land land in the ensuing weeks and months to speculators who had quickly bought i t up. simultaneously with these developments and later, wherever mennonites were to settle, tracts were individually procured by private purchase or even by the acquisition of homesteads. is a result of their close family ties and strong group consciousness these people always endeavoured to buy up plots in close proximity to one another. this was particularly successful in the area that became known as "south abbotsford" and also north and south of the junction of olearbrook road and the trans canada highway. in other rural areas entered by mennonites, and also i n vancouver, grouping was possible only to more limited degrees. periods of settlement the thirty years of mennonite settlement in the fraser valley that were thus begun may be divided roughly into three periods of overall development: ( ) the pioneer years, ( ) the post-war "boom" and ( ) the period of large scale centralization and urbanization. during this time there was a progressive increase in the total number of mennonites resident in the fraser valley (table iv). the f i r s t period lasted from to the beginning of world war ii and saw the establishment of f i r s t settlements. the second period, coinciding with the last years of the war and the immediate post-war years, saw an upsurge i n the economy and a marked acceleration of the i n f l u x of mennonites from the p r a i r i e provinces and elsewhere. the third period, beginning around , s t i l l witnessed a r e l a t i v e l y high rate of influx, but also a gradual change i n orientation of mennonite settlements from the r u r a l farm to the r u r a l non-farm and the urban, a substantiation of these changes i n the size, structure and orientation of the entire mennonite community i n the fraser valley i s provided by a table of church member- ship figures (table xvii), this table is more closely analysed later and so serves here only as an index to the o v e r a l l trend. a continuous growth i s evident, as well as an increase i n the rate of growth just after the war. of particular interest i s the retardation of growth i n r u r a l churches and the simultaneous disproportionate growth i n urban churches during the l a s t period. pioneer period in the consideration of the pioneer period of mennonite settlement the f i r s t area that must be mentioned i s agassiz. mr. eckert and his partner owned a farm there and so they encouraged some of the mennonites arriving from the p r a i r i e s to rent tracts on i t . a few complied, but they soon found that there were not nearly enough opportunities for remunerative employment available, certainly not as many as were offered i n the hop yards close to the newly established settlement of yarrow. without this part-time employment i t was impossible to make a living in these early years. it was also found that there were no really good tracts of land available near agassiz for a sizeable group settlement. very soon these people began seeking land elsewhere, and most of them found i t in the abbotsford area. settlement began in earnest with the establishment of the yarrow community. mr. eckert met the f i r s t group of families that arrived at the small station on the b. c. electric railway line known as yarrow and assisted them in the establishment of an i n i t i a l communal residence on mountain road. he had for their settlement a tract of acres, divided into acre parcels. they were to pay $ per acre « actually a high price at the time — and were to be given ample time for repayment. mr. eckert was willing, as was previously indicated, to furnish tractors and cattle to get the settlement under way. soon the first families were settled in their crude dwellings — and i t was not long before other groups of families arrived. the land itself needed to be cleared of its poplar trees and brush, and of logs which had floated in during high level periods in old sumas lake. wood was skidded in from the railway for the erection of dwellings and out-buildings. drainage ditches were dug, fences built and rough roads laid out. t h e c o m m u n i t y s u s t a i n e d i t s e l f d u r i n g t h e s e d i f - f i c u l t y e a r s b y t h e r e t u r n s o f t h e w o r k o f a l l a b l e - b o d i e d m e n i n t h e n e a r b y h o p y a r d s , m u n i c i p a l m a i n t e n a n c e p r o j e c t s a n d o t h e r j o b s . g r o w n - u p g i r l s o f m a n y o f t h e f a m i l i e s w e r e s e n t i n t o v a n c o u v e r t o a u g m e n t t h e f a m i l y b u d g e t b y w a g e s e a r n e d a s s e r v a n t s a n d h o u s e k e e p e r s . d u r i n g h o p - p i c k i n g s e a s o n , e v e r y o n e f r o m t h e y o u n g s t e r s t o t h e g r a n d p a r e n t s w e n t o u t t o e a r n a s m u c h a s t h e y c o u l d . w h i l e e a r n i n g a l i v i n g e l s e w h e r e t h e s e t t l e r s s o m e h o w m a n a g e d t o p r e p a r e t h e i r f a r m l a n d a n d e x p e r i m e n t w i t h a v a r i e t y o f c r o p s . e v e n t u a l l y i t w a s f o u n d , l a r g e l y b y t r i a l a n d e r r o r , t h a t c r o p s s u c h a s s u g a r b e e t s , b e a n s , l e t t u c e , a s p a r a g u s , c a b b a g e a n d c a r r o t s w e r e a l l n o t s u i t a b l e t o t h e s o i l a n d d r a i n a g e c o n d i t i o n s . r a s p b e r r i e s a n d s t r a w b e r r i e s , p a r t i - c u l a r l y t h e f i r s t , o f f e r e d t h e g r e a t e s t p o s s i b i l i t i e s a n d h a v e r e m a i n e d t h e m a i n s t a y o f t h e c o m m u n i t y e v e r s i n c e . t h e s o i l f u l f i l l s t h e n e e d s o f t h e r a s p b e r r y p l a n t , a n d t o a l e s s e r e x t e n t t h o s e o f t h e s t r a w b e r r y p l a n t t o o , i n t h a t i t h a s a r e a s o n a b l e f e r t i l i t y a n d g o o d s u b s o i l d r a i n a g e . t h e c l i m a t e o f t h e a r e a p r o v i d e s a f a i r a m o u n t o f r a i n f a l l , s u f f i c i e n t l y h i g h t e m p e r a t u r e s i n summer a n d a n a s s u r a n c e o f a n a d e q u a t e n u m b e r o f f r o s t - f r e e d a y s . a b e l t a l o n g t h e d y k e h a s p r o v e d p a r t i c u l a r l y p r o d u c t i v e b e c a u s e o f t h e s t e a d y s e e p a g e o f m o i s t u r e f r o m t h e c a n a l , w h i c h s u p p l e m e n t s n a t u r a l p r e c i p i t - a t i o n i n t h e d r y s e a s o n . the depression of the early 's kept the community i n financial straits longer than might have been necessary had i t been farther along in i t s development. by » however, many farms were productive enough to allow the heads of households, at least, to remain at home. yarrow survived i n i t i a l hardships and grew steadily, in spite of the fears held by mennonite leaders elsewhere in canada, from whose congregations people were moving to british columbia, that i t would not prosper financially. very soon after i t s establishment an institutional framework grew up in i t . the church, obviously the most important institution in the community, existed from earliest times right in the homes of the settlers. in the mennonite brethren faction built their f i r s t church building, only to replace i t in with a much larger structure, which, with alterations, remains the building in use today. the general conference mennonite group did not build their church until . this building, somewhat altered, is also s t i l l the present church. a bible school was established in - by the mennonite brethren church to f u l f i l l their needs for trained personnel. secular schooling was under public administration from the start. the f i r s t building provided i n was replaced in by a new, municipally built one-room school. further f a c i l i t i e s i n this respect were added later. it was not until after the war that the community, with government permission, built a private high school. this school, as well as the mennonite educational institute built i n olearbrook, was to conform to governmentally set academic standards, but to draw i t s support entirely from the community i t served. in the mennonites of yarrow organized a co- operative amongst themselves which was to provide consumer goods at lower prices on the one hand and familitate the marketing of produce on the other. going beyond the pioneer period for a moment, i t may be noted that the co-op grew in assets, t i l l in i t boasted a $ , processing plant with some $ , of equipment in i t . in the slump year of , however, charges of mismanagement were laid against the management, i n view of their inability to dispose of 's bumper crop and the heavy debts they had incurred in over- ambitious expansion schemes. shareholders lost faith in the establishment and voted for liquidation. they finally realized some # on the dollar. electricity was brought to the community in . other f a c i l i t i e s , such as pavement and sidewalks had to wait a good deal longer. local government was organized in an unofficial manner during the early years in order to cope with problems of providing basic u t i l i t i e s such as roads and water and in order to head off emergencies. m l the property owners made up a council, and elected a chairman or "schultze" after the old form, as well as a secretary. in the yarrow waterworks board was granted a charter and i t became the f i r s t o f f i c i a l governing body of the community. in this capacity i t achieved the installation of a fresh water supply from a nearby mountain creek after seepage from barns and septic tanks was found to be polluting the wells. in addition i t was respon- sible for the organization of a f i r e department. it has sinee served to mediate between the chilliwack township and yarrow ratepayers, and has also become the mouthpiece for organized opinion in the community. in , j. c. krause, one of the earliest settlers in yarrow, together with two partners, bought up a tract of land north and east of the vedder canal. they realized that the influx of mennonites would probable increase in volume and that these would soon be in need of more land for settle- ment. they closely inspected and classified their new tract and then made i t available through an agent in chilliwack to incoming settlers. this became then the greendale mennonite settlement. at the outset i t was hoped that this area would be taken up exclusively by mennonites of the general conference group and the yarrow area be l e f t to those of the mennonite brethren persuasion, but an intermingling took place never- theless. immediately from the beginning of the greendale settlement a "conference" church was organized; the "m.b.'s" organized independently some four to five years later. the f i r s t mennonites coming into the abbotsford area around from the abandoned agassiz settlement and from uneconomical p r a i r i e farms found generally f e r t i l e , well-drained land, but also a heavy second growth of forest i n many places and huge stumps everywhere. the e a r l i e s t s e t t l e r s took up land especially reserved for them by the matsqui municipality north of the trans-canada highway along what has become clearbrook road (map ) . a forest f i r e had burnt over the area i n , leaving a s t r i p of t a l l pines unscorched along old yale road — a good number of which have been preserved to the present time. elsewhere a low brush of small pines, alders, birches and hemlocks predominated. land i n the area was r e l a t i v e l y inexpensive, but i t proved also to be of low a g r i c u l t u r a l potential. a short time l a t e r , as has already been noted^- i n connection with the methods of land procurement, a number of mennonite settlers acquired land south of the clearbrook area by purchase through auction and from private holders. their sites had been recently logged off, for the most part, and were covered by low brush, a tangle of logging slash and a veritable forest of stumps and snags. settlers there, as i n yarrow and elsewhere, were obliged to work for wages i n the early years u n t i l their farms became self-supporting. the depression, of course, made jobs hard to get and wages low. many cycled long distances to work on farms i n sumas p r a i r i e — one of the e a r l i e s t settlement areas i n the fraser v a l l e y . others got jobs on road b u i l d i n g p r o j e c t s i n i t i a t e d by the m u n i c i p a l i t y . in t h e i r spare time they worked hard to c l e a r p l o t s f o r b u i l d i n g s , then f o r the p l a n t i n g of tree f r u i t s and small f r u i t s , and e v e n t u a l l y the seeding of f i e l d s f o r pasture. u n t i l - they d i d t h i s c h i e f l y by hand implements and the occasional use of stumping powder. later dynamite came i n t o very wide use and i t , together w i t h the b u l l d o z e r , f a c i l i t a t e d the c l e a r i n g "boom" that began i n the e a r l y 's. the t y p i c a l mennonite farmstead i n abbotsford, as w e l l as i n otherfraser v a l l e y settlements, consisted of unpretentious b u i l d i n g s , which were u s u a l l y set back a good distance from the road or t r a i l and constructed of whatever lumber could be purchased or manufactured r i g h t on the property i t s e l f . people s p l i t t h e i r own shakes f o r r o o f i n g and s i d i n g and long staves f o r r a i l fences. p a i n t and other decorations were r a r e l y used. as l i t t l e land as possible was used f o r yards and every a v a i l a b l e p l o t of cleared land was used f o r crops. c a t t l e were grazed on land that had had the brush removed and grasses seeded between the stumps. the mennonite brethren church was organized among these s e t t l e r s as e a r l y as the spring of . the congreg- a t i o n f i r s t met i n the farmer's i n s t i t u t e h a l l i n clearbrook road, south of king road (map ), but t h i s l o c a t i o n imposed hardships on many who had to walk long distances to attend services. in i t was decided to build two churches, one at the corner of old yale and clearbrook roads, the antecedent of the present church there, and the other on emerson road south of huntingdon. both of these buildings had to be enlarged within a few years. in abbotsford, as i n yarrow, mennonites of both "conference" and "m. b." groups banded together into a co-operative. here, however, the purpose was largely the procurement of consumer goods at lower than general r e t a i l prices. in a store was opened i n a private home on huntingdon road, and then a year l a t e r i t was moved to a separate building on i t s present s i t e . after three or four years i n these rather cramped quarters a new building was erected and a branch store opened i n the clearbrook area. in the whole co-op was sold to private individuals and a progressive l i q u i d a t i o n has gone on since then. to complete the picture regarding mennonite co-ops, i t might be interjected here that a co-op for the marketing of produce was formed i n abbotsford among the mennonites and a few of their non-mennonite neighbors i n - . its plant was erected just off the abbotsford-mission highway, where i t functioned successfully u n t i l being moved i n to i t s new location on the trans canada highway near clearbrook. mennonites began to move into the mission area i n « they came from the p r a i r i e s , as those moving i n t o yarrow and abbotsford had done, and established small f r u i t farms on the h i l l y t e r r a i n north of the fraser, as w e l l as l a r g e r general farms on the matsqui f l a t s . to supplement meager returns on t h e i r farm lands they took jobs i n sawmills and wherever else they were a v a i l a b l e . at f i r s t members of both the mennonite brethren and general conference persuasion met together f o r worship i n p r i v a t e homes. i n - the general conference people e s t a b l i s h e d t h e i r own church north of mission. i t was not u n t i l - ", when the economic upsurge of the l a t e war years and the associated increase i n the number of mennonite migrants i n t o b r i t i s h columbia were w e l l underway, that the mennonite brethren adherents acquired a church j u s t north of the v i l l a g e of matsqui. even though the predominant o r i e n t a t i o n of the mennonites i n the fraser v a l l e y was s t i l l r u r a l some f a m i l i e s already were moving i n t o vancouver i n the e a r l y ' s. by there were some half-dozen mennonite homes established near fraser s t r e e t . the p l o t t i n g of f a m i l i e s making up the vancouver m. b. church and the f i r s t mennonite (conference) church (map ) mirrors t h i s e a r l y conscious attempt at close settlement i n an urban area. the reasons f o r movement i n t o the c i t y were l a r g e l y economic. people needed jobs and these could be found i n the saw mills on the north arm of the fraser river. wages, however were only some to cents an hour and the general economic conditions as d i f f i c u l t there as anywhere else at this time. eventually other avenues of employment opened for the mennonites, including skilled and professional occupations, until at the present time the economic base of the mennonite community here is relatively broad. the one main mennonite institution that was able to survive the shift from rural to urban, the church, was organized in the city soon after the people settled there. mennonite brethren and general conference adherents at f i r s t worshipped together i n a hall at th avenue and fraser street. in separate churches were organized and buildings provided, an interesting smaller institution, antedating the earliest mennonite church i n the area was the "m&dchenheim" or g i r l s ' home, established in . it helped mennonite girls coming into the city to find jobs and generally sought to shelter them from harmful influences. in a modified form the home exists to the present time. post-war "boom" during the war years and immediately after them the canadian economy, only recently recovered from the great depression lag, was experiencing a forward thrust in response to demands for increased production in a wide range of fields. in agriculture, a l l existing capital goods and land resources had to he utilized in the most efficient manner possible. markets presented few problems; the major problem was to be able to deliver. in the prairie provinces, where farmers already had had to make drastic adjustments in crops, machinery and acreage to the market and to drought conditions in the decade before the war, mechanization and consolidation of farm holdings gathered momentum. in british columbia intensification of land use through mechanization, chemical fertilization, irrigation and the introduction of improved stocks was going on, together with an extension of the area under cultivation, as well. the physical value of production increased some forty per cent here from - . the improved land areas increased some twenty-five per cent. larger farms of over acres were increasing only slowly in number, whereas the smaller farms, particularly those between and acres, were increasing very quickly. this reflected the possibilities for production on small, intensively-farmed plots as well as a desire on the part of many farmers to operate with as l i t t l e hired labour as possible and perhaps even to operate the farm as a sideline to more profitable employment elsewhere. against the background of these overall economic factors the influx of mennonites into b. c. increased markedly, as did the general migration of population westward (map ) . the trend toward the liquidation of marginal farms on the prairies and their consolidation into larger holdings heightened the attraction of small economic acreages in b. c. for many a mennonite farmer, tired of the rigors of grain farm work and prairie climate. just as important to many prospective mennonite migrants were the attractions of religious and educational opportunities that could be offered by rapidly growing settlements such as yarrow, abbotsford or greendale. added to a l l this, of course, was the ever-present attraction of a moderate climate and a beautifully-green, mountain-ringed location. in the established mennonite settlements a l l through the fraser valley incoming mennonites, using the capital acquired through liquidation of holdings elsewhere in canada, bought up more and more of the land held by non-mennonites. those who had come in as pioneers built new homes and barns. implements and vehicles were replaced and supplemented. in areas where land remained to be cleared, particularly in the abbotsford and aldergrove areas, dynamite and bulldozers were brought into service on a large scale to win new acreage. many landowners found i t profitable, moreover, to subdivide their holdings and realize tidy profits on the resale of plots to other mennonite farmers who were willing to establish farms on a smaller scale. new church buildings that sprang up during the immediate post-war period attested visibly to the increasing prominence of the mennonites in many communities. no fewer than nine churches were built within the - - period — each one of them, because of the locational policies of the builders, being f a i r l y accurately in the center of a new group of mennonite households, (map ) . the new schools built in these years, while also marks of the physical expansion of the community, showed something of heightened group consciousness and aspirations as well. the f i r s t one was established in abbotsford in and housed in a new building in . the other one was built i n yarrow soon after. both helped to focus the orient- ation of the mennonites on these two localities. after the economic decline of yarrow in , abbotsford, and more particularly the new settlement of clearbrook, became the major center of mennonitism in the valley. (f^ure^) the rise of mennonite centers during the latter part of the post war "surge" merits further mention here and special consideration as to structure later in this study. in response to needs for services, a business district, largely operated by mennonite businessmen, grew up in yarrow. clear- brook advanced from its"crossroad-filling-station"status to that of a service "village" too. general stores, garages and a few other services, usually operated by mennonites, were established near a number of churches. such centers, hardly deserving the t i t l e of "hamlets" may be seen at green- dale, arnold, south abbotsford and west abbotsford (maps and ) . the center at south abbotsford was later to undergo an interesting shift as the result of the abandonment of the ol< church and the building of a new one approximately one half-mi < figure . mennonite schools i n the fraser valley a. mennonite educational institute, clearbrook. bo sharon mennonite collegiate institute, yarrow. c. former s.m.c.i., yarrow. d. mennonite brethren bible school, clearbrook. distant. present period of centralization and urbanization the accelerating demand on the part of prospective home builders and r e a l estate promoters for lots on the one hand and the pressure exerted on farmers by the r i s i n g costs of upkeep, mechanization and r a t i o n a l i z a t i o n on the other are at present converting more and more farm land i n the fraser valley, as elsewhere, to non-agricultural uses. this has brought new patterns of settlement and, indeed, a new s o c i a l and c u l t u r a l orientation i n i t s wake for the men- nonites — as w i l l be brought out i n greater d e t a i l i n the l a s t chapter. alternative and more lucrative opportunities for employment have for some time now been inducing very many mennonite young people to leave the farms and come to the c i t y . landowners thus l e f t without successors to cultivate their land are being forced to s e l l and move into towns and c i t i e s as well. i t i s reported from the area that the buyers of these farms are largely european immigrants, as i s the case i n other parts of canada. i t seems that they are s t i l l w i l l i n g , together with their families, to take up a - acre dairy farm. farmers on small, formerly economical tracts of land, f i n d they must take on additional employment and join the increasing stream of long distance commuters coming from r u r a l fraser valley points into areas where employment may be found i n construction, m i l l i n g or other pursuits. often these owners subdivide their properties or simply dispose of them entirely. the dominant pattern of employment resembles again the wage-earning, part-time farming situation of the pioneer period, except that i t is a deliberate move away from or de-sire agriculture and carries with i t l i t t l e hopeafor a return to full-time farming. an index of this large scale change in settlement patterns of the mennonites is the trend in congregational grouping and new church construction. since - most of the new congregations organized and new churches erected have been in rural non-farm or urban areas (table xv). s certainly the recent dwelling of membership numbers in mennonite churches in clearbrook, chilliwack and especially vancouver indicate well this trend toward urbanization. in the following chapter this large scale shift and other related changes and conditions among the mennonites in the fraser valley w i l l be dealt with in terms of statistics. footnotes and references a man who precedes a group of s e t t l e r s into an area and works to f a c i l i t a t e i n i t i a l d i v i s i o n of land, upkeep of the s e t t l e r s while they are getting established and so f o r t h . i t i s an ancient term used, for example, with reference to individuals who led eastward germanic settlement movements into central europe during the th and th centuries. one of the community's main roads i s respectfully named eckert road. j. m. smith, canada's economic growth and development from to % royal commission on canada's economic"' prospects, hull, queen's printer and controller of stationery, , v o l . , p. . chapter v a statistical delineation of the situation of the mennonites in the fraser valley valuable facts come to light when one complies statistics on any situation, breaks them down into component parts and analyses' them with the help of various techniques and formulae. to provide the basis for such an analysis of the distribution and characteristics of the mennonites in the fraser valley, s t a t i s t i c a l information was gathered from a number of sources. these sources, which were different in some respects than those most often utilized in other geo- graphic studies, must be discussed and evaluated before actual figures can be quoted. sources the census of canada for provides data on mennonites as a religious denomination. it enumeratess the specific religious denomination of which the person was either a member or to which he adhered or favoured...! this probably gives f a i r l y accurate.figures as to numbers of mennonites i n the various areas and under various classifications because the great majority of them, whether they belong to one or another of the four sub-groups mentioned, would acknowledge themselves as mennonites without hesitation, since their adherence is a deep-seated cultural as well as religious a f f a i r . even those who do not have membership in any parti- cular church congregation would not readily deny their heritage. origin statistics were not utilized because of the confusion regarding concepts such as nationality, birth place and race that enters into a consideration of this type. n. b. snyder, in a discussion of the usefulness of canadian origin statistics summarizes the limitations of this data well when he states that: . . . i t seems f a i r to conclude that the usefulness in research of canadian statistics on origins is probably limited for the most part to the dividing of the population into four broad groups? the british, the french, the other whites and the non-whites, and that attempts to carry out serious, more detailed research on origins requires extreme caution, particularly with regard to variations through time. much valuable information was gained from individual church records wherever they were in a sufficiently systematic and orderly form. the records of the fraserview mennonite brethren church in vancouver provided the most useful data, and this is analysed in detail below. it is interesting to note that the emphasis in most of the mennonite church records on family descendance, personalities involved in church leadership and data relating to the spiritual growth of the church, rather than on the simple numerical characteristics of the group, their economic and cultural standing and the like. map ̂ mennonites in t h e l o w e r f r a s e r v a l l e y total — ca. , one dot = a r e a s o v e r in a l t i t u d e census of canada — i f m a p . a s i e m e n s the l a t t e r considerations are appearing more and more frequently, however, as the organization of the churches becomes more unified and methods of recording are perfected and extended. the published church directories were useful i n outlining the tributary regions of the respective churches. in addition to the i n d i v i d u a l church records, the yearbooks of the several b r i t i s h columbia, canadian and north american conferences of which the churches i n the fraser valley are members, i n one way or another, provided useful material — p a r t i c u l a r l y regarding past membership t o t a l s . municipal voter's l i s t s were used i n several of the r u r a l municipalities of the valley, where mennonites are most numerous, i n order to find the r a t i o of mennonites to non-mennonites. f i e l d inquiries supplemented a l l of these, p a r t i - cularly to f a c i l i t a t e the delimitation of church tributary regions and the tracing of h i s t o r i c a l developments. distributions the percentage dot map showing the mennonite population of canada (map ) , as compiled from census figures, indicates that . $ of canada's , mennonites, some , of them, were resident i n b r i t i s h columbia. this compares with the . $ i n manitoba, . $ i n saskatchewan, , $ i n ontario and . $ i n alberta. the entire mennonite population of canada i s . $ of the t o t a l canadian population,, of british columbia's , mennonites the over- whelming majority, or at least , , were in the fraser valley in .^ it may be projected on the basis of increases in the province's mennonite church enrolment from to that this figure rose to some , in . this is in the same o order of magnitude as an estimate of ,# made by the rev. a. a. wiens of yarrow, secretary of the british columbia office of the mennonite central committee and a man well acquainted with trends in the mennonite community.^ the dot map showing mennonites in the fraser valley (map ), compiled from census data and correlated with the map of church tributary regions (map ), indicates concentrations of mennonites in the essentially rural municipalities of matsqui and chilliwack, a concentration in vancouver and scatterings else- where. the following table gives the exact numbers involved. table iii total of mennonites i n sub-divisions of census division no. - lower fraser valley , . district municipalities chllliwhack , coquitlam delta fraser mills kent langley l maple ridge matsqui , mission - pitt meadows sumas , surrey unorganized , total , . vancouver metropolitan area city proper , richmond surrey burnaby coquitlam new westminster other sub-divisions combined - bi note: there is some slight overlapping in these two sub-divisions, therefore a minor discrepancy appears between the lower fraser valley total and the sum of the totals of the district municipalities and the metropolitan area. a further table, also obtained from the census, shows the increase of the mennonite population of b. c : table iv total numbers of mennonites in b. c , - ^ , , , the increase, therefore, has been continuous and f a i r l y rapid, except for a short period around when settlements in central british columbia failed and had to be partly abandoned. characteristics of mennonite population a closer analysis of figures obtained from the census, church records and field inquiries, provides interesting information on many aspects of the internal structure of the group, particularly when these figures are compared with those for the entire populations of british columbia and of canada. the mennonites of this province and of the whole country, as well, have much greater percentages of their total numbers resident in rural areas than is the case for the rest of the population of federal and provincial levels. this clearly reflects persisting agrarian tendencies up to . it must be remembered, however, that the rural- urban relationship w i l l have been altered for both mennonites and non-mennonites since . certainly i t is evident from church membership trends in the fraser valley that a greater percentage of the mennonites there are urban now than were so in . an interesting deviation from national and provincial male-female breakdowns is also evident, as the following table shows? table v male-female breakdown - canadian canadian b. c. b. c. total mennonites total mennonites total , , - , , , , m. , , , , , f. , , , , , \ there are more females than males in the mennonite populations of the nation and of b. c, in contrast to an opposite trend in the total populations of both regions. this is largely, no doubt, a result of the recent immigration of numerous female mennonite refugees from eastern europe where many of their husbands, fathers and brothers were war casualties or victims of slave labour. patterns of immigration from the and issues of the canadian mennonite conference yearbook ^ certain facts regarding the stream of mennonite immigrants into canada and into british columbia may be ascertained. in general, since the early 's, there have been two main waves of mennonite immigrants, one from - and another from - - ? with sizeable numbers entering the country in the intervening years. the table below cites some figures regarding this influx: table vi immigrants brought in under the auspices of the mennonite board of colonizationll . , . , , , , , ' , , , m , until recently these immigrants were coming mainly from european countries. in the last two or three years, however, the contingent coming from paraguay has grown in significance and at present i t is the largest part of the influx. figures available on the classification of these immigrants as to origin follows table vii origin of immigrants brought in by mennonite board of colonization ^ immigrants arriving immigrants arriving - june, june - june europe , paraguay , brazil uruguay china mexico argentina columbia , of the immigrants coming into canada from - some $ have come to british columbia. only manitoba has received a greater percentage, as seen below: table viii destinations of mennonite immigrants - - prince edward island hew brunswick quebec ontario , manitoba , saskatchewan , alberta , british columbia . , for the same period, - a breakdown of mennonite immigrants is available, showing that a greater number of females than males entered canada — for reasons already referred to in the discussion of male-female classifications. table ix classification according to sex of immigrants arriving in - intact families widows and women whose men were taken into slave labour widowers and men whose women were taken into slave labour single men single women c one entra t i ons it has already been pointed out that on the map showing the distribution of mennonites in the fraser valley (map ) the municipalities of matsqui and chilliwack stand out with their particularly heavy concentrations of these people. from the voters' l i s t s of these two municipalities some idea of the percentage of the population that is men- nonite within them can be gained by singling out those registered voters with typical mennonite names and comparing their number with that of the non-menn_onites. it must be interjected here that i t is possible to identify mennonite names generally, and also to dif- ferentiate between the names that may be found within various strains of mennonitism. a good deal of work has been done by scholars, notably dr. b. h. unruh of karlsruhe, germany, to , establish origins of mennonite names and to c l a s s i f y them. the great majority of mennonites i n the fraser valley are c l e a r l y of the s t r a i n that originated i n the netherlands and north germany, moved from there to prussia, russia and f i n a l l y to north america — i n contrast to the other main s t r a i n that originated in switzerland and what i s now southwestern germany, moved from there to pennsylvania and other eastern and mid-western states. from church directories a l i s t of names peculiar to these people was compiled (table xvi). when encountered i n records by anyone at a l l familiar with them they stand out c l e a r l y . matsqui and "]% of those i n chilliwack were mennonites. when compared with the breakdown of major ethnic groups for census division of b. c. the above percentages show that mennonites make up a considerably higher proportion of the population of these municipalities than i s the case for the population of the entire d i v i s i o n . ethnic breakdown i n census division no. of b r i t i s h columbia total population of division - , i t was found i n this way that -% of the voters of table x % of total german french b r i t i s h scandinavian , , , , , , h . . . netherland ukrainian . . . the german and netherland segments, under either or both which mennonites might he c l a s s i f i e d ethnically, together make up only . % of the population of the d i v i s i o n . a further refinement regarding concentration was obtained from post o f f i c e r e g i s t r i e s i n the villages of yarrow and clearbrook. using mennonite names as c r i t e r i a again i t was found that in both settlements the mennonite to non-mennonite r a t i o was * . ° c a l l them "mennonite towns", as many casual observers do, i s therefore quite j u s t i f i a b l e . the degree of concentration of mennonites within the vancouver metropolitan area i s best conveyed v i s u a l l y , as on the isopleth map showing the concentration of mennonite families within the area (map ) . a rough quadrangle, bounded on the north by king edward avenue, on the east by v i c t o r i a drive, on the south by the north arm of the fraser and on the west by gamble street enclosed most of these families. a scattering may be found concentrically around this area. a new grouping has taken place i n - east of v i c t o r i a drive into burnaby. this trend w i l l no doubt be accentuated i f and when the proposed new mennonite brethren church i s b u i l t i n that general v i c i n i t y . shifts i n the center of gravity of the group to give some idea of the movements that have taken place within the mennonite community of the fraser valley over the l a s t twenty years the centers of gravity were calculated for church membership figures throughout the area at two-year intervals. ( e a r l i e r centers could not be calculated because of the inadequacy of available figures). these points were then collated into a centrogram and the movement of the centers noted (map ). church membership figures were used for a number of reasons. they were, f i r s t of a l l , the only yearly s t a t i s t i c s on mennonites available. then, even though they do not include younger children and deviants, they seem a f a i r l y constant index of the whole. this i s so because, t r a d i t i o n a l l y , these people are very closely connected to their church and hence there are not very many families who are not represented on the church r o l e . also, most of the churches induct young people i n their early teens and thus ensure a f a i r l y constant increase. the r e l i a b i l i t y of these figures as indices i s substantiated by the relationship evident between figures for t o t a l mennonite populations i n census division no. of b. c. and figures for church membership i n the years and . in the f i r s t case membership figures are . $ of the t o t a l mennonite population; i n the percentage i s . , a difference of only $. it may be assumed, therefore, that large scale trends in church membership figures mirror trends i n the entire mennonite community. in this case we are able to recognize changing settlement patterns i n the whole group from s h i f t s i n membership figures. the center of gravity moves f i r s t eastward and then pronouncedly westward from - . this locus is i n clear and close correspondence with other factors. in the period between - , for which the center moved eastward, the destination of mennonites migrating from the prairies into b. c. and those immigrating from europe was predominantly into r u r a l areas of the valley — thus swelling church memberships in places such as chilliwack, greendale, yarrow and abbotsford. around a remarkable reversal took place, as a result of a decrease i n job opportunities i n r u r a l areas together with a decrease i n attractiveness of existing opportunities there — over against the increased attractiveness of the urban environment i n many respects. in any case, a strong movement toward vancouver becomes evident i n the pronounced westward s h i f t of the center. this movement probably represents the most s i g n i f i c a n t large scale s o c i a l change going on amongst mennonites, and the surrounding population too, for that matter. further deductions as to minor variations i n the locus of the center of gravity are not warranted because of the frequent minor i r r e g u l a r i t i e s i n the way church secretaries send s t a t i s t i c s into conference headquarters. the l i n e i s useful simply to i l l u s t r a t e a general trend. the fraserview mennonite brethren church — an example study from the well organized and r e l a t i v e l y comprehensive records of the fraserview mennonite brethren church of vancouver it was possible to obtain detailed information regarding the membership and thus to i l l u s t r a t e on the l e v e l of one individual church a number of general points made else- where i n this thesis. at the close of the church had a t o t a l of members, which represented families. including children years old and under who were not classed as members, the church had some adherents. the record of the birthplaces of the congregation showed up two main places of o r i g i n . some $ of the con- gregation, most of them being over years of age, were born i n the p r a i r i e provinces. another $, most of them over years of age, were born i n russia. this r e f l e c t s clearly the main components of most mennonite congregations i n the fraser valley. those who were i n the f i r s t wave of mennonite immigration after world war i are now over years of age. most of these people settled i n the p r a i r i e s f i r s t and raised families there. their children, as well as some children of e a r l i e r (c. ) immigrants, are the group that register with p r a i r i e birthplaces. the small group of members born i n b r i t i s h columbia (some - $), a l l between and years of age, are the offspring of mennonite pioneers i n this province. the almost complete absence of members who were born i n vancouver ( $) indicates that the offspring of the early mennonite brethren settlers i n vancouver are either a f f i l i a t e d with the f i r s t of their churches to be organized i n vancouver, the vancouver mennonite brethren church at rd avenue and prince edward street, or are not yet of baptismal and induction age. it also shows the obvious fact that the families of the recent wave of young mennonite migrants into the urban area are small and their children mostly below baptismal age as yet. an analysis of occupations represented within this church's membership shows a f a i r spread over a variety of f i e l d s . certainly the absence of the a g r i c u l t u r a l pursuit i s i n i t s e l f already a wide deviation from the t r a d i t i o n a l orientation of the group. the greatest number of the gainfully employed members may be classed as tradesmen and labourers. while s t a t i s t i c s were being compiled, i t was noticeable that among them a surprisingly large number of elderly men held positions as common labourers, a r e f l e c t i o n of the d i f f i c u l t i e s these men had i n gaining qualifications for better jobs and a secure future under the turbulent conditions of the russian revolution and the depression years that followed while they were i n canada. a sizeable number of better qualified persons are already to be found amongst these people. a growing owner and operator group i s i n evidence. there are a number of professional people, most of them i n professions t r a d i t i o n a l l y sanctioned within mennonitism, such as medicine, nursing and teaching. among the students now enrolled i n the church, however, are those who are entering new and varied f i e l d s . understandably, a large number of young people, p a r t i c u l a r l y g i r l s , who have come from the country into the c i t y to find work, appear i n the analysis as c l e r i c a l , factory and day household workers. ? in summary, then, i t may be said that this congregation represents latest developments i n the structure and orientation of mennonitism i n this area. the r i s i n g membership (table xvii) i t s e l f i s an indication of the trend toward urbanization. the breakdown of the membership according to age groups and birthplaces represents the pattern of origin and movement westward that is t y p i c a l for many mennonites i n b. c. in the occupational structure an economic reorientation i s evident. the general s p i r i t and outlook, as well as a certain "progressiveness" — a l l of which are hard to sub- stantiate here — mirror an interesting s o c i a l and s p i r i t u a l change that seems to be spreading amongst mennonite churches of the valley in spite of their sporadic opposition to i t . footnotes and references dominion bureau of s t a t i s t i c s , ninth census of canada - ~i (ottawa, kings printer, ), v o l . , p. x v i . ' the two main sub-groups of the mennonite community i n the lower fraser valley are the mennonite brethren churches and the united mennonite churches, or as they are commonly referred to, the "general conference" people. two small sub-groups also exist, but they s h a l l be omitted i n the s t a t i s t i c a l calculations of this study because numerical information on trends within their congregations were not available, and also because both groups make up only a small part of the t o t a l of mennonites i n the valley. one of them i s the church of christ mennonite of bradner, which was established in and had some members i n . this congregation i s interesting because of the ultraconservative views i t s members hold on e t h i c a l matters and also because the men usually wear f u l l beards and no neckties. the other i s the evangelical mennonite brethren church of the town of abbotsford. i t was established i n and had approximately members i n . i. b. ryder, "interpretation of origin s t a t i s t i c s , " canadian journal of economics and p o l i t i c a l science, : - , november, , p. . the term "conference" here denotes a regional grouping of individual congregations. any one congregation may belong to provincial, national and international mennonite conferences. the term "fraser valley" or "lower fraser valley" coincides closely with census division no. , hence the figure. interview with rev. a. a. wiens of yarrow, i n the summer of . canada census , vol. i, table . canada census . vol. i, table - canada census , vol. i, table . conferenz der mennoniten i n canada, jahrbuch - jubilaums ausgabe, - , (rosthern, der bote, ), pp. - , and conferenz der mennoniten i n canada. jahrbuch - , ( , der bote, rosthern), p. . conferenz jahrbuch, , p. . conferenz jahrbuch, , p. . note: the mennonite board of colonization undertakes negotiations for the movement of displaced persons and other migrants from one country to another. it also seeks to f a c i l i t a t e the establishment of the immigrant i n his new homeland, which may e n t a i l the development of new settlements or the addition to those already well underway. conferenz jahrbuch, ? p. l l . conferenz jahrbuch, , p. . - i b i d . , p. . b. h. unruh, die niederlandlsh-niederdeutschen hintergrunde der mennonitischen ostwanderrungen im"'l ," cr,""urld^l ^e^~ ~ jahrhundert, karlsrulret'getrt^y, h. schneider, %*t, ~ canada census , v o l . i i , table l . chapter vi intra-group movement patterns centers of a t t r a c t i o n within a community and the movement of people into these centers are factors that help to bind individuals and congregations closely together. this i s certainly the case among the various separate fraser valley mennonite settlements, which we may group together and term a community because of their common heritage, common religious ideals and close ties of kinship — not to mention economic and s o c i a l connections. probably the most important central point of a t t r a c t i o n for the entire group i s the mennonite secondary school i n clearbrook, known as the mennonite educational i n s t i t u t e . there are other centers that are also important points of attraction, such as the mennonite brethren church i n yarrow, where large conferences are occasionally held; the bible schools i n chilliwack, yarrow and abbotsford to which many students come; and the fraserview mennonite brethren church i n vancouver, where many mennonite transients i n the c i t y come to worship. however, the "m.e.i.", as the high school i s commonly called, s h a l l serve here as the prominent example. i t i s possible to portray the flow of students into this center cartographically (map ). the complex convergence on the school auditorium of participants in numerous extra-curricular functions must be described generally. the school was established in the years of the great economic and numerical upsurge of the late war and early postwar years already referred to in chapter iv. the founding of the institution was a response, f i r s t of a l l , to deeply f e l t needs for secondary education f a c i l i t i e s where, in addition to the required secular subjects, studies in religion, the german language, mennonite history and the like could be offered. new functions were added to the institution, however, as i t was moved from cramped quarters near the old south abbotsford mennonite brethren church to i t s new building on the present site (map ). the auditorium of this building became the common meeting place for a l l the mennonite congreg- ations around abbotsford, as well as those elsewhere in the valley. about a year after the founding of the m. e. i. i n another mennonite high school was founded in yarrow and called the sharon mennonite collegiate institute. together with the rather spacious mennonite brethren church there i t served for a considerable period as a center for the activities of mennonite congregations in the eastern part of the valley. with the discontinuation of private secondary education in yarrow in , and also as a result of the general eclipse of yarrow by fast-growing clearbrook, the m. e.# i. became the most important mennonite meeting place in the fraser valley. in its primary function of education the school s m a l l mennonite centers in the lower fraser v a l l e y (located on map number ) "south a b b o t s f o r d " l e g e n d ch [ church or church school r — — | buildings i c i commercial buildings schools i non-farm residence h farm residence principal barns approximate s c a l e / m i . " a r n o l d " 'south a b b o t s f o r d "(old) " w e s t abbotsford" m a p a . s i e m e n s serves a far-flung constituency. the following table shows the c l a s s i f i c a t i o n of the - student body according to the congregations from whieh they came. this table may be compared with the map of church tributary regions (map ) i n order to visualize the areas involved. table xi congregational origin of students at the mennonite educational institute - bethel (g.c.) east aldergrove (m.b.) west abbotsford ( g.c.) clearbrook (m.b.) clearbrook (g.c.) south abbotsford (m.b.) abbotsford (m.b.) matsqui (m.b.) arnold (m.b.) greendale (m.b.) chilliwack (m.b.) chilliwack (g.c.) east chilliwack (g.c.) east chilliwack (m.b.) i t i s immediately apparent that considerable numbers of students would need to be transported to the school from areas as far distant as east aldergrove, arnold, greendale and chilliwack. this problem i s solved, i n the main, for students coming from eastern communities by chartered buses. car chains provide transportation for most of the other students coming from outside clearbrook. a number of them, p a r t i c u l a r l y those from vancouver and v i c i n i t y , obtain room and board near numbers of % of total students enrollment . . . - . . . . . . . . . . . the school i t i s to be noted that the high school which was re-established i n yarrow i n does not yet attract to i t s e l f many students that have been coming to the m. e. i. from chilliwack and greendale congregations. since both mennonite high schools i n the fraser valley depend, f i n a n c i a l l y , to a large degree on t u i t i o n fees, the diversion of students from the m. e. i. to yarrow would be desirable. most of the students themselves, however, prefer to continue on at the m.e.i. solutions to this situation have often been discussed amongst school board members, teachers and parents, but without r e a l success to date. in the meantime the m. e. i. i s overcrowded, whereas the yarrow school stands i n need of more students. another problem related to the finances of the school has resulted from the fact that only six of the fraser valley's mennonite congregations o f f i c i a l l y support the school by contributing to i t a certain amount per church member. e f f o r t s are being made to broaden this base, but the other churches are not anxious to increase levies on their memberships. roughly $ of the students of the school come from a mennonite brethren background, and most of the others come from general conference congregations. this i s of interest when compared with the : r a t i o of mennonite brethren to general conference that prevails i n the mennonite population of the province. the reason for this situation may be sought, largely, i n the greater stress l a i d generally by members of the mennonite brethren churches on the preservation of certain key religious principles and c u l t u r a l values. in considering the extra-curricular uses of the school, p a r t i c u l a r l y of its auditoria and playing f i e l d s , one comes on a long l i s t of interesting a c t i v i t i e s . a brief reference to the more important of them gives us a further indication of the importance of the school as a central gathering place and also shows some of the scope and character of mennonite group a c t i v i t i e s . to those who l i v e on access routes to the school the importance of these a c t i v i t i e s to mennonites i s clearly evident. streams of cars converge on the school, f i l l i n g a l l available parking space on the school grounds and on the road allowances nearby. often special t r a f f i c police and parking o f f i c i a l s are on hand to regulate the flow. clearly, the school f a c i l i t i e s meet a number of needs, mostly s o c i a l and cultural, which the individual churches are not able to meet, both because i t i s not considered suitable to hold certain events i n church buildings and also because there simply i s not another meeting place available that is so spacious and centrally located. among the cultural achievements of the mennonites their musical renditions are probably the best known; and the favourite medium, the choir, is often featured at musical f e s t i v a l s held at the m. e. i. the student body i t s e l f sponsors educational and entertaining programs c a l l e d " l i t e r a r i e s " . i t has become a tradition, too, that the graduating class of the school presents a major drama that runs for two or three nights. the auditorium serves a number of church young peoples' groups as a gymnasium for recreational events. the l o c a l junior s o f t b a l l league and the municipal league use the school's s o f t b a l l diamonds, and every summer evening there are a score or more of boys from the neighbourhood playing b a l l there. during every winter a considerable number of films, including f u l l - l e n g t h features, are shown in the auditorium under the auspices of the school i t s e l f or of some other organization. the use of the auditorium for this purpose seems somewhat anachronistic i n view of the o f f i c i a l positions of most churches regarding the attendance at "shows". a l l of these showings are well attended, however, and i t i s a familiar fact that the best way to raise money i n the com- munity i s to schedule a f i l m at the m. e. i. auditorium. when events of interest to mennonite brethren, general conference and other mennonite congregations are to be scheduled, such as meetings i n support of r e l i e f organizations l i k e the mennonite central committee and the mennonite disaster service, the place that i s usually chosen i s the m. e. i. a number of mass meetings of great interest to a l l mennonites were held there just after the war, when mennonites everywhere i n north america were r a l l y i n g to the r e l i e f of their "brethren" i n europe. this area represents, i t must be added, one of the few i n which the various mennonite groups w i l l a c t i v e l y co-operate. funeral services of prominent mennonite leaders, and weddings planned on an extraordinarily large scale usually take place i n the auditorium of the school. in the l a t t e r case, however, this expedient i s often regarded as being just a b i t ostentatious. up to the present time the administration of the school has resisted the use of the auditorium for s t r i c t l y p o l i t i c a l purposes. this would, no doubt, make a highly advantageous platform for p o l i t i c i a n s who wished to gain ground with the mennonites. several other interesting extra-curricular uses of the school may be mentioned i n conclusion here, and these have to-do with the promotion of the use of the german language amongst the mennonites. every saturday during the winter a number of mennonite children from the surrounding areas come to what i s known as "saturday school" or "german school". this i s an innovation that has served many mennonite com- munities throughout canada for a good number of years i n providing elementary instruction i n the german language for youngsters. educational methods here have often been inadequate and teaching staffs i n s u f f i c i e n t l y trained; a result, no doubt, of the half-hearted support that the community gives this a c t i v i t y . at the m. e. i,, too, a b r i t i s h columbia chapter of an association for the promotion of the use of the german language has had occasional meetings. these are usually gatherings of people who vociferously r e s i s t the introduction of english into church services and who vigorously support a l l things german. i t seems, however, that the use of the german language among mennonites continues to wane, regardless of the protests of individuals and organizations such as this one. what has been said here about the c e n t r a l i t y of the m. e. i. applies to the entire settlement of clearbrook and also to other lesser centers within the mennonite community, each one of which has i t s own area of dominance. this factor, as well as considerations of the structure and function of a wide range of t y p i c a l mennonite settlement forms are dealt with i n the following chapter. chapter vii settlement forms the holdings of the mennonites i n the fraser valley, whether r u r a l and dispersed, r u r a l and nucleated, "rurban" or urban i n character, are i n most cases not e a s i l y distinguished from those of their non-mennonite neighbors. this i s a r e f l e c t i o n of the r e l a t i v e l y l i b e r a l religious ideas of the mennonites represented here, which allow for modernization and the entry into whatever honourable economic opportunities present themselves. one may contrast this to more conservative mennonite groups, such as the extremely conservative "old colony" people of manitoba and saskatchewan, who u n t i l recently settled i n v i l l a g e s , restricted themselves to agriculture and endeavoured to keep out of their l i v e s anything that was i n their opinion "worldly". i t i s also, of course, an indication of the degree to which mennonite settlers have been caught up into universal trends such as those toward r a t i o n a l i z a t i o n i n agriculture and urbanization. farm types there are a number of different farm types i n the fraser valley, found in non-mennonite as well as mennonite settlements, which must be considered i n a discussion of mennonite r u r a l settlement i n this area. in those r e l a t i v e l y f l a t areas of the fraser valley covered by post-glacial alluvium (map ) and resultant s o i l s of the monroe and lynden series (map ) a farm type based on dairying dominates the landscape. fields are spacious there, as much as - acres each, and hay, pasture and sileage crops occupy the greatest acreage. cash crops such as beans or small f r u i t s may occupy several acres. barbed wires', having displaced the old stave fences, i s almost universal now. the farmyard on such a holding i s amply l a i d out, having a kitchen garden, some old f r u i t trees (newly planted orchards seem l i t t l e i n evidence) and, occasionally, some landscaping i n front. the buildings are, of course, dominated by the barn. older barns, b u i l t sometime before world war ii or even before the depression, usually have a straight peaked roof, a lean-to type of stable for cattle and a central storage area often reaching down to the ground (figure ). the newer barns that have largely replaced these old structures usually have a hip roof, two storeys and a substantial s i l o attached (figure )• low annexes may extend to one side or another to house c a t t l e . a track extending out to a sizeable manure p i l e i s usually there. near the barn one finds the other necessary outbuildings; the milkhouse, the machine shed, a garage for the family car and the truck, as well as swine and poultry shelters. the house on such a farm i s i n many cases now a new, modern bungalow which has replaced the old box-like two-storey farmhouse. in the more highly relieved abbotsford area, where figure . barn types i n the fraser valley a. an early dairy barn, of the type s t i l l to be seen i n the sumas, sardis, chilliwack areas and elsewhere. b. a modern, hip-roof barn of the type that i s generally replacing the above type. late g l a c i a l alluvium of a pitted and undulating configuration and resultant whatcom s o i l s mantle the surface (maps and ), farming "becomes more intensive and the average size of holdings decreases. agriculture of a mixed nature, depending mainly on dairying, poultry and small f r u i t s , i s carried on there. the dairy herds are usually smaller than those on lowland areas, and hence the dairy barns need not be as large. the chicken barns, however, are larger and more important i n the overall farm economy. strawberries and raspberries take up considerable acreage on every farm. in the period when new farm land was being won from the forest on a large scale i n this area, the numerous stumps and the undulating topography made every cleared acre a r e a l achievement. this land was then divided into r e l a t i v e l y small f i e l d s , some as small as one or two acres, and put to a variety of uses. the nature of cash crops and the modest feed requirements of small herds made these f i e l d s p r a c t i c a l . the fences of the early days were of cedar poles, assembled i n a variety of ways. now, of course, fences here are of wire as well. the farmyard i t s e l f , i n view of the high value of cleared land, was usually kept as small as possible. on many farms i n the abbotsford area these small farmyards, with their closely grouped buildings, are s t i l l i n evidence (figure ) . the barn i s most often of the hiproof type, but i t i s stubbier than those found on the flatlands of sumas and chilliwack because herds are usually smaller here. i t i s almost always figure . abbotsford farmland a view of farmland that was cleared from an area infested with numerous heavy stumps. the picture was taken on emerson road, near the international border (map ), looking eastward. two-storied over part or a l l of i t s floor plan and has the manure track, milking machine and other fixtures of the larger dairy barn. i t may face i n any direction, since there i s no prevailing wind strong enough to make any special alignment necessary. in close proximity to the barn i s the milkhouse, usually smaller than those on f l a t l a n d farms simply because there i s less milk to handle. the poultry barn may be a one- storied long, low structure or a two-storied a f f a i r . brooder houses and poultry ranges usually take up considerable space around i t , unless the newest methods of raising the birds on wire platforms have been adopted. in this area too, many of the o r i g i n a l houses have been replaced by modern structures. the range of styles, corresponding to some degree to the times when they were b u i l t , may be observed on the accompanying photographs (figure ). since the farmyard i s generally small i t i s possible to keep i t t i d i e r than a large farmyard i n sumas or chilliwack, to landscape i t and plant decorative plants. traditionally, the mennonite farmer has prided himself on a neat and tidy yard, and i t i s maintained by many of them that one may s t i l l differentiate their farms from those of their non-mennonite neighbors on this basis. i t i s doubtful whether this could actually be substantiated. a growing number of the smaller farms of the abbotsford area, as well as many other areas of the fraser valley, no longer f u l l y support the people l i v i n g on them. among farms of this type there are a number of long, narrow figure . mennonite houses i n the abbotsford area a. a pioneer home redecorated and kept i n good condition. b. more recently b u i l t homes along huntingdon road (map ) . the one i n the foreground i s a home b u i l t i n the late - 's or early ' 's. the one i n the background i s a modern home of the type seen throughout the area. holdings noticeable i n the s o l i d l y mennonite areas around clearbrook. these were the products of hasty subdivision i n a time of a g r i c u l t u r a l "boom", when i t was possible to make a l i v i n g on a small acreage. now they are undoubtedly a highly uneconomic arrangement of property, for f i e l d s and barns often remain unused and uncared-for while the owner works at a gob. the matsqui municipality passed a by-law i n that makes it compulsory to keep % of the periphery of a newly surveyed piece of a g r i c u l t u r a l property fronting on a road. this would tend to prevent the creation of further excessively narrow farm plots. undoubtedly similar l e g i s l a t i o n exists i n most other r u r a l municipalities by now. an interesting arrangement of buildings and f i e l d s may often be found on these small narrow farms. a house faces the road, behind i t i s the poultry barn which i s set p a r a l l e l to the long boundaries of the l o t , and back of this are, successively, berry patches, pasture and hay f i e l d s , and woodlots at the very back. many other forms of small a g r i c u l t u r a l holdings, occupied by mennonites as well as non-mennonites, may be found on the peripheries of expanding urban areas and elsewhere. their owners may be keeping poultry, several head of cattle or other animals. some part of the acreage i s usually devoted to vegetables and small f r u i t s . a l l these pursuits are usually sidelines to an outside job. it i s this type of a farm, l a i d out haphazardly in great numbers along many of the main roads of the fraser valley, that gives r i s e to extremely cluttered and unsightly settlement. when uncontrolled sub- d i v i s i o n and the erection of substandard r e s i d e n t i a l units follows, one has what might well be called "rurban" slums. small non-farm nucleations in a number of the larger mennonite settlement areas one may find an interesting non-farm nucleation, which provides such basic services as the general store, the automotive service station and possibly a lumber yard or r e a l estate o f f i c e . most nucleations of this type are closely related to a church s i t e , because people building non-farm residences i n an otherwise r u r a l area are often r e t i r i n g couples, and they prefer to l i v e near their place of worship. commercial establishments, owned or operated by mennonites, take advantage of this development and make of the l i t t l e center something approaching the "hamlet" i n size and function. in the stores of these nucleations one may e a s i l y detect an a i r of f a m i l i a r i t y and probably even hear the low german dialect being spoken. (fc^re.\y) flppe^;* e) wherever there i s a continued impetus for growth, as seems to be the case i n the new "south abbotsford" nucleation (map ), such a settlement may develop into something larger and more s i g n i f i c a n t . in general, however, these small centers seem to be very limited i n their potential for expansion. most of them were established prior to the post-war increase i n the mobility of the r u r a l shopper and have since been reduced to supplying incidentials. the fact l o £ / that very l i t t l e new commercial building or renovation of existing stores is going on seems to indicate that they have become commercially s t a t i c . prominent mennonite centers the two nucleations of yarrow (pop. approximately ) and clearbrook (pop. approximately ) deserve special analyses of their functions and structures. most of the people i n both centers, as was pointed out i n chapter v, are mennonites. within these two places one finds the clearest expression of current mennonite settlement trends, as well as the s o c i a l and religious trends, which can only be referred to b r i e f l y here. yarrow yarrow'd wedge-like s i t e i s very neatly bounded to the north by the vedder river, to the south by the mountains and to the east by the monroe clay loam s o i l boundary (map ). the promoter of the settlement, mr. eckert, happened to own the major part of this triangle of land. as soon as the mennonites had acquired i t from him the stage was set for the development of a thriving community. yarrow's f i r s t transportation links with other settlements were the b. c. e l e c t r i c railway, which maintained a small station at the head of wilson road, and the old mountain road, which skirted the f l a t s l e f t by drained sumas lake. in time the trans canada highway superseded both of these routes i n importance, which gave yarrow an "off-the- main-road" character and made i t for a l l p r a c t i c a l purposes a * mennonite reserve. in spite of the fact, however, that the greatest numerical concentration of mennonites i s s t i l l i n yarrow, the f o c a l point of mennonitism i n the fraser valley- has become clearbrook. a placard at the junction of the highway and' the road that leads to yarrow advertises the "scenic" route to cultus via yarrow, i l l u s t r a t i n g thereby this main dilemma of the town and efforts made to improve the situation. in i t s form, yarrow seems l i k e an antenuated, branching a g r i c u l t u r a l v i l l a g e . the properties along roads, or "streets", such as eckert, f i r s t , wilson or even yarrow central are i n many ways l i k e holdings on either side of the main street of a "strassendorf" (map ) . the old pattern of v i l l a g e settlement i n russia, besides being evident i n the arrangement of the streets and properties, i s also noticeable i n many of the individual farms. the orchard i s at the front, the house i s set back among the trees, the farm buildings are close behind the house and back of i t a l l stretch the garden plots and the f i e l d s . gradually, of course, this pattern i s bemg obscured as purely r e s i d e n t i a l housing i n modern styles i s being b u i l t . the yarrow farm, as the study of a map of property lines or of an a i r photo reveals, i s predominantly a small one — seldom reaching a size of ten acres. the land i s usually under intensive use. the raspberry, discovered more or the structural pattern of the yarrow settlement t y p e s o f b u i l d i n g s f o u n d in t h e s e t t l e m e n t commercial industrial feel a s i e m e n s less by t r i a l and error as the most advantageous crop for the area, dominates. this, as was already indicated, i s partly the result of s o i l conditions which provide adequate f e r t i l i t y and good sub-soil drainage and also the result of advantageous climatic conditions. the numerous f r u i t trees one sees i n the area are now proving somewhat of an embarrassment because of the lack of markets for the s l i g h t l y substandard f r u i t that i s produced. some farms s t i l l have their cows and flocks of poultry, but many dairy and poultry barns now stand unused. as might be expected on small acreages, the buildings on the average yarrow farm are closely grouped together around a rather small yard. the barns on many farms include a d i s t i n c t i v e , stubby dairy barn that i s just big enough for one or two cows, and a small, low poultry barn (figure ). where these have become v e s t i g i a l they are usually i n poor repair and unpainted. the houses show an interesting d i f f e r e n t i a t i o n according to styles and economic conditions prevailing at the time of their construction. on some farms the simplest of pioneer farmhouses i s s t i l l i n evidence, with i t s four straight walls and pitched roof. as prosperity came to the community new and more pretentious buildings were erected. these are the box-like, two-storey houses with porches and dormer windows. this form went through a number of variations and then was displaced by the low, modern bungalow that usually features gaudy coloring, stucco and wood exterior f i n i s h , asphalt shingles and false fronts of brick and stonework, a l l set near to the street and landscaped (figure ) . figure „ typical small yarrow farm the small barn for one or two cows and the chicken barn near i t , just big enough for a small flock, i l l u s t r a t e the scale of farming i n this area. the raspberry f i e l d s are the most important elements i n the economy of most yarrow farms l i k e this one. figure . mennonite houses in yarrow a. a substantial farm house of the type built throughout the area during the economic upsurge of the late 's. b. houses dating back to the 's, and even to the pioneer period, stand in sharp contrast to the modern bungalow. view is along yarrow's main street. c. crowded low value housing around the mennonite brethren church (map ) . yarrow bible school is in the foreground. the purely r e s i d e n t i a l property, as differentiated from the small farm, i s similar to modern r e s i d e n t i a l housing everywhere. as far as quality i s concerned, there i s a gradation from the very well b u i l t and spaciously landscaped houses of the community's leading citizens to the somewhat small and unsubstantial yet neat housing that may be found near the mennonite brethren church. as well as the dominance of mennonite businessmen, may be seen i n the following l i s t of businesses. where businesses were owned and operated by the same people the a f f i l i a t i o n of the owner i s given; and where the business i s a branch of a parent company the a f f i l i a t i o n of the manager i s given. the range of commercial services offered i n yarrow, table xii commercial services of yarrow - number type of business a f f i l i a t i o n of owner or manager mennonite non-mennonite general store grocery garage clothing hardware radio and e l e c t r i c cartage farm feeds and equipment lumber yard furniture and upholstery jewellery real estate and finance blacksmith barber shop cafe and pool h a l l b. c. telephone office bank of commerce post office i l l i t i s obvious that by far the majority of people serving the community commercially are mennonites. they provide the day-to-day essentials and some luxury goods as well. for major purchases people go to chilliwack or even to vancouver. it i s notable, too, that the community has only meager amusement f a c i l i t i e s — which does not mean, however, that i t i s entirely free of the rowdyism often associated with a small town theatre and licensed premises. in most of yarrow's shops, even more so than i n the shops of the smaller centers referred to e a r l i e r , one finds an a i r of f a m i l i a r i t y . one i s quite l i k e l y to hear a good deal of low german or high german spoken there at any given time. i t is interesting to note that the entire commercial section i s arranged i n a bi-nodal fashion along the yarrow central road. the reason for this separation l i e s largely i n the location of the two churches and i n the nature of the junctions of eckert road and dyke road with yarrow central. mennonite churches have often been located on land donated by one of the church members. in communities where both of the main sub-groups have congregations, moreover, these plots are not l i k e l y to be located too closely together, since to the mennonites the difference between general conference and mennonite brethren i s highly significant and these two groups are not comfortable i n too-close company. in yarrow each church has attracted residences and commerce around i t , with the result that a straggling line of businesses, having a concentration at either end, stretches i n an inconvenient life manner through the toym. (one sees a similar pattern of attraction on r e s i d e n t i a l building i n the greendale settlement (map ). the commerce i n this l i t t l e center, however, has gathered around a strategic intersection.) the rough coin- cidence of two t-form intersections with the location of the churches has also contributed very s i g n i f i c a n t l y to the bi-nodality of yarrow. one cross-form intersection, l i k e that of clearbrook road with the trans canada highway i n the town of clearbrook, would probably have made for a much more concentrated commercial zone. the industries of this community, as may be expected, consist of f r u i t processing and packing plants, as well as one box factory. the folloy/ing table l i s t s the concerns with the a f f i l i a t i o n of their owners and managers: table xiii industries of yarrov? - concern owner or owners manager hon- non- mennonite mennonite mennonite mennonite e a r l pearcy and son (packing plant) clearbrook frozen foods p a c i f i c coast canners ocean spray canners yarrow box factory two of these plants, that of the p a c i f i c coast canners and ocean spray canners, are located just south of the town proper on the b. c. e l e c t r i c railway. the box factory x x x x x x x x x x t h e s t r u c t u r a l p a t t e r n of t h e g r e e n d a l e s e t t l e m e n t i l e g e n d o n ' o n - f a r m r e s i d e n c e c o m m e r c e c h u r c h s c h o o l f a r m r e s i d e n c e / / m l map a. siemens i s located near the yarrow lumber yard on yarrow central road and clearbrook frozen foods have their plant just west of the town proper. i t may be noted from the table that most of the investment for these plants has come from non-mennonite sources. this was not the case before the collapse of the co-op, which was discussed i n an e a r l i e r chapter, and i s , no doubt, a further indication of the economic decline of the community. the i n s t i t u t i o n s of yarrow, of course, are dominated by the two churches. the mennonite brethren church is by far the larger and has served, as was already pointed out, as an important meeting place for mennonites from eastern lower fraser valley congregations as well as those of the entire valley. the general conference church i s s t i l l housed i n i t s unpretentious f i r s t structure on eckert road (figure ). the sharon mennonite collegiate institute, yarrow's private high school, operated for a period i n the building now occupied by the public yarrow elementary and junior high school. after a lapse of seven years the school was revived and i n s t a l l e d i n new premises on stewart road, where i t i s now serving a growing student body (figure ). a bible school, conducted i n a building on the mennonite brethren church grounds, ceased to operate i n * it may be said i n summary that yarrow remains b. c.'s most d i s t i n c t i v e l y mennonite settlement i n population as well as i n form and overall character. in it are preserved, even if they are economically "passe", numerous small farms l a i d out on old v i l l a g e patterns. i t i s to be regretted that there hangs over the whole community an atmosphere of decline, as many young people leave to find occupation elsewhere, as farms become p a r t i a l l y or completely unproductive and new construction lags. i t seems doubtful that any new impetus w i l l be found to r e v i t a l i z e i t and set i t on a path toward new growth. clearbrook the settlement of clearbrook, located on a g l a c i a l floodplain and on the gravelly s o i l of the lynden series (maps and ) , offered only a limited a g r i c u l t u r a l potential to i t s f i r s t mennonite s e t t l e r s . the land could sustain quickly maturing f i e l d crops such as strawberries and rasp- berries, but i t was best suited for the limited demands of poultry culture. i t could moreover, be e a s i l y cleared of the brush that had grown on i t after the forest f i r e of . the potential of the area lay not i n agriculture, but i n the r e l a t i v e l y f l a t topography that would allow easy r e s i d e n t i a l growth i n a l l directions, and i n the advantageous proximity to the fraser valley's main highway artery. as the mennonite settlements of the valley increased, the congregations forming at clearbrook came to be more and more at the geo- graphical center of a l l of them. once the m. e. i. had been moved to i t s present location on the northwest corner of clearbrook and old yale roads and business of various descriptions had begun to locate near the junction of clearbrook road and the trans canada highway, this centrality could be developed to advantage. in order to introduce clearbrook's functions as a center and i t s resulting form, two aspects of i t s development are discussed and i l l u s t r a t e d below. i t i s interesting to note, f i r s t of a l l , the retreat of brush vegetation as settlers entered the area and cleared plots for a g r i c u l t u r a l , r e s i d e n t i a l and other uses. the two attached maps, one showing the vegetation pattern i n and the other that of , indicate the extensive progress of clearing i n some twenty years (map ) . this cleared area provided the land for numerous small farms which are s t i l l i n evidence around the present town (figure ). the patches of trees interspersed among the houses give the settlement the "half-hidden" character i t has today when viewed from nearby h i l l s (figure ) . two land use maps of clearbrook, the one prepared i n and the other i n (map ) , i l l u s t r a t e the rapid expansion of clearbrook i n that period, p a r t i c u l a r l y the spread of r e s i d e n t i a l areas. the commercial sections have been extended and modernized too, but the rapid subdivision of land and the building of new homes remains the most remarkable development. to outline the present form of the clearbrook s e t t l e - ment we may begin with the farms that are s t i l l to be seen around the periphery of the nucleation and along the roads figure . clearbrook and surroundings a view of clearbrook and the surrounding farm land. the nucleation i t s e l f is hidden behind trees i n the middle and on the right of the photo, mt. baker can be seen i n the distance. figure . views of clearbrook a. clearbrook as seen from the northwest. b. clearbrook as seen from the southwest. c h a n g e s in t h e s t r u c t u r a l p a t t e r n o f c l e a r b r o o k commerce industry non-farm residence light-farm residence l e g e n d ffffph institut ions u parkland - - boundaries of the clearbrook water district — • abandoned railway note'- non-farm residence and l i g h t - f a r m r e s i d e n c e were not d i f f e r e n t i a t e d for since the rapid subdivision of small farms was making this less and less meaningful. most new residential building since was n o n - f a r m in c h a r a c t e r . / i / =fc= i m i . m a p a . s i e m e n s branching out from i t . farmland i n this area i s held by many persons on a speculative basis, i n anticipation of a time when advantageous subdivision w i l l be possible. livestock are s t i l l being kept and f i e l d crops grown, but many of the barns are becoming v e s t i g i a l and a good number of f i e l d s l i e unused. yftien one compares these farms and ones that existed i n the area before the onset of urbanization with the farms of mennonite settlers i n chilliwack and greendale, or even with the farms of the surrounding abbotsford countryside one notices that the average clearbrook farm i s poorer i n appearance. this was attributable i n the early years of the settlement largely to the very limited a g r i c u l t u r a l potential of the s o i l . now the p o s s i b i l i t y of further urbanization contributes to the run-down appearance of many of the farm buildings, because the owners see no reason to keep up buildings that w i l l probably soon be removed. i t must be pointed out, however, that several model poultry farms do exist just north of clearbrook on clearbrook road. the owners developed hatcheries i n connection with their poultry barns, and with careful management have prospered. many farms engulfed i n clearbrook's advancing periphery have experienced the familiar process of succession i n their land use. fields are cleared of fences and barns, streets and lots are l a i d out and the building of modern bungalows begins — leaving the old farmhouse as an oddity among them. in the meantime the farmer has realized a tidy p r o f i t , and possibly has had the new street named after him. the residences of clearbrook may be differentiated somewhat s i m i l a r l y as those of yarrow. one finds remodelled and painted homes of pioneer days. there are the box-like, two-storied homes of the immediate post-war period too. in clearbrook, even more than in yarrow, one finds groups of small, unsubstantial but neat houses crowded together. the type of house that i s most prevalent, of course, i s the modern bungalow, erected during the r e l a t i v e l y recent period of clearbrook's rapid expansion (figure ) . the changes i n r e s i d e n t i a l areas between - and have involved this type of a home almost exclusively. 'behind some of these differences i n the nature of clearbrook r e s i d e n t i a l areas l i e developments i n the building regulations ot matsqui municipality. in the period up to the early 's, subdivision and building of residences proceeded i n an unplanned manner. haphazard housing developments "were the result. any orderliness that was brought into subdivisions during this time resulted simply from agreements between developers and the municipality. effective control by the municipality began i n , when a building by-law was passed, requiring the i n s t a l l a t i o n of certain sanitation f a c i l i t i e s to the satisfaction of inspectors and regulating the size of lots somewhat. more specific by-laws were passed i n and , stipulating certain dimensions for l o t s , careful location of houses on lots and so on. the values that houses should have i n particular areas have not yet been expressly put into law, but the existing and contemplated restrictions figure . mennonite buildings in clearbrook a. a farm of the type seen on the peripheries of clearbrook. b. modern bungalows along clearbrook road (map or ), c. more expensive houses on the heights overlooking the town on the northwest. w i l l automatically bring about the construction of reasonably attractive and functional homes. i t may be noted here, i n passing, that clearbrook too i s developing i t s own higher class r e s i d e n t i a l d i s t r i c t . a number of good quality houses are located on the r i s e of land northwest of the town, where lots with excellent views may be obtained. cf"\«"« >a) establishment of a store on the southeast corner of clearbrook and the highway by a certain mr. harter. this store, even though i t changed ownership, remained the only commercial establishment i n the area u n t i l the early 's. at this time mennonite businesses began to move i n , f i r s t a garage, then a jewellery shop and soon numerous others. the dominance of the mennonite businessman has been maintained, and today one may quite easily shop for most of one's needs here without having to speak english. commercial establishments of the nucleation and shows the a f f i l i a t i o n of the owners or branch managers. the commerce of clearbrook began i n & with the the following table c l a s s i f i e s the present table xiv commercial services of clearbrook - number type of business owners managers hon- non- mennonite mennonite mennonite mennonite grocery automotive service table xiv (continued) number type of business owners managers non- non- mennonite mennonite mennonite mennonite hardware building supply farm equipment farm feed clothing furniture and appliances jewellery book and music photo pharmacy auto metal plumbing and heating e l e c t r i c and radio auto courts l beauty shop l barber shop cafe variety l general repair real estate bank post office here again i t i s clear that, except for the obvious lack of businesses providing entertainment, there i s a f u l l range of goods and services available to the people of the community. i t i s notable that the general store no longer r e a l l y exists there, i t s place having been taken by the super- market and s p e c i a l i t y shops. a number of businesses are i n keen competition. these include firms providing for food, clothing, automotive and farm needs. a good number of others, however, s t i l l enjoy the advantages of being the only shops of their kind i n the community. notable i n this respect i s the community's largest single firm, dueck building supplies, whose competition no one, u n t i l recently, has been w i l l i n g to face. that a community of this type has special needs may be seen i n some of the grocery stores that s e l l foods favoured by mennonites and also i n the two book and music stores that provide certain texts for m. e. i. students, music and instruments for a generally music-loving group of people and religious a r t i c l e s suited to the mennonite f a i t h . i t must be added that, since the summer of when this survey was begun, several changes have taken place i n the pattern of clearbrook commerce. a shopping center has been b u i l t on the northwest corner of clearbrook road and the highway, and new businesses, such as a used car l o t , have been added. a new commercial and i n d u s t r i a l area has been opened up on the highway just east of the community through the location there of a trucking firm and the new receiving plant of the abbotsford growers co-op union. no doubt this w i l l become i n time a part of the expanding town i t s e l f . some of the characteristics of clearbrook*s commercial area may be seen i n the accompanying photographs (figure ) . the industry of clearbrook i s limited to the f r u i t packing plant of sunripe f r u i t packers and the new co-op plant just going into operation. these supply work for only a small number of the settlement s breadwinners. others work to provide goods and services for the population, commute to places of work outside of the community or depend on private incomes and pensions. the institutions of the settlement have already been •f i figure . clearbrook's commercial core a. the commercial section as seen in . the corner store is the oldest business establishment in the nucleation. b. the same corner location in . supermarkets of this type were built in a number of places in the area and represent the most radical change in the structure of clearbrook s commercial core. dealt with i n part and need only be mentioned here. they include the large buildings of the junior and senior divisions of the m. e. i., the bible school b u i l t recently just north of the m. e. i. on clearbrook road (figure ), and the two churches (figure ). a photographic comparison of a number of points i n the town, as they looked i n and as they are now, are included i n this study as a further evidence of the dynamics of growth within this settlement (figure ). this growth may very well continue for some time. physically, the only barrier that presents i t s e l f to the spread of the town i s the upland to the northwest. this may be turned to advantage, however, by the lay-out of preferred view l o t s . economic barriers, i f they do present themselves, w i l l probably come i n the form of a scarcity of employment i n surrounding areas. increased commuting may preclude this and allow clearbrook to exist as a predominantly r e s i d e n t i a l town. it i s d i f f i c u l t to foresee what other barriers may present themselves to the growth of this settlement, but developments i n former s e t t l e - ments i n prussia and russia seem to point to the fact that i t i s not i n the group's best s o c i a l and religious interests to settle too compactly. the undesirable s o c i a l attitudes and religious stagnation that often result from such settlement may make residence i n clearbrook less attractive i n the future. some further mention must be made, i n conclusion, of the important characteristics of clearbrook s population) since the people are most responsible for the form and character, f i g u r e a . m e n n o n i t e c h u r c h e s a . e a s t a l d e r g r o v e m e n n o n i t e b r e t h r e n , b . s t r a w b e r r y h i l l m e n n o n i t e b r e t h r e n , c . y a r r o w m e n n o n i t e b r e t h r e n , d . m i s s i o n g e n e r a l c o n f e r e n c e , e . g r e e n d a l e g e n e r a l c o n f e r e n c e f . c h i l l i w a c k m e n n o n i t e b r e t h r e n , g . c l e a r b r o o k m e n n o n i t e b r e t h r e n , h . c l e a r b r o o k g e n e r a l c o n f e r e n c e , . m a t s q u i m e n n o n i t e b r e t h r e n , n o t e : t h e t e r m s " m e n n o n i t e " , " f i r s t m e n n o n i t e " o r " u n i t e d m e n n o n i t e " a r e u s e d i n some c a s e s t o d e s i g n a t e c h u r c h e s t h a t a r e h e r e t e r m e d " g e n e r a l c o n f e r e n c e " . t h i s s i m p l i f i c a t i o n f a c i l i t a t e s t h e d i v i s i o n i n t o t h e t w o m a i n s u b - g r o u p s . figure b. mennonite churches a. old south abbotsford mennonite brethren (now a wood- working shop), b. bradner church of christ (mennonite), c. west abbotsford general conference, d. east chilliwack general conference, e. arnold mennonite brethren, f. yarrow general conference, g. east chilliwack mennonite brethren (including the old church building and the newer one beside i t ) , h. fraserview mennonite brethren (vancouver), i . vancouver general conference. of any settlement. unfortunately l i t t l e exact information beyond that already quoted i n the s t a t i s t i c a l chapter i s available. church records generally proved of l i t t l e overall value for this study, because they were either i n process of revision or did not include the information necessary. i t may be safely said, however, that a good number of the community's citizens, probably more than i s usual for a settlement of this size, are retired folk who find a location near the churches, shops, their friends and the m. e. i. auditorium very amenable. this higher than average proportion of older people has tended to produce an excessively conser- vative church policy, much to the d i s l i k e of the younger generation. the proportion of younger families i s increasing, however, and this i s raising the problem of providing recreational f a c i l i t i e s for the youngsters. loitering, vandalism and petty crime are already well known i n the community. the development and structure of the settlement of clearbrook, therefore, i s interesting because here i s an example of ethnic homogeneity paralleled i n very few other places i n our province. here i s also an expression of changing cultural patterns i n terms of settlement forms. within this community we have i l l u s t r a t e d trends that are taking place among other ethnic groups i n our province and other parts of canada. urban settlement i n vancouver the last major area of mennonite settlement remaining f c for discussion i s that within the completely urban environment of southeast vancouver. there are other places, such as abbotsford, chilliwack and for that matter clearbrook, where mennonites have settled under essentially urban conditions, but these w i l l be omitted here. the trend toward urbanization as well as the effects of i t , are best i l l u s t r a t e d i n vancouver. in both the chapter dealing with sequent occupance (chapter iv) and that on s t a t i s t i c s (chapter v) references were made to urbanization trends and resulting conditions. these w i l l be reviewed here and supplemented. the plotting of mennonite families, as located with the help of church directories, provides a f a i r l y accurate picture of the degree of concentration found among them, and this i s one of the f i r s t aspects of the form of urban mennonite settlement in which we are interested. there i s a definite concentration i n the area bounded on the north by king edward avenue, on the east by victoria drive, on the south by the north arm of the fraser and on the west by gamble street. an isopleth map (map ) reduces the vague v i s u a l pattern to a numerical basis and shows an interesting d i f f e r e n t i a t i o n . the number of mennonite families per unit area increases as one moves from the peripheries of the concentration into a well defined core. this core coincides roughly with the location of the two oldest mennonite churches in the area. a secondary concentration is clearly evident around the recently established fraserview mennonite brethren church. a third concentration shows up near the united mennonite mission church, concentration of mennonite families in s o u t h e a s t e r n vancouver c l/fe / / mi. i i ' a . s i e m e n s but i n view of the dispersed locations of the members of this congregation a correlation i s not warranted. after separating the patterns of concentration around each individual church from the whole complex one may observe a number of differences betv/een these patterns (map ). the churches with the densest concentrations immediately around the church building are the f i r s t united mennonite church on nd avenue and especially the vancouver mennonite brethren church on rd avenue and prince edward street. transportation was s t i l l an important problem during the early 's when many mennonites were coming into the c i t y and so they grouped as closely as possible around their most important i n s t i t u t i o n . there was no p o s s i b i l i t y for contiguous settlement, of course, since the area into which they came was already largely occupied by residences. any concentration that was achieved resulted from the efforts of the individual buyer to find property close to that of the others of his group. the churches organized at later dates p a r t i c u l a r l y the fraserview mennonite brethren church, show a more evenly dispersed d i s t r i b u t i o n of families. this i s a r e f l e c t i o n of the fact that these new churches were established to serve families already scattered far from the o r i g i n a l core area and families coming into the c i t y and settling i n an extensive area, a l l of whom f e l t no great need or desire for close settlement. the houses of mennonites i n vancouver do not d i f f e r households a s s o c i a t e d with v a n c o u v e r ' s four m e n n o n i t e c h u r c h e s king,, ' edward avt; s.east marine unve fraserview mennonite brethren vancouver mennonite brethren first mennonite one dot represents the household of one of the following: a family; a widow or widower with or utthi.ul c h i l d r e n , r e s i d i n g m tlii; family home", seveicil r^iblitigs living together at one a d d r e s s . churches are r e p r e s e n t e d by c r o s s e s . for l o c a t i o n within vancouver refer to map , vancouver mennonite mission s c a l e / / . i ' ^ ^ , _ „ map a siemens perceptively i n quality and style from the houses of people around them. they are a part of the settlement of people i n lower and middle income brackets that one finds generally around main, fraser and v i c t o r i a streets. only a few mennonite households have entered f i r s t class r e s i d e n t i a l d i s t r i c t s such as those on southwest marine drive and granville street. even where some of the more well-to-do among them have b u i l t quite costly homes these are not usually architecturally sophisticated. the commerce carried on by an increasing number of mennonite businessmen i s not localized i n any one area. it i s d i f f i c u l t to differentiate their establishments from those around them, except perhaps i n one respect, and that is their usual aversion to dealing i n entertainment or any a r t i c l e s that their religious position might lead them to consider as "questionable". the large number of mennonites working i n industries, moreover, are not usually employed i n mennonite concerns, nor do the products and services they provide go mainly to their own people. it becomes clear, then, that i n the urban environment the commercial and i n d u s t r i a l a c t i v i t i e s of people l i k e the mennonites, as well as their residential patterns, are submerged i n the bustle of the city's l i f e . of key importance i n maintaining any sort of peculiarity, and giving outward v i s i b l e expression to i t , are the churches. located as centrally as possible among the households that are tributary to them, they provide the only r e a l focus and central attraction for them. they are not of the same stereotyped style as most of those i n the valley, but they are not advanced i n their design either. a photo- graphic comparison brings out their characteristics quite c l e a r l y (figure ). the only mennonite schools i n the vancouver are a "saturday school" of the kind already described (chapter vi), which i s held i n the vancouver mennonite brethren church, and a bible school conducted i n the evenings i n the fraserview mennonite brethren church. there have been discussions about the building of a high school and possibly a bible college, but these are s t i l l very inconclusive. it may be, however, that i f and when these are undertaken a new and stronger centralizing influence w i l l be f e l t i n the vancouver mennonite community. footnotes and references the terra "hamlet" i s defined variously i n different countrie for our purposes we may think of i t as a small agglomeration of residences and a few service buildings such as a general store and possibly a garage. this l i t t l e center may or may not have a well established name. i t i s usually not incorporated. compiled by f i e l d survey. compiled by f i e l d survey. compiled from f i e l d survey and information given by o f f i c i a l s of the matsqui municipal o f f i c e . reference i s made here to the ukrainians, the doukhobors and the finns; but other groups might well be mentioned too. sources of information on the above three are entered i n the bibliography at the end of this study. chapter v i i i conclusions although the significance of most facts that emerged from description and analysis in this study was pointed out immediately, it is useful to make several summarizing con- clusions, particularly regarding the marks of peculiarity s t i l l discernable within mennonite settlements, the disap- pearance of distinctions on the other hand, as well as the social and cultural significance of data treated here pri- marily from a geographic point of view. the large scale movements of mennonites into the city, the conversion of many of their farms into housing subdivisions and the rationalization of procedures on the remaining farms are a l l evidence of a state of flux within the mennonite home, congregation and community at large. similar things are taking place, of course, in the settlements of other ethnic groups within british columbia and elsewhere in canada. one might cite as examples the doukhobors, the finns, the ukrainians and others. for all of these people the processes that are changing their settlement patterns help to bring about an eventual breakdown of traditionally well defined social and cultural patterns. efficient means of communication create new needs and desires; and increased prosperity make their fulfillment possible. the characteristic foods, clothes, household appointments, building styles, farm groupings and often religious practices as well, give way to the modern innovation. the old things are preserved with considerable nostalgia by the older folks, but considered by younger people as belonging to the closet, the museum or l i t e r a t u r e . outward p e c u l i a r i t y has dwindled; much assimilation, merging and melting into the "canadian whole" has taken place — leaving the unanswerable question of whether i t was a gain or a loss. evidence has been given i n this study for the existence of certain settlement features that make i t possible to designate parts of the fraser valley as c h a r a c t e r i s t i c a l l y mennonite. in yarroy/, the e a r l i e s t sizeable settlement i n the valley, there i s the old a g r i c u l t u r a l "strassendorf" v i l l a g e form. the individual farms with their orchards and flower gardens i n front of the house, mirror elements of the russian mennonite v i l l a g e farmyard. in other r u r a l areas, where compact mennonite settlement was not possible to the same extent, i t i s more d i f f i c u l t to recognize p e c u l i a r i t i e s . a general tidiness and orderliness often sets the mennonite farm apart from neighbouring farms, as do some minor features such as whitewash on f r u i t tree trunks and the l i k e . james gibson, i n his comparison of mennonite and anglo-saxon farms i n the fraser valley, makes the point that the mennonites on monroe s o i l s are preoccupied with'raspberries, whereas the anglo-saxon farmers are more concerned with dairying. it i s certainly true that this crop has been developed very extensively by mennonites i n chilliwack and yarrow, as their co-operative f a c i l i t i e s for small-fruit processing clearly indicate. wherever the mennonites are found, i n our area as elsewhere, the church i s always a central, conspicuous and d i s t i n c t i v e settlement feature. it draws mennonite settlement closely around i t s e l f ; i n yarrow, and to a lesser extent i n greendale, churches of the two subgroups have exerted a p u l l strong enough to bring about a binodality i n the structure of these centers (maps and ), a rare feature anywhere. architecturally, these churches have, up to recent times, been constructed on a stereotyped plan. the rather low-pitched roof, the wide auditorium, the twin towers and the white stucco are features that one sees again and again. the interiors follow a common basic form as well, being closely related to the nature of the mennonite church service. only i n the c i t y are exterior form and i n t e r i o r appointment changing somewhat i n basic design (figure ). in the country, where r u r a l mail delivery i s widespread, there i s another indication of mennonite distinctiveness. the t y p i c a l l y mennonite names on mail boxes i n r u r a l chilliwack, sumas, abbotsford or aldergrove leave no doubt as to the ethnic background of their proprietors (table xvi, appendix b). the mennonite centers such as clearbrook, yarrow and greendale seem very similar to most other small nucleations i n the province as far as the appearance of their commercial cores i s concerned. one characteristic sets them off, however, and this i s the absence of theatres and licensed premises — an obvious r e s u l t of certain religious principles held i n the community. on the streets and i n the stores of these centers one may s t i l l hear the old west prussian low german dialect and possibly even some high german being spoken. usually i t w i l l be the older folks, many of whom know l i t t l e or no english, who use the low german, and recently arrived immigrants from europe who use the high german. among the garish placards and refrigerated display cabinets of an ultra-modern supermarket i n canada this sounds rather incongruous. in spite of a l l the p e c u l i a r i t i e s that persist, however, more evidence may be found for the obliteration of old forms and practices by new innovations than for their preservation. modern housing, i n styles seen along the length of north america's west coast may be found now even i n the most r u r a l of mennonite settlements in the fraser valley. municipal building by-laws have brought about an even, e f f i c i e n t use of l o t space that gives streets of new- houses a similar appearance, whether they be on b r i t i s h columbia's lower mainland, i n western washington or elsewhere. and the relentless process of farm subdivision has made of many mennonite and non-mennonite farms alike, housing developments that are essentially urban i n form, and function. strong documentary, p i c t o r i a l and s t a t i s t i c a l evidence i s given i n this study for this rapid change of the use of a good deal of land from the r u r a l to the non-farm or urban. i t is common knowledge, moreover, that more and more people are moving into the c i t y to l i v e or commuting into i t to work. this whole process has had serious social consequences for t r a d i t i o n a l l y agrarian people such as the mennonites. it has tended to disturb close family ties i n that it has drawn many young people away from the farm and home into non-farm occupations, often at considerable distance from the family residence. the return of these people has often introduced new ideas and practices into the home, the church and c i r c l e s of relatives and friends. i l l of this could not but generate a considerable amount of tension and estrangement. when these contacts with the "outside" have become frequent enough i t has happened that whole families or congregations have changed their attitudes and behaviour from broadly accepted norms. they have then often regarded as excessively sophisticated or even "worldly" and they i n turn have looked upon others as backward. thus, the whole complex of economic and cultural influences exerted upon the mennonites i n connection with changes i n settlement as outlined i n this study, together with numerous social and personal consider- ations have gradually brought about a reorientation of the value and behaviour patterns of a large segment of this ethnic group. this situation must be recognized as the background to s t a t i s t i c a l trends and regional description. geographic evidence for reorientation i s also persuasive evidence for advanced assimilation into canadian culture and nationality. the term "assimilation" may be defined as at .... process or processes by which people of diverse r a c i a l origins and different cultural heritages, occupying a common t e r r i t o r y , achieve a c u l t u r a l s o l i d a r i t y s u f f i c i e n t at least to sustain a national existence. this process must not be considered as simply an adoption of some c u l t u r a l t r a i t s by the immigrant from the people of his new homeland. this would be simply acculturation or accommodation. i t i s , rather, a two-way exchange, involving contributions by both new immigrants and those that have been i n the country for a longer period of time, toward a common culture. naturally, this i s seldom, i f ever, completely achieved. for the f i r s t generation immigrant, i f he considers i t at a l l desirable, assimilation involves intense personal c o n f l i c t , as well as the expense of great efforts i n the learning of a new language and new modes of l i f e . the elderly people i n every mennonite congregation would readily attest to the d i f f i c u l t i e s of assimilation, p a r t i c u l a r l y since most of them had to begin the process during the d i f f i c u l t depression years when i t was hard to make a bare l i v i n g , to say nothing of becoming proficient in english or any of the other refinements of the 'culture into which they had come. i t must be said too, that many consciously resisted assimilation on religious or other personal grounds. people who are second generation immigrants, as are most of the mennonites coming to maturity now i n the fraser valley, find the c o n f l i c t between themselves and "outsiders" lessened. many elements of their background are reduced to sentimental attachments only. they have, on the other hand, to contend with a c o n f l i c t between themselves and their eld e r s« i or whom i t was almost impossible to advance as far i n their adjustment to the new way of l i f e . the second generation, i f i t i s at a l l a l e r t , begins to question, to re-examine and to modify t r a d i t i o n a l stands on cultural and certainly also on religious matters. this questioning i s more l i k e l y to happen i n an urban or semi-urban environment than i n the t r a d i t i o n a l a g r i c u l t u r a l environment. the third generation, of which the children of many young mennonite couples are now members, probably w i l l not ever have any great interest i n the homeland and culture of their grandparents. the appeal of a v i t a l r e l i g i o n that takes into account the changing s p i r i t u a l needs of modern young people w i l l be necessary to keep these growing youngsters consciously and creatively associated with their group. an appeal based on the d e s i r a b i l i t y to preserve the use of the german language and other cultural elements w i l l probably not be s u f f i c i e n t . i t is interesting to project some of the trends that are evident i n the settlement patterns as well as i n the changing s o c i a l , c u l t u r a l and religious orientation of the mennonites, and to speculate on the future of this hitherto well-defined ethnic group. one may foresee an increase i n the urbanization of residence, occupations and mentality. these people and a l l of their neighbours are involved i n a seemingly inexorable economic process that has i t s repercussions i n almost every other aspect of l i f e . e f f i c i e n t media of communication and pressure toward conformity and acquisition of status symbols within an urban society serve to obscure and even to eliminate ethnic p e c u l i a r i t i e s . the influence of the ideas and practices of other religious denominations, moreover, makes the maintenance of a t r a d i t i o n a l religious position d i f f i c u l t as well. further conformity, therefore, seems inevitable i n s o c i a l and cultural matters and i n outward religious practices, i f not basic ideals and principles, as well. a repetition of unified group action, such as the mass movements from country to country that took place only some - decades ago, i s d i f f i c u l t to imagine. mennonitism, as have many other movements, has run into the sands of a modern, m a t e r i a l i s t i c and urbanized environment, from which an extrication would seem almost impossible. footnotes and references sources dealing with each one of these peoples are entered i n the bibliography. j. r. gibson, a comparison of anglo-saxon, mennonite and dutch farms i n the lower fraser valley: a methodological study i n areal d i f f e r e n t i a t i o n and the relative influences of the physical and cultural environments, unpublished thesis (m. a.), university of oregon, corvallis, . r. e. parks, "social assimilation," encyclopedia of s o c i a l sciences, vol. ii, p. . bibliography . reference works b. c. natural resources conference. b. c. atlas of resources. vancouver, b. c., smith's lithography, . f a i r c h i l d , h. p. dictionary of sociology. new york, philosophical library, - . klassen, c. f. b r i t i s h columbia mennonite encyclopedia, v o l . l , , p. . oxford regional economic atlas, the u.s.s.r. and eastern europe. "oxfordt oxford untv^rstty~ptess, [o ~. suckan, g. h. "b. c. provincial mennonite brethren conference," mennonite encyclopedia, vol. , , p» . . books dawson, c. a. group settlement, ethnic communities i n western canada, vol. v i i . macmillan, . dawson, c. a. and gettys, w. e. an introduction to sociology. new york, ronald press, . ehrt, a. das mennoni tent urn i n r.ussland. berlin and leipzig, julius beltz, . francis, e. k. in search of utopia. altona, manitoba, d. w. friesen, . friesen, p. m. die alt-evangejische mennonitische briiderschaft , i n russland" t i b - ) t l l a l l ^ " v e r l a g "raduga", ' . gibbon, j. m. canadian mosaic: the making of a northern nation. toronto, mcclelland, • hawthorn, harry b. the doukhobors of b r i t i s h columbia. vancouver, university of b r i t i s h columbia and dent, * hubbard, george d. the geography of europe. new york, appleton-century-crofts, . kelley, c. c. and spilsbury, r. h. s o i l survey of the lower fraser valley, dominion department of agriculture, publication no. , technical b u l l e t i n , , lohrenz, j. h. the mennonite brethren church. hilsboro, kansas, mennonite brethren publishing house, . lysenko, vera. men i n sheepskin coats: a study i n assimilation. toronto, ryerson, . putnam, d. f. et a l . canadian regions. toronto, j. m. dent and sons, . shoemaker, j. s. small-fruit culture. , pp. - . smith, c. henry. the story of the mennonites. berne, indiana, mennonite book concern, . unruh, a. h. die geschichte der mennoniten brudergemeinde. winnipeg, canada, christian press, . unruh, b. h. die niederlandisch-niederdeutschen hintergrunde der mennonitischen osterwanderungen im l t , ten~ * jahrhundert. karlsruhe, germany, h. schneider, . wiebe, h. "das siedlungswerk niederlandischer mennoniten im welchseltal zwischen forden und weisenberg bis anfang des l t e n jahrhunderts." wissenschaftliche beitrage zur geschichte und landeskunde ost-mitteleuropas, v o l . (manuscript), marburg-lahn, germany, johann gottfried herder institut, . wiens, h. j. the mennonite brethren churches of north america. killsboro, kansas, mennonite brethren publishing house, . . periodicals "a guide to maps in mennonite books and periodicals," mennonite quarterly review, vol. , no. (october ) • bender, h. s. "mennonite colleges and mennonite research." mennonite quarterly review, vol. (january ), pp. - . * "doukhobors: canada's untractable minority." world today, vol. (december ), pp. - . driedger, j. "farming among the mennonites i n west and east prussia, - ." mennonite quarterly review, vol. ? no. (january ), pp. - . duncan, h. c. "a study i n the process of assimilation." american sociological society papers, vol. , , pp. - . francis, e. k. "mennonite institutions i n early manitoba - a study on their origins," agricultural history, x x i i , . pp. - . ~ ' ' francis, e. k. "the russian mennonites: from religious to ethnic group." the american journal of sociology, vol. , no. (september ), pp. - . horsbrugh. patrick. "barns i n central i l l i n o i s . " landscape, v o l . , no. (spring ), p. . — humphrey, n. d. "on assimilation and acculturation." psychiatry, vol. , , pp. - . krahn, c. "agriculture among the mennonites of russia." mennonite l i f e , vol. x, no. (january ), pp. - . krahn, c. "mennonite community l i f e i n russia." mennonite quarterly review, vol. , no. (july ). krahn, c. "mennonite industry i n russia," mennonite l i f e , vol. x, no. (january ) , pp. - . krahn, c. "the ethnic origin of the mennonites from russia." mennonite l i f e , v o l . , no. (july ), pp. - . fretz, w. "recent mennonite community building i n canada." mennonite quarterly review, vol. , no. (january ), p~p t- ." ~™~~ parks, r. e. "social assimilation," encyclopedia of the social sciences, vol. ii, pp. - . penner, h. "west prussian mennonites through four centuries." mennonite quarterly review, vol. , no. (october ), pp. - . ~~ ryder, n. b. "the interpretation of origin s t a t i s t i c s . " canadian journal of economics and p o l i t i c a l science, vol. , no. (november ) , pp. - . simons, s. e. "social assimilation." american journal of sociology, vol. , , pp. - . unruh, b. h. "dutch backgrounds of mennonite migration of the t h century to prussia." mennonite quarterly review, vol. , no. (july ) , pp. - . van cleef, eugene. "finnish settlement in canada." geographical review, v o l . ( a p r i l ) , pp. - . wiens, b. b. "pioneering i n b. c." mennonite l i f e , vol. , no. (july ), pp. - . woolston, h. "the process of assimilation." social forces (may ), pp. - . . government publications b r i t i s h columbia. department of agriculture. climate of b r i t i s h columbia, report for . v i c t o r i a , queen's printer, . b r i t i s h columbia. department of agriculture. raspberry culture, horticultural circular no. . victoria, king's printer, . chapman, j. d. the climate of b. c. reprint, f i f t h b, c. natural resources conference, . dominion bureau of s t a t i s t i c s . eighth census of canada, . v o l . ii (population by s o i l subdivisions). ottawa, king's printer, . dominion bureau of s t a t i s t i c s . ninth census of canada, , v o l . i (population). ottawa, king's printer, . dominion department of transport. meteorological division, and national research council. division of building research. climatological atlas of canada. ottawa, king's printer, . drummond, w. m. and mackenzie, w. program and prospects of canadian agriculture (royal commission on canada's economic prospects). hull, quebec, queen's printer and controller of stationery, . smith, j. m. canada's economic growth and development from to (royal commission on canada's economic prospects). hull, quebec, queen's printer and controller of stationery, . united states. department of agriculture. s o i l : the yearbook of agriculture, . washington, government printing office, . . unpublished research papers gibson, james r. a comparison of anglo-saxon, mennonite. and dutch farms i n the lower fraser valley: a methodological study i n areal differentiation and the relative influences of the physical and cultural environment.unpublished thesis (m. a.). university of oregon, . krahn, john j. a history of the mennonites i n b r i t i s h columbia. unpublished thesis, university of b r i t i s h columbia, faculty of medicine, . mathews, w. h. preliminary report on the superficial deposits of the lower fraser valley. unpublished report. b. c. department of mines, . reimer, d. p. the mennonites i n b. c. unpublished thesis (m. a.) university of b r i t i s h columbia, department of history, . rempel, dick. united mennonite church, mission city, b. c. ' unpublished research paper. winnipeg, . siemens, a. an h i s t o r i c a l geographical survey of the development of the community of clearbrook. unpublished research paper. university of b r i t i s h columbia, . siemens, a. the fraser valley lowlands. unpublished research paper. university of b r i t i s h columbia, . . pamphlets die vereinigten mennoniten gemeinden i n b r i t i s h columbia. yarrow, b. c., columbia press, . glesbrecht, j. history of the mennonite church at rd and prince edward. address to the congregation on the occasion of i t s th anniversary. december , . kettle, l. j. where t r a i l s meet. abbotsford, a. m. s. news, . " krause, j. c. kurzgefasster bericht ueber einige siedlungs- moeglichkeiten i n b r i t i s h columbia. yarrow, b. c., columbia press. willms, h. j. die sued-abbotsford ansiedlung. yarrow, b. c., columbia press, . conferenz der mennoniten i n canada, jahrbuch . rosthern, sask., der bate, . conferenz der mennoniten i n canada, jahrbuch - jubilhums ausgabe, - . rosthern, sask., der bate, . notes; church directories, which .were often only mimeo- graphed sheets, and conference yearbooks too numerous to iention here, were used frequently throughout the study. m . newspapers the chilliwack progress (may , ), pp. - . series of a r t i c l e s commemorating the community's t h anniversary. krause, j. c. "mennoniten - jahre in b r i t i s h columbien." mennonitische rundschau, p. . toews, j. j. "warum verlhsst der ackermann seinen acker?". mennonitische rundschau (january ) , pp. - . "yarrow's.pioneer recalls community beginning years ago." the chilliwack progress (may , ) , p. . appendix a table xv dates of establishment of mennonite churches i n the fraser valley (excluding the mission stations) greendale mennonite (conference) south abbotsford mennonite brethren, aggasiz mennonite brethren, yarrow mennonite brethren, greendale mennonite brethren north abbotsford (clearbrook) mennonite brethren yarrow mennonite (conference), west abbotsford mennonite (conference), bethel mennonite (conference) vancouver mennonite brethren, f i r s t united mennonite of vancouver (conference) mission city mennonite (conference) arnold mennonite brethren, east chilliwack m. b., matsqui m. b., strawberry h i l l , m. b., chilliwack mennonite (conference), east chilliwack mennonite (conference) evangelical mennonite brethren of abbotsford chilliwack mennonite brethren, east aldergrove mennonite brethren church of christ mennonite of bradner abbotsford mennonite brethren ? new westminster mennonite (conference) , clearbrook mennonite (conference) fraserview mennonite brethren of vancouver note: the names of individual churches tend to vary somewhat; the names on signboards often are different than those i n publi- cations put out by provincial and canadian conferences, or even by the churches themselves. the above names have been used in a form that would f a c i l i t a t e location and differentiation between sub-groups. appendix b table xyi a representative listing of mennonite family names as compiled from church directories of lower fraser valley mennonite churches abrahams da h i adrian daniels albert defehr a l l e r t delesky andres derksen arens dick arndt dirks dirksen baerg doerksen bahnman dosso baier driediger balzer dueck barg dueckmann bargen duerksen bartel dyck bartsch barwich ediger berg engbrecht bergen enns bergmann ens blatz epp block esau boese espenberg boldt ewert born borowsky fa ik boschmann fast brandt fieguth braun fleming brauer franz brede friesen brown froese brucks funk bruehler buhr gauer buller geddert busse gienger giesbrecht classen goepinger cornelson goertz cornies goerzen cornis goossen gorecki gossen koohn graeve konrad gronau koop grunau kopp guenther kornelsen gruen koslowsky gutwin krahn kran haak krause hamm kroeker harder krone harms kungel heide he i n lange heinrichs langemann helgeborde lehn hep ting lemke iliebert lenzmann hildebrand lepp hildebrandt letkemann hintz loepp hoeppner loewen hodel lowen hubert lohrenz huebert mantler isaac martens matis jackel matthies jantz matties jantzen meyer janz mieike janzen mirau jensen mueller kaethler nachtigal kasper neitsch keilbart neufeld kehler neufeldt ketler neuman klassen neumann kleebaum nickel kliewer niebuhr knecht table xvi (continued) niessen ratzlaff nikkei redekop nussbaumer reimer regehr olfert regier rempel paetkau renpening pankratz riediger pauls riesen p enner rogalsky peters rumpel petker russenberger p l e t t poetker sagert poettcker sawatsky p o l l s schapansky pump schellenberg pump schier quapp schierling quiring s c h i l l i n g schmidt s chin or schowalter unger schroeder unrau schulz unruh siebel siebert van bergen siemens veer sommerfeld vogt spenst voth stobbe suderman walde sudermann wall sukkau warkentin wed e l teichroeb wegenart teichgrab /eyer thielmann wiebe thiessen wiens tleszen wiensz t i l i t s k y willems toews wlllms wittenberg wittman wolfe • * pq ' > « pq cp * • • • « o o • o ^ s / pq • « o ) o o o o r h h c d c d cd & !?• c d cd •s c d cd & !?• • h • h •rh • r - i o o d h h r h r h h h -> r h •p h sh
h & c d s h s h xi xi cd x! cd x! > h t o o w o appendix c table xvii membership totals of mennonite churches of the lower fraser valley from to s h pq ^ pq cq pq ^ pq ) » • s h s • ' - n • . -p o s o w o • ^ • v ^ - f j •—v «•> • pq e j c ; -h >> . a> cd -p ^ t is s ) t n c ^ g u p q > > o o o e h s h w ^ s • h cd c d . [ ]. blood samples were obtained after – h fast to measure the following via an automated clinical analyzer (prestige i; tokio, boeki medical system ltd, japan): fasting glucose, total cholesterol (tc), high-density lipoprotein cholesterol (hdl), low-density lipoprotein cholesterol (ldl), and triglycerides (tg). the metabolic traits cut-off points included high blood pressure, defined as systolic and/or diastolic blood pressure ≥ p (sbp/dbp); waist circumference ≥ p ; tg ≥ mg/dl; hdl ≤ mg/dl; and, high blood glucose ≥ mg/dl according to cook et al. [ ]. other metabolic traits risk values were included tc ≥ mg/dl, ldl ≥ mg/dl, and the atherogenic index (ai = tc/hdl; male > . and female > . ) [ , ]. . . genotyping genomic dna was isolated from a peripheral blood buffy coat while using a master pure epicentre kit (thermo scientific, madison, wi, usa). the pro ala ppar-γ polymorphism was genotyped by mutagenically separated pcr with two different length allele-specific downstream primers (p and p ) and a common upstream primer (p ). the p ( ′-gtgtatcagtgaaggaatcgctttcttg- ′) was specific for the c allele (pro); and p ( ′-ttgtgatatgtttgcagacaaggtatcagtgaaggaatcgctttgtgc- ′) bound to the g allele (ala). the p (upstream primer) was ′-tttctgtgtttattcccatctctccc- ′. the bases underlined and in bold type indicate the location of mismatches to maintain the specificity of the two separate amplification reactions. here, dna ( ng) was added to a ml reaction mix containing mm mgcl , pmol p , pmol p , pmol p , mm dntp´s, and u taq polymerase (invitrogen, carlsbad, ca, usa). the pcr conditions used an initial denaturation of min. at ◦c followed by cycles of denaturation at ◦c for s, annealing at ◦c for s, and extension at ◦c for s. the final extension step was min. at ◦c (agilent surecycler , santa clara, ca, usa). a bp product identified the pro allele, and the ala-specific product was bp. electrophoresis used . % agarose (figure s ) [ ]. the + t/c ppar-δ polymorphism genotyping used endpoint pcr with ′-catggtatagcactgcaggaa- ′ (forward) and ′-cttcctcctgtggctgctc- ′ (reverse) primers. the -ml mix reaction contained . mm mgcl , . µm forward primer, . µm reverse primer, µm dntps, and u taq polymerase (invitrogen, carlsbad, ca, usa). the pcr conditions were the same as in the pro ala polymorphism. the bp resulting pcr product was genes , , of digested with u fast bsl i (thermo scientific, madison, wi, usa) restriction enzyme for h at ◦c. the % polyacrylamide electrophoresis was used to identify the three different genotypes: single bp fragment for tt, three fragments for tc ( , , and bp), and two fragments for cc ( and bp) (figure s ) [ ]. . . statistical analysis an exploratory analysis was performed to verify the data quality and observe variable distribution and frequencies. normality tests were conducted for variables measured in ratio scale. the mean and standard deviation or median and interquartile range were used to describe normally (sbp, glucose, total cholesterol, and ldl) or non-normally distributed variables (the other metabolic traits), respectively. metabolic traits measured in ratio scale were analyzed as continuous or categorical variables with the cutoffs defined in section . . for comparisons among ethnic groups or polymorphism groups, we used either anova or t-test for normally distributed variables, and kruskal–wallis or wilcoxon rank sum test (non-parametric tests) for non-normally distributed variables. for linear regression analyses we log-transformed non-normally distributed variables, as described in the following paragraphs. to compare metabolic traits measured in continuous scale among ethnic groups we used anova—for normally distributed—or kruskal–wallis test—for non-normally distributed—variables, followed by post hoc bonferroni´s test or dunn´s test with bonferroni adjustment, respectively, for pairwise comparisons. significant differences between ethnic groups were indicated by different superscripts (a–e). when groups were not statistically different, they share the same letter; therefore, some groups may have more than one superscript letter. the frequency and percentage were used to describe categorical variables. the chi test was used to compare groups and to verify hardy-weinberg equilibrium (hwe). we formed two groups according to ppar-γ and ppar-δ genotypes (major vs. minor allele carriers). comparison of metabolic traits between the two allelic groups was performed with t-test or wilcoxon´s rank sum test for normal or non-normally distributed variables, respectively. the α value was adjusted for multiple comparisons by the holm–bonferroni method, to correct for family-wise error rate. multiple linear regression models were used to adjust the relation between metabolic traits (as continuous variables) and genotype groups for potential confounders and effect modifiers using a forward inclusion of variables. metabolic trait variables with a non-normal distribution were log-transformed (tg, hdl, vldl, and atherogenic index) to reach normality, only in the case of the diastolic blood pressure, we left the original values, because the distribution did not reach normality with any of the tested transformations. the model residuals were analyzed and a heteroskedasticity test was performed to verify linear regression assumptions. in further analyses, we included ethnic groups as dummy variables and as fixed effects, for the analyses performed in the entire sample. because we found interaction effects between the polymorphism and ethnic groups, we conducted a stratified analysis, by ethnic group. dichotomous variables of metabolic traits were compared by pearson’s chi or fisher exact test. logistic regression models were used to calculate the odds ratio (or) of metabolic traits (dichotomous) according to the genotype groups. the reference group was homozygous for the major allele for both ppar polymorphisms. logistic regression analysis was performed on the total studied population only due to the limited sample size in some ethnic groups, which led to very low frequencies in some categories. a p-value < . was considered to be statistically significant, unless otherwise specified. all of the statistical analyses were performed with stata software (v. . , statacorp, college station, tx, usa). genes , , of . results . . population characteristics and metabolic traits among them three main ethnic populations were studied, mestizo, tarahumara, and mennonite. however, the mestizo group was separated in two: mestizo- and mestizo- , since they were from a different location and showed significant differences between them. the median age in the total studied population was years and . % were females. the mestizo- group had the highest overweight/obese phenotype proportion according to their pbmi (table ). table . general characteristics of studied populations. characteristic mestizo- n = ( %) mestizo- n = ( %) tarahumara n = ( %) mennonite n = ( %) total (n = ) md (iqr) md (iqr) md (iqr) md (iqr) md (iqr) age (years) ( – ) a ( – ) a ( – ) b ( – ) c ( – ) weight (kg) ( – ) a ( – ) b,d ( – ) a ( – ) c,d ( – ) height (cm) ( – ) a ( – ) a ( – ) b ( – ) c ( – ) bmi (kg/m ) ( – ) a ( – ) b ( – ) c,d ( – ) a,d ( – ) n (%) n (%) n (%) n (%) n (%) sex male ( )a ( )a ( )b ( )a ( ) female ( ) ( ) ( ) ( ) ( ) pbmi ≥ th (kg/m ) ( )a ( )b ( )a ( )a ( ) ethnic group characteristics were compared by kruskal-wallis test, followed by post hoc dunn’s test with bonferroni adjustment a–d different letters indicate significant differences between ethnic groups by pairwise comparisons. abbreviations: md = median, iqr = interquartile range, bmi (body mass index, pbmi (body mass index percentile). metabolic traits were compared among the ethnic populations (table ). relevant differences were observed among them. the mestizo- group showed greater values for bmi z-score, waist circumference, and waist/height ratio, but lower glucose levels when compared to the other populations. the tarahumara and mestizo- populations had higher triglycerides values compared to mestizo- and mennonite, whereas the tarahumara group had the lowest hdl levels with greater atherogenic index as compared to the others. the prevalence of altered metabolic traits in total studied population included overweight/obesity . % (by bmi z-score), high blood pressure . %, high waist circumference . %, high waist/height ratio . %, hyperglycemia . %, hypertriglyceridemia . %, high cholesterol . %, low hdl . %, high ldl . %, high vldl . %, and high atherogenic index . %. table . metabolic traits comparison among the studied populations. characteristic mestizo- mestizo- tarahumara mennonite total mean ± sd/md (iqr) mean ± sd/md (iqr) mean ± sd/md (iqr) mean ± sd/md (iqr) mean ± sd/md (iqr) bmi (z-score) . (− . – . ) a . (. – . ) b . (- . – . ) a,c - . (- . – . ) a,d . (- . – . ) sbp (mmhg) ± a ± a ± a ± a ± dbp (mmhg) ( – ) a ( – ) a,c ( – ) a ( – ) b,c ( – ) wc (cm) ( – ) a ( – ) b,e ( – ) c ( – ) d,e ( – ) whr . ( . – . ) a . ( . – . ) b . ( . – . ) c . ( . – . ) a . ( . – . ) glucose (mg/dl) ± a ± b ± a ± c ± tg (mg/dl) ( – ) a ( – ) a,c ( – ) b,c ( – ) a,d ( – ) tc (mg/dl) ± a ± a ± a ± a ± hdl (mg/dl) ( – ) a ( – ) a ( – ) b ( – ) a ( – ) ldl (mg/dl) ± a ± a ± a ± a ± vldl (mg/dl) ( – ) a ( – ) a,c ( – ) b,c ( – ) a,d ( – ) ai (index) . ( . – . ) a . ( . – . ) a . ( . – . ) b . ( . – . ) a . ( . – . ) ethnic group metabolic traits were compared by anova or kruskal-wallis test for normally or non-normally distributed data, followed by post hoc bonferroni or dunn’s tests, respectively. a–e different letters in the superscript indicate significant difference between ethnic groups by pairwise comparisons. abbreviations: md = median, iqr = interquartile range, sd = standard deviation, bmi (body mass index), sbp (systolic blood pressure), dbp (diastolic blood pressure), wc (waist circumference), whr (waist/height ratio), tc (total cholesterol), tg (triglycerides), vldl (very density lipoproteins cholesterol), ldl (low density lipoproteins cholesterol), hdl (high low density lipoproteins cholesterol), and ai (atherogenic index). genes , , of . . pro ala ppar-γ and + t/c ppar-δ the genotype and allelic frequency distribution were compared among populations. for ppar-γ , no significant difference was observed among mestizo- , mestizo- , and mennonite populations; however, the genotype distribution in tarahumara was different between mestizo- and mennonite, but not with mestizo- (table ). similar results were observed for ppar-δ genotype distribution—only the tarahumara population showed a different genotype distribution (table ). the polymorphisms pro ala ppar-γ and + t/c ppar-δ were in hardy–weinberg equilibrium in all of the ethnic groups and total studied population. table . pro ala ppar-γ genotype and allelic frequencies comparison among populations. ppar-γ mestizo- n (%) mestizo- n (%) tarahumara n (%) mennonite n (%) total n (%) cc ( ) a ( ) a,c ( ) b,c ( ) a ( ) cg ( ) ( ) ( ) ( ) ( ) gg ( ) ( ) ( ) ( ) ( ) hwe p . . . . c ( ) a ( ) a,c ( ) b,c ( ) a ( ) g ( ) ( ) ( ) ( ) ( ) chi test. a–c different letters indicate significant difference in genotype and allelic frequencies among groups p < . . hwe p (hardy-weinberg equilibrium p). g = minor allele. the tarahumara (b,c) group differed from mestizo- (a) and mennonite (a), but not from mestizo- (a,c). mestizo- (a), mestizo- (a) and mennonite (a) were not different. the difference between mestizo- and mestizo- showed a p value = . . table . + t/c ppar-δ genotype and allelic frequencies comparison among populations. ppar-δ mestizo- n (%) mestizo- n (%) tarahumara n (%) mennonite n (%) total n (%) tt ( ) a ( ) a ( ) b ( ) a ( ) tc ( ) ( ) ( ) ( ) ( ) cc ( ) ( ) ( ) ( ) ( ) hwe p . . . . . t ( ) a ( ) a ( ) b ( ) a ( ) c ( ) ( ) ( ) ( ) ( ) chi test. a,b different letters indicate significant differences in genotype and allelic frequencies among groups p < . . hwe p (hardy-weinberg equilibrium p). c = minor allele. the tarahumara group differed from the other ethnic groups. . . metabolic traits by pro ala ppar-γ and + t/c ppar-δ polymorphism genotype: major allele homozygous vs. minor allele carriers in the total studied population statistical analysis showed significant differences in waist/height ratio and hdl median values between ppar-γ alleles. the α value was adjusted for multiple comparisons by the holm–bonferroni method, to correct for family-wise error rate. this association remained significant after adjusting for multiple testing (cut off p value = . ), whereas the difference in waist/height ratio did not (cut off p value = . ). individuals showed significant differences in tg, hdl, and vldl median values, according with their ppar-δ genotype. however, the association between ppar-δ and hdl did not remain significant after correcting for multiple testing, while significance remained for tg and vldl (table ). genes , , of table . metabolic traits comparison between pro ala ppar-γ and + t/c ppar-δ genotype (major allele homozygous vs. minor allele carriers) in the total studied population. metabolic traits pro ala ppar-γ + t/c ppar-δ cc (n = ) cg/gg (n = ) tt (n = ) tc/cc (n = ) mean ± sd/md (iqr) mean ± sd/md (iqr) p mean ± sd/md (iqr) mean ± sd/md (iqr) p bmi (z-score) . (− . – . ) . (- . – . ) . # . (- . – . ) . (− . – . ) . # sbp (mmhg) ± ± . * ± ± . * dbp (mmhg) ( – ) ( – ) . # ( – ) ( – ) . # wc (cm) ( – ) ( – ) . # ( – ) ( – ) . # whr . ( . – . ) . ( . – . ) . # . ( . – . ) . ( . – . ) . # glucose (mg/dl) ± ± . * ± ± . * tg (mg/dl) ( – ) ( – ) . # ( – ) ( – ) . # tc (mg/dl) ± ± . * ± ± . * hdl (mg/dl) ( – ) ( – ) < . # ( – ) ( – ) . # ldl (mg/dl) ± ± . * ± ± . * vldl (mg/dl) ( – ) ( – ) . # ( – ) ( – ) . # ai (index) . ( . – . ) . ( . – . ) . # . ( . – . ) . ( . – . ) . # groups were compared by * t-student test or # wilcoxon’s rank sum test for normally or non-normally distributed data, respectively. the association between ppar-γ polymorphism and hdl remained significant after adjusting for multiple testing by the holm-bonferroni method (cut off p value = . ) but the one of whr did not (cut off p value = . ). the association between ppar-δ and hdl did not remain significant after correcting for multiple testing; while significance remained for tg and vldl. abbreviations: md = median, iqr = interquartile range, sd = standard deviation, bmi (body mass index), sbp (systolic blood pressure), dbp (diastolic blood pressure), wc (waist circumference), whr (waist/height ratio), tc (total cholesterol), tg (triglycerides), vldl (very density lipoproteins cholesterol), ldl (low density lipoproteins cholesterol), hdl (high low density lipoproteins cholesterol), ai (atherogenic index), pbp (blood pressure percentile), and pwc (waist circumference percentile). . . association between pro ala ppar-γ and metabolic traits among the clinical variables, sex was significantly associated (p < . ) with all metabolic traits, except for diastolic blood pressure and age was also associated with all, except for ldl and atherogenic index. therefore, we included them as covariates in multivariate models. associations between metabolic traits and the polymorphism pro ala ppar-γ were found with glucose, hdl, and atherogenic index in the total studied population, adjusting for clinical variables (age, sex, and or waist circumference). minor allele carries had lower hdl and glucose levels and higher atherogenic index, than major allele homozygous. however, analysis according to ethnic populations only showed a significant association in the mestizo- group with sbp and hdl. the minor allele carriers had ~ . mmhg lower sbp (adjusted by waist circumference, sex, and age) and ~ . mg/dl lower hdl than major allele homozygotes (log(− . ), adjusted by waist circumference and sex) (table ). after also adjusting for ethnic group, only the association of atherogenic index remained significant. the interaction effect of sex and age for sbp showed that men had a slight elevation in spb as age increased. the ppar-γ and atherogenic index relation was modified by the waist circumference. atherogenic index increased as waist circumference increased, but this relation differed by the studied polymorphism (table footnote). after also adjusting for ethnic group (last column), only the association of atherogenic index remained significant. an interaction effect between the polymorphism and the ethnic group was also observed for ldl. . . association between + t/c ppar-δ and metabolic traits associations between + t/c ppar-δ and metabolic traits in the total studied population were observed with glucose, tg, tc, and vldl. c allele carries had . mg/dl less glucose (adjusted by waist circumference, sex and age), . mg/dl less tg (log(− . ), adjusted by sex and age), . mg/dl less vldl (log(− . ), adjusted by waist circumference, sex and age), and . mg/dl more tc (adjusted by sex and age) than major allele homozygotes. among ethnic groups, the only association was found in the tarahumara population with hdl where c allele carriers had . mg/dl less hdl genes , , of (log(− . ), adjusted by waist circumference, sex, and age) than major allele homozygotes (table ). the relation between ppar-δ allele and hdl was modified by sex. in male teenagers, the hdl levels were higher in c allele carriers versus major allele homozygotes; no differences were noted in females (figure a). in the total studied population, ppar-δ and ldl relation was also modified by sex. males with the major allele had the lowest values of ldl versus females and males with minor allele carriers (figure b). the same interaction was found in mestizo- population (table footnote). after adjusting for ethnic group (table , last column), the association of the polymorphism and glucose levels remained significant, as well as the interaction effect between the polymorphism and sex for ldl. we also observed a significant interaction effect between ethnic group and this polymorphism in its relation to hdl and atherogenic index. table . association/interaction between pro ala ppar-γ polymorphism and metabolic traits by population groups. metabolic trait mestizo- mestizo- tarahumara mennonite total total (adjusted) n = ( ) n = ( ) n = ( ) n = ( ) n = ( ) n = ( ) β ± se β ± se β ± se β ± se β ± se β ± se (p) (p) (p) (p) (p) (p) sbp (mmhg) * − . ± . − . ± . − . ± . . ± . − . ± . − . ± . ( . ) *, ++ ( . ) ( . ) ( . ) ( . ) ( . ) + dbp (mmhg) * − . ± . − . ± . − . ± . . ± . − . ± . − . ± . ( . ) ‡( . ) ( . ) ( . ) ( . ) ( . ) glucose (mg/dl) * − . ± . . ± . . ± . . ± . − . ± . − . ± . ( . ) *, – ( . ) ( . ) ( . ) ( . ) ( . ) - tg (log mg/dl) * − . ± . − . ± . − . ± . . ± . . ± . - . ± . ( . ) §( . ) ( . ) ( . ) ( . ) ( . ) tc (mg/dl) # − . ± . − . ± . − . ± . . ± . − . ± . − . ± . ( . ) ¶( . ) ( . ) ( . ) ( . ) ( . ) hdl (log mg/dl) ˆ − . ± . <− . ± . . ± . . ± . − . ± . − . ± . ( . ) ‡ ( . ) ( . ) ( . ) ( . ) ( . ) ~ ldl (mg/dl) * . ± . − . ± . − . ± . . ± . − . ± . − . ± . ( . ) ˆ ( . ) ( . ) ( . ) ( . ) ( . ) vldl (log mg/dl) * − . ± . − . ± . − . ± . . ± . . ± . − . ± . ( . ) §( . ) ( . ) ( . ) ( . ) ( . ) ai (log) ˆ . ± . − . ± . − . ± . . ± . . ± . . ± . ( . ) ˆ, //( . ) ( . ) ( . ) ( . ) ( . ) / analyses on total studied population were adjusted for waist circumference and/or sex, and/or age, as indicated in variable names and ethnic groups. total studied population adjusted models included ethnic groups as fixed effects, in addition to those indicated by the superscript. variables with non-normal distribution were log transformed (hdl, tg, vldl and ai). coefficients for interaction terms are described below and indicated by symbols in the table. * adjusted for waist circumference, sex and age. # adjusted for sex and age. ˆ adjusted for waist circumference and sex. ‡ adjusted for waist circumference. § adjusted for waist circumference and age. ¶ adjusted for sex. + interaction sex x age (β = − . ± . , p = . ), ++ interaction sex x age (β = . ± . , p = . ). - interaction polymorphism x waist circumference (β = . ± . , p = . ), – interaction polymorphism x waist circumference (β = . ± . , p = . ). ~ interaction sex x waist circumference (β = . ± . , p = . ). / interaction polymorphism x waist circumference (β = − . ± . , p = . ), // interaction polymorphism x waist circumference (β = − . ± . , p = . ). abbreviations: sbp (systolic blood pressure), dbp (diastolic blood pressure), tc (total cholesterol), tg (triglycerides), hdl (high density lipoproteins cholesterol), ldl (low density lipoproteins cholesterol), vldl (very low-density lipoproteins cholesterol), and ai (atherogenic index). figure . (a) interaction between ppar-δ mutated allele and sex: effect in hdl levels. *β = - . ± . , p = . . (b) interaction between ppar-δ mutated allele and sex: effect in ldl levels. *β = . ± . , p = . . female, male. genes , , of table . association between + t/c ppar-δ polymorphism and metabolic traits in studied populations. metabolic trait mestizo- mestizo- tarahumara mennonite total total (adjusted) n = ( ) n = ( ) n = ( ) n = ( ) n = ( ) n = ( ) β ± se β ± se β ± se β ± se β ± se β ± se (p) (p) (p) (p) (p) (p) sbp (mmhg) * . ± . . ± . . ± . − . ± . . ± . . ± . ( . ) ( . ) ( . ) ( . ) ( . ) ( . ) * dbp (mmhg) # − . ± . − . ± . . ± . − . ± . . ± . . ± . ( . ) ( . ) ( . ) ( . ) ( . ) ( . ) # glucose (mg/dl) * − . ± . . ± . − . ± . − . ± . − . ± . − . ± . ( . ) *( . ) ( . ) ( . ) ( . ) ( . ) tg (log mg/dl) * − . ± . − . ± . − . ± . − . ± . − . ± . − . ± . ( . ) #( . ) ( . ) ( . ) ( . ) ( . ) tc (mg/dl) ˆ − . ± . . ± . − . ± . − . ± . . ± . . ± . ( . ) &, ++( ) ( . ) ( . ) ( . ) ( . ) + hdl (log mg/dl) * . ± . . ± . − . ± . . ± . < . ± . . ± . ( . ) ‡( . ) ( . ) ( . ) ( . ) ( . ) - ldl (mg/dl) * − . ± . . ± . . ± . − . ± . − . ± . − . ± . ( . ) ‡,~~( . ) / ( . ) ( . ) ˆ ( . ) & ( . ) ‡,~ vldl (log mg/dl) * . ± . − . ± . − . ± . − . ± . − . ± . − . ± . ( . ) #( . ) ( . ) ( . ) ( . ) ( . ) ai (log) * − . ± . − . ± . . ± . − . ± . − . ± . − . ± . ( . ) #( . ) ( . ) ( . ) ( . ) ( . ) analyses on total studied population were adjusted for waist circumference and/or sex, and/or age, as indicated in variable names and ethnic groups. total studied population. adjusted models included ethnic groups as fixed effects, in addition to those indicated by the superscript. variables with non-normal distribution were log transformed (hdl, tg, vldl and ai). coefficients for interaction terms are described below and indicated by symbols in the table. * adjusted for waist circumference, sex, and age. # adjusted for waist circumference and age. ˆ adjusted for sex and age. & adjusted for age. ‡ adjusted for waist circumference. + interaction polymorphism x age (β = − . ± . , p = . ), ++ interaction polymorphism x age (β = − . ± . , p = . ). - interaction polymorphism x sex (β = − . ± . , p = . ). ~ interaction polymorphism x sex (β = − . ± . p = . ), ~~ interaction polymorphism x sex (β = − . ± . p = . ). / interaction polymorphism x and sex (β = − . ± . p = . ). significant differences in bold p < . . abbreviations: sbp (systolic blood pressure), dbp (diastolic blood pressure), tc (total cholesterol), tg (triglycerides), hdl (high density lipoproteins cholesterol), ldl (low density lipoproteins cholesterol), vldl (very low density lipoproteins cholesterol), and ai (atherogenic index). . . logistic regression in the total studied population, pro ala ppar-γ minor allele carriers had greater likelihood of having an elevated waist-height ratio (or = . , adjusted by sex) and . -fold greater chance of having low hdl values (adjusted by waist circumference, sex, and age) than major allele homozygous. in contrast, they had a nearly two-fold lower likelihood of having a bmi z-score suggestive of overweight/obesity (or = . ) and increased tc (or = . , adjusted by sex and age) than major allele homozygous. the ppar-δ minor allele carriers had greater likelihood (or = . ) of having a bmi z-score that was suggestive of overweight/obesity (table ). no significant interactions were seen between both minor alleles. table . association between pro ala ppar-γ or + t/c ppar-δ with metabolic traits in the total studied population. metabolic traits pro ala ppar-γ + t/c ppar-δ cc cg/gg adjusted or ( %ci) p tt c/cc adjusted or ( %ci) p(n = ) (n = ) (n = ) (n = ) n (%) n (%) n (%) n (%) bmi (z-score > . ) ( ) ( ) . ( . – . ) . ( ) ( ) . ( . – . ) . pbp ≥ th ( ) ( ) . ( . – . ) . ( ) ( ) ( . – . ) . pwc ≥ th ( ) ( ) . ( . – . ) . ( ) ( ) . ( . – . ) . genes , , of table . cont. metabolic traits pro ala ppar-γ + t/c ppar-δ cc cg/gg adjusted or ( %ci) p tt c/cc adjusted or ( %ci) p(n = ) (n = ) (n = ) (n = ) n (%) n (%) n (%) n (%) whr > . * ( ) ( ) . ( . – . ) . ¶ ( ) ( ) . ( . – . ) . glucose ≥ (mg/dl) ** ( ) ( ) – ( ) ( ) – tg ≥ ˆ (mg/dl) ( ) ( ) . ( . – . ) . ( ) ( ) . ( . – . ) . tc ≥ # (mg/dl) ( ) ( ) . ( . – ) . - ( ) ( ) . ( . – . ) . ~ hdl ≤ @ (mg/dl) ( ) ( ) . ( . – . ) < . ( ) ( ) ( . – . ) . / ldl ≥ ‡ (mg/dl) ( ) ( ) . ( . – . ) . ( ) ( ) . ( . – . ) . vldl ≥ ‡ (mg/dl) ( ) ( ) . ( . – . ) . ( ) ( ) . ( . – . ) . ai (m > f > . ) & ( ) ( ) . ( . – . ) . ( ) ( ) . ( . – . ) . reference: homozygous group for major allele. * adjusted by sex,# adjusted by sex and age, ˆ adjusted by waist circumference and age, @ adjusted by waist circumference, sex and age, ‡ adjusted by waist circumference, & adjusted by sex and wc. ¶ interaction polymorphism x sex (β = . ± . , p = . ), - interaction sex x age (β = . ± . , p = . ), ~ interaction sex x age (β = . ± . , p = . ), / interaction polymorphism x sex (β = . ± . , p = . ). ** odds ratio was not calculated, due to the low frequency of individuals in the high-glucose category. abbreviations: pbp (blood pressure percentile), pwc (waist circumference percentile), whr (waist-height ratio), tc (total cholesterol), tg (triglycerides), hdl (high low density lipoproteins cholesterol), ldl (low density lipoproteins cholesterol), vldl (very low density lipoproteins cholesterol), and ai (atherogenic index) m = male, f = female. . discussion in this study, we analyzed the association between the pro ala ppar-γ or + t/c ppar-δ polymorphisms and metabolic traits in teenagers from the north of mexico, including mestizo, tarahumara, and mennonite populations. hispanic populations have a higher tendency for obesity than other caucasians due to their genetic origin and cultural characteristics [ – ]. mexican-origin population have native american and spanish admixture. however, salzano et al. reported that amerindian ancestry is most prevalent in the general population of mexico followed by european ancestry [ ]. the mexican territory is extensive, it borders with countries of north and central america. in addition, mexico has a great history of spanish colonization and the arrival of a large number of immigrants of african and european origin. therefore, it is not surprising to find diversity in the population in this country. the interest of this study was to include the three most representative populations of the chihuahua state, northern of mexico. the overweight/obesity prevalence in the total studied population was . %, which is lower than the national prevalence reported among mexican teenagers in ( . %) [ ]. however, it was similar to the us national report in ( . %) [ ]. mestizo- group had the highest overweight/obesity prevalence ( %) when compared to the other ethnic populations—this might be because they are from an urbanized location. benitez et al. found that urban tarahumara children were % more overweight than rural tarahumara children in chihuahua, mexico [ ]. the high blood pressure prevalence in the total studied population was . % similar to the frequency that was reported by salcedo-rocha et al. ( . %) and higher than that found by cardoso-saldaña et al. ( . %) in mexican adolescents [ , ]. the results in mexicans are significantly higher than values reported by the nhanes in american teenagers ( . %) [ ]. in contrast, the hypertriglyceridemia and hdl prevalence in this study was lower than most reported in mexican teenagers [ , ]. the prevalence of hyperglycemia was low ( . %) similar to the reported by cardoso-saldaña et al. ( . %), but different the reported by camarillo-romero et al. ( . %) [ , ]. among the four ethnic groups analyzed in this study, the mennonites were the healthiest, whereas the mestizo- population had the greater genes , , of number of metabolic traits above normal values. the metabolic indicators we chose are considered metabolic syndrome risk factors for adults. even though the study population appeared to be in healthy individuals—no clinical setting—there was a percentage of teenagers with values outside the expected for healthy populations. this suggests that at these early ages, some metabolic risks could be detected, thus providing an opportunity window for intervention targeted to modifiable factors of obesity and chronic non-transmissible diseases. ppars play complex, overlapping, and specific roles in metabolic networks by regulating cellular energy homeostasis during lipid and carbohydrate metabolism. therefore, ppars have been considered as potential therapeutic targets [ ]. however, the allele frequencies vary among different populations. the pro ala ppar-γ g minor allele frequency in the literature ranges from % to % [ , – , , ]. in this study, the frequency in the total studied population was %, while other studies in mexican population report – % [ , ]. similarly, the + t/c ppar-δ c minor allele frequencies vary from % to % among different populations [ , , , – , , – ]. we found that the + t/c ppar-δ c allele frequency in the total studied population was %, which is lower than what was found in other mexican population ( %) by rosales-reynoso et al. [ ]. differences in both ppar-γ and ppar-δ allelic and genotype frequencies were only observed in the tarahumara group. this might be explained by differences in ethnic admixture; however, further studies are needed. the pro ala ppar-γ g minor allele has been associated with hypertension, insulin resistance, greater bmi, and lipemia profiles, mainly in adult population. with the multiple linear regression analysis, we found significant associations with several metabolic traits: systolic blood pressure, glucose, hdl, and atherogenic index. however, except for the atherogenic index, these associations were no longer significant after adjusting for ethnic group. hasan et al. in egyptian populations reported that the polymorphism was related to lower sbp and dbp values in patients with t d and chd [ ]. however, most literature reports an opposite association with higher blood pressure values (sbp and dbp) in individuals from the usa, finland, and spain [ – ]. we also found a relation between the pro ala ppar-γ g allele and lower glucose values (adjusted by waist circumference, sex, and age). most studies showed no association between the polymorphism and glucose levels in other populations, such as tunisian (adjusted by age and bmi), cypriot, egyptian, and emirati populations [ , , , ]. other studies have reported an association of minor allele with increased insulin [ , ]. it would have been interesting to have insulin data in this study. in terms of lipemia, we only found an association between the pro ala ppar-γ -minor allele and lower hdl values in the total studied population and the mestizo- group (adjusted by waist circumference and sex). after the adjustment for ethnic group, this relation was no significant. in contrast, to the higher hdl levels reported in finnish population, becer et al. found no association between the snp and lipemia traits in non-obese cypriot subjects; however, obese subjects with homozygous minor genotype had increased tg values [ , ]. this suggests that obesity may interact with pro ala ppar-γ g minor allele and lipemia traits. as expected, we found an association between the pro ala ppar-γ g allele and higher atherogenic index. the + t/c ppar-δ polymorphism has been related to hdl, ldl, vldl, and tg. with a multiple linear regression analysis, we found significant associations between the ppar-δ polymorphism and glucose, tg, total cholesterol, hdl, and vldl. the presence of the minor allele was associated with lower glucose values in this study (adjusted by waist circumference, sex and age). in contrast, hu et al. found that the minor allele associated with higher glucose concentrations in shanghai, china population (adjusted by age and sex) [ ]. whereas, no association between the c allele and glucose was observed in other shanghai study (adjusted by age) and in denmark subjects (adjusted by age, sex, and bmi) [ , ]. the + t/c ppar-δ c minor allele was also associated with lower tg (adjusted by waist circumference, sex and age), higher total cholesterol (adjusted by sex and age), and lower vldl (adjusted by waist circumference, sex, and age) values in the total studied population. however, an association with lower hdl values was also found in the tarahumara group (adjusted by waist genes , , of circumference, sex, and age). this polymorphism has been associated with hdl since its discovery by skogsberg et al. who observed its relation with lower hdl in scottish population [ ]. similar results were reported by aberle et al. in german woman, where + t/c ppar-δ-minor allele carriers had lower hdl and vldl values (adjusted by age, smoking, and bmi) [ ]. in contrast, association between the snp and higher hdl values has been reported in scottish and canadian studies [ , ]. no relation was found with sbp in this study, while others have related the minor allele with lower blood pressure in chinese population [ , ]. the logistic regression analysis with dichotomous metabolic traits values indicated that individuals with the pro ala ppar-γ g allele had greater risk of having an elevated waist/height ratio (adjusted by sex). similar results were reported by sözen et al. in turkish populations with obesity, where the minor allele was associated with higher values of waist/height ratio; however, the same snp was also associated with lower values in the non-obese group [ ]. whereas, meirhaeghe et al. found no association [ ]. in this study the pro ala g allele carriers had two-fold less possibilities of being overweight/obese (adjusted by sex and age). in contrast to most studies in the literature, such as different meta-analysis that have shown a bmi increment in minor allele carriers [ , ]. in this study, we also found that pro ala-minor allele carriers had . -fold more chances of having low hdl values when adjusted by waist circumference, sex, and age and two-fold more total cholesterol (adjusted by sex and age). regarding + t/c ppar-δ, we observed that c minor allele carriers had greater probability of having an overweight/obese phenotype. in contrast, this polymorphism has been related with lower bmi in scottish males, as well as german and chinese adult populations [ , , ]. nevertheless, an association was found between + t/c minor allele and bmi in greek toddlers [ ]. these analyses were not adjusted for ethnic group, due to the low frequency in several categories. taking into account the observed effects in the metabolic traits analyzed as continuous variables, these results may vary across the groups. metabolic diseases are of public health concern. for years, health programs have been focused on how to maintain normal values of clinical indicators. unfortunately, most actions are taken in adulthood when it is already difficult to change a person’s habits. however, it should be considered that metabolic diseases depend on modifiable and non-modifiable factors. the latter are those that are related to genetic load. ideally, the era of “omics” aims to create networks between the different levels of information that an individual has (genome, transcriptome, metabolome, proteome, etc.). we consider that the detection of risk components for metabolic diseases at an early age would allow us to improve preventive programs for health care. to the best of our knowledge, this is the first study to report differences among ethnic populations that live in chihuahua state from mexico regarding ppar-γ and ppar-δ and their association/interaction with metabolic traits. population admixtures, habits, and cultural aspects need to be considered in public health strategies. networking disciplines, including genetics, may help to identify new therapeutic answers, and ppars are potential therapeutic targets to control metabolic diseases. further studies in the same ethnic populations with larger sample size and including adults will be important to confirm our findings. . study limitations the cross-sectional nature of this study does not allow to follow up if participants would develop a metabolic disease in the future associated with the studied polymorphisms. the sample size by ethnic group was small for logistic regression analysis and the variable diastolic blood pressure did not reach normality with any transformation, then we used the original scale. on the other hand, the initial study was focused on early detection of metabolic syndrome components in teenagers, thus most of the studied population was in good health, contrary to most studies that include adults with specific inclusion criteria. moreover, metabolic diseases, such as diabetes type , hypertension, and obesity, are multifactorial, meaning that there are external factors, such as environmental conditions, diet, and exercise, which can be modified. however, we did not explore those issues. multifactorial diseases are also multigenic, whereas, in this study, we just included two ppar polymorphisms and multiple genes , , of snps analysis could still give more information. finally, the schools were not randomly selected to assure the sample representativity. . conclusions the results of this study showed that pro ala ppar-γ and + t/c ppar-δ polymorphisms are associated with metabolic indicators among ethnic populations. the total studied population showed a significant relationship between the ppar-γ and ppar-δ polymorphisms with some metabolic traits. this ppar polymorphism study seems to be the first that includes different ethnic teenagers from the north of mexico and, to our knowledge, it is the first report to estimate + t/c ppar-δ minor allele frequencies among them. an early metabolic syndrome components detection will provide the opportunity to implement prophylactic measures on modifiable factors. further research is warranted in order to confirm the role of other ppar polymorphisms on metabolic diseases. supplementary materials: the following are available online at http://www.mdpi.com/ - / / / /s , figure s : electrophoresis example for both polymorphisms. author contributions: conceptualization, v.l.-c. and i.l.-b.; data curation, j.g.m.-g.; formal analysis, s.a.r.-l., m.a.c.-v., i.l.-b.; funding acquisition, i.l.-b.; investigation, i.l.-b.; methodology, j.g.m.-g., m.a.c.-v., and n.r.e.-a.; project administration, i.l.-b.; resources, p.d.c.h.-r.; supervision, v.m.-b. and a.l.-t.; visualization, e.g.-r.; writing–original draft, m.a.c.-v.; writing–review & editing, i.l.-b., s.a.r.-l., m.a.c.-v. all authors have read and agreed to the published version of the manuscript. funding: this research study was supported by the universidad autónoma de chihuahua (facultad de medicina y ciencias biomédicas) with pfce- - msu h- and publication expenses will be covered by universidad autónoma de chihuahua. conflicts of interest: the authors declare that there is no conflict of interest regarding the publication of this paper. references . afshin, a.; forouzanfar, m.h.; reitsma, m.b.; sur, p.; estep, k.; lee, a.; marczak, l.; mokdad, a.h.; moradi-lakeh, m.; naghavi, m.; et al. health effects of overweight and obesity in countries over years. new engl. j. med. , , – . [pubmed] . oecd. the heavy burden of obesity; oecd health policy studies, ed.; oecd publishing: paris, france, . . ogden, c.l.; carroll, m.d.; lawman, h.g.; fryar, c.d.; kruszon-moran, d.; kit, b.k.; flegal, k.m. trends in obesity prevalence among children and adolescents in the united states, - through - . jama , , – . [crossref] [pubmed] . instituto nacional de salud pública. encuesta nacional de salud y nutrición . méxico: instituto nacional de salud pública. . available online: https://www.inegi.org.mx/contenidos/programas/ensanut/ /doc/ensanut_ _diseno_conceptual.pdf (accessed on june ). . willson, t.m.; brown, p.j.; sternbach, d.d.; henke, b.r. the ppars: from orphan receptors to drug discovery. j. med. chem. , , – . [crossref] . hong, f.; pan, s.; guo, y.; xu, p.; zhai, y. ppars as nuclear receptors for nutrients and energy metabolism. molecules , , . [crossref] [pubmed] . chen, y.; jiménez, a.r.; medh, j.d. identification and regulation of novel ppar-γ splice variants in human thp- macrophages. biochim. biophys. acta , , – . [crossref] [pubmed] . gouda, h.n.; sagoo, g.s.; harding, a.h.; yates, j.; sandhu, m.s.; higgins, j.p.t. the association between the peroxisome proliferator-activated receptor-γ (pparg ) pro ala gene variant and type diabetes mellitus: a huge review and meta-analysis. am. j. epidemiol. , , – . [crossref] [pubmed] . swarbrick, m.m.; chapman, c.m.l.; mcquillan, b.m.; hung, j.; thompson, p.l. a pro ala polymorphism in the human peroxisome proliferator-activated receptor-γ is associated with combined hyperlipidaemia in obesity. eur. j. endocrinol. , , – . [crossref] . stumvoll, m.; häring, h. the peroxisome proliferator-activated receptor-γ pro ala polymorphism. perspect. diabetes , , – . http://www.mdpi.com/ - / / / /s http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /jama. . http://www.ncbi.nlm.nih.gov/pubmed/ https://www.inegi.org.mx/contenidos/programas/ensanut/ /doc/ensanut_ _diseno_conceptual.pdf https://www.inegi.org.mx/contenidos/programas/ensanut/ /doc/ensanut_ _diseno_conceptual.pdf http://dx.doi.org/ . /jm g http://dx.doi.org/ . /molecules http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /j.bbaexp. . . http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /aje/kwp http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /eje. . genes , , of . stryjecki, c.; peralta-romero, j.; alyass, a.; karam-araujo, r.; suarez, f.; gomez-zamudio, j.; burguete-garcia, a.; cruz, m.; meyre, d. pro ala genotype and insulin resistance is modified by circulating lipids in mexican children. sci. rep. , , – . [crossref] . yen, c.; beamer, b.a.; negri, c.; silver, k.; yarnall, d.p. molecular scanning of the human peroxisome proliferator activated receptor γ (hpparγ) gene in diabetic caucasians: identification of a pro ala γ missense mutation. biochem. biophys. res. commun. , , – . [crossref] . galbete, c.; toledo, e.; martínez-gonzález, m.a.; martínez, j.a.; guillén-grima, f.; marti, a. pro ala variant of the pparg gene increases body mass index: an updated meta-analysis encompassing , subjects. obesity , , – . [crossref] . morris, a.; voight, b.; teslobich, t.; ferreira, t.; segre, a.; steinthorsdottir, b.; strawbridge, r.j.; khan, h.; grallert, h.; mahajan, a.; et al. large-scale association analysis provides insights into the genetic architecture and pathophysiology of type diabetes. nat. genet. , , – . [pubmed] . deeb, s.s.; fajas, l.; nemoto, m.; pihlajamäki, j.; mykkänen, l.; kuusisto, j.; laakso, m.; fujimoto, w.; auwerx, j. a pro ala substitution in pparγ associated with decreased receptor activity, lower body mass index and improved insulin sensitivity. nat. genet. , , – . [crossref] . muller, y.l.; bogardus, c.; beamer, b.a.; shuldiner, a.r.; baier, l.j. a functional variant in the peroxisome proliferator—activated receptor γ promoter is associated with predictors of obesity and type diabetes in pima indians. diabetes , , – . [crossref] [pubmed] . canizales-quinteros, s.; aguilar-salinas, c.a.; ortiz-lópez, m.g.; rodríguez-cruz, m.; villarreal-molina, m.t.; coral-vázquez, r.; huertas-vázquez, a.; hernández-caballero, a.; lópez-alarcón, m.; brito-zurita, o.r.; et al. association of pparg pro ala variant with larger body mass index in mestizo and amerindian populations of mexico. hum. biol. , , – . [crossref] [pubmed] . ben ali, s.; ben yahia, f.; sediri, y.; kallel, a.; ftouhi, b. gender-specific effect of pro ala polymorphism in peroxisome proliferator-activated receptor γ- gene on obesity risk and leptin levels in a tunisian population. clin. biochem. , , – . [crossref] [pubmed] . baldani, d.p.; skrgatic, l.; cerne, j.z.; ferk, p.; simunic, v.; gersak, k. association of pparg pro ala polymorphism with insulin sensitivity and body mass index in patients with polycystic ovary syndrome. biomed. rep. , , – . [crossref] . tönjes, a.; stumvoll, m. the role of the pro ala polymorphism in peroxisome proliferator-activated receptor γ in diabetes risk. lippincott williams & wilkins. curr. opin. clin. nutr. metab. care , , – . . information nc for b. ppard peroxisome proliferator activated receptor delta [homo sapiens (human)]. . available online: https://www.ncbi.nlm.nih.gov/gene/ #gene-expression (accessed on november ). . gouni-berthold, i.; giannakidou, e.; faust, m.; berthold, h.k.; krone, w. the peroxisome proliferator-activated receptor delta + t/c polymorphism in relation to lipoprotein metabolism in patients with diabetes mellitus type and in non-diabetic controls. atherosclerosis , , – . [crossref] . sznaidman, m.l.; haffner, c.d.; maloney, p.r.; fivush, a.; chao, e.; goreham, d.; sierra, m.l.; legrumelec, c.; xu, h.e.; montana, v.g.; et al. novel selective small molecule agonists for peroxisome proliferator-activated receptor δ (pparδ) - synthesis and biological activity. bioorg med. chem. lett. , , – . [crossref] . skogsberg, j.; mcmahon, a.d.; karpe, f.; hamsten, a.; packard, c.j.; ehrenborg, e. peroxisome proliferator activated receptor delta genotype in relation to cardiovascular risk factors and risk of coronary heart disease in hypercholesterolaemic men. j. intern. med. , , – . [crossref] [pubmed] . luo, c.y.; liu, c.w.; ge, l.; pang, g.f.; yang, m.; hu, c.y.; ze-ping, l.; ning-yuan, c.; hai-yan, l.; hua-yu, w.; et al. ppard + c overrepresentation in general and long-lived population in china bama longevity area and unique relationships between ppard + t/c polymorphism and serum lipid profiles. lipids health dis. , , – . [crossref] [pubmed] . aberle, j.; hopfer, i.; beil, f.u.; seedorf, u. association of the t+ c polymorphism in ppar δ with low hdl cholesterol and coronary heart disease risk in women. int. j. med sci. , , – . [crossref] [pubmed] . burch, l.r.; donnelly, l.a.; doney, a.s.f.; brady, j.; tommasi, a.m.; whitley, a.l.; goddard, c.; morris, a.d.; hansen, m.k.; palmer, c.n.a. peroxisome proliferator-activated receptor-δ genotype influences metabolic phenotype and may influence lipid response to statin therapy in humans: a genetics of diabetes audit and research tayside study. j. clin. endocrinol. metab. , , – . [crossref] http://dx.doi.org/ . /srep http://dx.doi.org/ . /bbrc. . http://dx.doi.org/ . /oby. http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . / http://dx.doi.org/ . /diabetes. . . http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /hub. . http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /j.clinbiochem. . . http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /br. . https://www.ncbi.nlm.nih.gov/gene/ #gene-expression http://dx.doi.org/ . /j.atherosclerosis. . . http://dx.doi.org/ . /s - x( ) - http://dx.doi.org/ . /j. - . . .x http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /s - - - http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /ijms. . http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /jc. - genes , , of . robitaille, j.; gaudet, d.; pérusse, l.; vohl, m.-c. features of the metabolic syndrome are modulated by an interaction between the peroxisome proliferator-activated receptor-delta - t>c polymorphism and dietary fat in french-canadians. int. j. obes. , , – . . aberle, j.; hopfer, i.; beil, f.u.; seedorf, u. association of peroxisome proliferator-activated receptor delta + t/c with body mass index and interaction with peroxisome proliferator-activated receptor alpha l v. int. j. obes. , , – . [crossref] . grarup, n.; albrechtsen, a.; ek, j.; borch-johnsen, k.; jørgensen, t.; schmitz, o.; pedersen, o. variation in the peroxisome proliferator-activated receptor δ gene in relation to common metabolic traits in , middle-aged white people. diabetologia , , – . [crossref] . villegas, r.; williams, s.; gao, y.; cai, q.; li, h.; elasy, t.; cai, h.; edwards, t.; xiang, y.b.; zheng, w.; et al. peroxisome proliferator-activated receptor (ppar) delta genetic variation and type diabetes in middle age chinese women. ann. hum. genet. , , – . [crossref] . tang, l.; lü, q.; cao, h.; yang, q.; tong, n. ppard rs polymorphism is associated with metabolic traits in a large population of chinese adults. gene , , – . [crossref] . qian, y.; li, p.; zhang, j.; shi, y.; chen, k.; yang, j.; wu, y.; ye, x. association between peroxisome proliferator-activated receptor-alpha, delta, and gamma polymorphisms and risk of coronary heart disease: a case-control study and meta-analysis. medicine , , – . [crossref] . jguirim-souissi, i.; jelassi, a.; hrira, y.; najah, m.; slimani, a.; addad, f.; hassine, m.; hamda, k.b.; maatouk, f.; rouis, m.; et al. + t/c polymorphism in the ppar-δ gene is associated with risk of coronary artery disease in normolipidemic tunisians. genet. mol. res. , , – . [crossref] . miao, l.; yin, r.-x.; wu, d.-f.; cao, x.-l.; li, q.; hu, x.-j.; yan, t.-t.; aung, l.h.h.; yang, d.-z.; lin, w.-x.; et al. peroxisome proliferator-activated receptor delta + > c polymorphism and serum lipid levels in the guangxi bai ku yao and han populations. lipids health dis. , , – . . rosales-reynoso, m.a.; wence-chavez, l.i.; arredondo-valdez, a.r.; dumois-petersen, s.; barros-núñez, p.; gallegos-arreola, m.p.; flores-martínez, s.e.; sánchez-corona, j. protective role of + t/c (rs ) polymorphism of ppard in mexican patients with colorectal cancer. genet. mol. res. , , – . [crossref] [pubmed] . cook, s.; weitzman, m.; auinger, p.; michael, n.; dietz, w.h. prevalence of a metabolic syndrome phenotype in adolescents. arch. pediatr. adolescent med. , , – . [crossref] [pubmed] . mederico, m.; paoli, m.; zerpa, y.; camacho, n.; cichetti, r.; molina, z.; camachob, n.; cichettib, r.; molinab, z.; mora, y.; et al. valores de referencia de la circunferencia de la cintura e índice de la cintura/cadera en escolares y adolescentes de mérida, venezuela: comparación con referencias internacionales. endocrinol. y nutr. , , – . [crossref] [pubmed] . mokha, j.s.; srinivasan, s.r.; dasmahapatra, p.; fernandez, c.; chen, w.; xu, j.; berenson, g.s. utility of waist-to-height ratio in assessing the status of central obesity and related cardiometabolic risk profile among normal weight and overweight/obese children: the bogalusa heart study. bmc pediatr. , , . . cdc. defining childhood obesity. . available online: https://www.cdc.gov/obesity/childhood/defining. html (accessed on june ). . must, a.; anderson, s.e. body mass index in children and adolescents: considerations for population-based applications. int. j. obes. , , – . [crossref] [pubmed] . world health organization. growth reference - years. . available online: https://www.who.int/ growthref/who _bmi_for_age/en/ (accessed on june ). . national heart lung and blood institute. expert panel on integrated guidelines for cardiovascular health and risk reduction in children and adolescents. . available online: http://www.nhlbi.nih.gov/files/ docs/guidelines/peds_guidelines_full.pdf (accessed on june ). . millán, j.; pintó, x.; muñoz, a.; zúñiga, m.; rubiés-prat, j.; pallardo, l.f.; masana, l.; mangas, a.; hernández-mijares, a.; gonzález-santos, p.; et al. cocientes lipoproteicos: significado fisiológico y utilidad clínica de los índices aterogénicos en prevención cardiovascular. clin. e investig. en arterioscler. , , – . [crossref] . cossrow, n.; falkner, b. race/ethnic issues in obesity and obesity-related comorbidities. j. clin. endocrinol. metab. , , – . [crossref] . anderson, s.e.; whitaker, r.c. prevalence of obesity among us preschool children in different racial and ethnic groups. arch. pediatrics adolesc. med. , , – . [crossref] http://dx.doi.org/ . /sj.ijo. http://dx.doi.org/ . /s - - - http://dx.doi.org/ . /j. - . . .x http://dx.doi.org/ . /j.gene. . . http://dx.doi.org/ . /md. http://dx.doi.org/ . /vol - gmr http://dx.doi.org/ . /gmr http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /archpedi. . . http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /j.endonu. . . http://www.ncbi.nlm.nih.gov/pubmed/ https://www.cdc.gov/obesity/childhood/defining.html https://www.cdc.gov/obesity/childhood/defining.html http://dx.doi.org/ . /sj.ijo. http://www.ncbi.nlm.nih.gov/pubmed/ https://www.who.int/growthref/who _bmi_for_age/en/ https://www.who.int/growthref/who _bmi_for_age/en/ http://www.nhlbi.nih.gov/files/docs/guidelines/peds_guidelines_full.pdf http://www.nhlbi.nih.gov/files/docs/guidelines/peds_guidelines_full.pdf http://dx.doi.org/ . /s - ( ) -x http://dx.doi.org/ . /jc. - http://dx.doi.org/ . /archpediatrics. . genes , , of . taveras, e.m.; gillman, m.w.; kleinman, k.; rich-edwards, j.w.; rifas-shiman, s.l. racial/ethnic differences in early-life risk factors for childhood obesity. pediatrics , , – . [crossref] . salzano, f.m.; sans, m. interethnic admixture and the evolution of latin american populations. genetics mol. biol. , (suppl. ), – . [crossref] . hales, c.m.; carroll, m.d.; fryar, c.d.; ogden, c.l. prevalence of obesity among adults and youth: united states, – ; nchs data brief; ; , pp. – . available online: https://www.cdc.gov/nchs/products/ databriefs/db .htm (accessed on june ). . benítez-hernández, z.p.; hernández-torres, p.; cabañas, m.d.; de la torre-díaz, m.d.l.; lópez-ejeda, n.; marrodán, m.d.; cervantes-borunda, m. composición corporal, estado nutricional y alimentación en escolares tarahumaras urbanos y rurales de chihuahua, méxico. nutr. clínica y dietética hosp. , , – . . salcedo-rocha, a.l.; garcía de alba, j.e.; contreras-marmolejo, m. presión arterial en adolescentes mexicanos: clasificación, factores de riesgo e importancia. rev. de salud pública , , – . . cardoso-saldaña, g.c.; yamamoto-kimura, l.; medina-urrutia, a.; posadas-sánchez, r.; caracas-portilla, n.a.; posadas-romero, c. exceso de peso y síndrome metabólico en adolescentes de la ciudad de méxico. archivos de cardiología de méxico , , – . . jackson, s.l.; zhang, z.; wiltz, j.l.; loustalot, f.; ritchey, m.d.; goodman, a.b.; yang, q. hypertension among youths—united states, – . morb. mortal. wkly. rep. , , – . [crossref] . romero-velarde, e.; campollo-rivas, o.; de la rosa, a.c.; vásquez-garibay, e.m.; castro-hernández, j.f.; cruz-osorio, r.m. factores de riesgo de dislipidemia en niños y adolescentes con obesidad. salud pública de méxico , , – . [crossref] [pubmed] . perea-martínez, a.; bárcena-sobrino, e.; rodríguez-herrera, r.; greenawalt-rodríguez, s.; carbajal-rodríguez, l.; zarco-román, j. obesidad y comorbilidades en niños y adolescentes asistidos en el instituto nacional de pediatría. acta pediátrica de méxico , , – . . camarillo-romero, e.; garcía, m.v.d.; amaya-chávez, a.; huitrón-bravo, g.; majluf-cruz, a. dificultades en la clasificación del síndrome metabólico. el ejemplo de los adolescentes en méxico. salud pública de méxico , , – . [pubmed] . almeida, s.m.; furtado, j.m.; mascarenhas, p.; ferraz, m.e.; ferreira, j.c.; monteiro, m.p.; vilanova, m.; ferraz, f.p. association between lepr, fto, mc r, and pparg- polymorphisms with obesity traits and metabolic phenotypes in school-aged children. endocrine , , – . [crossref] [pubmed] . becer, e.; Çlrakoǧlu, a. effect of the pro ala polymorphism of the peroxisome proliferator-activated receptor γ gene on lipid profile and adipokines levels in obese subjects. balk. j. med genet. , , – . [crossref] . lagou, v.; scott, r.a.; manios, y.; chen, t.l.j.; wang, g.; grammatikaki, e.; kortsalioudaki, c.; liarigkovinos, t.; moschonis, g.; roma-giannikou, e.; et al. impact of peroxisome proliferator-activated receptors γ and δ on adiposity in toddlers and preschoolers in the genesis study. obesity , , – . [crossref] . akhmetov, i.; astranenkove, i.; togozkin, v. association of ppard gene polymorphism with human physical performance. mol. biol. , , – . . shin, h.d.; park, b.l.; kim, l.h.; jung, h.s.; cho, y.m.; moon, m.k.; park, y.j.; lee, h.k.; park, k.s. genetic polymorphisms in peroxisome proliferator-activated receptor δ associated with obesity. diabetes , , – . [crossref] . hasan, n.s.; kamel, s.a.; hamed, m.; awadallah, e.; rahman, a.h.a.; musa, n.i.; hussein, g.h.s. peroxisome proliferator-activated receptor-γ polymorphism (rs ) is associated with obesity in egyptian patients with coronary artery disease and type diabetes mellitus. j. genet. eng. biotechnol. , , – . [crossref] . hasstedt, s.j.; ren, q.f.; teng, k.; elbein, s.c. effect of the peroxisome proliferator-activated receptor-γ pro ala variant on obesity, glucose homeostasis, and blood pressure in members of familial type diabetic kindreds. j. clin. endocrinol. metab. , , – . [crossref] . douglas, j.a.; erdos, m.r.; watanabe, r.m.; braun, a.; johnston, c.l.; oeth, p.; mohlke, k.l.; valle, t.t.; ehnholm, c.; buchanan, t.a.; et al. the peroxisome proliferator-activated receptor-γ pro ala variant association with type diabetes and trait differences. diabetes , , – . [crossref] [pubmed] http://dx.doi.org/ . /peds. - http://dx.doi.org/ . /s - https://www.cdc.gov/nchs/products/databriefs/db .htm https://www.cdc.gov/nchs/products/databriefs/db .htm http://dx.doi.org/ . /mmwr.mm a http://dx.doi.org/ . /s - http://www.ncbi.nlm.nih.gov/pubmed/ http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /s - - - http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /bjmg- - http://dx.doi.org/ . /oby. . http://dx.doi.org/ . /diabetes. . . http://dx.doi.org/ . /j.jgeb. . . http://dx.doi.org/ . /jcem. . . http://dx.doi.org/ . /diabetes. . . http://www.ncbi.nlm.nih.gov/pubmed/ genes , , of . rodríguez-esparragón, f.j.; rodríguez-pérez, j.c.; macías-reyes, a.; alamo-santana, f. peroxisome proliferator-activated receptor-gamma -pro ala and endothelial nitric oxide synthase- a/b gene polymorphisms are associated with essential hypertension. j. hypertens. , , – . [crossref] [pubmed] . al-safar, h.; hassoun, a.; almazrouei, s.; kamal, w.; afandi, b.; rais, n. association of the genetic polymorphisms in transcription factor -like and peroxisome proliferator-activated receptors-γ with type diabetes mellitus and its interaction with obesity status in emirati population. j. diabetes res. , , . [crossref] . hu, c.; jia, w.; fang, q.; zhang, r.; wang, c.; lu, j.; xiang, k. peroxisome proliferator-activated receptor (ppar) delta genetic polymorphism and its association with insulin resistance index and fasting plasma glucose concentrations in chinese subjects. diabet. med. , , – . [crossref] . ye, h.; li, y.; hong, q.; zhou, a.; zhao, q.; xu, l.; xu, m.q.; xu, x.t.; tang, l.l.; dai, j.; et al. positive association between ppard rs polymorphism and coronary heart disease in a han chinese population. genet. mol. res. , , – . [crossref] [pubmed] . sözen, m.a.; Özcan, m.u.; Çıldır, m.; doğru, i.h.; aygök, a.g.; balkan, k. association of the human pparγ pro ala polymorphism with obesity in a population from turkey. acta endocrinol. , , – . . meirhaeghe, a.; fajas, l.; helbecque, n.; cottel, d.; auwerx, j.; deeb, s.s.; amouyel, p. impact of the peroxisome proliferator activated receptor γ pro ala polymorphism on adiposity, lipids and non-insulin-dependent diabetes mellitus. int. j. obes. , , – . [crossref] . masud, s.; ye, s. effect of the peroxisome proliferator activated receptor-y gene pro ala variant on body mass index: a meta-analysis. j. med. genetics , , – . [crossref] . mansoori, a.; amini, m.; kolahdooz, f.; seyedrezazadeh, e. obesity and pro ala polymorphism of peroxisome proliferator-activated receptor-gamma gene in healthy adults: a systematic review and meta-analysis. ann. nutr. metab. , , – . [crossref] . luo, w.; guo, z.; wu, m.; hao, c.; hu, x.; zhou, z.; zhou, z.; yao, x.; zhang, l.; liu, j. association of peroxisome proliferator-activated receptor α/δ/γ with obesity, and gene-gene interaction, in the chinese han population. j. epidemiol. , , – . [crossref] © by the authors. licensee mdpi, basel, switzerland. this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc by) license (http://creativecommons.org/licenses/by/ . /). http://dx.doi.org/ . / - - http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . / / http://dx.doi.org/ . /j. - . . .x http://dx.doi.org/ . / .june. . http://www.ncbi.nlm.nih.gov/pubmed/ http://dx.doi.org/ . /sj.ijo. http://dx.doi.org/ . /jmg. . . http://dx.doi.org/ . / http://dx.doi.org/ . /jea.je http://creativecommons.org/ http://creativecommons.org/licenses/by/ . /. introduction materials and methods study population phenotyping genotyping statistical analysis results population characteristics and metabolic traits among them pro ala ppar- and + t/c ppar- metabolic traits by pro ala ppar- and + t/c ppar- polymorphism genotype: major allele homozygous vs. minor allele carriers in the total studied population association between pro ala ppar- and metabolic traits association between + t/c ppar- and metabolic traits logistic regression discussion study limitations conclusions references the molecular basis of human -methylcrotonyl-coa carboxylase deficiency matthias r. baumgartner, … , e. regula baumgartner, david valle j clin invest. ; ( ): - . https://doi.org/ . /jci . isolated biotin-resistant -methylcrotonyl-coa carboxylase (mcc) deficiency is an autosomal recessive disorder of leucine catabolism that appears to be the most frequent organic aciduria detected in tandem mass spectrometry–based neonatal screening programs. the phenotype is variable, ranging from neonatal onset with severe neurological involvement to asymptomatic adults. mcc is a heteromeric mitochondrial enzyme composed of biotin-containing α subunits and smaller β subunits. here, we report cloning of mcca and mccb cdnas and the organization of their structural genes. we show that a series of mcc-deficient probands defines two complementation groups, cg and , resulting from mutations in mccb and mcca, respectively. we identify five mcca and nine mccb mutant alleles and show that missense mutations in each result in loss of function. article find the latest version: https://jci.me/ /pdf http://www.jci.org http://www.jci.org/ / ?utm_campaign=cover-page&utm_medium=pdf&utm_source=content https://doi.org/ . /jci http://www.jci.org/tags/ ?utm_campaign=cover-page&utm_medium=pdf&utm_source=content https://jci.me/ /pdf https://jci.me/ /pdf?utm_content=qrcode introduction mcc (ec . . . ) is a biotin-dependent carboxylase that catalyzes the fourth step in the leucine catabolic path- way. isolated, biotin-resistant mcc deficiency (also known as methylcrotonylglycinuria [mim ]) is inherited as an autosomal recessive trait ( ). the clinical phenotype is highly variable: some patients present in the neonatal period with seizures and muscular hypoto- nia ( , ); others are asymptomatic women identified only by detection of abnormal metabolites in the neona- tal screening samples of their healthy babies ( ). there is a characteristic organic aciduria with massive excretion of -hydroxyisovaleric acid and -methylcrotonylglycine, usually in combination with a severe secondary carnitine deficiency. mcc activity in extracts of cultured fibrob- lasts of patients is usually less than % of control. no correlation between the level of residual enzyme activity and clinical presentation has been observed. tandem mass spectrometry (ms/ms), recently intro- duced for newborn screening, provides for the first time to our knowledge a way to detect a large variety of organ- ic acidurias including mcc deficiency ( ). surprisingly, mcc deficiency appears to be the most frequent organ- ic aciduria detected in ms/ms screening programs in north america ( , , ), europe ( ), and australia ( ), with an overall frequency of approximately in , . mcc is a member of the family of biotin-dependent carboxylases, a group of enzymes with diverse meta- bolic functions but common structural features ( , ). members of this family have three structurally con- served functional domains: the biotin carboxyl carrier domain, which carries the biotin prosthetic group; the biotin carboxylation domain, which catalyzes the car- boxylation of biotin; and the carboxyltransferase domain, which catalyzes the transfer of a carboxyl group from carboxybiotin to the organic substrate spe- cific for each carboxylase ( , ). in addition to mcc, there are three other biotin-dependent carboxylases in humans: propionyl-coa carboxylase (pcc), pyruvate carboxylase (pc), and acetyl-coa carboxylase (acc) ( , ). the genes for all human carboxylases except mcc have been cloned and characterized ( – ). mcc carboxylates -methylcrotonyl-coa at the - carbon to form -methylglutaconyl-coa (figure ) ( ). the reaction uses atp and bicarbonate and is reversible. bovine mcc has an approximate size of kda and appears to comprise six heterodimers (αβ) ( ). like pcc, mcc has a larger α subunit, which covalently binds biotin, and a smaller β subunit ( ). mcc is predominantly localized to the inner mem- brane of mitochondria and is known to be highly expressed in kidney and liver ( ). cdnas encoding both subunits of mcc recently have been cloned in ara- bidopsis thaliana and other plants ( , ). here we report cloning of human mcca and mccb cdnas, confirmation of their identity by biochemical and molecular studies, and identification of mutations in mcc-deficient patients. the journal of clinical investigation | february | volume | number the molecular basis of human -methylcrotonyl-coa carboxylase deficiency matthias r. baumgartner, , shlomo almashanu, , terttu suormala, cassandra obie, , robert n. cole, seymour packman, e. regula baumgartner, and david valle , mckusick-nathans institute of genetic medicine, johns hopkins university, baltimore, maryland, usa metabolic unit, children’s hospital, university of basel, basel, switzerland howard hughes medical institute, and department of biological chemistry, johns hopkins university, baltimore, maryland, usa department of pediatrics, university of california, san francisco, california, usa address correspondence to: david valle, pctb, johns hopkins university, n. wolfe street, baltimore, maryland , usa. phone: ( ) - ; fax: ( ) - ; e-mail: dvalle@jhmi.edu. received for publication december , , and accepted in revised form january , . isolated biotin-resistant -methylcrotonyl-coa carboxylase (mcc) deficiency is an autosomal recessive disorder of leucine catabolism that appears to be the most frequent organic aciduria detected in tandem mass spectrometry–based neonatal screening programs. the phenotype is variable, ranging from neonatal onset with severe neurological involvement to asymptomatic adults. mcc is a heteromeric mitochondrial enzyme composed of biotin-containing α subunits and smaller β subunits. here, we report cloning of mcca and mccb cdnas and the organiza- tion of their structural genes. we show that a series of mcc-deficient probands defines two complementation groups, cg and , resulting from mutations in mccb and mcca, respective- ly. we identify five mcca and nine mccb mutant alleles and show that missense mutations in each result in loss of function. j. clin. invest. : – ( ). the journal of clinical investigation | february | volume | number methods patients, complementation analysis, and mcc assay this study includes mcc-deficient probands, all of whom had the diagnostic pattern of organic acid excre- tion and less than % mcc activity in extracts of cul- tured skin fibroblasts. clinical and biochemical data of ten patients have been reported in the literature: ( ), ( ), ( ), ( ), ( ), ( ), ( ), ( ), ( ), and ( ). fibroblasts or dna of the remaining patients were referred by b.t. poll-the (patient ), h.g. koch (patient ), j. smeitink (patient ), u. von döbeln (patient ), r.d. de kre- mer dodelson (patient ), and d.h. morton (patient ). skin fibroblasts were cultured in eagle’s minimal essential medium (life technologies inc., rockville, maryland, usa) supplemented with mmol/l l-gluta- mine and % fcs. complementation analysis was modified from that described by wolf et al. ( ). briefly, we produced heterokaryons by a - or -second treatment with % peg harvested the cells days later and measured mcc activity as described previously ( , ). mcc activity in cultures of mixed but unfused cells was subtracted as blank and self fusions were included as a negative control. expression of biotin-containing proteins in fibroblasts we harvested cultured fibroblasts by trypsinization, disrupted the washed cells by homogenization, har- vested the mitochondria by differential centrifugation ( ), suspended them in sds-buffer ( mm tris- acetate, % sds [wt/vol], mm dtt, . % [wt/vol] bromphenol blue), and dissolved the proteins by boil- ing for minutes. the cellular proteins were separated by sds-page, and the biotin-containing proteins were detected with an avidin alkaline phosphatase conjugate (avidin-ap, : , ; bio-rad laboratories ag, glat- tbrugg, switzerland). fibroblasts of an unaffected control, a patient with isolated pc deficiency, and a patient with isolated pccα deficiency were used to confirm the identity of the protein bands. cdna cloning, sequence analysis, and chromosome mapping we obtained two mouse (ai and ai ) and two human (aa and aa ) mcca est clones, and one human mccb (ai ) est clone from the image consortium (genome systems inc., st. louis, missouri, usa) and sequenced both strands with an abi automated sequencer. to design primers corresponding to the ′ utr of our putative mcca, we used the sequence of the mcca est clone aa (not available commercially). we used primers dv (sense, ′-gacgcagctgcctctg tac) and dv (sense, ′-tggccgggctccagggacatg), complementary to the ′ utr, and dv (antisense, ′-aactgctctttatgagacccc), complementary to the ′ utr, to amplify full-length human mcca from a human retina cdna library ( ); and primers dv (sense, ′-aggacctgagctcagcttcc) and dv (sense, ′-tcggtgcccgccgccatg), complementary to the ′ utr, and dv (antisense, ′-actg- taacagcctcatgttcg), complementary to the ′ utr, to amplify full-length human mccb from the same human retina cdna library ( ). we gel-purified the pcr products and sequenced them directly. the sequence alignments were prepared with megalign (dnastar inc., madison, wisconsin, usa). we mapped hsmcca using the genebridge radia- tion hybrid panel (research genetics inc., huntsville, alabama, usa) using primers dv (sense, ′- tttgtcgtctcagactcgatg) and dv (antisense, ′-agtcagaaaaataaggccaacc) corresponding to ′ flanking intronic sequence of exon and ′ flanking intronic sequence of exon . isolation and mass spectrometry analysis of biotin- containing proteins enrichment for biotin-containing proteins. we homogenized . g of flash frozen male mouse kidney in . ml buffer a ( mm tris-hcl [ph . ], mm dtt, mm edta, . % (vol/vol) triton x- , % (vol/vol) glycerol, µm dmsf, tablet cocktail protease inhibitor (boehringer-mannheim) and centrifuged the homogenate at , g for minutes at °c. peg was added to the supernatant to a final concentration of % (wt/vol), and the mixture was centrifuged at , g for minutes at °c. the pellet was resus- pended in ml of buffer a, approximately × pre- washed m streptavidin dynabeads (dynal inc., lake success, new york, usa) were added, and the slur- ry mixed by rotating for hour at °c. we washed the beads five times with buffer b ( . m kcl in buffer a), resuspended them in µl of xi protein loading buffer, boiled for minutes, and placed the solution on ice. we loaded µl in each lane of a % polyacry- lamide gel and stained the separated proteins with coomassie brilliant blue r . s-carboxymethylation and proteolytic digestion. we per- formed in gel digestion of the proteins using the coomassie blue–stained sds-polyacrylamide gels according to williams et al. ( ) with the following modifications. cystines were modified by car- boxymethylation as described elsewhere ( ). after rehydrating gel pieces with ng/µl tpck-treated trypsin in % acetic acid, excess trypsin solution was removed and the gel piece was covered with gel vol- umes of mm nh hco (ph ), at °c for hours. the resulting tryptic peptides were extracted from the gel piece with % acetonitrile in . % tfa and concentrated by drying. mass spectrometry analysis. tryptic peptides were resus- pended in % acetic acid and loaded into a fused silica capillary column ( µm inner diameter) packed with cm of µm c reverse-phase resin (ymc inc., atlanta, georgia, usa) as described elsewhere ( ). a -minute, . – % methanol gradient in % acetic acid was applied to the column at f low rates of – nl/min. eluting peptides were electrosprayed directly into a finnigan lcq atmospheric pressure ionization quadrupole ion trap mass spectrometer (thermoquest corp., san jose, california, usa). pos- itive-ion mass spectra were obtained at using xcal- ibur software (thermoquest corp.). peptides were fragmented by a % collision energy using a two- atomic-mass-unit isolation width. fragmentation data were screened against the protein.nrdb.z data- base from the frederick biomedical supercomputing center (ftp://ftp.ncifcrf.gov/pub/nonredun/) using the sequest browser ( ) (thermoquest corp.). mutation analysis by rt-pcr and genomic pcr we extracted rna and genomic dna from cultured skin fibroblasts and/or blood using the puregene rna and dna isolation kits (gentra systems, minneapolis, minnesota, usa) and performed rt-pcr using – µg fibroblast rna and a cdna cycle kit (invitrogen corp., carlsbad, california, usa) following the manu- facturers’ recommendations. we generated first-strand cdna with primers dv (antisense, ′-gacc- caaatgcatgattctcc), complementary to sequence in the mcca ′ utr region, and dv (antisense, ′-ggtagaaaagtacaa tgcacag), complementary to sequence in the mccb ′ utr region. we then ampli- fied first-strand mcca cdna with primers dv and dv to generate a , -bp fragment (– to + , where + is the a of the initiation methionine codon); and we amplified first-strand mccb cdna with primers dv and dv to generate a , - bp fragment (– to + ). in some instances, when the amount of amplified product was inadequate, we went through a second round of pcr with nested primers dv and dv . we gel-purified the pcr products and sequenced them directly. to confirm mutations identified in rt-pcr products, we amplified a genomic fragment containing the corre- sponding exon using flanking intronic primers and sequenced the pcr product directly. in the compound heterozygous patients in whom we identified only one of two alleles in rt-pcr products, we amplified and sequenced all exons and flanking intronic sequences. all pcr reactions ( µl) contained primers ( ng each), × standard pcr buffer (life technologies inc.), dntps ( µm), and taq polymerase ( . u; life tech- nologies inc.). the sequences of all primers are available upon request. to survey a control population for the identified mis- sense mutations, we amplified the relevant exon from genomic dna and performed allele-specific oligonu- cleotide analysis as described previously ( ). construction of wild-type and mutant human mcca/b expression vectors we ta cloned the full-length human mcca (– to + ) and mccb (– to + ) cdnas into pcr blunt ii topo (invitrogen corp.). to introduce the mcca mutations r s, a v, and l p, we har- vested an -bp acci fragment from rt-pcr–ampli- fied patient cdna and subcloned this fragment into the pmcca-topo construct. we then transferred the wild-type and mutant mcca constructs into a mam- malian expression vector (ptracer-cmv ; invitrogen- corp.) at the ecor i site. this vector contains a green fluorescent protein (gfp) gene fused to the zeocin resistance gene. similarly, to introduce the mccb mis- sense mutation e q, we harvested a -bp econ i/bste ii fragment from rt-pcr amplified patient cdna, subcloned this fragment into the pmccb- topo construct and then transferred the wild-type and mutant constructs into ptracer-cmv . to intro- duce the mccb missense mutations s l, v m, r c, p r and r c, we harvested a -bp bste ii/sfi i fragment from rt-pcr–amplified patient cdna and subcloned this fragment directly into mccb-ptracer-cmv . we sequenced all constructs in both directions to validate the sequences. transfections we transformed primary fibroblasts from proband (homozygous for mcca q fs(+ ), from proband (homozygous for mccb s l), and from a con- trol as described previously ( ). for expression stud- ies, we electroporated the indicated constructs into transformed cells as described elsewhere ( ). we har- vested the cells after hours and measured mcc and pcc activity radioisotopically as described previously ( ). our standard mcc assay enables us to reliably detect activity as low as – pmol/min/mg protein. all the journal of clinical investigation | february | volume | number figure the mcc-catalyzed reaction and its position in the leucine catabol- ic pathway. the dashed arrow indicates the metabolites that accu- mulate due to deficiency of mcc. the journal of clinical investigation | february | volume | number transfections were in duplicates. transformed fibrob- lasts from an unaffected individual were used as con- trol. transfection efficiency was assessed by coexpress- ing gfp in the same construct. results genetic complementation and assignment to mcca or mccb as an initial step in defining the molecular basis of mcc deficiency, we performed biochemical and somatic cell genetic studies with fibroblasts from mcc-deficient probands. using restoration of mcc activity in peg-induced heterokaryons of fibroblasts as an end point, we defined two complementation groups (cgs), one comprising eight probands (mcc- cg , - ) and the other, six probands (mcc- cg , - ) (data available upon request). given that mcc is composed of αβ heteromers, we antici- pated that the two cgs likely corresponded to muta- tions in genes encoding the α and β subunits of mcc (encoded by mcca and mccb, respectively). to investigate the complementation phenotype at the protein level, we examined the expression of the mccα subunit using the covalently bound biotin as a tag in fibroblasts of five of six cg and in all of the eight cg probands (figure ). in cg , mccα was not detected in four of five probands, whereas in the remaining cg cell line (proband ), the mccα band was at least as intense as in controls (figure ). in all the cg cell extracts, mccα was reduced but present. these results suggested that mcc-cg is caused by mutations in mcca and, by exclusion, mcc-cg , by mutations in mccb. identification of mammalian candidate mcca and mccb cdnas database search. we used the amino acid sequences of a. thaliana mcca and mccb ( , ) and the tblastn algorithm to probe the public est data- bases to identify murine and human cdnas encoding candidate mccas and mccbs. we used the murine candidates to assemble full-length mouse putative mcca cdna (genbank accession number: mmmc- ca: af ) and the human candidate ests to design primers corresponding to the predicted ′ and ′ utr of the putative human mcca and mccb cdnas. using these primer pairs, we amplified a sin- gle fragment of the predicted size for both mcca and mccb from a human retina cdna library ( ). gen- bank accession numbers: hsmcca: af . hsm- ccb: af . we used additional ests to extend the ′ and ′ utr sequences. the sequence of the human mcca candidate has bp of ′ utr, a , -bp orf, and bp of ′ utr extending to a polyadenylation signal (aauaaa). the murine can- didate mcca cdna has bp of ′ utr, a , -bp orf, and bp of ′ utr extending to a probable polyadenylation signal (auaaa). the sequence of the amplified human mccb candidate has bp of ′ utr, a , -bp orf, and bp of ′ utr. the candidate cdnas predict a human mccα of amino acids with a calculated molecular mass of kda, a mouse mccα of amino acids with a calcu- lated molecular mass of kda, and a human mccβ of amino acids with a calculated molecular mass of kda. human mccα has % and % identity to mccα of mouse and a. thaliana, respectively (figure a). human mccβ has % identity to mccβ of a. thaliana (figure b). similar to pcc, the mccα subunit contains an nh -terminal biotin carboxylation domain and a cooh-terminal biotin carrier domain ( ). the biotin carrier domain is centered on the motif amkm, which is found in most biotinylated proteins (figure a) ( ). biotin is covalently attached to the ε-amino group of lysine ; the ε-biotinyl lysine amide is termed biocytin (figure a). as with other biotin- dependent carboxylases, there is a conserved (a)pm motif residues nh -terminal and a hydrophobic residue (f ) - residues cooh-terminal of bio- cytin ( ). the biotin carboxylation domain is located in the nh -terminal two-thirds of mccα and is linked to the biotin carrier domain by a less-conserved (only % identity to a. thaliana residues - ) “hinge” region of residues - . additionally, there is per- fect conservation of residues (figure a, asterisks) that are highly conserved among all biotin-dependent figure expression of the biotin-containing mccα subunit in fibroblasts. proteins in mitochondrial enriched fractions from cultured fibrob- lasts were separated by sds-page, and the biotin-containing sub- units of mcc, pcc, and pc were detected with an avidin alkaline phosphatase conjugate. most, but not all, cg -probands lack the mccα subunit, while it is detectable in all cg probands. the journal of clinical investigation | february | volume | number figure sequence alignment of human mccα and mccβ with orthologs from mouse and a. thaliana. amino acids identical to the human sequence are highlighted. missense mutations identified in mcc-defi- cient patients are indicated above with the substituted amino acid. potential cleavage sites for the nh -terminal mitochondrial leader sequences are indicated by vertical arrowheads. (a) sequence align- ment of human, mouse, and a. thaliana mccα. the predicted atp- binding site in the nh -terminal biotin carboxylation domain and the predicted cooh-terminal biotin carboxyl carrier domain are indicated by solid and dashed over- lines, respectively. the arrow indi- cates the lysine residue that links covalently to biotin (biocytin). the residues marked with an asterisk within the biotin carboxylation domain are thought to play an important role in catalysis ( , ). (b) sequence alignment of human and a. thaliana mccβ. the putative -methylcrotonyl-coa binding domain is indicated by a solid over-line. the journal of clinical investigation | february | volume | number figure coomassie-stained sds-page gel of biotin-containing proteins puri- fied from a mouse kidney extract with streptavidin dynabeads. we excised the proteins from the gel, digested with trypsin, and analyzed the tryptic peptides using maldi-tof and liquid chromatography coupled to esi-ms/ms. we analyzed all the indicated bands includ- ing those that we identified as mccα and β. carboxylases and thought to play a role in catalysis ( , , ). consistent with this prediction, the putative carboxylation domain contains the conserved sequence ggggkgmriv at positions - (figure a), which is part of the atp binding pocket in the biotin carboxylation domain of escherichia coli acc ( ) and is similar to a consensus p-loop atp-binding site [g′xgk(ts)] ( ). the β subunit has a putative coa binding motif (figure b) ( , ). mccα and β have candidate nh -terminal mito- chondrial targeting sequences with multiple arginine residues and a paucity of acidic residues ( ). possible cleavage sites are indicated by vertical arrowheads in figure . because the sequence of mitochondrial lead- ers is not highly conserved, we favor the more cooh- terminal cleavage site in mccα just before a highly conserved region (figure a). isolation and mass spectrometry analysis of biotin-contain- ing proteins. we also used a biochemical strategy to identify mccα and β. we enriched biotin-containing proteins in a mouse kidney extract using streptavidin dynabeads and separated these by sds-page (figure ). using maldi-tof and electrospray ionization mass spectrometry (esi-ms/ms), we analyzed tryptic fragments of these proteins to confirm the identity expected on the basis of the size of acc, pc, and pccβ. the analysis of the expected pccα identified, in addition to fragments derived from pccα, unique fragments corresponding to the conceptual transla- tion of the putative murine mcca cdna (figure ). we identified peptides with % identity to the putative murine mccα subunit covering amino acids or % of the putative full-length murine mccα. the protein comigrating with the -kda marker (fig- ure ) contained tryptic fragments with sequences cor- responding to the conceptual translation of the puta- tive human mccb cdna. we identified peptides with % identity to the putative human mccβ sub- unit covering amino acids or % of the putative full-length mccβ. these sequence results strongly supported the identity of the mammalian mcca and mccb cdnas. organization of human mcca and mccb structural genes during the course of determining the structural organization of these genes by long-range pcr and direct sequencing, we identified sequences correspon- ding to mcca and mccb in the human high through- out genome sequence database (genbank accession numbers ac and ac , respectively). these clones contain exons encoding the complete mcca and mccb cdnas and provide all exon/intron boundaries including the flanking intronic sequences with one exception ( ′ flanking intronic sequence of mcca exon ). mcca has exons and mccb exons. given that the draft sequence has gaps, our information on the size of some introns is incomplete. because the mcca gene was not mapped in the uni- gene database, we searched the flanking sequence in the bac clone containing mcca for other mapped genes. we identified the unigene cluster hs. represented by several ests present in the mcca genomic clone and localized to q -q (d s - d s ). to confirm this localization, we used the genebridge radiation hybrid panel to regionally localize mcca . cr from the wi- marker cor- responding to the same region on chromosome . similarly, we identified unigene cluster hs. representing several est clones covering the ′ end of the mccb cdna. this cluster maps to chromosome q -q . (d s -d s ). patients with isolated mcc deficiency have mutations in mcca or mccb to confirm the identity of mcca and mccb, we sur- veyed these genes for mutations in our collection of unrelated mcc-deficient probands. we grouped the probands according to their cgs and used rt-pcr to amplify the corresponding mrna from their cultured skin fibroblasts. we sequenced the entire orf in each proband and confirmed all mutations by direct sequencing of pcr-amplified genomic dna. in two additional probands ( and ) (ref. ) from the amish/mennonite population in lancaster county, pennsylvania, we searched for mutations by direct sequencing of pcr-amplified genomic dna. we iden- tified five mcca mutant alleles in cg cell lines accounting for ten of possible mutant mcca genes (table ). the mutations include three uncomplicated missense mutations (figure a), one missense mutation that alters splicing (figure a), and one -bp insertion. in cg cell lines, we identified nine mccb mutant alle- les accounting for of possible mutant genes (table ). the mutations include uncomplicated missense mutations (figure b), one missense mutation that alters splicing (figure b), one splice site mutation, and one -bp insertion. in spite of sequencing all exons and flanking intronic sequences (with the exception of the alleles has a low frequency in this population. we did not screen for alleles for which we did not have the appropriate control population (vietnamese, mccb- r q, -p r; turkish, mccb-s l, -v m). discussion using a combination of homology probing and mass spectrometry we cloned human mcca and mccb full length cdnas. the conceptual translation of mcca shows the expected nh -terminal biotin carboxylation domain and the cooh-terminal biotin carboxyl carrier domain (figure a), separated by a less conserved “hinge” region ( , ). presumably because of differ- ences in substrate specificities, carboxyltransferase domains are less conserved among biotin-dependent carboxylases. mcc catalyzes the carboxylation of methylcrotonyl-coa ( ). the acceptor binding site is thought to be on mccβ ( , ). consistent with this, human mccβ shares high identity with a. thaliana mccβ ( %) and only % identity with human pccβ ( ) that supports the role of the β subunit in determin- ing substrate specificity of these enzymes (figure b). our series of mcca- and mccb-deficient ′ flanking intronic sequence of mcca exon ), we were not able to identify a second allele in two cg and four cg probands. in five of these probands, the one allele identi- fied appeared to be homozygous in the rt-pcr product, but was clearly heterozygous in genomic dna, sug- gesting that the steady level of mrna from the second allele was not detectable as would be the case for a promoter mutation or an intra- genic deletion or insertion missed by genomic pcr. these results strong- ly support the identification of the mcca and mccb genes and their assignment to mcc deficiency in cg and cg , respectively. expression of mcca and mccb alleles as a final test of the identity of our candidate human mcca and mccb cdnas, we subcloned them into a mammalian expression vector (ptracer-cmv ), electroporated the recombinant constructs into a sv t transformed reference cg or cg cell line, and measured mcc activity hours later ( ). as a ref- erence, we also measured pcc activ- ity ( ). wild-type mcca and mccb alleles restored mcc activity to % and % of untransfected control fibroblasts, respectively (table ). transfection efficiency, assessed by scoring a subset of cells in each transfection for the presence of the coexpressed gfp, ranged from to % in these experiments. similarly, to test the functional consequences of the missense mutations, we expressed three mcca and six mccb missense alleles. mccb-r c and -v m had activity of and pmol/min/mg protein, respectively, or about % of the activity produced by the wild-type allele, whereas the remaining four mccb alleles and the three mcca alleles produced no detectable activity (table ). these results confirm the deleterious func- tional consequences of the tested missense mutations. population frequency of selected mcca and mccb alleles additionally, we used allele-specific oligonucleotide analysis ( ) to survey a north american control popu- lation of individuals for three mcca alleles (r s, a v, and l p) and two mccb alleles (e q and r c). aside from one individual heterozygous for r s, we did not identify any of these alleles in this collection of control chromosomes (data not shown). these results indicate that each of these mutant the journal of clinical investigation | february | volume | number figure mcca and b missense mutations that alter splicing. (a) mcca d h. the g→c trans- version of the last bp of exon results in the missense mutation d h. the ′ base of an exon also contributes to donor splice site recognition and, as shown in the lower panel, rt-pcr of mcca cdna in this patient with primers corresponding to the ′ and ′ utr resulted in a product smaller than in wild-type. sequence analysis of this product showed that exon ( bp) is skipped, which shifts the reading frame. thus, the deleterious consequences of this mis- sense mutation appear to be entirely due to the splicing defect. (b) mccb i v. as shown in the upper panel, the a→g transition in exon results in the replacement of isoleucine by valine, a conservative change. however, the mutation also activates a cryptic splice donor. use of this new donor splice site deletes the last bp of exon from the mature transcript. as shown in the lower panel, direct sequencing of the rt-pcr product shows that virtually all the transcript present uses the new, more ′ splice donor. the second allele of this compound heterozygous patient does not produce detectable rna. wt, wild-type; mut, mutant. the journal of clinical investigation | february | volume | number probands is characterized by the fact that almost every proband had a unique genotype with no prevalent mutant allele for either gene. in agreement with this observation, using allele-specific oligonucleotide analy- sis to screen north american controls ( chro- mosomes), we found only a single heterozygote from one allele (mcca-r s) and no carriers for the others tested (mcca-a v, -l p; mccb-e q, -r c). for mcca, we assume functional significance for the frameshift mutation q fs(+ ) and the missense mutation d h, which alters splicing (figure a), because both result in truncated proteins lacking func- tionally important domains. the mcca mutations r s, a v, and l p all change conserved residues (figure a), and the corresponding alleles con- fer no detectable mcc activity when expressed in the cg reference cell line (table ). in contrast to the other four cg probands tested, who had no detectable mccα, we detected normal amounts of mccα protein in the proband homozygous for r s (figure ). this result is consistent with the pre- diction based on the structure of the biotin carboxyla- tion domain of e. coli acc that the residue correspon- ding to mccα r is part of a positively charged pocket for bicarbonate binding ( , ). for mccb, we assume functional significance for the frameshift mutation s fs(+ ), the splice site muta- tion in ac- g→a and the missense mutation i v, which alters splicing (figure b). the remaining six mccb missense mutations all change conserved residues and were the only coding alterations we found in sequencing the full-length orf (figure b). in expression studies, we showed that the mccb-r q, -p r, -s l, and -e q alleles had no detectable mcc activity, whereas mccb-v m and -r c had some residual activity, about % of the experimental control value (table ), when expressed in cg -deficient reference cell lines. we identified v m in two com- pound heterozygous turkish probands (table ), the only patients in our collection with residual mcc activity in fibroblasts. although % residual activity is at the detec- tion limit of the standard mcc assay we used for the expression studies ( ), these results are in accordance with the residual activity detect- ed in fibroblasts of these patients with a modi- fied mcc assay of increased sensitivity ( , ). mccα was reduced, but clearly present, in all cg cell lines in our biochemical detection of the biotin-containing α subunit (figure ). this suggests that the mccα subunit is less stable when the β subunit is absent or defective. interestingly, we detected the mccβ s fs(+ ), a t insertion, as one allele in a mild- ly affected swiss compound heterozygote ( ) and in an asymptomatic mennonite homozy- gote from lancaster county, pennsylvania (table ). the ancestors of the lancaster county amish/men- nonite population originated from switzerland ( ) and may have brought this allele with them. haplotype analysis will be necessary to confirm a founder muta- tion. moreover, the amish proband is homozygous for a different mccb allele, e q. thus, despite the small size and common origins of the amish/mennonite population in this region, there is allelic heterogeneity for mcc deficiency. combining our results and the published clinical reports ( – , – ), we were not able to discern a phenotype-genotype correlation. probands and , homozygous for truncating mutations in mcca or mccb (tables and ), have, in one case, no symp- toms and, in the other, a mild phenotype with late onset and no residual damage ( ). by contrast, probands , , and , homozygous for mis- sense mutations mcca-r s, mccb-s l, and - e q, have a severe phenotype with early-onset, major neurological involvement and, in one case, a fatal outcome (table ) ( , , ). proband , an adult amish patient homozygous for the same mccb-e q, has only mild symptoms ( ). further- more, the two turkish patients with mccb-v m that have some residual mcc activity both have a severe phenotype. taken together, these results sug- gest that factors other than the genotype at the table mccb mutant alleles no. allele exon nucleotide clinical ethnic proband change phenotypea origin r q g→a mild vietnamese p r c→g mild vietnamese s fs(+ ) inst mild swiss/mennoniteb c, d i v a→ge mild dutch c r c c→t mild dutch in ac- g→a in ac- g→a mild dutch s l c→t severe turkish d e q g→c severe/mild turkish/amish d, d v m g→a severe turkish c, c amild: late onset, good recovery after acute attack, no or mild developmental delay; severe: onset in infancy, severe neurological involvement with severe developmental delay. bdetect- ed by newborn screening. conly one allele identified. dhomozygous. eactivates cryptic splice donor (figure b). table mcca mutant alleles no. allele exon nucleotide clinical ethnic proband change phenotypea origin r s a→c severe german b q fs(+ ) insg mild swedish/amer. c, b a v c→t mild american c d h g→cd severe turkish b l p t→c severe argentine b amild: late onset, good recovery after acute attack, no or mild developmental delay; severe: onset in infancy, severe neurological involvement with severe developmental delay. bhomozygous. conly one allele identified. dalters splicing (figure a). the journal of clinical investigation | february | volume | number mcca and mccb loci (modifying genes, environ- mental variables) must have a major influence on the phenotype of mcc deficiency. since the widespread introduction of ms/ms to new- born screening, many new patients with mcc defi- ciency have been detected. surprisingly, mcc deficien- cy appears to be the most frequent organic aciduria in these screening programs ( , – ) with an overall fre- quency of approximately in , . studies of these prospectively identified individuals should provide insight into the factors that determine the phenotypic severity of mcc deficiency. note added in proof. we have recently learned that the molecular basis of mcc deficiency has also been identi- fied by gallardo et al. ( , am. j. hum. genet. : ). acknowledgments we thank a. kohlschütter, u. von döbeln, s. berry, j. smeitink, r.d. de kremer dodelson, w. lehnert, u. wiesmann, u. wendel, w.j. kleijer, b. steinmann, b.t. poll-the, d.h. morton, and h.g koch for referring fibroblasts of their patients, and j. nathans for provid- ing the human retina cdna library and s. muscelli for assistance in preparing the manuscript. m.r. baum- gartner, t. suormala, and e.r. baumgartner are sup- ported by grants from the swiss national science foun- dation ( - . for t. suormala and e.r. baumgartner). r.n. cole was supported by the ameri- can health foundation. d. valle is an investigator in the howard hughes medical institute. . sweetman, l., and williams, j.c. . branched chain organic acidurias. in the metabolic and molecular bases of inherited disease. th edition. c.r. scriver, a.l. beaudet, w.s. sly, and d. valle, editors. mcgraw-hill. new york, new york, usa. – . . bannwart, c., wermuth, b., baumgartner, r., suormala, t., and weis- mann, u.n. . isolated biotin-resistant deficiency of -methyl- crotonyl-coa carboxylase presenting as a clinically severe form in a newborn with fatal outcome. j. inherit. metab. dis. : – . . lehnert, w., niederhoff, h., suormala, t., and baumgartner, e.r. . isolated biotin-resistant -methylcrotonyl-coa carboxylase deficiency: long-term outcome in a case with neonatal onset. eur. j. pediatr. : – . . gibson, k.m., bennett, m.j., naylor, e.w., and morton, d.h. . - methylcrotonyl-coenzyme a carboxylase deficiency in amish/men- nonite adults identified by detection of increased acylcarnitines in blood spots of their children. j. pediatr. : – . . levy, h.l. . newborn screening by tandem mass spectrometry: a new era. clin. chem. : – . . naylor, e.w., and chace, d.h. . automated tandem mass spec- trometry for mass newborn screening for disorders in fatty acid, organic acid and amino acid metabolism. j. child neurol. (suppl. ):s –s . . smith, w.e., et al. . evaluation of elevated hydroxyisovaleryl- carnitine in the newborn screen by tandem mass spectrometry. am. j. hum. genet. : . (abstr.) . roscher, a.a., liebl, b., fingerhut, r., and olgemöller, b. . prospective study of ms-ms newborn screening in bavaria, germany. j. inherit. metab. dis. : . (abstr.) . wilcken, b., wiley, v., and carpenter, k. . two years of routine newborn screening by tandem mass spectrometry (msms) in new south wales, australia. j. inherit. metab. dis. : . (abstr.) . samols, d., et al. . evolutionary conservation among biotin enzymes. j. biol. chem. : – . . wolf, b. . disorders of biotin metabolism. in the metabolic and molecular bases of inherited disease. th edition. c.r. scriver, a.l. beaudet, w.s. sly, and d. valle, editors. mcgraw-hill. new york, new york, usa. – . . jitrapakdee, s., and wallace, j.c. . structure, function and regu- lation of pyruvate carboxylase. biochem. j. : – . . lamhonwah, a.-m., et al. . isolation of cdna clones coding for the a and b chains of human propionyl-coa carboxylase: chromoso- mal assignments and dna polymorphisms associated with pcca and pccb genes. proc. natl. acad. sci. usa. : – . . freytag, s.o., and collier, k.j. . molecular cloning of a cdna for human pyruvate carboxylase. j. biol. chem. : – . . abu-elheiga, l., jayakumar, a., baldini, a., chirala, s.s., and wakil, s.j. . human acetyl-coa carboxylase: characterization, molecular cloning and evidence for two isoforms. proc. natl. acad. sci. usa. : – . . lau, e.p., cochran, b.c., and fall, r.r. . isolation of -methyl- crotonyl-coenzyme a carboxylase from bovine kidney. arch. biochem. biophys. : – . . weaver, l.m., et al. . molecular cloning of the biotinylated sub- unit of -methylcrotonyl-coenzyme a carboxylase of arabidopsis thaliana. plant physiol. : – . . mckean, a.l., et al. . molecular characterization of the non- biotin-containing subunit of -methylcrotonyl-coa carboxylase. j. biol. chem. : – . . mourmans, j., et al. . isolated (biotin-resistant) -methyl- crotonyl-coa carboxylase deficiency: four sibs devoid of pathology. j. inherit. metab. dis. : – . . gitzelmann, r., et al. . isolated (biotin-resistant) -methyl- crotonyl-coa carboxylase deficiency presenting at age months with sopor, hypoglycaemia and ketoacidosis. j. inherit. metab. dis. (suppl. ): – . . beemer, f.a., et al. . isolated biotin-resistant -methylcrotonyl- coa carboxylase deficiency in two sibs. eur. j. pediatr. : – . . wiesmann, u.n., suormala, t., pfenninger, j., and baumgartner, e.r. . partial -methylcrotonyl-coa carboxylase deficiency in an infant with fatal outcome due to progressive respiratory failure. eur. j. pediatr. : – . . tsai, m.y., johnson, d.d., sweetman, l., and berry, s.a. . two siblings with biotin-resistant -methylcrotonyl-coenzyme a car- boxylase deficiency. j. pediatr. : – . . steen, c., et al. . metabolic stroke in isolated -methylcrotonyl- coa carboxylase deficiency. eur. j. pediatr. : – . . jurecki, e., and packman, s. . nutritional therapy for beta- methylcrotonylglycinuria. metabolic currents. : – . . wolf, b., willard, h.f., and rosenberg le. . kinetic analysis of genetic complementation in heterokaryons of propionyl coa car- boxylase-deficient human fibroblasts. am. j. hum. genet. : – . . suormala, t., wick, h., bonjour, j.-p., and baumgartner, e.r. . rapid differential diagnosis of carboxylase deficiencies and evalua- tion for biotin responsiveness in a single blood sample. clin. chim. acta. : – . . old, s.e., and devivo, d.c. . pyruvate dehydrogenase complex deficiency: biochemical and immunoblot analysis of cultured skin fibroblasts. ann. neurol. : – . . nathans, j., piantanida, t.p., eddy, r.l., shows, t.b., and hogness, d.s. . molecular genetics of inherited variation in human color vision. science. : – . table expressiona of mcca and mccb alleles allele enzyme activityb (pmol/min/mg protein) experiment experiment mcc pcc mcc pcc mcca wild type r s a v l p vector mccb wild type s l – – e q – – v m – – r q – – p r – – r c – – vector control fibroblasts atransient transfection in sv t-transformed reference cg or cg cell lines. bnumbers represent average of duplicates. the journal of clinical investigation | february | volume | number . williams, k., lopresti, m., and stone, k. . internal proteins sequencing of sds-page-separated proteins: optimization of an in gel digest protocol. in techniques in protein chemistry. d.r. marshak, editor. academic press. new york, new york, usa. – . . smith, b.j. . chemical cleavage of proteins. methods mol. biol. : – . . kennedy, r.t., and jorgenson, j.w. . preparation and evaluation of packed capillary liquid chromatography columns with inner diam- eters from to µm. anal. chem. : – . . eng, j.k., mccormak, a.l., ashley, l., and yates, j.r.i. . an approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. j. am. soc. mass spectrom. : – . . braverman, n., et al. . human pex encodes the peroxisomal pts receptor and is responsible for rhizomelic chondrodysplasia punctata. nat. genet. : – . . leon-del-rio, a., and gravel, r.a. . sequence requirements for the biotinylation of carboxyl-terminal fragments of human propi- onyl-coa carboxylase alpha subunit expression in escherichia coli. j. biol. chem. : – . . waldrop, g.l., rayment, i., and holden, h.m. . three-dimen- sional structure of the biotin carboxylase subunit of acetyl-coa car- boxylase. biochemistry. : – . . thoden, j.b., blanchard, c.z., holden, h.m., and waldrop, g.l. . movement of biotin carboxylase b-domain as a result of atp bind- ing. j. biol. chem. : – . . saraste, m., sibbald, p.r., and wittinghofer, a. . the p-loop: a common motif in atp- and gtp-binding proteins. trends biochem. sci. : – . . lópez-casillas, f., et al. . structure of the coding sequence and primary amino acid sequence of acetyl-coenzyme a carboxylase. proc. natl. acad. sci. usa. : – . . hendrick, j.p., hodges, p.e., and rosenberg, l.e. . survey of amino-terminal proteolytic cleavage sites in mitochondrial precur- sor proteins: leader peptides cleaved by two matrix proteases share a three-amino acid motif. proc. natl. acad. sci. usa. : – . . nolt, s.m. . a history of the amish. good books. intercourse, penn- sylvania, usa. pp. the british journal of psychiatry | cambridge core skip to main content accessibility help we use cookies to distinguish you from other users and to provide you with a better experience on our websites. close this message to accept cookies or find out how to manage your cookie settings. login alert cancel log in × × home only search content i have access to home log in register browse subjects what we publish services about cambridge core cart cart access provided by carnegie mellon university manage institution login logged in as: carnegie mellon university manage institution login register register log in cart < back to search results home journals the british journal of psychiatry english | français the british journal of psychiatry search within full text search within journal search within society submit your article information submit your article you are leaving cambridge core and will be taken to this journal's article submission site. cancel leave now × other actions submit your article information visit: journal home journal home accepted manuscripts firstview articles latest issue all issues most read subscribe open access articles there is currently a delay in the posting of accepted eletters to cambridge core. we apologise for the inconvenience. access: subscribed contains open access on the cover continues the asylum journal ( - ), the asylum journal of mental science ( - ), journal of mental science ( - ) title history issn: - (print), - (online) editor: professor kamaldeep bhui cbe oxford university, uk editorial board the british journal of psychiatry (bjpsych) is a leading international peer-reviewed journal, covering all branches of psychiatry with a particular emphasis on the clinical aspects of each topic. published monthly on behalf of the royal college of psychiatrists, the journal is committed to improving the prevention, investigation, diagnosis, treatment, and care of mental illness, as well as the promotion of mental health globally. in addition to authoritative original research papers from around the world, the journal publishes editorials, review articles, commentaries on contentious articles, short reports, a comprehensive book review section and a lively, well-informed correspondence column. bjpsych is essential reading for psychiatrists, clinical psychologists, and all professionals with an interest in mental health. latest articles view all article bjp volume issue cover and front matter the british journal of psychiatry, volume , issue article plus ça change, plus c'est la même chose – psychiatry in history stephen wilson the british journal of psychiatry, volume , issue article robert hooke's bethlem hospital of : an architectural wonder – psychiatry in pictures r.h.s. mindham the british journal of psychiatry, volume , issue article ‘of the chaunge from one sex to another’: eye-witness accounts of pliny the elder ( – ) and ambroise paré ( – ) – psychiatry in literature greg wilkinson the british journal of psychiatry, volume , issue article kaleidoscope derek k. tracy, dan w. joyce, dawn n. albertson, sukhwinder s. shergill the british journal of psychiatry, volume , issue article ‘lone travelers’ – psychiatry in pictures brent r. carr the british journal of psychiatry, volume , issue article the medical model in mental health: an explanation and evaluation by ahmed samei huda oup. . £ . (pb). pp. isbn alistair stewart the british journal of psychiatry, volume , issue article highlights of this issue kate adlington the british journal of psychiatry, volume , issue view all rcpsych article of the month blog view all are there ethno-cultural disparities in mental health during the covid- pandemic? march , diana miconi, phd the rcpsych article of the month for february is ‘ethno-cultural disparities in mental health during the covid- pandemic: a cross-sectional study on the impact... view all tweets by bjpsych facebook loading https://www.facebook.com/rcpsych... . impact factor: out of psychiatry journal citation reports © clarivate analytics most read view all article factors influencing the decision to use hanging as a method of suicide: qualitative study lucy biddle, jenny donovan, amanda owen-smith, john potokar, damien longson, keith hawton, nav kapur, david gunnell the british journal of psychiatry, volume , issue view all most cited view all article a new depression scale designed to be sensitive to change stuart a. montgomery, marie Åsberg the british journal of psychiatry, volume , issue view all librarians authors publishing partners agents corporates additional information accessibility our blog news contact and help cambridge core legal notices feedback sitemap join us online legal information rights & permissions copyright privacy notice terms of use cookies policy © cambridge university press back to top © cambridge university press back to top cancel confirm × master layout sheet genetic and environmental factors are important determinants of disease frequency and distribution. , several inherited disorders are more commonly seen in certain ethnic groups, for example carnitine palmitoyltransferase type a in the canadian aboriginal population, , and maple syrup urine disease in the mennonite population. the high incidence of genetic diseases among specific ethnic groups is important in health care planning. - in addition, understanding ethnic differences and associated risk factors for various disorders is important in planning appropriate prevention strategies. ataxia is characterized by incoordination and inability to maintain balance. ataxia is clinically and etiologically a heterogeneous group of disorders. several disorders associated abstract: background: genetic and environmental factors are important determinants of disease distribution. several disorders associated with ataxia are known to occur more commonly in certain ethnic groups; for example, the disequilibrium syndrome in the hutterites. the aim of this study was to determine the ethnic and geographic distribution of pediatric patients with chronic ataxia in manitoba, canada. methods: we identified patients less than years-of-age with chronic ataxia during - from multiple sources. their diagnosis, ethnicity and place of residence were determined following a chart review. results: most patients resided in manitoba (n= ) and the majority in winnipeg, the provincial capital. thirty five aboriginal, mennonite and hutterite patients resided in manitoba. the latter two groups were significantly overrepresented in our cohort. ataxia telangiectasia, mitochondrial disorders, and non-progressive ataxia of unknown etiology associated with pyramidal tracts signs and developmental delay were significantly more common in mennonite patients. four of five patients with neuronal migration disorders associated with chronic ataxia were aboriginal. few isolated disorders with chronic ataxia occurred in the hutterite patients including a joubert syndrome related disorder. conclusions: three disorders associated with chronic ataxia were more prevalent than expected in mennonites in manitoba. few rare disorders were more prevalent in the hutterite and aboriginal population. further research is needed to determine the risk factors underlying these variations in prevalence within different ethnic groups. the unique risk factor profiles of each ethnic group need to be considered in health promotion endeavors. rÉsumÉ: ethnie et distribution géographique de l’ataxie chronique chez des patients d’âge pédiatrique au manitoba. contexte : les facteurs génétiques et environnementaux sont des déterminants importants de la répartition d’une maladie dans une population. il est bien connu que plusieurs maladies comportant de l’ataxie surviennent plus fréquemment dans certaines ethnies, comme par exemple le syndrome de déséquilibre chez les communautés huttériennes. le but de cette étude était de déterminer la distribution ethnique et géographique des patients pédiatriques atteints d’ataxie chronique au manitoba, canada. méthode : nous avons identifié patients de moins de ans atteints d’ataxie chronique entre et . nos sources de renseignements étaient multiples. le diagnostic, l’ethnie et le lieu de résidence étaient obtenus du dossier médical. résultats : la plupart des patients résidaient au manitoba (n = ) et la majorité habitait winnipeg, la capitale provinciale. trente-cinq patients autochtones, mennonites et huttériens résidaient au manitoba. ces deux derniers groupes étaient significativement surreprésentés dans notre cohorte de patients. l’ataxie- téléangiectasie, les maladies mitochondriales et l’ataxie non évolutive d’étiologie inconnue associée à des signes pyramidaux et à un retard du développement étaient significativement plus fréquentes chez les patients mennonites. quatre des patients atteints de troubles de la migration neuronale associé à une ataxie chronique étaient des autochtones. peu de maladies isolées avec ataxie chronique ont été observées chez les huttériens, incluant une maladie liée au syndrome de joubert. conclusions : trois maladies comportant une ataxie chronique avaient une prévalence plus élevée que prévu chez les mennonites du manitoba. la prévalence de quelques maladies rares était plus élevée dans les populations huttérienne et autochtone. on devra procéder à des recherches plus poussées pour déterminer les facteurs de risque sous-jacents à ces variations de la prévalence au sein de différents groupes ethniques. le profil de facteurs de risque unique à chaque groupe ethnique doit être pris en compte lors de campagnes de promotion de la santé. can j neurol sci. ; : - the canadian journal of neurological sciences ethnicity and geographic distribution of pediatric chronic ataxia in manitoba michael s. salman, shaheen masood, meghan azad, bernard n. chodirker from the section of pediatric neurology (mss, sm), section of genetics and metabolism (bnc), department of pediatrics and child health (mss, bnc), faculty of medicine, university of manitoba, winnipeg, manitoba; and department of pediatrics (ma), university of alberta, edmonton, alberta; canada. received march , . final revisions submitted july , . correspondence to: michael s. salman, section of pediatric neurology, children’s hospital, ae , sherbrook street, winnipeg, manitoba, r a r , canada. email: msalman@hsc.mb.ca. original article with ataxia are known to occur more commonly in geographic or ethnic clusters. , - the canadian population is ethnically diverse because of migration. during the last few decades a https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core number of new genetic causes of ataxia have been described in discrete ethnic groups within canada and elsewhere. , , previously, we have identified pediatric patients with chronic ataxia in manitoba, canada. patients with ataxia caused solely by brain tumors, peripheral nervous system diseases and vestibular system dysfunction were excluded. angelman syndrome, ataxia telangiectasia and mitochondrial disorders were the most common etiologies in our cohort. the aims of this study were to describe the ethnic and geographic distribution of pediatric patients presenting with chronic ataxia in manitoba and to ascertain if any clustering of diseases associated with pediatric chronic ataxia occurs in the province; specifically in the mennonite, hutterite, and aboriginal populations who are minority groups in manitoba that are known to have a higher prevalence of genetic disorders. methods we searched several databases and clinical information resources to identify pediatric patients with chronic ataxia, who received care at winnipeg children’s hospital between and . further details on the methodology, including ascertainment of the patients are described elsewhere. patients from neighboring provinces whose health needs are served by our tertiary pediatric hospital were also included in the initial search. in the analysis, only patients resident in manitoba were investigated for ethnic and geographic clustering. ethical approval for the study was granted by the research ethics board of the university of manitoba. data were collected from the patients’ hospital medical charts including age, gender, place of birth, place of residence, and etiology as described previously. as part of routine clinical practice, parents are asked about their ethnic background during the patient assessment. the information is usually documented in the neurology and genetics/metabolic charts. data pertaining to ethnic groups were extracted and defined according to the following categories: mennonite, hutterite, caucasian (excluding mennonites and hutterites), asian, indian, african/ caribbean, mixed, or aboriginal and if known: first nation, metis, or inuit. the inclusion criteria were: . the age of the patients on presentation was less than years. . the ataxia was chronic (i.e. greater than two months long or intermittent with two or more discrete episodes of ataxia) during any period between birth and years-of-age. . the patients attended winnipeg children’s hospital, the only tertiary pediatric hospital in the province of manitoba, to assess and investigate their ataxia. . the patients presented between and . the exclusion criteria were: . patients whose ataxia was not an important clinical feature (i.e. not clinically significant and not affecting day to day life). . a single episode of ataxia that fully recovered within two months of onset and never recurred. . ataxia caused only by diseases of the peripheral nerves, vestibular system, or primary brain tumors. . patients who were clumsy or had developmental coordination disorder but were not ataxic. disease etiology and ethnicity were then investigated to identify any disease clustering. this information was compared to the population at risk (children residing in manitoba) obtained from provincial census data. statistics canada conducts a population census once every five years. data on ethnicity and religion are available by various age groups including children less than years and youth aged - years. ethnicity is documented in every census, but religion (used to identify mennonites and hutterites) is documented only once every ten years. the census published by statistics canada (available on-line at http://www.statcan.gc.ca/), was used to obtain the relative frequencies of various ethnicities and religions in children less than years-of-age living in the province of manitoba. the census year was chosen because it was near the middle of our study period and also because statistics on religions were available for that census year. the age group of children less than years was considered a close match for our study cohort. for the more common diseases found in our cohort (defined arbitrarily as being present in at least four patients), exact logistic regression was conducted to determine the likelihood of disease (odds ratio and % confidence interval) according to ethnicity. patients were classified according to the following ethnic groups: aboriginal (all types or first nations only), hutterite, mennonite, caucasian, or “all others” (including africans/caribbean, indian, asian, mixed, and unknown ethnicity). the reference group comprised caucasian children (both parents are caucasian) who were not mennonite or hutterite to the best of our knowledge. in order to minimize the effect of disease clustering among first degree relatives, the analyses were repeated after excluding sibling pairs (only the first presenting sibling was retained; there were ten sibling pairs in the cohort). statistical analyses were conducted using sas . (sas institute inc., cary, nc, usa); results were considered significant when p < . . results of the patients that satisfied the inclusion criteria of this study, half were males and resided in manitoba with many (n= ) living in winnipeg, the provincial capital. mean age (sd, range) at the end of the study was ( . , . - . ) years. detailed stratification of the cohort by age and gender and other demographic information has already been published elsewhere. geographic clustering of patients was uncommon (figure). only a few patients clustered in the small towns of steinbach (n= ), which is km south east of winnipeg, and morden/ winkler (n= ), which are neighboring towns located km south west of winnipeg. these patients were mostly mennonite, which is expected since these communities have a high population of mennonites. in our cohort of patients living in manitoba, were fully or partially caucasian (both parents in patients, one parent in with the other parent’s ethnicity being unknown, and mixed, i.e. one parent is caucasian while the other parent is of another non- aboriginal race, in ). another patients were aboriginals, the canadian journal of neurological sciences https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core were mennonites, and were hutterites. the proportion of mennonite and hutterite patients in our cohort ( . % and . %, respectively) was significantly higher than anticipated in comparison to the pediatric population at risk living in the province (estimated at . % and . % according to the national census) (table ). the likelihood of each disorder according to ethnicity (compared to caucasian) is shown in table for manitoba residents (n= ), while the ethnicities among the more common disorders in the whole cohort (n= ) are displayed in tables and . there were patients with angelman syndrome. most had caucasian parents and four were aboriginal; no significant differences according to ethnicity were observed. mennonites were significantly overrepresented among patients with ataxia telangiectasia and mitochondrial disorders (p< . and p< . , respectively). ten of ( . %) patients with ataxia telangiectasia were mennonite, including one pair of siblings. six patients resided in steinbach. the nine patients with mitochondrial disorders resided in several cities and towns in and around winnipeg. the furthest town was located km west of winnipeg. three of the nine patients were mennonite and had abnormalities in respiratory chain enzyme complexes i, iv, or both. there was no obvious geographic clustering. the other six non-mennonite patients with mitochondrial disorders had alpers disease, melas (mitochondrial encephalomyopathy, lactic acidosis and stroke- like episodes), leigh syndrome, respiratory enzyme complexes i le journal canadien des sciences neurologiques volume , no. – january figure: map of the province of manitoba, canada showing the geographic distribution of pediatric patients (n= ) with chronic ataxia during the period - . ‘n’ denotes the number of patients represented by the colored squares (not drawn to scale) displayed on the map. map source: © department of natural resources canada. all rights reserved. https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core the canadian journal of neurological sciences l parents ethnicity aboriginal (all) aboriginal (first nation subgroup only) hutterite mennonite‡‡ caucasian† all others total proportion of total manitoba - years-old population§ . % . % . % . % . % . % % any etiology of pediatric chronic ataxia observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) . ( . - . )** ns . ( . - . )*** . ( . - . )*** (ref) angelman syndrome observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ns ne ns (ref) ataxia telangiectasia observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ne ne ne . ( . - > . )*** (ref) mitochondrial disorder observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ns ns . ( . - . )** (ref) ischemic stroke observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ns ns ne (ref) neuronal ceroid lipofuscinosis observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ns ne ne (ref) neuronal migration disorder observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) . ( . - !)* . ( . - !)* ne ns (ref) hypoxic ischemic encephalopathy observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ns . ( . - !)* ne (ref) epilepsy syndrome observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ns ne ns (ref) retts syndrome observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ns ne ne (ref) leukodystrophy observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ne ne ne (ref) † * non-significant associations (ns) not shown. table : likelihood of disorders associated with the more common causes of pediatric chronic ataxia‡ according to ethnicity https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core and iv deficiency, pyruvate carboxylase deficiency, and an uncharacterized mitochondrial disorder. six of seven patients with friedreich ataxia had at least one caucasian parent. there were two pairs of siblings with friedreich ataxia. in addition, two pairs of siblings had acetazolamide responsive episodic ataxia. of the nine patients with ischemic stroke associated with chronic ataxia, two resided in winnipeg and another two resided km south east of winnipeg while the others were scattered in small towns. of the six patients with neuronal ceroid lipofuscinosis, four were aboriginal (three first nation and one metis), but this did not represent a statistically significant association (table ). two of these four were siblings and three of the four resided about km north of winnipeg. no geographic clustering was noted among the other patients. there were five patients including one pair of siblings with neuronal migration disorder involving the cerebral hemispheres associated with chronic ataxia. four were aboriginal and thus a statistically significant association was found between the disorder and the patients’ ethnicity (p < . , see table ). three were first nations and one metis. two resided in winnipeg and two resided km north east of winnipeg. two of the four patients with leukodystrophy associated with chronic ataxia were siblings who had cree leukodystrophy (synonymous with vanishing white matter leukodystrophy) and resided in the very far north of the province while the other two were caucasians and resided in two towns west and far north of winnipeg. one had x-linked adrenoleukodystrophy and the other had the presumptive diagnosis of pelizaeus–merzbacher disease. the diagnosis was unknown in of patients with chronic ataxia, of whom had a non progressive disease course. the other patients were made up of clinically heterogeneous small groups of patients with intermittent or progressive ataxia of unknown etiology. the patients were divided into several subgroups depending on the presence or absence of associated clinical features e.g., epilepsy and pyramidal tract signs. abnormal pyramidal tract signs included hypertonia, hyper-reflexia, clonus, and babinski’s response. table shows the ethnicity among these subgroups for the whole of our cohort. the subgroups were as follows: ) twenty two of the patients had a combination of developmental delay, cerebellar and pyramidal tracts sign(s). the disorder was significantly more common in mennonite patients (p < . , table ), ) seven of the patients had developmental delay, epilepsy, cerebellar and pyramidal tracts signs, ) five of the patients in this subgroup had cerebellar signs and developmental delay only. there was one pair of siblings in this subgroup, ) le journal canadien des sciences neurologiques volume , no. – january ‡defined by the presence of at least four patients with the same disease group; ‡‡at least one parent is mennonite; †caucasian reference group includes children who are known to have two caucasian parents that are not hutterite or mennonite. children who have only one caucasian parent, other ethnicities, and unknown ethnicities are included in the "all others" column, §statistics canada census data. *p< . , **p< . , ***p< . (shown in bold), or, odds ratio; ci, confidence interval; ne, not estimable (due to patients); ref, reference group. non-significant associations (ns) not shown. l joubert syndrome and related disorders observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ne ne . ( . - !)*** ns (ref) disorders associated with a non progressive chronic ataxia of unknown etiology in the pediatric population ) non progressive cerebellar syndrome of unknown etiology with developmental delay and pyramidal tract signs observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ns ns . ( . - . )*** (ref) ) non progressive cerebellar syndrome of unknown etiology with developmental delay, epilepsy and pyramidal tract signs observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ne ns ne (ref) ) non progressive cerebellar syndrome of unknown etiology with developmental delay observed patients (%) ( . %) ( . %) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ns ne ne (ref) ) non progressive cerebellar syndrome of unknown etiology with developmental delay and epilepsy observed patients (%) ( . %) (%) ( . %) ( . %) ( . %) or vs caucasian ( % ci) ns ne . ( . - !)* ne (ref) † * non-significant associations (ns) not shown. table : likelihood of disorders associated with the more common causes of pediatric chronic ataxia‡ according to ethnicity (continued) https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core the canadian journal of neurological sciences ‡defined by the presence of at least four patients with the same disease group; †includes one pair of siblings; §two pairs of siblings at, ataxia telangiectasia; md, mitochondrial disorder; fa, friedreich ataxia; fn, first nation e parents ethnicity angelman syndrome at md ischemic stroke fa acetazolamide responsive episodic ataxia intermittent ataxia of unknown etiology total both caucasians † § one caucasian † both mennonites † one mennonite hutterites aboriginals fn fn, metis fn, metis metis unknown african/ caribbean asians § a table : ethnicity among the more common causes of pediatric chronic ataxia‡ for the whole cohort (n= ) ‡defined by the presence of at least four patients with the same disease group; †includes (or they are) one pair of siblings; *one patient lives outside manitoba; §one of the parent is fn and the other is metis. ncl, neuronal ceroid lipofuscinosis; hie, hypoxic ischemic encephalopa- thy; ld, leukodystrophy; js, joubert syndrome related disorder; fn, first nation; ab, dad is fn and mom is aboriginal but type is unknown parents ethnicity ncl epilepsy syndrome hie neuronal migration disorder retts syndrome js ld total both caucasians one caucasian both mennonites one mennonite hutterites aboriginals fn†, metis fn* fn*, ab ( fn†, metis§) fn metis†§ unknown indians * one patient lives outside manitoba § table : ethnicity among other common causes of pediatric chronic ataxia‡ for the whole cohort (n= ) *one patient moved later on to another province within canada; †one of these two patients, who lives in manitoba has a sibling marked as §; umn, upper motor neuron; dd, developmental delay; fn, first nation disorders with cerebellar signs associated with: parents ethnicity umn sign(s) and dd epilepsy, one umn sign and dd dd only epilepsy and dd no other features total both caucasians one caucasian both mennonites one mennonite hutterites aboriginals fn*†, metis metis fn§, metis metis indian unknown table : ethnic distribution among the (of ) patients with non progressive disorders associated with pediatric chronic ataxia https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core five of the patients had developmental delay, epilepsy and cerebellar signs, and ) two of patients had cerebellar signs only. although based on very few patients, three disorders appeared to be statistically more common in the hutterite population (table ). the first was a joubert syndrome related disorder in two patients, the second was hypoxic ischemic encephalopathy in a single patient, and the third was a non- progressive cerebellar motor syndrome associated with developmental delay and epilepsy of unknown etiology in another single patient. the results of all the analyses in table were similar after excluding sibling pairs (data not shown). discussion genetic disorders within defined ethnic groups may show strong founder effects, or may have multiple origins even within small geographic areas. , , , factors influencing these patterns include the mutation rate for specific genes, the age of the examined mutations, and the degree of isolation of the investigated community from other ethnic groups. the ability to identify carriers in this population facilitates genetic counseling and biomedical research, and enables epidemiologists to correlate any carrier susceptibility risks. , adequate counseling and support should accompany such testing in the event that a correlation is found. the prevalence of pediatric chronic ataxia varied across different ethnicities in our province. angelman syndrome has been reported in both genders and in individuals of diverse ethnic backgrounds. our study revealed angelman syndrome to be most common in non-mennonite or hutterite caucasians, who represent the majority of the manitoba population, which is consistent with another study. no excess patients were found in the aboriginal population. mennonite patients were significantly over represented in our cohort of patients with chronic ataxia. mennonites are a religious and genetic isolate of th century dutch/ german ancestry. this group moved to canada over the past years. many patients in our cohort with ataxia telangiectasia were mennonites, which may be due to a common founder effect. , a significantly higher proportion of mennonite patients had mitochondrial disorders. this is consistent with other studies that reported higher prevalence of different mitochondrial disorders in the mennonite population, which have been reviewed elsewhere. among the patients with chronic ataxia whose disease etiology remains unknown, we identified several with a non-progressive cerebellar motor syndrome associated with pyramidal tract signs and developmental delay, which was more frequent in mennonite patients. this deserves further investigation. friedreich ataxia is reported in individuals of european, north american, middle eastern or indian origin. this is consistent with our study results. the neuronal ceroid lipofuscinoses are a group of progressive neurodegenerative disorders, which are usually recessively inherited. there is a high prevalence of neuronal ceroid lipofuscinosis in the canadian province of newfoundland, which may be due to social isolation and the founder effect. , four of our six patients with this diagnosis were aboriginal and three of these four (including one sibling pair) were cree from one northern region in the province. this apparent higher incidence was not statistically significant. neuronal migration disorders associated with chronic ataxia occurred mostly among aboriginal pediatric patients in our cohort. no such association has been reported previously. there were a significantly higher proportion of hutterite patients in our cohort. the association with a joubert syndrome related disorder has already been described in the hutterite population. however, the other two disease associations reported in this paper affected only single patients. therefore, the statistical significance of the two associations is of uncertain clinical significance. in addition, there were two hutterite patients in our cohort, who had autosomal recessive cerebellar hypoplasia in the hutterites population (disequilibrium syndrome), which has already been characterized in this population. findings in this study were not significantly affected by the ten sibling pairs since the results were unchanged after siblings were excluded on a subanalysis. our study limitations include incomplete ascertainment of patients with chronic ataxia, although this is unlikely since our center is the only tertiary pediatric facility in the province where such patients are assessed. we also encountered missing, incomplete and inaccurate information recorded in the hospital chart including information on ethnicity. in addition, our study is hospital rather than community based. finally, the actual prevalence of known disease etiologies may be higher since the ability to make definitive diagnoses improved significantly over the year study period with more medical advances. the effects of these limitations on our study results are likely minimal as discussed previously. in conclusion, the prevalence of pediatric chronic ataxia was variable across ethnic groups in manitoba, canada. a few disease-specific clusters were identified in the mennonite, hutterite, and aboriginal populations. further research is needed to understand the risk factors underlying these variations in prevalence within certain ethnic groups. the unique risk factor profiles of each ethnic group need to be considered during health promotion activities. acknowledgements the authors thank v. harari for her help in mapping some of the data. they also thank the manitoba medical service foundation and braden hope fund for their financial support, as well as the manitoba institute of child health and the children hospital foundation of manitoba for providing the infrastructure needed for the project and for financial support. we thank t. styba for performing part of the data collection. le journal canadien des sciences neurologiques volume , no. – january https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core references . sequeiros j, martins s, silveira i. epidemiology and population genetics of degenerative ataxias. handb clin neurol. ; : - . . werdelin l, keiding n. hereditary ataxias: epidemiological aspects. neuroepidemiology. ; ( ): - . . collins sa, sinclair g, mcintosh s, et al. carnitine palmitoyltransferase a (cpt a) p l prevalence in live newborns in yukon, northwest territories, and nunavut. mol genet metab. ; ( - ): - . . greenberg cr, dilling la, thompson gr, et al. the paradox of the carnitine palmitoyltransferase type ia p l variant in canadian aboriginal populations. mol genet metab. ; ( ): - . . morton dh, morton cs, strauss ka, et al. pediatric medicine and the genetic disorders of the amish and mennonite people of pennsylvania. am j med genet c semin med genet. ; c ( ): - . . thomson ak, glasson ej, bittles ah. a long-term population- based clinical and morbidity profile of angelman syndrome in western australia: - . disabil rehabil. ; ( ): - . . tsuji s, onodera o, goto j, nishizawa m, on behalf of the study group on ataxic diseases. sporadic ataxias in japan - a population-based epidemiological study. cerebellum. ; ( ): - . . palau f, espinós c. autosomal recessive cerebellar ataxias. orphanet j rare dis. ; : . . erichsen ak, koht j, stray-pedersen a, abdelnoor m, tallaksen cme. prevalence of hereditary ataxia and spastic paraplegia in southeast norway: a population-based study. brain. ; (pt ): - . . anheim m, fleury m, monga b, et al. epidemiological, clinical, paraclinical and molecular study of a cohort of patients affected with autosomal recessive progressive cerebellar ataxia from alsace, eastern france: implications for clinical management. neurogenetics. ; ( ): - . . sridharan r, radhakrishnan k, ashok pp, mousa me. prevalence and pattern of spinocerebellar degenerations in northeastern libya. brain. ; ( pt ): - . . boycott km, flavelle s, bureau a, et al. homozygous deletion of the very low density lipoprotein receptor gene causes autosomal recessive cerebellar hypoplasia with cerebral gyral simplification. am j hum genet. ; ( ): - . . dupré n, bouchard jp, brais b, rouleau ga. hereditary ataxia, spastic paraparesis and neuropathy in the french-canadian population. can j neurol sci. ; ( ): - . . salman ms, lee ej, tjahjadi a, chodirker bn. the epidemiology of intermittent and chronic ataxia in children in manitoba, canada. dev med child neurol. ; ( ): - . . statistics canada, census of population of canada, provinces, territories (data products, topic-based tabulations) catalogues no. f xcb , f xcb , f xcb , f xcb (manitoba, code ). ottawa, ontario: statistics canada. available from: http://www . statcan.ca/english/census /products/standard/themes/index- eng.cfm (accessed december th ). . buckley rh, dinno n, weber p. angelman syndrome: are the estimates too low? am j med genet. ; ( ): - . . orton nc, innes am, chudley ae, bech-hansen nt. unique disease heritage of the dutch-german mennonite population. am j med genet a. ; a( ): - . . telatar m, teraoka s, wang z, et al. ataxia-telangiectasia: identification and detection of founder-effect mutations in the atm gene in ethnic populations. am j hum genet. ; : - . . labuda m, labuda d, miranda c, et al. unique origin and specific ethnic distribution of the friedreich ataxia gaa expansion. neurology. ; ( ): - . . moore sj, buckley dj, macmillan a, et al. the clinical and genetic epidemiology of neuronal ceroid lipofuscinosis in newfoundland. clin genet. ; : – . . vamp mutation causes dominant hereditary spastic ataxia in newfoundland families. bourassa cv, meijer ia, merner nd, et al. am j hum genet. ; ( ): - . . boycott km, parboosingh js, scott jn, et al. meckel syndrome in the hutterite population is actually a joubert-related cerebello- oculo-renal syndrome. am j med genet a. ; a( ): - . the canadian journal of neurological sciences https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core biomed centralbmc pediatrics ss open accecorrespondence care for amish and mennonite children with cystic fibrosis: a case series jonathan f henderson and ran d anbar* address: department of pediatrics, state university of new york upstate medical university, syracuse, ny, usa email: jonathan f henderson - hendersonj@upstate.edu; ran d anbar* - anbarr@upstate.edu * corresponding author abstract background: published articles have described a lack of willingness to allow preventative measures, as well as other types of modern therapies, as an obstacle to providing medical care for amish and mennonite populations. methods: we present data regarding the amish and mennonite patients at the suny upstate medical university pediatric cystic fibrosis center and three representative case reports. results: families of patients from these communities receiving care at our center have accepted preventive therapy, acute medical interventions including home intravenous antibiotic administration, and some immunizations for their children with cystic fibrosis, which have improved the health of our patients. some have even participated in clinical research trials. health care education for both the child and family is warranted and extensive. significant cystic fibrosis center personnel time and fundraising are needed in order to address medical bills incurred by uninsured amish and mennonite patients. conclusion: amish and mennonite families seeking care for cystic fibrosis may choose to utilize modern medical therapies for their children, with resultant significant improvement in outcome. background while the amish and mennonite communities offer the opportunity for study of closed populations with an increased incidence of certain genetic disease and defects, including cystic fibrosis (cf) [ - ], no published data have dealt with treatment and socioeconomic impact of cf on amish and mennonite families. in the united states, the population of the amish in was reported as approximately , while the men- nonite population was approximately , [ ]. the incidence of cf among these populations has been diffi- cult to estimate because of the closed nature of their com- munities. for example, in one ohio amish isolate the incidence of cf was / live births, while in another isolate there was no occurrence of cf among live births [ ]. the incidence of cf in the general united states population has been approximately / live births, however this incidence is falling, perhaps as a result of preconception and prenatal screening offered to the gen- eral population in order to identify carriers of cystic fibro- sis [ ]. as a majority of amish and mennonites may approve of cf carrier testing that can impact whether cf carriers marry each other [ ], it is possible that these pop- published: january bmc pediatrics , : doi: . / - - - received: august accepted: january this article is available from: http://www.biomedcentral.com/ - / / © henderson and anbar; licensee biomed central ltd. this is an open access article distributed under the terms of the creative commons attribution license (http://creativecommons.org/licenses/by/ . ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. page of (page number not for citation purposes) http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.biomedcentral.com/ - / / http://creativecommons.org/licenses/by/ . http://www.biomedcentral.com/ http://www.biomedcentral.com/info/about/charter/ bmc pediatrics , : http://www.biomedcentral.com/ - / / ulations also are experiencing a decline in the incidence of cf. however, the extent of genetic testing and counseling services available to these communities is unclear [ ]. the mennonites separated from the "old order" amish in as a result of adoption of new practices by the men- nonites, however, many of the central tenants of each group remain similar [ ]. both the amish and mennon- ites believe that good health is a gift from god, resulting from hard work and strict obedience to the teachings of the bible. the ability to work defines a "healthy" individ- ual [ - ]. conversely, illness is generally believed to be "god's will," while death is considered a natural part of life and a new beginning, rather than an end or punish- ment [ ]. the amish and mennonites believe in the strict separation of church and state, which historically has extended to refraining from use of government funds, including medicaid and social security [ , ]. further, typically they do not purchase commercial insurance [ ]. thus, barriers to provision of modern medical care include reimbursement issues, as well as the amish repu- diation of worldly conveniences such as telephones, elec- tricity, and automobiles [ ]. in most instances of illness, the amish rely on folk reme- dies and herbal medications, among other types of "alter- native" care [ ]. patients coming to modern medical facilities typically do so with chronic illness of many years, only after symptoms have become severe and herbal remedies have not proven beneficial [ ]. such will- ingness has been attributed to a lack of trained profession- als within their own communities to deal with severe illness [ , ]. contrary to the implications of the literature, we present data regarding the amish and mennonite patients at the suny upstate medical university pediatric cf center ( % of our cf patients) along with three representative case reports in order to alert physicians that families of these patients can be receptive to modern medical ther- apy, including preventive measures, which can greatly benefit the patients. table shows the proportion of our amish and mennonite patients who have accepted the recommended standard therapies for cf at our center. nine of the patients have undergone genotype testing and found to be homozygous for the Δf cf mutation. five of the patients have participated in clinical research trials through our center. due to the small nature of the amish and mennonite communities, we were concerned that members of their communities could identify the patients in the case reports. further, we were concerned by the potential impact of the current article on such communities [ ]. therefore, following consultation with the suny upstate institutional review board (irb), the families of the patients described in the case reports and their commu- nity elders reviewed and approved this manuscript prior to its submission for publication, in order to minimize risk of group harm, and harm to the families involved in each of the three presented cases. approval of the manu- script also was obtained from the suny upstate irb. case reports patient a – amish patient a was four-years-old when he began receiving care at our center. he had multiple siblings, including an older, much healthier sister who had cf. at the start of therapy, the patient's parents considered the long-term prognosis of their son when deliberating what treatments should be used. would the disease be painful? what help, if any, would medications and other medical technology provide that herbal therapies had not? is treatment futile in children with cf? following lengthy conversations involving not only the patient's parents, but also the bishop and elders in his community, it was felt to be in patient a's best interest to begin care with standard therapy for cf at our center (table ). a gas-powered generator was used to power the vest. patient a, as well as all of our amish and mennonite patients, qualified for pharmaceutical companies' patient assistance programs for many of his medications. those medications not covered under individual patient assist- ance programs were secured from pharmaceutical com- pany representatives in the form of samples. our hospital established a fee reduction program to help offset the cost of outpatient visits and inpatient hospital admissions for these families, all of whom qualified based on their income level. notably, all of the aforementioned assist- ance was secured by our cf center social worker, who was table : rate of standard cf therapy use by amish and mennonite patients at our center chest physiotherapy manual percussion % high frequency chest wall oscillator (vest) % nebulized mucolytic therapy with rhdnase % multivitamins fortified with vitamins a, d, e, and k % pancreatic enzymes % nutritional supplementation % antibiotic therapy % page of (page number not for citation purposes) bmc pediatrics , : http://www.biomedcentral.com/ - / / vital in communicating with the parents and helping them complete required paperwork. while standard therapies appeared to slow progression of the patient's lung disease, when his status worsened it was recommended by our center physician that intravenous antibiotic therapy be instituted. the family consulted with their elders who recommended that such therapy be with- held because of its cost, and as use of such therapy would only prolong the dying process in a patient with a termi- nal disease. during discussions with the family, our center physician stated that he believed the patient still would have a reasonable quality of life for several months or even a few years with use of intravenous antibiotics. further, withholding of antibiotic therapy at the time of the discussions would result in a much longer dying proc- ess than if the patient lived a longer life with concomitant lung disease progression prior to withholding of aggres- sive therapy. after a number of discussions at our center, the patient's parents allowed the introduction of intrave- nous therapy. they stated that if the medications did not seem to help their son's symptoms, it would be "god's will." at such a point they would not want to give him fur- ther intravenous therapy. home intravenous therapy was instituted because the family could not afford to pay in- patient hospital charges. several courses of intravenous antibiotic therapy were associated with a significant improvement of the patient's respiratory condition. however, after two years, he failed to respond to two intravenous antibiotic courses. at that time, the decision was made to withhold further intrave- nous therapy. the patient was provided supplemental oxygen at home that was generated by a concentrator, as well as on-going vest therapy. at the invitation of the patient and his family, a physician, respiratory therapist, and social worker from our center made home visits to check on the patient as he deteriorated. as he grew sicker, the patient was prescribed oral narcotics to be used as necessary for discomfort. four months after withholding intravenous therapy, following eight years of treatment at our center, patient a died. according to his family, as has become custom within this community, all of his supplies, including the vest and medicines, were given to another child in the community with cf; in this case, his sister. the strong bond between the family and providers at our center has led to amish from other com- munities in new york to seek care at our center at this family's advice. patient b – mennonite at the age of two months, patient b was seen at another center for failure to thrive, emesis, bloody stools, rash and bruising as a result of a vitamin k deficiency. follow- ing an episode of significant cough and wheezing, he was diagnosed with cf. later, it was found that patient b also had biliary cirrhosis. after receiving care elsewhere for four years, the patient came to our center because his family became discon- tented with the medical care they had been receiving. the parents stated they were unhappy because they were not provided with accurate information regarding the patient's health condition, need for testing, and treatment options. reportedly, the family was told that the patient would require hospitalization every few months for his entire life, as well as a liver transplant. the parents report- edly felt much pressure from staff members of the other institution to obtain state aid because of the high on- going and projected costs of his medical care. moreover, herbal remedies that patient b had used since he first became ill were discouraged by his physician, even though the family felt his caregivers did little to under- stand the need for these remedies. after transferring to our center, the parents of patient b were willing to try therapies they had heard worked well in others with cf in their community, including standard therapies offered at our center (table ). according to these parents, their readiness to try such therapies, includ- ing those that they may have previously rejected, was the result of the willingness of our center staff to discuss the potential benefit and harm of standard as well as alterna- tive therapies. for example, our cf center physician was open to use of herbal therapies for patient b, although he informed the family that no studies have demonstrated the effectiveness of treatment of cf. notably, the deacon and some of the bishops of patient b's mennonite com- munity actively discouraged use of the herbs because their use was thought to represent witchcraft. this created sig- nificant discomfort between the family and their bishop. the parents felt that while some of their community were supportive of herbs and would be willing to help fund this therapy, they felt uncomfortable asking for financial resources from other community members. ultimately, without pressure from our center, the family decided to obtain insurance coverage through medicaid. four months after institution of our standard cf therapies and nebulized tobramycin (tobi®) in treatment of the patient's airway colonization with pseudomonas aerugi- nosa, the patient's pulmonary crackles cleared, and his hemoglobin saturation in room air rose from % to %. his body mass index over the same time interval increased from . kg/m ( th percentile for age) to . kg/m ( th percentile for age). helping others within their community with cf was an important aspect of patient b's overall care, according to page of (page number not for citation purposes) bmc pediatrics , : http://www.biomedcentral.com/ - / / his parents. therefore, they consented to his inclusion in the cf foundation national patient registry, which tracks demographics of cf patients throughout the united states. moreover, because of the significant history of bil- iary disease in their child, the parents also consented to his enrollment in a gene modifier study of patients with cf liver disease, for which participation consisted of pro- vision of a single blood specimen. patient c – amish patient c was diagnosed with cf following postnatal test- ing done as a result of a sibling with the disease. she showed few symptoms of cf until she was two-years-old, at which time she was brought by her parents to a hospital in michigan because she was "pale". while she did not have any significant respiratory disease prior to this admission, her condition warranted the start of treatment for cf including rhdnase, and a bronchodilator, which largely was covered under michigan's trust fund for chil- dren with special needs (formerly the crippled chil- dren's fund). shortly thereafter, the patient and her family relocated to another state, where coverage for her expensive therapies was less available. more importantly to the family, they "didn't like the doctor" taking care of their children in the new cf center because they felt he did little to understand the beliefs of their culture, and why certain therapies are accepted while others are not. after talking to others in their community, the parents of patient c were told to come to our center because of the work we have done with the amish. a generator was installed by the family for the use of a nebulizer and vest. medications needing refrigeration have been kept on ice. three years ago, the family was contacted by an individual who sought to, "help amish children with cf." the family was presented with a plan to help cover the costs of treat- ment and were told that it "did not involve government assistance." ultimately, this plan turned out to be medic- aid through the state of new york, which caused distress for this family, when they learned about this at a subse- quent visit to our center. the social worker at our center worked to amend this problem with the state, and assured the elders and others within their community that the family in fact did not knowingly apply for state or govern- mental aid. the family of patient c was advised by the social worker to refrain from applying for any sort of "help" from others outside our facility without first con- tacting our center. the parents consented to have patient c participate in two studies, including one involving growth hormone. the latter study provided reimbursement for the family's transportation costs to our center and there were no charges associated with the center visits for the duration of the study. the family also agreed to allow immuniza- tion for influenza virus on a yearly basis. this family explained that even though amish patients often have refused immunizations of any kind, such preventative care currently is being left to the family's discretion as atti- tudes towards preventative care among the amish have shifted significantly over the past decade. discussion publications have described a lack of willingness to allow preventative measures as an obstacle to providing modern medical care for amish and mennonite populations [ - ]. based on the experiences reported by our patients, this information may have led some within the medical community to assume that amish and mennonite fami- lies are unwilling to allow preventative care, as well as other types of modern therapies, which has resulted in provision of suboptimal care for patients with cf. nonetheless, it is evident that amish and mennonite fam- ilies can be open to effective, modern therapy for this dis- ease. after extensive exploration of the beliefs and expectations of families from these communities, they have accepted preventive therapy, acute medical interven- tions including home intravenous antibiotic administra- tion, and some immunizations for their children with cf. some even have participated in clinical research trials. significant cf center personnel time and fundraising are needed in order to address medical bills incurred by unin- sured amish and mennonite patients with chronic disease such as cf. several options are available. churches within the community often have fundraisers, through selling amish and mennonite foods, quilts and furniture. "amish aid" is a type of medical insurance governed by business- men within the amish church to help pay for hospital bills [ ]. such funds are used by members of the church community, but often fall short of covering costs. with the availability of programs such as our institution's fee reduction program to offset costs, caring for amish patients becomes more manageable, and helps these fam- ilies to seek care. health care education for both the child and family is war- ranted and extensive. by openly discussing the rationale for state-of-the-art and alternative treatments, side effects and outcomes, amish and mennonite families can embrace state-of-the-art medical therapies, with signifi- cant positive results. participation of amish and mennon- ite patients in some of our clinical research trials also has been very helpful in that participating patients are reim- bursed for their transportation costs, and clinic charges are minimized for the duration of studies sponsored by pharmaceutical companies. further, participation in such page of (page number not for citation purposes) bmc pediatrics , : http://www.biomedcentral.com/ - / / trials allows for more frequent visits at the cf center for the enrolled patients as well as siblings with cf, which leads to provision of more timely and thus improved health care. as presented in this report, some members of each group also are willing to allow certain preventative measures. a recent study by yoder and dworkin [ ], in which ques- tionnaires were mailed to all households in an illinois amish community, showed that the majority of the com- munity vaccinates all ( %) or some ( %) of their chil- dren, with only a small minority objecting due to concerns about vaccine safety, and an even smaller cohort objecting due to religious reasons. thus, amish families often are willing to utilize vaccination as a form of pre- ventative care. this report illustrates that health care geared to the cul- tural needs of patients and their families can lead to an improved outcome. it has been proposed that cultural sensitivity improves establishment of rapport and thus promotes cooperation and adherence to therapy [ ]. such sensitivity should include assessment of the patients' preferences and beliefs, and adjustment of health care delivery accordingly [ ]. for example, in some cultures more emphasis is placed on collective rather than individ- ual decision making, communication patterns may differ (e.g., there may be a relative emphasis on non-verbal com- munication), and views may differ regarding physicians, suffering, and the afterlife [ ]. conclusion it appears essential for the health care team to understand, consider, and incorporate current beliefs of amish and mennonite communities into the development of effec- tive programs for treatment of their members with cf. similar efforts should be undertaken whenever health care providers encounter patients from different cultures or religions. abbreviations cf: cystic fibrosis competing interests the authors declare that they have no competing interests. authors' contributions jh wrote the manuscript, and it was edited by ra, who was the attending physician for the described patients. both of us approve the submission of this version of the manuscript, and take full responsibility for it. acknowledgements this study was not funded. written consent was obtained from the families of the described patients for publication of this report. references . miller sr, schwartz rh: attitudes toward genetic testing of amish, mennonite, and hutterite families with cf. am j public health , : - . . tsui lc, barker d, braman jc, knowlton r, schumm jw, eiberg h, mohr j, kennedy d, plavsic n, zsiga m, markiewicz d, akots g, brown v, helms c, gravius t, parker c, rediker k, donis-keller h: cf locus defined by a genetically linked polymorphic dna marker. science , : - . . morton dh, morton cs, strauss ka, robinson dl, puffenberger eg, hendrickson c, kelly ri: pediatric medicine and the genetic dis- orders of the amish and mennonite people of pennsylvania. am j med genet c sem med genet , c: - . . francomano ca, mckusick va, biesecker lg: medical genetic studies in the amish: historical perspective. am j med genet c sem med genet , c: - . . kraybill db, bowman cf: on the background of heaven: old order hutterites, mennonites, amish, and brethren. balti- more, maryland: johns hopkins university press; . . klinger kw: cystic fibrosis in the ohio amish: gene frequency and founder effect. hum genet , : - . . hale je, parad rb, comeau am: newborn screening showing decreasing incidence of cystic fibrosis. n engl j med , : - . . brensinger jd, laxova r: the amish: perceptions of genetic dis- orders and services. j genet counseling , : - . . "mennonite beliefs and practices." britannica online. britannica [http://www.britannica.com/eb/article- /mennonite]. . weyer sm, hustey vr, rathbun l, armstrong vl, anna sr, ronyak j, savrin c: a look into the amish culture: what should we learn? j transcult nurs , : - . . brewer ja, bonalumi nm: health care beliefs and practices among the pennsylvania amish. j emerg nurs , : - . . banks mj, benchot rj: unique aspects of nursing care for amish children. the american journal of maternal/child nursing , : - . . shapiro ht: national bioethics advisory commission: ethical and policy issues in research involving human participants. bethesda, maryland . . yoder js, dworkin ms: vaccination usage among an old-order amish community in illinois. pediatr infect dis j , : - . . donate-bartfield e, lausten l: why practice culturally sensitive care? integrating ethics and behavioral science. j dent educ , : - . . searight hr, gafford j: cultural diversity at the end of life: issues and guidelines for family physicians. am fam physician , : - . pre-publication history the pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/ - / / /prepub page of (page number not for citation purposes) http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.britannica.com/eb/article- /mennonite http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.biomedcentral.com/ - / / /prepub abstract background methods results conclusion background case reports patient a – amish patient b – mennonite patient c – amish discussion conclusion abbreviations competing interests authors' contributions acknowledgements references pre-publication history church history volume reprinted with the permission of the original publisher by periodicals service company germantown, ny core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core printed on acid-free paper. this reprint was reproduced from the best original edition copy available. core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core church history edited by matthew spinka robert hastings nichols charles lyttle volume viii published by the american society of church history core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core table of contents articles pages arbaugh, george b., gossner missionaries m america - baron, hans, calvinist republicanism and its historical roots - bella, julius l, father tyrrell's dogmas - downey, glanville, julian the apostate at antioch - gray, john r., the political theory of john knox - harkness, r. e. e., the development of democracy in the english reformation - hawley, charles arthur, gerald massey and america - hershberger, guy franklin, pacifism and the state in colonial pennsylvania ., - hudson, winthrop s., the morison myth concerning the founding of harvard college - hudson, winthrop s., the scottish effort to presbyterianize the church of england - kristeller, paul oskar, florentine platonism and its rela- tions with humanism and scholasticism - odlozilik, otakar, bohemian protestants and the calvinistic churches - outler, albert c, origen and the regulae fidei - pennington, edgar legare, john wesley's georgia ministry .... - spinka, matthew, latin church of the early crusades - sweet, william warren, church archives in the united states - minutes of the society minutes of the forty-sixth consecutive (thirty-second annual) meeting of the society and of the council, december, - minutes of the forty-seventh meeting of the society and of the council, april, - book reviews angus, s., essential christianity - attwater, donald, st. john chrysostom beardsley, frank granville, the history of christianity in america bentwich, n., solomon schechter: a biography - bernhart, joseph, the vatican as a world power berthold, s. m., thomas paine, america's first liberal - be"venot, maurice, st. cyprian's be unitate, chapter billington, e. a., the protestant crusade, - - binns, l. e., the church in the ancient world bonner, c, some baptist hymnists from the th century to modern times burton, k., paradise planters - cadbury, henry j., annual catalogue of george fox's papers - corrigan, kaymond, s. j., the church and the nineteenth century - coulton, g. g., inquisition and liberty coulton, g. g., medieval panorama: the english scene from conquest to 'reformation; coulton, g. g., social life in britain from the conquest to the reformation - davis, helen c. m., comp., some aspects of religious liberty dodd, charles harold, history and the gospels - dru, alexander, ed., the journals of soren kierkegaard > - duckett, eleanor shipley, the gateway to the middle ages - eisenach, g. j., a history of the german congregational churches in the united states - core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core pages fairchild, hoxie n., 'religious trends in english poetry, vol. i - finkelstein, louis, the pharisees, the sociological background of their faith - flew, r. newton, jesus and his church - foster, frank hugh, the modern movement in american theology - garraghan, gilbert j., the jesuits of the middle united states - garrett, c. h., the marian exiles, a study in the origins of elizabethan puritanism _ - gingerieh, melvin, the mennonites in iowa - gipson, lawrence henry, ed., the moravian indian mission of white river: diaries and letters - gobbel, l. l., church-state relations in education in north carolina since l ye - goodenough, erwin, the politics of philo judaeus: practice and theory - goodwin, mary c, papal conflict with josephinism gordon, antoinette k., the iconography of tibetan lamaism hagen, lois d., a parish in the pines - haller, william, the rise of puritanism - halperin, s. william, italy and the vatican at war - hardy, e. n., george whitefield, the matchless soul winner horstmann, j. h. and wernecke, h. h., through four centuries - hull, william i., the rise of quakerism in amsterdam, - - jordan, w. k., the development of religious toleration in england, - - jorgensen, j., saint catherine of siena - knapton, ernest john, the lady of the holy alliance: the life of julie de krudener - knox, wilfred l., st. paul and the church of the gentiles - latourette, k. s., the thousand years of uncertainty, a.d. -a.d. - lietzmann, h., die reichskirche bis zum tode julians; and the founding of the church universal - mackinnon, james, the origins of the reformation - mareuse, ludwig, soldier of the church-. the life of ignatius loyola - mcconnell, francis j., john wesley mckinney, w. w., early pittsburgh presbyterianism - mcneill, john t. and gamer, helena m., medieval handbooks of penance - merkel, h. m., history of methodism in utah - moland, e., the conception of the gospel in the alexandrine theology .... - moore, ernest carroll, the story of instruction - muller, karl, kirchengeschichte murison, w., sir david lyndsay, poet and satirist of the old church of scotland - nelson, william, john skelton, laureate - nobbs, douglas, theocracy and toleration, a study in dutch calvinism from - - parsons, ernest william, the religion of the new testament - payton, james simpson, our fathers have told us pennington, e. l., apostle of new jersey, john talbot phelan, m., a history of the expansion of methodism in texas, - pratt, parley p., jr., ed., life and letters of parley p. pratt - riley, arthur j., catholicism in new england to - smith, h. maynard, pre-reformation england - smith, joseph fielding, ed., teachings of the prophet joseph smith - sonne, niels henry, liberal kentucky — - - sturge, c, cuthbert tunszal, churchman, scholar, statesman, administrator - torrey, norman l., the spirit of voltaire - - trobridge, george, swedenborg: life and teachings - walten, m. g., ed., thomas fuller's the holy state and the profane state - walter, johannes von, die geschichte des christentums, vol. i i wenger, j. c, history of the mennonites of the franconia conference - wertenbaker, thomas jefferson, the founding of american civilization: the middle colonies - white, l. t., latin monasticism in norman sicily - williamson, claude, ed., great catholics - winters, r. l., francis lambert of avignon ( - ) - zyzykin, m. v., patriarch nikon - core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core the american society of church history founded by phtt.ip schaff, : reorganized, : incorporated by act of the legislature of new york, officers for charles lyttle president roland h. bainton vice-president matthew spinka secretary robert hastings nichols . treasurer robert fortenbaugh assistant secretary other members of the council william warren sweet herbert wallace schneider conrad henry moehlman reuben e. e. harkness frederick w i l l i a m loetscher f. w. buckler j o h n thomas mcneill e. r. hardy, jr. wllhelm pauck percy v. norwood editorial board of church history matthew s p i n k a , managing editor robert hastings nichols charles lyttle, ex officio publication office, berne, indiana executive and editorial office, chicago, illinois core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core church history editorial board matthew spinka, managing editor robert hastings nichols charles lyttle, ex officio vol. viii june, no. table of contents part l a t i n c h u r c h of the early crusades matthew spinka t h e political theory of j o h n knox john r. gray t h e morison m y t h concerning t h e founding of harvard college winthrop s. hudson m i n u t e s of the forty-seventh meeting of the american society of c h u r c h history, a p r i l - , m i n u t e s of the meeting of the council of the american society of c h u r c h history,, a p r i l , book reviews: goodenough, e r w i n : the politics of philo judaeus: practice and theory donald w. riddle f i n k e l s t e i n , l o u i s : the piwrisees, the sociological back- ground of their faith donald w. riddle core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core contents flew, r. newton : jesus and his church ernest w. parsons mulleir, karl: kirchengeschichte conrad henry moehlman moore, ernest carroll: the story of instruction ...-r. m. tryon mcneill, john t. and gamer, helena m.: medieval hand- books of penance s. harrison thomson smith, h. maynard: pre-reformation england, john t. mcneill coulton, g. g.: medieval panorama: the english scene from conquest to reformation; coulton, g. g.: social life in britain from the conquest to the reformation, ." john t. mcneill nobbs, douglas : theocracy and toleration, a study in dutch calvinism from - w. k. jordan walten, m. g., ed.: thomas fuller's the holy state and the profane state r. h. nichols jordan, w. k.: the development of religious toleration in england, - m. m. knappen trobridge, george : swedenborg: life and teachings marguerite b. block garraghan, gilbert j.: the jesuits of the middle united states thomas j. mcmahon pratt, parley p., jr., ed.: life and letters of parley p. pr&tt clifford m. drury merkel, h. m.: history of methodism in utah martin rist corrigan, raymond, s. j.: the church and the nineteenth century john m. lenhart, o. m. cap. gordon, antoinette k.: the iconography of tibetan lamaism matthew spinka p a r t l i s t of members of the american society of c h u r c h history core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ constructing feminist histories of immigrant women / burnett, jean, ed. looking into my sister's eyes: an exploration in women's history. toronto: the multicultural history society of ontario, . pp. ix, . $ . all rights reserved © urban history review / revue d'histoire urbaine, ce document est protégé par la loi sur le droit d’auteur. l’utilisation des services d’Érudit (y compris la reproduction) est assujettie à sa politique d’utilisation que vous pouvez consulter en ligne. https://apropos.erudit.org/fr/usagers/politique-dutilisation/ cet article est diffusé et préservé par Érudit. Érudit est un consortium interuniversitaire sans but lucratif composé de l’université de montréal, l’université laval et l’université du québec à montréal. il a pour mission la promotion et la valorisation de la recherche. https://www.erudit.org/fr/ document généré le avr. : urban history review revue d'histoire urbaine constructing feminist histories of immigrant women burnett, jean, ed. looking into my sister's eyes: an exploration in women's history. toronto: the multicultural history society of ontario, . pp. ix, . $ . daiva k. stasiulis volume , numéro , february uri : https://id.erudit.org/iderudit/ ar doi : https://doi.org/ . / ar aller au sommaire du numéro Éditeur(s) urban history review / revue d'histoire urbaine issn - (imprimé) - (numérique) découvrir la revue citer ce compte rendu stasiulis, d. k. ( ). compte rendu de [constructing feminist histories of immigrant women / burnett, jean, ed. looking into my sister's eyes: an exploration in women's history. toronto: the multicultural history society of ontario, . pp. ix, . $ . ]. urban history review / revue d'histoire urbaine, ( ), – . https://doi.org/ . / ar https://apropos.erudit.org/fr/usagers/politique-dutilisation/ https://www.erudit.org/fr/ https://www.erudit.org/fr/ https://www.erudit.org/fr/revues/uhr/ https://id.erudit.org/iderudit/ ar https://doi.org/ . / ar https://www.erudit.org/fr/revues/uhr/ -v -n -uhr / https://www.erudit.org/fr/revues/uhr/ urban history review/revue d'histoire urbaine proportion of the population living in cities increased in this era, too. the result of white's inclusiveness is a proliferation of passages in which each succeeding short paragraph, at times every sentence, deals with a different major issue. the reader's head begins to swim with facts, unrelieved by col- our. even a figure as colourful as william lyon mackenzie becomes simply a label for the radical fringe of upper cana- dian reform, a sort of left-wing robert responsible government. white at times seems to deliberately avoid a good story. we hear nothing of mackenzie's highly personal slurs on the character of the "family compact" or of the consequent relocation of his press to the bottom of lake ontario, and there is nary a mention of laura secord, per- haps the only figure in the upper canadian period some readers will remember. bothwell demythologizes mackenzie and yet presents him as a fiery, colourful personality. white's politicians remain match-stick figures in the presence of bothwell's vividly critical portraits of hepburn and drew. the pragmatic mowat, indeed, is white's representative ontario politician, with whom his successors are constantly compared. white is politically cautious, too, though he does venture to pronounce the province's liquor licensing regula- tions "draconian" (p. ). historical explanation also suffers from white's chroni- cling technique. depressions and financial crises are simply events which have political consequences; they have no causes of their own. bothwell structures his book to a far greater extent to facilitate promoting the reader's understanding of why things happened. his explanations are often briefer than white's, but they tend to hit home with greater emphasis because of his admirable economy of words, apt turns of phrase, and better sense of organization. white's is also a curious book with which to kick off a local history series, as it pays little more than lip service to regionalism. indeed, he uses the word "regional" as equiva- lent to "provincial." he recognizes the distinct political cultures of eastern ontario and the south-western peninsula, but these distinctions become, predictably, less important as one leaves upper canada in the past. bothwell, too, cites this "serviceable generalization" but he at least notes that it becomes "clearer and truer" when "reduced to a township- to-township basis" (p. ). one would expect the introduc- tory volume to a series of local histories to place greater emphasis upon regional variation, the elucidation of which is arguably one of the strongest reasons for doing local his- tory at all. if the authors of future volumes in the oh f series commit themselves to writing good local histories, we can hope that a radically different history of ontario can be written at a later date. the first book in the series attempts nothing so revisionist, but instead aims to provide the local historian with a handy reference to the provincial back- ground against which to view sub-regional variations on major themes. for this the book is scarcely adequate. any local historian exploring a theme will immediately need more information than white's book provides, and the decision to exclude endnotes suggesting further reading, while accord- ing with the customary wisdom that references toll the death- knell for general sales, leaves the reader nothing to fall back on. the bibliography is no substitute for this — consisting as it does almost entirely of books — since much of the best work on ontario's history is to be found in periodical litera- ture. it is, nonetheless, nice to see that ontario has been judged worthy of two provincial histories after so many years. some will see poetic justice in the fact that one of the commissions originated in alberta. much work remains to be done before the history of ontario can be rewritten to reflect an under- standing of the province's internal diversity, but in the meantime the uninitiated can find a pleasant introduction in bothwell's a short history of ontario. the serious local historian will still prefer to have the better volumes of the centenary series near to hand. bruce s. elliott department of history queen's university constructing feminist histories of immigrant women burnett, jean, ed. looking into my sister's eyes: an explo- ration in women's history. toronto: the multicultural history society of ontario, . pp. ix, . $ . . a large body of literature on the process of overseas migration to canada and the construction of urban ethnic enclaves in canadian cities has obscured the role and expe- riences of migrant women. one basis for the preoccupation within migrant and ethnic studies with the male experience resides in the great numerical imbalances of men over women in migration and during the lengthy periods of sojourning fostered by early canadian industrialization. the invisibility of women has additionally been abetted by the stereotypical assumptions regarding the passive and non-productive roles of female migrants underlying historical and sociological ethnic studies. looking into my sister's eyes is the first collection of articles which deals exclusively with the experiences of immigrant women in the processes of migration and settle- ment in canada. while not achieving (nor claiming to strive for) a feminist volte-face in ethnic and migration studies, this pioneering book succeeds in filling in many of the silences on the social history of immigrant and "ethnic" women in ontario. book reviews/comptes rendus comprised by thirteen articles and a brief introduction by the editor, the book explores the diverse roles and expe- riences of women in the migration process itself, the family, labour force, and ethnic institutions and organizations. the subjects of this collection are women originating from both 'preferred' sources of immigration such as britain and northern europe, and from southern and eastern european, middle eastern and asian countries regarded by immigra- tion authorities as populated by rude peasants or workers, too far removed in temperament, culture and complexion to assimilate to british norms of settler acceptability. women from these latter 'nontraditionap sources were accordingly discouraged from entering canada by a system of head taxes, quotas and other administrative restrictions, and their num- bers in ontario remained low prior to the second world war. while the experience of making one's home in a strange new country was rarely an easy one, material and social hardships could be vastly mitigated by ethnic and class advantages. hopkins provides a portrait of the lives of five british gentlewomen — including the famous sisters, susan- nah moodie and catharine parr traill, who settled in the backwoods and towns of what is now southern ontario dur- ing the first half of the nineteenth century. the rich bequest of letters, diaries, journals and manuscripts left by these educated women itself attests to their exceptional privilege and ability to carve out relatively leisured lifestyles in com- parison with less advantaged pioneer women. while their gentility could not cushion these women and their families from the severe climate, isolation and hardships common to bush life, their move to prosperous farmlands and towns generally brought increased material comforts, social con- tacts and class advantages not unlike those enjoyed in the old country. the domestic servants who came to canada between and from the british isles did not enjoy the class priv- ileges of their upper middle-class counterparts. barber attributes the decision of single british women to journey to ontario to the insatiable demand for domestic workers, stories of higher wages in the new country, family connec- tions, and recruitment literature which stressed the strength of british traditions and way of life in ontario society. while british imperial ties expedited the movement of english, scottish and irish domestics to ontario, they provided a lesser guarantee of successful accommodation to ontario's work- ing and living conditions. brought over to toil in strange households, british domestics found that differences in cli- mate, technology and diet required adaptation in their labour process. while the discovery of vacuum cleaners in toronto compelled one irish domestic (used to cleaning carpets by spreading and sweeping tea leaves) to exclaim that she thought she had "died and gone to heaven" (p. ), com- plaints about hard work and long hours rivalled more positive assessments by domestics of the working conditions. lindstrom-best's account of finnish domestic workers in canada from to illuminates the similarities of status and work conditions among dometics which transcend ethnicity and often time. physical isolation coupled with lack of privacy, autocratic control by employers and difficulties in having families of their own were the considerable social costs borne by both finnish and british domestics. both groups of women sought to mitigate and escape these hard- ships by seeking support from ethnic institutions, such as the socialist locals of the finnish organization of canada and finnish employment agencies, and for british domestics, the church of england, the presbyterian church and women's hostel. organizing efforts among finnish domestics were fuelled by the strong current of socialist activity among finns and enjoyed brief successes in montreal, toronto, sudbury, sault ste. marie and timmins. resistance to servile treat- ment also involved attempts to maximize autonomy in employment by quitting often during the first year of employment and relying on networks of information to negotiate more effectively with employers. unlike british and finnish domestics who migrated as single women, the majority of female immigrants entered canada via family migration channels as fiancées, wives, sisters and mothers of male immigrants. several articles in this volume emphasize the prime importance of the familial context and the family economy in guiding the behaviour of women in matters of sexuality, domestic labour, waged work and community activity. sturino, writing about pre-war southern italian migration to toronto, depicts the protection of women's sexual honour both in italian peasant society and in the urban ethnic enclave as a keynote to the stability of the family unit. while the pervasive demands of the hon- our complex might evoke the resentment of individual women, in sturino's view, they were the primary determi- nant in both the conduct of sexual relations and in the prevalence of paid homeworking among italian women. two of the strongest contributions to this collection, iacovetta's account of southern italian women in the post- war period and petroffs study of macedonian women to , illuminate the complex nature of gender relations in the immigrant household. while patriarchal precepts and distinct gender roles manifested themselves in all-male cof- fee houses, all-female occupational enclaves and the obsessive concern about female sexual purity, gender relations in immigrant families were far more intricate, contradictory and variable than the model of male-dominance/female submission suggests. the exercise of power by women was greatest in the private sphere where as iacovetta observes, women "made effective use of their capacity to argue, nag, manipulate, disrupt normal routine and generally make life miserable for men in order to achieve certain demands" (p. ). draper and karlinsky maintain that "within the euro- pean jewish family structure, women were the undisputed rulers of the household" (p. ). urban history review/revue d'histoire urbaine in canada, the constant striving of immigrant women to gain control in the private sphere of the family household spilled over into the conduct of public matters such as the running of family businesses. the family-owned restaurants, corner stores, boardinghouses and laundries in toronto's macedonian and chinese communities frequently operated more as "joint stock companies," with women playing indis- pensable and often equal roles with men, than as ventures following the dictates of patriarchal heads. all too often migration research ignores the social rela- tions and productive roles of immigrant women in their countries of origin and thus erroneously assumes that their entry into waged labour is a step towards emancipation. iacovetta, sturino and other authors emphasize that in the context of mass migration by men, women played key roles in their home countries' subsistence and burgeoning cash economies. in the old country, the distinction between men's and women's work became blurred as women increasingly engaged in back-breaking agricultural work, supervised family property and conducted family business with strangers. although the integration of immigrant women into the canadian capitalist labour market as new wage workers entailed novel forms of exploitation and new work experi- ences, it did not require a fundamental break in norms of hard work, or compliance with ethnic community structures. the ingenuity, resilience and entrepreneurialism of immigrant women were put to a severe test with the death of a husband and the loss of the major source of family income. the survival skills of widowed women are poign- antly conveyed in nipp's exploration of women in ontario's tiny chinese communities of the interwar period. one toronto widow kept her family alive by preparing a nutri- tious, though unsavoury, steady diet of fish heads. another diminutive widowed woman, whose feet had once been bound, supported her family in the laundry she ran by labouring seventy and eighty hours per week over boiling vats of clothing. community organizations formed another public site where the contradictory themes of women's submission to traditional roles and their self-expression and resistance to male dominance were played out. a central objective of many of the articles is to document the vital contributions made by immigrant women to their respective community's wel- fare, language, ethnocultural and religious education, and maintenance of group cohesion. constraints imposed by women's domestic responsibilities and the traditional male dominance of community governance inhibited the adoption of leadership positions by women in the majority of ethnic community structures. kojda, polyzoi, kaprielian and swyripa, writing about polish, greek, armenian and ukrainian women's associations respectively, report that such organizations accommodated to the supportive and subsid- iary tasks relegated to "ladies' auxiliaries" by male policy- makers. yet many women's organizations also provided both training grounds for the development of organizational skills and an atmosphere of cooperation and mutual assistance lacking in the more hierarchical structures of male-domi- nated organizations. during crises in the armenian community such as internecine struggles, the collectivism and solidarity nurtured by women's organizations could be mobilized to hold the community together, thus contradict- ing stereotypes of "women's proverbial obedience to their husbands" (p. ). draper and karlinsky document the more direct resistance taken by working class, east euro- pean jewish women in toronto who responded to their exclusion from decision-making in the labour zionist movement by forming their own pioneer women's organi- zation. the goals of this organization were both explicity feminist and socialist, until the holocaust and creation of israel shifted the attention of the community as a whole to political, nationalist concerns. epp and epp attribute the inroads made since the s by mennonite women into both the community's church organizations and professional careers to the influences of the feminist movement, including a more egalitarian divi- sion of domestic responsibilities and increased educational opportunities for women. the call by a significant segment of the ontario mennonite community for increased conserv- tism and retrenchment of male authority in mennonite households is a stark reminder of the fragile and contested nature of women's liberation in ethnic minority communi- ties, as in the society at large. looking into my sisters eyes helps redress the invisibil- ity of women in the canadian ethnic studies and immigration literature. one of the strengths of the book lies in the images it projects of immigrant women as creative and purposeful agents who manipulate and shape their social environments to varying degrees. the articles also collectively convey the diversities, ambiguities and contradictions that characterize the female immigrant experience, mediated by class, ethnic- ity and historical period of migration. before closing, it is useful to consider what has not been accomplished in this book. the methodological reliance on oral histories and community newspapers in many of the articles provides rich insights into women's lives from the perspectives of community spokespersons and the women themselves. but in pursuing this research strategy, some authors pay insufficient attention to factors 'external' to eth- nic communities. thus, the key influence in shaping immigrant women's work and home lives of structural con- straints (e.g.: local labour markets, state welfare policies, racial discrimination) and dominant societal ideologies are often ignored. some authors document the influence of rac- ist notions of 'assimilability' in limiting non-british immigration prior to the 'liberalisation' of immigration pol- icies in the s and s. they fail, however, to consider the significance for immigrant women of the racism which book reviews/comptes rendus permeated the culture of post-war ontario cities and which become attached to differences of an "ethnic" (non-british, non-protestant) character. (an important exception is iacovetta's account of the anxiety and fear among italian women in toronto during the s evoked by their daily confrontation with prejudice). the reader is also left with the impression that the pre- and post-war preoccupation among immigrant women with domesticity and familial responsibilities was a peculiarly "ethnic" trait, when such traditional ideas about women's appropriate roles characterized the dominant gender ideol- ogy of canadian society. the descriptive nature of some of the articles also precludes a more systematic treatment of issues of concern to feminist historiography such as the spec- ificity of the social relations and patriarchal ideologies mediating the sexual division of labour and demands of pro- duction and familial life for different groups of immigrant and ethnic women. looking into my sister's eyes represents an important beginning in studies presenting and validating the experi- ences of immigrant women in canada. some of the essays in this book help assimilate the experiences of immigrant women into existing analytical categories; the best of them aid in reconstructing our understanding of migration and social history to make it richer, more inclusive and carefully nuanced. daiva k. stasiulis department of sociology and anthropology carleton university baccigalupo, alain, avec la collaboration de luc rhéaume. les administrations municipales québécoises des origines à nos jours. tome , les municipalités. montréal: agence d'arc, . pp. . $ . . combien de fois n'avons-nous pas entendu ceux et celles qui s'intéressent au domaine des affaires municipales déplorer l'absence d'un ouvrage général abordant la question sous son angle administratif? c'est ce vide que l'auteur tente de combler en nous présentant son «anthologie administrative», qui devrait offrir un accès rapide à l'information que recèlent de nombreux textes législatifs et réglementaires ainsi que certaines publications gouvernementales régissant l'organisation et le fonctionnement des collectivités locales au québec. l'examen de la table des matières nous révèle qu'aucun des aspects importants n'a été oublié. c'est donc avec un certain enthousiasme qu'on entreprend la lecture de cet ouvrage, malgré le caractère aride des textes que regroupe généralement ce genre de recueil. cet enthousiasme est toutefois de courte durée. la déception vient dès le premier chapitre, consacré à l'histoire des administrations municipales. les textes portant sur chacune des trois périodes qui ont marqué la mise en place et l'évolution de nos institutions locales (régimes français, anglais et confédéral) devraient nous aider à mieux saisir comment et pourquoi certains changements institutionnels se sont produits. or, si on nous laisse entrevoir le comment, nous trouvons peu d'indices sur le pourquoi. le régime confédéral, source d'une répartition des pouvoirs qui servira de base à l'édification des structures actuelles, revêt une importance particulière; malheureusement, la section qui s'y rapporte nous laisse face à des textes pratiquement «livrés à eux-mêmes». ni l'introduction ni la conclusion du chapitre ne viennent combler cette lacune. Étant donné la complexité des structures administratives locales, on s'étonne de ce que l'auteur n'y consacre qu'une soixantaine de pages. des trois approches choisies pour aborder ce thème (sociologique, institutionnelle et conceptuelle), une seule réussit vraiment à l'éclairer: l'approche institutionnelle. quant aux deux autres, trop courtes et incomplètes, elles donnent l'impression d'un travail bâclé et laissent sur sa faim le lecteur qui espérait une vision globale du sujet. la partie de l'ouvrage consacrée aux élus locaux intègre habilement des textes législatifs, des témoignages et des tableaux concernant tant le processus électoral que l'exercice des fonctions d'élu. c'est là un des apports les plus intéressants du livre. le chapitre qui traite des fonctions publiques comporte un exposé très complet sur les fonctions des gérants locaux, leurs relations avec les élus et l'évolution de leurs rôles. il est dommage que les autres sections du chapitre n'aient pas bénéficié du même traitement; ainsi, on ne connaîtra des autres officiers municipaux que la définition législative de leurs fonctions, et des employés salariés que le contenu des diverses conventions collectives régissant leurs conditions de travail et les étapes du processus de recrutement. puisant à des sources plus variées que dans la plupart des autres chapitres, l'auteur arrive à mettre un peu de vie dans la longue enumeration que constitue le chapitre sur les services. il ne dépasse cependant pas cette enumeration, même si la conclusion propose un début de réflexion sur l'inégalité des citoyens devant les services offerts et sur la normalisation des niveaux de services municipaux. le livre se termine par un chapitre sur les finances municipales. on nous y présente les étapes et les débats qui ont mené à l'adoption récente de la loi sur la fiscalité municipale, et l'impact de cette réforme sur l'évaluation foncière et sur le revenu des municipalités. le sujet est complexe, mais l'auteur réussit à le clarifier et à faire ressortir coupled vulnerability and resilience: the dynamics of cross-scale interactions in post-katrina new orleans copyright © by the author(s). published here under license by the resilience alliance. gotham, k. f., and r. campanella. . coupled vulnerability and resilience: the dynamics of cross-scale interactions in post-katrina new orleans. ecology and society ( ): . http://dx.doi.org/ . /es- - research coupled vulnerability and resilience: the dynamics of cross-scale interactions in post-katrina new orleans kevin f. gotham and richard campanella abstract. we investigate the impact of trauma on cross-scale interactions in order to identify the major social-ecological factors affecting the pace and trajectory of post-katrina rebuilding in new orleans, louisiana, usa. disaster and traumatic events create and activate networks and linkages at different spatial and institutional levels to provide information and resources related to post-trauma recovery and rebuilding. the extension, intensification, and acceleration of cross-scale linkages and interactions in response to trauma alter organizational couplings, which then contribute to the vulnerability and resilience of social- ecological systems. rather than viewing urban ecosystems as either resilient or vulnerable, we conceptualize them as embodying both resilient and vulnerable components. this integrated approach directs analytical attention to the impact of socio-legal regulations, government policies, and institutional actions on resilience and vulnerability, which are also systemic properties of urban ecosystems. key words: disaster; hurricane katrina; new orleans; resilience; trauma; vulnerability introduction resilience and vulnerability are concepts scholars have developed to explain the interconnections, reciprocal effects, and feedbacks among human and natural systems. resilience studies seek to explain how and under what conditions ecological and human communities adapt and adjust, or transform and innovate in response to a shock or traumatic event (berkes et al. , brand and jax , norris et al. , resilience alliance , gunderson ). the term “vulnerability” represents the geographical, economic, political, or social susceptibility, predisposition, or risk factor of a group or community to damage by a hazardous condition. vulnerability studies examine the origin of hazards within coupled systems, the different capacities of social-ecological systems to respond to hazards, and the co-existence of adaptive and maladaptive couplings in vulnerable systems (blaikie et al. , comfort , cutter , bankoff , pelling ). what unites the diverse work of both resilience and vulnerability perspectives is the “overriding concern with the response of systems to stress or perturbations” (miller et al. ). vulnerability and resilience approaches emphasize the interaction between endogenous and exogenous processes in the stabilization and transformation of social- ecological systems. trauma refers to an extraordinary and potentially dangerous and life changing event linked to reactions and coping including but not limited to human responses (figley ). it may involve social and ecological disruption and devastation caused by war, terrorist strikes, pandemics, and natural disasters (e.g., fires, drought, hurricanes, floods, heat waves, tornados). hurricane katrina and the subsequent failure of the federal levee system in new orleans on august presents a prime case study of the impact of trauma on a major urban area—and on cross-scale interactions in the subsequent recovery. resilience and vulnerability, as well as the related concepts of adaptation and transformation, reveal both opportunities and challenges facing post- katrina new orleans, a disaster impacted urban ecosystem recovering from hurricane katrina, the great recession, and the deepwater horizon oil spill in . the paradoxical pairing struck the authors of a recent brookings institution report: “[d]espite sustaining three ‘shocks’ in the last five tulane university http://dx.doi.org/ . /es- - mailto:kgotham@tulane.edu mailto:rcampane@tulane.edu ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / years, greater new orleans is rebounding and, in some ways, doing much better than before” (liu and plyer : ). “entrepreneurship has spiked[,] surpassing the rate of individuals starting businesses nationally after having lagged the nation for nearly years[;] average wages in greater new orleans grew by nearly percent in the last five years, catching up to the national average” (liu and plyer : ). in addition, the median household income grew by four percent during – , to us$ , , despite declines nationally. the report concludes that “greater new orleans has become more ‘resilient,’ with increased civic capacity and new systemic reforms, better positioning the metro area to adapt and transform its future” (liu and plyer : – ). yet others lament the region’s vulnerabilities. despite billions of dollars spent rebuilding and upgrading levees and floodwalls, researchers contend the flood protection system remains inadequate for powerful hurricanes (freudenburg et al. ). since katrina, housing costs and crime have increased dramatically, contributing to neighborhood instability and social conflict. housing has moved beyond reach of the working class, with percent of renters paying more than percent of pre-tax income on rent and utilities. in addition, economic sectors such as petro- chemical and shipping have eliminated thousands of jobs over the last three decades, while new jobs have increasingly sprawled to the suburbs and exurbs and productivity remains stagnant (gotham and greenberg , plyer and campanella ). the deepwater horizon oil disaster “may further weaken legacy industries, and exposes the vulnerability of these sectors to offshore or water- related catastrophes” (liu and plyer : ). we examine the extension, intensification, and acceleration of cross-scale interactions in the aftermath of katrina to reveal the connections between resilience and vulnerability in social- ecological systems. by “cross-scale interactions” we mean influences, connections, and networks among institutions, government agencies, and networks to facilitate the flow of recovery information and resources. cross-scale interactions imply the ( ) extension or stretching of disaster recovery activities across borders, ( ) the intensification or magnitude of recovery activities and flows of investment and resources to encourage rebuilding, and ( ) the velocity or speed of flows, activity, and interchanges to accelerate post-disaster recovery and rebuilding. charting the extension, intensity, and velocity of cross-scale interactions involves identifying how and to what extent traumatic events affect patterns and processes of both vulnerability and resilience within and across urban ecosystems. cross-scale interactions are the communicatory and fiscal infrastructure through which government agencies and organizations circulate and transmit information and resources to facilitate post-disaster recovery and rebuilding. rather than viewing urban ecosystems as either resilient or vulnerable, we conceptualize them as embodying both resilient and vulnerable components. vulnerability and resilience are an interplay that presuppose each other—a duality, not a dualism. they are products of cross-scale linkages of policies, socio-legal regulations, networks, and organizations that facilitate some forms of action and decision-making while discouraging others. cross-scale interactions can alter organizational couplings, leading to adaptive couplings that promote resilience, adjustment, and innovation, but can also reinforce maladaptive couplings, which in turn can produce vulnerabilities to future stress and trauma. vulnerability and resilience in post-trauma urban ecosystems this analysis builds on scholarly works that have used urban ecosystem analysis in examining change and stability in patterns and processes of post- trauma social and ecological recovery (see ernstson et al. a, b, gunderson ). urban ecosystems analysis emphasizes interactions between cities and their environments. unlike natural ecosystems, however, urban ones are affected additionally by culture, infrastructure, personal behavior, politics, economics, and social organization (pickett et al. , grimm and redman ). central to urban ecosystems analysis is the view that “ecological” and “social” factors are “fundamentally combined” (swyngedouw : ), and display “conjoint constitution” or “mutual contingency” (freudenburg et al. ). rather than viewing humans as outside or apart from ecosystems, humans are agents of change acting within social-ecological systems (grimm et al. , grimm and redman ). as noted by the u.s. long-term ecological research network (lter :ii- ), ecosystems “self- organize from evolved components; interactions of slow processes with fast ones, and big processes with small ones, [to] create much of the pattern and http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / dynamics that we observe.” a major assumption of social-ecological research is that urban ecosystems are “coupled human and natural systems” (e.g., liu et al. ) or “social-ecological systems” (walker and meyers , folke ) that exhibit nonlinear dynamics with thresholds, reciprocal feedback loops, time lags, vulnerabilities, resilience, and heterogeneity. this important point suggests that we can conceptualize urban ecosystems as entities with nested hierarchies in which people and nature interact reciprocally across diverse organizational, spatial, and temporal levels. vulnerability and resilience are central concepts and approaches to understanding the response of urban ecosystems to trauma (miller et al. ). kasperson et al. ( ), adger ( ), and gallopín ( ) identify the major concepts of exposure, sensitivity, coping, and adaptive capacity as dominant in many studies of disasters, risk, poverty, and climate change. rather than viewing vulnerability as a direct outcome of a perturbation or stress, the work of blaikie et al. ( ), downing et al. ( ), and eakin and luers ( ), among others, examines how policy-makers, organizations, political economic processes, and power relations influence characteristics of exposure, susceptibility, and coping capacity. although vulnerability analyses differ in their theoretical intent and scales of analysis, they tend to examine how factors such as social class, race/ethnicity, gender, and age shape conditions and perceptions of vulnerability (freudenburg , perrow , klinenberg , auyero and swinstun ). scholars recognize that political, social, and economic processes influence estimates of vulnerability and peoples' ability to understand vulnerability and assess hazards. such a perspective eschews a notion of vulnerability as an a priori social condition and examines the social and political construction of vulnerability assessments, interpretations, and perceptions. fig. shows our conceptual framework for explaining the effects of trauma on cross-scale interactions, and the particular effects of these interactions on resilience and vulnerability. the figure suggests that we can understand the concepts of resilience and vulnerability only in relation to one another since both are properties of a social- ecological system. we view vulnerability as a condition that encompasses the features of exposure, susceptibility, and coping capacity. power relations, socio-cultural processes, and political economy shape and influence the variability of these features, making some groups more susceptible to stress and trauma than others. we view resilience as incorporating three factors: the ability to absorb shocks and trauma, the ability to bounce back and recover, and the ability to learn, adapt, and innovate. paraphrasing folke ( ), resilience refers to the ability of social-ecological systems to cope with and adapt to uncertainty and surprise. we explain cross-scale interactions in terms of the extension, intensification, and acceleration of government actions, interchanges between public and private actors, socioeconomic activities, and flows and networks of investment and finance. acknowledging these dimensions suggests an interpretive schema for describing cross-scale interactions, evaluating the impact of different kinds of public and private activities, and assessing what is novel about the pace and trajectory of the post- katrina recovery and rebuilding process. “flows” refer to the movement of commodities, money, people, and information across space and time, while “networks” refer to patterned interactions among agents, organizations, and activities. in this sense, cross-scale interactions involve increased interregional interconnectedness, a widening reach of networks of social activity, and the possibility that local events and actions (by individuals, corporations, and governments) can have far- reaching and long lasting consequences. increases in the extension, intensification, and acceleration of cross-scale interactions can influence the pace and trajectory of both post- disaster ecological and community system recoveries (liu et al. ). on the one hand, cross- scale interactions can promote adaptive couplings that involve processes of coordination, inter- and intra-government collaboration, social learning, knowledge sharing and integration, trust building, and conflict resolution (folke et al. , olsson et al. ). on the other hand, cross-scale interactions can promote maladaptive couplings that slow recovery, limit capacity for social-ecological renewal, and reinforce patterns and processes of vulnerability and unsustainable development. maladaptive couplings imply different forms of cross-scale interactions that perpetuate social- ecological inequality, generate and exacerbate group struggles and antagonisms, and impede conflict resolution. few studies have focused on the coupled nature of vulnerability and resilience in http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / fig. . conceptual framework for explaining the impact of trauma on social-ecological resilience and vulnerability. post-trauma urban ecosystems. we focus on how cross-scale interactions can generate both adaptive and maladaptive couplings in post-trauma urban ecosystems. we also recognize that resilience and vulnerability are not antonyms. rather, urban ecosystems exhibit both vulnerable and resilient qualities that are oftentimes products of past and present cross-scale interactions. three past cross-scale interactions linking local actions with federal policies and socio- legal regulations were important. first, the flood control act of authorized the army corps of engineers to create a series of joint federal, state, and local partnerships in which governments designed and built levees, floodwalls, and other flood control structures to protect the region from hurricane storm surges. while there were major alterations in these arrangements and designs over the decades, the overall intent was to encourage private investment in building urban infrastructure in the wetlands. second, the establishment of the national flood insurance program (p.l. - ) in served as a major socio-legal mechanism to urbanize the wetlands by subsidizing private insurers to write policies in areas at risk for flooding and hurricane damage. third, the building of the mississippi river gulf outlet (mr-go) navigation canal in the s operated as a conduit to dramatically increase salinity in the marshes and thereby devastate the wetlands (fig. ). before closure in , mr-go had contributed to the erosion of , – , hectares ( , – , acres) of wetlands, as much as of the , http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / fig. . mississippi river-gulf outlet canal. square kilometers ( of the square miles) of wetlands that had previously stood to the southeast of new orleans, an area that was in the bull's eye of hurricane katrina's storm surge that engulfed the city and region. all of these s developments interacted with the long-term degradation of surrounding wetlands through a combination of upstream dams and river channeling, and oil and gas exploration in southern louisiana. in sum, the confluence of suburbanization, growth pressures, and ecological degradation of the surrounding wetlands in the new orleans region after the s created long-term environmental, social, and economic problems that involve complex feedback loops. past federal, state, and local government interactions encouraged suburban development in the swamps and marshes, which increased vulnerability of human settlements and infrastructure to storm surge events and flooding. thus, hurricane katrina was a trigger event and not the actual cause of the massive flooding and subsequent property damage that affected the new orleans region. new orleans' poorly designed and constructed levees and floodwalls collapsed under moderate hurricane conditions due to the feedback effects of past cross-scale interactions. the transformation of the regional landscape with levees, canals, floodwalls, and real estate development in the swamps disguised risk in the built environment and generated future vulnerabilities to hurricanes and flood hazards. these points http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / table . funding history of community development block grant supplemental appropriations for hurricane katrina disaster relief. public law funding intended use of funds p.l. - . department of defense, emergency supplemental appropriations to address hurricanes in the gulf of mexico, and pandemic influenza act, (december , ) us$ . billion (louisiana receives $ . billion) hurricanes katrina, rita, and wilma. community development block grant (cdbg) funding for activities and necessary expenses related to disaster relief, long-term recovery, and restoration of infrastructure in the most impacted and distressed areas related to the consequences of hurricanes in the gulf of mexico in in states for which the president declared a major disaster under title iv of the robert t. stafford disaster relief and emergency assistance act ( u.s.c. et seq.). ( stat. ) pl - . emergency supplemental appropriations act for defense, the global war on terror, and hurricane recovery act of us$ . billion (louisiana receives us$ . billion) second supplemental appropriation of cdbg funding for activities and necessary expenses related to disaster relief, long-term recovery, and restoration of infrastructure in the most impacted and distressed areas related to the consequences of hurricanes in the gulf of mexico in in states for which the president declared a major disaster under title iv of the robert t. stafford disaster relief and emergency assistance act ( u.s.c. et seq.). ( stat. ) p.l. - . department of defense appropriations act for fy (november ) us$ billion (for louisiana) cdbg funding specifically for the state of louisiana’s “road home” homeowner assistance program sources: boyd ( ), hud ( ) connect with the work of bankoff ( ), who notes that cross-scale interactions and their effects on urban vulnerability and resilience have a historical trajectory. social-ecological processes interact over temporal and spatial scales simultaneously, suggesting that we must understand cross-scale interactions in historical as well as spatial context. cross-scale processes of post- katrina renewal and recovery since katrina, the federal government has relied on pre-existing as well as newly developed funding programs to encourage cross-scale interactions among government agencies, private firms, and nonprofit organizations to facilitate recovery and rebuilding. congress has authorized almost us$ billion for the army corps of engineers to repair and design the levee system that is supposed to protect new orleans and surrounding parishes from storm surge flooding caused by hurricanes with a one percent chance of occurring in any year, often referred to as a -year storm. the largest source of grant assistance has been the community development block grant program, which provides funding for neighborhood revitalization and housing rehabilitation activities and affords states broad discretion and flexibility in deciding how to allocate federal funds and for what purposes. to date, congress has appropriated us$ . billion for gulf coast rebuilding assistance, the largest amount in the history of the program (table ). the federal government has also used long- established grant programs such as the temporary assistance for needy families and the social services block grant programs to supply financial and human recovery assistance to louisiana residents. there have also been several newly created grants with emergency supplemental funds designed to provide human recovery assistance to hurricane-affected areas. some of these grants include the department of health and human services’ primary care access and stabilization grant and the department of housing and urban development’s (hud) disaster housing assistance program. table provides an overview of selected federal funding programs that facilitate gulf coast recovery. it provides evidence of the diversity of policies and programs that the federal government has used and created to increase the extension, http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / table . selected federal funding programs providing support to victims of hurricane katrina. federal funding programs description temporary assistance for needy families (tanf) the department of health and human services’ (hhs) tanf program provides assistance and work opportunities to needy families by granting states, territories, and tribes federal funds to develop and implement their own welfare programs. community development block grant (cdbg) the department of housing and urban development’s (hud) cdbg program provides grants to help cities, counties, and states recover from presidentially declared disasters, especially in low-income areas, subject to availability of supplemental appropriations. social services block grant hhs distributes social services block grant funds to enable states to provide social services to residents. such services may include daycare and protective services for children or adults, special services to persons with disabilities, adoption, case management, health-related services, transportation, foster care for children or adults, substance abuse services, housing, home-delivered meals, independent/transitional living, employment services, or any other social services found necessary by the state. cdbg workforce housing grant this hud grant targets housing to those between percent and percent of the area median income. cdbg entitlement communities through this cdbg program hud allocates annual grants to large cities and urban counties to develop sustainable communities. low-income home energy assistance program the low-income home energy assistance program is a federally funded block grant program administered by hhs and implemented at the state level. the grant serves individuals and families from low-income households who seek assistance for their home energy bills. federal emergency management agency (fema) community disaster loans fema offers these loans to any eligible jurisdiction in a designated disaster area that has suffered a substantial loss of tax and other revenue. the jurisdiction must demonstrate a need for financial assistance to perform its governmental functions to maintain essential services such as public schools, and fire and police services. fema voluntary agency liaison (val) as the primary liaison to the nonprofit community, vals are responsible for initiating and maintaining a working relationship between fema; federal, state, and local agencies; and nonprofit organizations. as of , fema's val program had memorandums of understanding with nonprofit organizations charged with implementing fema programs. these nonprofits include national voluntary organizations active in disaster, american red cross, the salvation army, united methodist committee on relief, adventists community services, church world service, feeding america, mennonite disaster service, northern american mission board—-southern baptist convention, and operation hope usa. office of the federal coordinator (ofc) for gulf coast rebuilding in february , the ofc and fema formed a transparency initiative, a web- based information sharing network to track the status of selected public infrastructure building projects (such as school or hospital) by providing detailed information on the public assistance grants funds allocated for the project. in , the ofc partnered with the white house to develop intra-government (horizontal) networks that link the white house office of faith-based and neighborhood partnership centers with federal agencies including the department of homeland security, hud, and the small business administration. these agencies, in turn, helped buttress and reinforce cross-scale networks with local community and faith-based organizations through the provision of temporary staff, training, and technical assistance. gulf opportunity zone low-income housing tax credit program hud designed the gulf opportunity zone low-income housing tax credit program to provide tax incentives for developing affordable rental housing along the gulf coast. primary care access and stabilization grant hhs awarded the primary care access and stabilization grant to louisiana to help restore primary health care services to low-income populations. (con'd) http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / disaster housing assistance program this hud program provides temporary long-term housing rental assistance and case management for households affected by hurricanes katrina and rita. community mental health services block grant the substance abuse and mental health services administration’s community mental health services block grant is awarded to states to provide mental health services to people with mental disorders. continuum of care program hud’s continuum of care program is a set of three competitively awarded programs (supportive housing program, single room occupancy program, and shelter plus care program) created to address the problems of homelessness in a comprehensive manner with other federal agencies. disaster case management pilot program fema uses funds from its disaster relief fund to provide state and local governments with federal disaster recovery assistance. the state-managed disaster case management pilot program is intended to help households in louisiana and mississippi achieve permanent housing. katrina aid today (kat) fema awarded a -year case management grant that channeled us$ million of foreign donations to the united methodist committee on relief (umcor). umcor used the grant to establish kat, a national consortium of nine social service and voluntary organizations, to provide case management services to victims of hurricane katrina. at the completion of its grant funded activity in march , kat had enabled case management services for approximately , households. as the umbrella grants manager, umcor provided financial compliance monitoring, technical assistance, and training to the nine consortium members. source: gao ( ) magnitude, and speed of disaster recovery and rebuilding activities and resources across scales. three examples are relevant. first, federal resources have encouraged faith-based organizations to mobilize and assist other nonprofits' access to available federal funds in order to deliver much needed services. using us$ million in federal emergency management agency (fema) channeled foreign donations, the united methodist committee on relief established the katrina aid today (kat), a national consortium of nine sub-grantees, to distribute grants to other nonprofit organizations. at the completion of its grant-funded activity in march , kat had enabled case management services for approximately , households. second, the national response framework designates the fema voluntary agency liaisons (val) as the primary liaisons for initiating and maintaining a working relationship between fema; federal, state, and local agencies; and nonprofit organizations. vals helped expand cross-scale networks of activity by linking the federal government to the nonprofit sector through state-level intermediaries. as of , fema's val program had memorandums of understanding with nonprofit organizations charged with implementing fema programs. these nonprofits include national voluntary organizations active in disaster, american red cross, the salvation army, united methodist committee on relief, adventists community services, church world service, feeding america, mennonite disaster service, northern american mission board–southern baptist convention, and operation hope usa. third, the office of the federal coordinator (ofc) for gulf coast rebuilding in the department of homeland security has played a key role in encouraging the formation of new cross-scale interactions and networks of activity through information sharing, grant distribution, and knowledge exchange with nonprofit organizations. in february , the ofc and fema formed a transparency initiative, a web-based information- sharing network to track the status of selected public infrastructure building projects (such as school or hospital) by providing detailed information on the public assistance grants funds allocated for the project. in , the ofc partnered with the white house to develop intra-government (horizontal) networks that link the white house office of faith- based and neighborhood partnership centers with federal agencies, including the department of homeland security, hud, and the small business http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / administration. these agencies, in turn, helped buttress and reinforce cross-scale networks with local community and faith-based organizations through the provision of temporary staff, training, and technical assistance (gao ). acceleration of cross-scale interactions recent advances in computing and communications technology have been central to accelerating cross- scale interactions and flows of activity related to post-disaster recovery and rebuilding. online disaster response capacities have expanded due to the integration of the internet with key geospatial technologies such as remote sensing, geographic information systems (gis), and global positioning systems (gps). use of the internet enhances the delivery of geospatial information to a larger audience, facilitating greater exchange of information, and increasing the speed of communication. in the immediate aftermath of katrina, websites dedicated to assisting evacuees, such as katrinacentral.com, craigslist.org, and nola.com, allowed people in remote and distant places to follow the relief effort. message boards, such as nola.com, provided information about shelter locations, family tracing, and missing persons. many displaced persons used wiki software as an organizational tool to create web portals to web pages such as those identifying immediate shelter needs (shelterfinder) and family tracing (peoplefinder). in addition, electronic communication and information technologies allowed people to donate money quickly for immediate disaster relief efforts. nearly one million people visited the american red cross website on the wednesday following katrina, a figure that was times the average amount of traffic to the nonprofit organization’s website (dang and burris , noguchi ). information and communication technologies that increase the velocity of cross-scale interactions provide for the establishment and routinization of “bridging” links that connect otherwise spatially dispersed and unconnected organizations to diverse networks and flows of post-disaster resources (tompkins and adger ). the development of gis, remote sensing, and the internet accelerate information flows and rapidly diffuse ideas, information, decisions, people, and diverse forms of capital. the increased velocity of diffusion, in turn, multiplies the number of bridging connections between individuals, organizations, groups, and communities. the fast transmission rate allows for quick responses to stresses and threats. the increasing speed of response is typically seen as enhancing resilience and adaptive capacity and reducing vulnerability (e.g., through real-time monitoring, fast delivery of humanitarian aid). more important, the proliferation of bridging connections creates new opportunities for social learning because the various components of the system are able to observe activities in other components. in short, bridging links encourage communities to communicate, exchange information and knowledge, and help foster vertical and horizontal relationships for proactive resilience building (newman and dale ). by sharing information and knowledge, communities are able to learn and incorporate new behaviors and actions into their repertoires of recovery to create novel and innovative processes and patterns of post-disaster redevelopment (norris et al. ). yet there is a dark side to information and communication technologies. technologies are capable of empowering nefarious or exploitive agents in times of crisis, as revealed by various fabrications and myths that circulated online after katrina. in the weeks following the disaster, online discussions and media portrayals obsessed on images of social breakdown, lawlessness, and violence. media outlets described the descent of new orleans into anarchy with “hundreds of armed gang members killing and raping people” and storm victims shooting at rescue crews (thevenot and russell :a ). various news reporters described the new orleans convention center, which became an unofficial gathering place for storm victims, as “a nightly scene of murders, rapes and regular stampedes” (thevenot : ). such reports constructed disaster victims as “lawless, violent, exploitative, and almost less than human” (tierney et al. : ). statements made by city officials—including the mayor and police chief— helped fuel some of the more extreme myths of mayhem during the new orleans disaster, including reports of rampant murder, “babies being raped,” and armed thugs taking control (dwyer and drew , pierre and gerhart :a , dynes and rodriguez ). the unsubstantiated and later discredited atrocity tales coming out of new orleans provided political ammunition to politicians looking to discredit government actions devoted to the recovery effort. http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / federal-local linkages and the role of nonprofit organizations one notable feature of the post-katrina rebuilding effort has been the reliance on nonprofit organizations to deliver services. rather than relying solely on government agencies, the federal government has increasingly partnered with nonprofit organizations because of their flexibility, diversity of functions, quick response rates, and extant and oftentimes trusting relationships with local communities (gao ). congress passed legislation to encourage nonprofit organizations to create networks of activity for the delivery of federal assistance to gulf coast residents. most notably, provisions in the post-katrina emergency management reform act of expanded eligibility requirements for nonprofit organizations to receive fema grant assistance. in order to deploy more highly trained workers to impacted communities, the federal corporation for national and community service waived state matching requirements for sponsoring americorps workers in louisiana and counted the cost of housing them as an in-kind match for sponsoring americorps workers (corporation for national and community service ). these program waivers made it easier for nonprofits with limited financial resources to sponsor americorps workers to increase capacity to serve disaster victims and communities. table provides examples of some of the nonprofit organizations that have partnered with the federal government to help build the capacity of direct service providers. these nongovernment partners provide human resources, guidance, training, funding, and technical assistance for gulf coast recovery. the cross-scale post-katrina rebuilding activities of the nonprofit organizations listed in table would be difficult to undertake were it not for federal government actions. federal grant programs have incentivized efforts to create new partnerships and collaborations among nonprofit organizations to provide financial, technical, and support services to gulf coast communities. in its – retrospective, the louisiana disaster recovery foundation reported awarding grants totaling nearly us$ million to nonprofit organizations involved in louisiana’s recovery process (gao : ). organizations such as the louisiana association of nonprofit organizations ([lano] ) had an existing communications infrastructure with more than nonprofits within the state of louisiana before the storm. lano accessed this network following the hurricane to disseminate grant and technical information, provide vital resource referrals, and communicate about available training workshops for nonprofit service providers. at the end of , fema officials in louisiana reported that more than us$ million in donated dollars, volunteer hours, and goods had been leveraged through long-term recovery groups to provide permanent housing and address other unmet needs. also, federal hazard mitigation grants have provided funds to raise homes to base flood elevation levels, and thereby have assisted community efforts to reduce vulnerability to future flooding. in addition, community organizations and networks have transmitted information and thereby increased awareness of the importance of purchasing flood insurance. overall, the organizations listed in table have played major roles in building a network of adaptive capacities by engaging local people in recovery and mitigation, creating organizational linkages, and establishing new social supports. in short, federal government policies and programs have been crucial in establishing a series of cross- scale interactions among government agencies and nonprofit organizations to promote coordination and capacity building. direct and indirect funding programs have helped create, activate, and reinforce vertical and horizontal linkages between governments and secular and faith-based nonprofit organizations to deliver and manage resources to support rebuilding efforts. in the aftermath of hurricane katrina, catholic, mennonite, salvation army, and other faith-based relief groups linked up with large secular nonprofit organizations such as the red cross to form the greater new orleans disaster recovery partnership (gnodrp), a major relief network that crossed parish lines and embraced an entire region. after most disasters, private, nonprofit relief organizations create country-based networks or roundtables to coordinate their work and share resources. for instance, a methodist relief agency assisting an earthquake-affected family can go to its country-based roundtable and make request to a partner, perhaps catholic charities, for a donation of cash or volunteers from catholic organizations to help methodist volunteers support affected families. gnodrp represents the first time in which major religious and secular nonprofit groups established a region-wide network to coordinate work and share resources, including http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / table . nonprofit organizations involved in post-katrina rebuilding in new orleans. nonprofit organization mission national voluntary organizations active in disaster (national voad) coalition of national nonprofit organizations that share knowledge and resources throughout the disaster cycle to help disaster survivors and their communities. members include the american red cross and the salvation army. state voads in louisiana consortium of voluntary organizations that are active in disasters within the states of louisiana and mississippi. their mission is to foster more effective service to people affected by disaster. local/community voads in louisiana consortium of voluntary organizations that are active in disasters at the local and community levels long-term recovery committees/organizations in louisiana groups of community leaders, including nonprofit, interfaith, local government, and private sector leaders, whose mission is to identify needs that have not been addressed through insurance or governmental aid and to match up voluntary agency sources and/or local sources for goods and services to meet those needs greater new orleans disaster recovery partnership coalition of + member agencies, including faith-based, nonprofit, government liaison, and long-term recovery organizations, that serve those impacted in the greater new orleans region neighborhoods partnership network nonprofit organization consisting of a citywide network of neighborhoods that was established after the hurricane katrina disaster to facilitate neighborhood collaboration, increase access to government and information, and strengthen the voices of individuals and communities across new orleans louisiana odyssey house organization that provided crisis, mental health, and substance abuse counseling through the use of federal funding catholic charities archdiocese of new orleans organization that contracted with the louisiana state office of mental health and the resulting louisiana spirit hurricane recovery project, funded by fema, to help provide intervention and mental health services to its clients mercy family center organization that provided crisis, mental health, and substance abuse counseling through the use of federal funding louisiana family recovery corps organization that facilitates human recovery in louisiana by partnering with human service and nonprofit agencies throughout the state and country to deliver assistance as effectively and efficiently as possible beacon of hope resource center nonprofit organization that serves new orleans neighborhoods and whose mission is to assist homeowners in the city of new orleans in the rebuilding process rebuilding together new orleans program of the preservation resource center of new orleans that focuses on home rehabilitation and community recovery using a combination of volunteer and professional labor funded by corporate, private, and public dollars, volunteers, and help from the americorps program louisiana association of nonprofit organizations (lano) statewide network of nonprofits, foundations, corporations, and individuals dedicated to supporting louisiana’s nonprofit sector. lano’s mission is to strengthen, promote, and build the capacity of nonprofits through education, advocacy, and member services. source: gao ( ) http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / building materials. from to , the gnodrp distributed more than us$ million in aid to more than families (nolan ). cross-scale networks as sources of resilience ecologists and social scientists have long recognized that processes that interact across spatial and temporal scales influence both post-trauma ecological and community system recoveries. holling ( ) labels a post-disturbance period of renewal and recovery as the “alpha phase,” in which the system is most vulnerable to random and chance events. this is also the phase in which many opportunities emerge for enhancing resiliency and reconfiguring the system for growth and development. gunderson ( ) describes this alpha phase as a “window of opportunity” in which novel actions and innovative changes are possible. post-trauma situations can be ripe for members to revaluate old patterns and processes of community organization, identify problems and limitations of social-ecological structure and function, and develop alternative plans for recovery and renewal that allow the system to develop in a new and different trajectory (holling , berke and campanella , masten and obradovic , gunderson ). the challenge, of course, is for communities and organizations to turn disturbances, disasters, and other forms of trauma into opportunities for reinvention and innovation. as mutter ( : ) has recently asserted, “a disaster that sweeps away shoddy infrastructure can be an impetus to improve roads, hospitals and industry.” in considering “deep solutions ... policy- makers must formulate plans to turn disasters into opportunities” (mutter : ). since katrina, neighborhood coalitions, nonprofit organizations, and cultural associations have mobilized to form novel collaborations and networks to leverage private and public resources to rebuild new orleans, increase flood awareness and protection, and maximize community participation to nurture social-ecological resilience. some of these organizations are described in table . shortly after the disaster, new orleans residents formed the neighborhoods partnership network (npn) as a nonprofit organization consisting of a citywide network of neighborhoods to facilitate neighborhood collaboration, leverage public and private investment, and engage civically. the npn helped create a “citywide framework to assist communities in accessing limited resources and information while providing connections to other communities that have similar obstacles so that communities can avoid duplicating efforts and work toward shared goals” (http://www.npnnola.com/about/ ). important, we view the npn and the organizations listed in table as vehicles of community resilience that mobilize emergency and ongoing support services for disaster survivors through both pre- existing and newly created organizational networks this observation corroborates the work of norris et al. ( : ), who note that building post-disaster community resilience is a process of “linking a network of adaptive capacities (resources with dynamic attributes) to adaptation after a disturbance.” nonprofit organizations, neighborhood coalitions, and other organizations are characterized by reciprocal links that broaden “the scope of actors, agents, and knowledge that can be marshaled” (comfort : ) not only for the purpose of community recovery but also for developing new strategies to lessen future disaster risk and vulnerability. private foundations have been important institutions in linking the top-down actions of the federal government with the bottom-up actions of grassroots community organizations. during the five years since the flood, the rockefeller foundation has awarded grants totaling us$ million to new orleans civic institutions and organizations, with a special emphasis on enhancing citizen participation. other foundations such as brad pitt's make it right (mir) foundation have formed networks of local groups and international organizations to seek donations, corporate sponsors, and seed capital to catalyze neighborhood redevelopment. while pitt is the celebrity spokesperson for the mir foundation, much of the planning takes place among the renowned designers and planners within the architecture firms that comprise the organization. pitt asks foundations, corporations, and individuals to contribute to the project by adopting one house, several houses, or a portion of a house through the project website. the mission of the mir foundation is to redevelop the lower ninth ward by building a neighborhood of high quality, affordable, and environmentally conscious homes that reflect and promote sustainable development. as of january , mir had constructed homes, gained worldwide attention for the urban sustainability movement, and —much to its chagrin—emerged as a must-see site for bus tours. http://www.ecologyandsociety.org/vol /iss /art / http://www.npnnola.com/about/ ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / ironically, mir’s decision to rebuild the neighborhood closest to the most severe high- velocity breach flooding, on a site that is mostly below sea level, isolated from the urban core, and adjacent to two risk-inducing humanmade navigation canals, has been criticized by some experts as increasing vulnerability—even as mir purports to do the exact opposite. indeed, some voices (both local and outside) questioned the wisdom of rebuilding heavily flooded, low-lying, far-flung subdivisions at all, in light of massive population losses since the s and particularly since katrina, while others (entirely outsiders) pondered whether the entire city would be better off abandoned or relocated. in nearly every case, the opining voices generally saw their arguments as rational, scientifically substantiated strategies that would increase future resilience and decrease vulnerability. this debate over “shrinking the urban footprint,” which played out polemically in the year following katrina, illustrates how resilience and vulnerability not only co-exist empirically in post- trauma environments, but also perceptually. cross-scale interactions not only empower new collective agents such as private foundations but also play a role in generating resilient ecosystem services such as improved mitigation of flooding, freshwater diversion projects, and re-introduced habitats (ernstson et al. b). the case of the mississippi river gulf outlet (mr-go), an environmentally deleterious navigation channel opened in , is illustrative. various parties across scales—from rural citizens to urban environmentalists, from local officials to scientists —have blamed the channel for the erosion of wetlands along lake borgne and for expediting hurricane storm surge into chalmette and new orleans. after congress ordered it closed, the army corps of engineers proposed its mr-go ecosystem restoration plan to protect or rebuild square kilometers ( square miles) of wetlands over years, beginning as early as . blocking salt water from the gulf and creating a freshwater diversion from the mississippi river into lake borgne would keep salinity levels low enough to allow vegetation to take root and thrive. the restoration plan also seeks to reduce erosion and hold soil in place to help healthy cypress forest and wetlands provide additional protection from future storms (fig. ). cross-scale pathologies and post- katrina vulnerability scholars recognize that cross-scale interactions vary in form and consequence (cash et al. ). on the one hand, they can expedite the delivery of resources to needy communities, mitigate conflict, speed recovery, and build resilience. olsson et al. ( ) and tompkins et al. ( ) have hypothesized prerequisites for sustained interaction between stakeholders in resource co-management that include ( ) the enabling of constitutional order and legislation, ( ) the ability of organizations to monitor and adapt their co-management experiments, and ( ) the presence of leaders and agents for change. on the other hand, cross-scale interactions can concentrate power and degrade resources for community resilience. berkes ( ) draws attention to “cross-scale institutional pathologies” where actions and inactions by powerful stakeholders can undermine trust, breed discontent, and disempower communities. government agencies can degrade community resilience and perpetuate vulnerabilities by using information and resources from cross-scale interactions to reinforce their political authority, promote narrow self- interests, and exploit disadvantaged groups. one way in which cross-scale linkages can reproduce human vulnerabilities to trauma is through policies that reinforce and perpetuate socio- spatial inequalities. louisiana’s road home program, which gives up to us$ , in grants to homeowners to rebuild their flooded homes, offers a case study. over the last several years, housing activists and civil rights groups have alleged that the road home program used a discriminatory formula in distributing awards. under road home rules, officials calculated rebuilding grants on the basis of the lower of two figures: the pre-storm market value of the home, or the cost of the storm damage to the house. by definition, therefore, homeowners received sufficient assistance to rebuild their homes if the cost of damage was lower than the pre-storm value, or homeowners received insufficient funds to rebuild if the pre-storm value was less than the actual cost of damage. under this formula, owners of identical homes with similar storm damage and repair estimates would receive very different grant awards based on where they lived (bates and green ). because african americans in new orleans generally live in historically segregated neighborhoods with depressed property values, they received http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / smaller road home compensation awards and therefore a fraction of the funds needed to rebuild their homes. as a result, many homeowners have not been able to complete repairs to their homes and move back into their communities. post-katrina rebuilding decisions and policies that perpetuate social inequalities are spawning not-in- my-backyard (nimby) movements dedicated to preserving pre-katrina demographic patterns. three examples are noteworthy. first, in october , the greater new orleans fair housing action center filed a federal lawsuit to overturn a suburban st. bernard parish ordinance that prohibits owners from renting to anyone who is not a blood relative. the suit contends that the ordinance, passed after the storm, will perpetuate segregation and reinforce the predominantly white character of the parish (rioux ). second, in , the suburban jefferson parish council passed a resolution objecting to any applications by developers to use federal tax credits to build government subsidized low-income housing (gordon ). third, since , homeowners and legislators have attempted to block efforts by developers and fair-housing advocates to build new multifamily housing developments in new orleans east, a heavily flooded area of the city. several attempts by the city council to pass blanket moratoria on such affordable housing led to claims of discrimination and threats of legal action, eventually forcing the city council to abandon such efforts. leaders from new orleans east, who are disproportionately middle class and upper middle class african americans with economic and political clout, have attempted to ban new multifamily developments, saying a glut of them has turned the once solidly middle class area into a dumping ground for the poor and thereby has destroyed property values and increased crime. the three cases together illustrate that class as well as race motivate the various civic attempts to perpetuate social inequities (hammer ). political mobilization against affordable housing both reflects and reinforces segregationist housing patterns, and complicates efforts to rebuild neighborhoods. scholars have long recognized that housing policies and real estate practices that preserve and enhance affordable housing are critical for the socioeconomic resilience of neighborhoods (wallace and wallace ). in new orleans, current policies and decisions are exacerbating the housing problems caused by the disaster as skyrocketing rents and housing costs are burdening not only the poor but the working and middle classes. cross-scale linkages can promote social antagonisms if communities believe that government agencies are withholding vital information, elected officials are dishonest, or government agencies distribute resources unfairly or unequally. over the last several years, coalitions of neighborhood residents in the lower ninth ward have complained about the dearth of recovery projects in the struggling community. residents have complained that city leaders have misappropriated recovery money to create new amenities in other neighborhoods, while their infrastructure remains devastated. city leaders acknowledged certain disparities but held that fema had not approved federal financing for recovery projects in the neighborhood. for some residents, incomplete information fuels perceptions that city leaders are dishonest and exploitative (krupa ). the above examples corroborate the work of adgar et al. ( ) and ernstson et al. ( a), who note that legitimacy and efficacy of governance systems depends on equitable distribution of benefits from cross-scale linkages through the mechanisms of accountability, transparency, and trust. information asymmetries that derive from knowledge concealment, restraint, and unequal control are not likely to generate sustainable development or facilitate social learning in cross-scale interactions. if government regulators, for example, mobilize information and resources from cross-level interactions to reinforce their authority, other stakeholders, such as resource users, are often disempowered. information and knowledge asymmetries within the social-ecological governance system have reinforced inequalities, intensified conflicts, and bolstered enmity and distrust. these problems have complicated recovery effort, slowed long-term rebuilding, reinforced vulnerabilities, and weakened social-ecological resilience. conclusion we have examined the extension, intensification, and acceleration of cross-scale interactions as major forces shaping patterns and processes of social- ecological vulnerability and resilience in the new orleans urban ecosystem. cross-scale interactions are the communicatory infrastructure through which information, resources, and other forms of http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / capital flow. how social-ecological processes interact over temporal and spatial scales is one of the key factors in the resilience and vulnerability of different parts of a social-ecological system, whether it is an urban community or a natural ecosystem. the usefulness of the concepts of vulnerability and resilience lie in the attempt to separate extra-local patterns and regularities from the context-laden urban environment, and reveal the reciprocal feedback effects of human action and urban ecosystem transformation. we provided a conceptual framework to assess the impact of government policies, programs, and other forms of activity on the transformation of organizational couplings in a dynamic urban ecosystem. different socio-legal regulations and government policies have helped constitute and shape various cross-scale linkages that both promote resilience and vulnerability in the new orleans urban ecosystem. traumatic events and disasters alter organizational couplings in social-ecological systems by extending, intensifying, and accelerating cross- scale interactions. by creating and extending linkages among diverse agents and institutions, cross-scale interactions have enabled the different components of the new orleans urban ecosystem to take advantage of opportunities, leverage resources, and learn from activities happening in other components. our findings buttress the work of young et al. ( : ), who assert that “the existence of many interconnections may enhance the robustness or resilience of large-scale [social- ecological systems] by diluting and distributing the impact of strong changes in individual elements upon other elements of the system.” cross-scale interactions have linked social and technical networks to activate and sustain processes of self- organization and social learning for innovation and progressive transformation. trust, cooperation, and sharing of information and resources has been necessary to implement policies and management actions to build knowledge, incentives, and learning capabilities into institutions and organizations for post-katrina recovery and rebuilding (folke et al. , gunderson and folke ). overall, our analysis supports turner et al. ( ), who argue that resilience is not the flip side or opposite of vulnerability. different socio-legal regulations and government policies have helped constitute and shape various cross-scale linkages that both promote resilience and vulnerability in the new orleans urban ecosystem. at the same time, our analysis demonstrates that cross-scale interactions can produce maladaptive couplings or negative feedbacks that perpetuate social inequalities and reinforce socio-spatial vulnerabilities to stress and trauma. this insight reinforces adger et al. ( : ), who note that cross-scale interactions “are by no means a zero- sum game.” rather, some linkages and connections “emerge that radically alter the playing field while others reinforce existing inequalities between powerful and less powerful players.” cross-scale linkages that promote and legitimize exclusionary policies, environmentally destructive growth practices, and exploitative land use decisions degrade resilience to disasters. currently, contested property rights, land claims, and land use planning processes both complicate and problematize the adaptive capacity of communities in the metropolitan region and could jeopardize long-term efforts to restore the wetlands ecosystem. furthermore, if social and political institutions do not promote more equitable and sustainable forms of development, it is less likely that communities will be able to adapt and respond effectively to future trauma. how institutions define and allocate property rights and develop water and land use planning practices is important for community adaptive capacity because they influence access to resources, wealth, well-being, and livelihood. finally, the integrated vulnerability-resilience perspective we have adopted suggests a multiscale approach to understanding the drivers of urban susceptibility and adaptive capacity in urban ecosystems. social and natural systems are deeply interwoven, and their dynamics of change are uneven and long term. patterns and processes of resilience and vulnerability involve complex relationships among political, socioeconomic, and cultural elements that vary across a range of temporal and spatial scales. cross-scale interactions shape the socioeconomic and institutional conditions that constrain and enable effective response and adaptation to stress and perturbation for social-ecological systems. yet we lack knowledge of how cross-scale interactions can stabilize some social-ecological components, degrade and/or improve other components, and affect the pace and trajectory of urban ecosystem transformation. wars, economic and financial crises, major shifts in food and fuel prices, technological changes, and land use policy are large in magnitude, spatially extensive, and transform social-ecological systems over long time periods. http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / infrequent events can radically alter trends and disrupt prevailing cross-scale interactions to the detriment of some communities and benefit of other communities. individual cases may be unique, and our ability to generalize or predict may be severely limited. understanding how cross-scale interactions affect extensive, pervasive, and subtle change is therefore one of the most important challenges for urban ecosystem science. responses to this article can be read online at: http://www.ecologyandsociety.org/vol /iss /art / responses/ acknowledgments: support for this research came from the national science foundation (nsf). literature cited adger, n. w. . vulnerability. global environmental change : – . adger, n. w., k. brown, and e.l. tompkins. . the political economy of cross-scale networks in resource co-management. ecology and society ( ): . [online] url: http://www.ecologyandsociety. org/vol /iss /art auyero, j., and d. swistun. . the social production of toxic uncertainty. american sociological review. : . http://dx.doi.org/ . / bankoff, g. . cultures of disaster: society and natural hazard in the philippines. routledge, london, uk. bankoff, g. . comparing vulnerabilities: toward charting an historical trajectory of disasters. historical social research ( ): – . bates, l. k., and r. a. green. . housing recovery in the ninth ward: disparities in policy, process, and prospects. pages – in r. d. bullard and b. wright, editors. race, place, and environmental justice after hurricane katrina: struggles to reclaim, rebuild, and revitalize new orleans and the gulf coast. westview press, boulder, colorado, usa. berke, p. r., and t. j. campanella. . planning for postdisaster resiliency. the annals of the american academy of political and social science ( ): – . http://dx.doi.org/ . / berkes, f. . cross-scale institutional linkages: perspectives from the bottom up. in e. ostrom, t. dietz, n. dolsak, p. c. stern, s. stonich, and e. u. weber, editors. the drama of the commons. national academy press, washington, d.c., usa. berkes, f., j. colding, and c. folke, editors. . navigating social-ecological systems: management practices and social mechanisms for building resilience. cambridge university press, cambridge, uk. blaikie, p., t. cannon, i. davis, and b. wisner. . at risk: natural hazards, people’s vulnerability and disasters. routledge, new york, new york, usa. boyd, e. . community development block grant funds in disaster relief and recovery. crs report for congress. rl . april , . brand, f. s., and k. jax. . focusing the meaning(s) of resilience: resilience as a descriptive concept and a boundary object. ecology and society ( ): . [online] url: http://www.ecologyandsoc iety.org/vol /iss /art / cash, d. w., w. adger, f. berkes, p. garden, l. lebel, p. olsson, l. pritchard, and o. young. . scale and cross-scale dynamics: governance and information in a multilevel world. ecology and society ( ): . [online] url: http://www.ecology andsociety.org/vol /iss /art / comfort, l. k. . shared risk: complex systems in seismic response. elsevier, oxford, uk. comfort, l. k. . risk, security, and disaster management. annual review of political science : – . corporation for national and community service. . semiannual regulatory agenda. federal http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art /responses/ http://www.ecologyandsociety.org/vol /iss /art http://www.ecologyandsociety.org/vol /iss /art http://dx.doi.org/ . / http://dx.doi.org/ . / http://dx.doi.org/ . / http://dx.doi.org/ . / http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art / ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / register ( ). october , . [online] url: http://www.americorps.gov/for_organizations/funding/ nofa_detail.asp?tbl_nofa_id= cutter, s. . american hazardscapes: the regionalization of hazards and disasters. joseph henry press, washington, d.c., usa. dang, t. d., and j. burris. . on the internet, offers of assistance. baltimore sun, september , . downing, t. e., j. aerts, j. soussan, o. barthelemy, s. bharwani, c. ionescu, j. hinkel, r. j. t. klein, l. j. mata, n. martin, s. moss, d. purkey, and g. ziervogel. . integrating social vulnerability into water management. sei working paper and newater working paper no. . stockholm environment institute, oxford, uk. dwyer, j., and c. drew. . fear exceeded crime’s reality in new orleans. new york times, september , . dynes, r. r., and h. rodriguez. . finding and framing katrina: the social construction of disaster. pages – in d. l. brunsma, d. overfelt, and j. s. picou, editors. the sociology of katrina: perspectives on a modern catastrophe. rowman & littlefield, new york, new york, usa. eakin, h., and a. l. luers. . assessing the vulnerability of social-environmental systems. annual review of environment and resources : – . http://dx.doi.org/ . /annurev.ene rgy. . . ernstson, h., s. barthel, e. andersson, and s. t. borgström. a. scale-crossing brokers and network governance of urban ecosystem services: the case of stockholm. ecology and society ( ): . [online] url: http://www.ecologyandsociety. org/vol /iss /art / ernstson, h., s. e. van der leeuw, c.l. redman, d. j. meffert, g. davis, c. alfsen, and t. elmqvist. b. urban transitions: on urban resilience and human-dominated ecosystems. ambio. doi: . /s - - - figley, c. r. . editorial. traumatology ( ): – . http://dx.doi.org/ . /s - ( ) - folke, c. . resilience: the emergence of a perspective for social-ecological systems analyses. global environmental change : – . http:// dx.doi.org/ . /j.gloenvcha. . . folke, c. . social-ecological systems and adaptive governance of the commons. ecological research. ( ): – . http://dx.doi.org/ . /s - - - folke, c., t. hahn, p. olsson, and j. norberg. . adaptive governance of social-ecological systems. annual review of environment and resources : – . http://dx.doi.org/ . /annurev.ene rgy. . . freudenburg, w. r. . risk and recreancy: weber, the division of labor, and the rationality of risk perceptions. social forces : – . http:// dx.doi.org/ . / freudenburg, w. r., s. frickel, and r. grambling. . beyond the nature/society divide: learning to think about a mountain. sociological forum ( ): – . http://dx.doi.org/ . /bf freudenburg, w. r., r. gramling, s. laska, and k. erikson . catastrophe in the making: the engineering of katrina and the disasters of tomorrow. island press, new york, new york, usa. gallopín, g. c. . linkages between vulnerability, resilience, and adaptive capacity. global environmental change ( ): – . htt p://dx.doi.org/ . /j.gloenvcha. . . gordon, m. . more housing for poor opposed; roberts says that those from city are unwelcome. times-picayune, october , . gotham, k., and m. greenberg. . from / to / : post-disaster recovery and rebuilding in new york and new orleans. social forces ( ): – . government accountability office (gao). . nonprofit sector: increasing numbers and key role in delivering federal services. statement of stanley j. czerwinski director, strategic issues. testimony before the subcommittee on oversight, committee http://www.ecologyandsociety.org/vol /iss /art / http://www.americorps.gov/for_organizations/funding/nofa_detail.asp?tbl_nofa_id= % http://www.americorps.gov/for_organizations/funding/nofa_detail.asp?tbl_nofa_id= % http://dx.doi.org/ . /annurev.energy. . . http://dx.doi.org/ . /annurev.energy. . . http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art / http://dx.doi.org/ . /s - ( ) - http://dx.doi.org/ . /s - ( ) - http://dx.doi.org/ . /j.gloenvcha. . . http://dx.doi.org/ . /j.gloenvcha. . . http://dx.doi.org/ . /s - - - http://dx.doi.org/ . /s - - - http://dx.doi.org/ . /annurev.energy. . . http://dx.doi.org/ . /annurev.energy. . . http://dx.doi.org/ . / http://dx.doi.org/ . / http://dx.doi.org/ . /bf http://dx.doi.org/ . /j.gloenvcha. . . ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / on ways and means, house of representatives. gao- - t. government accountability office, washington, d.c., usa. government accountability office (gao). . hurricane recovery: federal government provided a range of assistance to nonprofits following hurricanes katrina and rita. gao- - . government accountability office, washington, d.c., usa. grimm, n. b., j. m. grove, s. t. a. pickett, and c. l. redman. . integrated approaches to long- term studies of urban ecological systems. bioscience ( ): – . http://dx.doi.org/ . / - - - - _ grimm, n. b., and c. l. redman. . approaches to the study of urban ecosystems: the case of central arizona–phoenix. urban ecosystems : – . http://dx.doi.org/ . /b:ueco. . . a gunderson, l. . ecological and human community resilience in response to natural disasters. ecology and society ( ): . [online] url: http://www.ecologyandsociety.org/vol /iss / art / gunderson, l., and c. folke. . resilience— now more than ever. ecology and society ( ): . [online] url: http://www.ecologyandsociety.org/vol / iss /art / hammer, d. . homeowners, legislators battle eastern new orleans apartments. times-picayune, january , . holling, c. s. . the resilience of terrestrial ecosystems: local surprise and global change. pages – in w. c. clark and r. e. munn, editors. sustainable development of the biosphere. cambridge university press, cambridge, uk. holling, c. s. . understanding the complexity of economic, ecological, and social systems. ecosystems : – . http://dx.doi.org/ . /s - - - kasperson, r. e., k. dow, e. r. m. archer, d. cáceres, t. e. downing, t. elmqvist, s. eriksen, c. folke, g. han, k. iyengar, c. vogel, k. a. wilson, and g. ziervogel. . vulnerable people and places. chapter in ecosystems and human well-being: current state and trends assessment. millennium ecosystem assessment. island press, washington, d.c., usa. klinenberg, e. . heat wave: a social autopsy of disaster in chicago. chicago university press, chicago, illinois, usa. krupa, m. . n.o. to analyze recovery outlay; lower got less than was promised. times- picayune, july , . http://dx.doi.org/ . / bf liu, j., t. dietz, s. r. carpenter, m. alberti, c. folke, e. moran, a. n. pell, p. deadman, t. kratz, j. lubchenco, e. ostrom, z. ouyang, w. provencher, c. l. redman, s. h. schneider, and w. w. taylor. . complexity of coupled human and natural systems. science ( ): – . http://dx.doi.org/ . /science. liu, a., and a. plyer. . an overview of greater new orleans: from recovery to transformation in the new orleans index at five. brookings institution and greater new orleans community data center, washington, d.c., usa. louisiana association of nonprofit organizations (lano). . annual report, . louisiana association of nonprofit organizations (lano), baton rouge, louisiana, usa. http://dx.doi.org/ . /jlca. . . . . masten, a. s., and j. obradovic. . disaster preparation and recovery: lessons from research on resilience in human development. ecology and society ( ): . [online] url: http://www.ecology andsociety.org/vol /iss /art / miller, f., h. osbahr, e. boyd, f. thomalla, s. bharwani, g. ziervogel, b. walker, j. birkmann, s. van der leeuw, j. rockström, j. hinkel, t. downing, c. folke, and d. nelson. . resilience and vulnerability: complementary or conflicting concepts? ecology and society ( ): . [online] url: http://www.ecologyandsociety.org/vol /iss / art / mutter, j. . disasters widen the rich–poor gap. nature : . http://dx.doi.org/ . / a newman, l. l., and a. dale. . network structure, diversity, and proactive resilience http://www.ecologyandsociety.org/vol /iss /art / http://dx.doi.org/ . / - - - - _ http://dx.doi.org/ . / - - - - _ http://dx.doi.org/ . /b:ueco. . .a http://dx.doi.org/ . /b:ueco. . .a http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art / http://dx.doi.org/ . /s - - - http://dx.doi.org/ . /s - - - http://dx.doi.org/ . /bf http://dx.doi.org/ . /bf http://dx.doi.org/ . /science. http://dx.doi.org/ . /jlca. . . . . http://dx.doi.org/ . /jlca. . . . . http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art / http://dx.doi.org/ . / a ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / building: a response to tompkins and adger. ecology and society ( ):r . [online] url: http:// www.ecologyandsociety.org/vol /iss /resp / noguchi, y. . good samaritans turn to web to help victims. washington post, september , . nolan, b. . katrina's devastation rewrote the playbook; local groups say relief about half finished. times picayune, july , . [online] url: http: //www.nola.com/news/index.ssf/ / / katrinas_devastation_rewrote_t.html norris, f. h., s. p. stevens, b. pfefferbaum, k. f. wyche, and r. l. pfefferbaum. . community resilience as a metaphor, theory, set of capacities, and strategy for disaster readiness. american journal of community psychology : – . ht tp://dx.doi.org/ . /s - - - olsson, p., c. folke, and f. berkes. . adaptive co-management for building resilience in social- ecological systems. environmental management : – . http://dx.doi.org/ . /s - - - olsson, p., l. h. gunderson, s. r. carpenter, p. ryan, l. lebel, c. folke, and c. s. holling. . shooting the rapids: navigating transitions to adaptive governance of social-ecological systems. ecology and society ( ): . [online] url: http:/ /www.ecologyandsociety.org/vol /iss /art / pelling, m. . the vulnerability of cities: natural disasters and social resilience. earthscan publications, london, uk. perrow, c. a. . organizing for environmental destruction. organization & environment : – . pickett, s. t. a., m. l. cadenasso, j. m. grove, c. h. nilon, r. v. pouyat, w. c. zipperer, and r. costanza. . urban ecological systems: linking terrestrial, ecological, physical, and socioeconomic components of metropolitan areas. annual review of ecological systems : – . http://dx.doi.or g/ . /annurev.ecolsys. . . pierre, r. e., and a. gerhart. . news of pandemonium may have slowed aid; unsubstantiated reports of violence were confirmed by some officials, spread by news media. washington post, october , . plyer, a., and r. campanella. . job sprawl in metropolitan new orleans: based on local employment dynamics data from the u.s. census bureau. greater new orleans community data center (gnocdc), new orleans, louisiana, usa. [online] url: http://www.gnocdc.org/jobsprawl/index. html resilience alliance. . assessing resilience in social-ecological systems: a workbook for practitioners. revised version . . [online] url: http://www.resalliance.org/index.php/ resilience_assessment rioux, p. . st. bernard sued over rent limit; group says new law upholds segregation. times- picayune, october , . http://dx.doi.org/ . / ardp. swyngedouw, e. . social power and the urbanization of water: flows of power. oxford university press, new york, new york, usa. thevenot, b. . myth-making in new orleans. american journalism review ( ): – . thevenot, b., and g. russell. . rape, murder, gunfights; for three anguished days the world’s headlines blared that the superdome and convention center had descended into anarchy. times- picayune, september , . tierney, k., c. bevc, and e. kuligowski. . metaphors matter: disaster myths, media frames, and their consequences in hurricane katrina. annals of the american academy of political and social science : – . http://dx.doi.org/ . / tompkins, e. l., and w. n. adger. . does adaptive management of natural resources enhance resilience to climate change? ecology and society ( ): . [online] url: http://www.ecologyandsociety. org/vol /iss /art tompkins, e., w. n. adger, and k. brown. . institutional networks for inclusive coastal zone management in trinidad and tobago. environment and planning a. : – . turner, b. l., ii, r. e. kasperson, p. a. matson, j. mccarthy, r. w. corell, l. christensen, n. eckley, j. x. kasperson, a. luers, m. l. martello, c. http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /resp / http://www.ecologyandsociety.org/vol /iss /resp / http://www.nola.com/news/index.ssf/ / /katrinas_devastation_rewrote_t.html http://www.nola.com/news/index.ssf/ / /katrinas_devastation_rewrote_t.html http://dx.doi.org/ . /s - - - http://dx.doi.org/ . /s - - - http://dx.doi.org/ . /s - - - http://www.ecologyandsociety.org/vol /iss /art / http://www.ecologyandsociety.org/vol /iss /art / http://dx.doi.org/ . /annurev.ecolsys. . . http://dx.doi.org/ . /annurev.ecolsys. . . http://www.gnocdc.org/jobsprawl/index.html http://www.gnocdc.org/jobsprawl/index.html http://www.resalliance.org/index.php/resilience_assessment. http://www.resalliance.org/index.php/resilience_assessment. http://dx.doi.org/ . /ardp. http://dx.doi.org/ . /ardp. http://dx.doi.org/ . / http://dx.doi.org/ . / http://www.ecologyandsociety.org/vol /iss /art http://www.ecologyandsociety.org/vol /iss /art ecology and society ( ): http://www.ecologyandsociety.org/vol /iss /art / polsky, a. pulsipher, and a. schiller. . a framework for vulnerability analysis in sustainability science. proceedings of the national academy of sciences ( ): – . http://dx.doi.org/ . /pnas. u.s. department of housing and urban development (hud). . disaster recovery initiative. federal register ( ). department of defense appropriations act, . u.s. long term ecological research network (lter). . the decadal plan for lter: integrative science for society and the environment. lter network office publication series no. , albuquerque, new mexico, usa. walker, b., and j. a. meyers. . thresholds in ecological and social–ecological systems: a developing database. ecology and society ( ): . [online] url: http://www.ecologyandsociety.org/vol / iss /art / wallace, d., and r. wallace. . urban systems during disasters: factors for resilience. ecology and society ( ): . [online] url: http://www.ecolog yandsociety.org/vol /iss /art / young, o. r., f. berkhout, g. c. gallopin, m. a. janssen, e. ostrom, and s. van der leeuw. . the globalization of socio-ecological systems: an agenda for scientific research. global environmental change : – . http://dx.doi.org/ . /j.gl oenvcha. . . http://www.ecologyandsociety.org/vol /iss /art / http://dx.doi.org/ . /pnas. http://dx.doi.org/ . /pnas. http://www.ecologyandsociety.org/vol /iss /art /% http://www.ecologyandsociety.org/vol /iss /art /% http://www.ecologyandsociety.org/vol /iss /art /% http://www.ecologyandsociety.org/vol /iss /art /% http://dx.doi.org/ . /j.gloenvcha. . . http://dx.doi.org/ . /j.gloenvcha. . . title abstract introduction vulnerability and resilience in post-trauma urban ecosystems cross-scale processes of post-katrina renewal and recovery acceleration of cross-scale interactions federal-local linkages and the role of nonprofit organizations cross-scale networks as sources of resilience cross-scale pathologies and post-katrina vulnerability conclusion responses to this article acknowledgments literature cited figure figure table table table commentary founder populations and their uses for breast cancer genetics susan l neuhausen university of utah school of medicine, salt lake city, utah, usa abstract numerous founder mutations have been reported in brca and brca . for genetic screening of a population with a founder mutation, testing can be targeted to the mutation, allowing for a more rapid and less expensive test. in addition, more precise estimates of the prior probability of carrying a mutation and of the likelihood of a mutation carrier developing cancer should be possible. for a given founder mutation a large number of carriers are available, so that focused scientific studies of penetrance, expression, and genetic and environmental modifiers of risk can be performed. finally, founder populations may be a powerful resource to localize additional breast cancer susceptibility loci, because of the reduction in locus heterogeneity. keywords: brca , brca , breast cancer genes, founder mutations, genetic epidemiology received: december accepted: january published: february breast cancer res , : – © current science ltd http://breast-cancer-research.com/content/ / / introduction ethnic differences in the prevalences of many diseases have been observed. for example, sickle-cell anemia in individuals of african descent, tay–sachs disease in ashkenazi jews [ ], and approximately diseases in finland [ ] are more prevalent than in other populations. a likely reason for a preponderance of a disease in a specific population is a founder effect. founder effects occur when a population is established by a small number of people or when a bottleneck occurs that reduces the population to a small number. when population expansion occurs, the mutation in a founder becomes prevalent in a larger pro- portion of the population. there may also be a selective advantage to the mutation carrier. by following genetic relationships over many generations, the significance of founder effects can be studied. diamond and rotter [ ] reviewed studies of the afrikaner population of south africa. in , one founding immigrant carried a gene for huntington’s chorea and one brother–sister pair carried a gene for lipoid proteinosis. the result of founder effects is that these diseases are more common in south africa than in holland from where the carriers emigrated. founder populations can be useful in genetic studies, par- ticularly for genetic mapping of complex traits. there is little genetic heterogeneity, so that the majority of individu- als with disease will carry the same gene mutation. linkage disequilibrium between the site of the gene and close markers will exist, so that shared regions of the genome cosegregating with disease can be more readily discerned. as an example, hirschprung’s disease has been described in individuals of many different back- grounds. using a mennonite population, in which all affected individuals could be traced to a single common ancestral couple, one of the genes for the disease was localized and subsequently identified [ ]. once founder mutations are identified, researchers are able to examine prevalence of mutations in different popu- lations and mutation-specific effects on penetrance and breast cancer research vol no neuhausen disease phenotype. possibly, better estimates of risk for individuals in populations with founder mutations can be calculated. this editorial focuses on founder populations in genetic studies of breast cancer. prevalence of mutations in brca and brca brca and brca , two genes predisposing to breast and ovarian cancers, were isolated in and , respectively [ , ]. since that time, researchers have been screening for mutations in high-risk breast and/or ovarian cancer families and in population-based samples of women with these cancers to determine the prevalence and range of mutations. over distinct variants have been found across all population groups, of which approxi- mately are identified as causal [ , ]. a number of these mutations have been identified multiple times [ ]. many of these common mutations have been classified as founder mutations on the basis of a shared haplotype in the genomic region containing the gene. founder muta- tions for brca and brca have been described in numerous populations (table ), as well as across popula- tions. for example, brca insc has been reported in individuals of jewish, dutch, lithuanian, russian, hun- garian, germanic, french, italian, british, and french– canadian ancestry [ ]. this suggests that this is a rela- tively old mutation that has spread through migration. relative ages of several founder mutations have been investigated by examining the distance over which haplo- types are conserved [ , ]. based on the general age of a mutation and historic data on migration and social pat- terns, the origin and subsequent migration of specific mutations may be described. now that a large number of mutation carriers have been identified the breast cancer linkage consortium is undertaking such a study for a set of founder mutations. assessment of risk genetic screening since the isolation of brca and brca , genetic testing for mutations is becoming more common in clinical genetic practice. important considerations are who should be offered predictive testing and when it should be done. in general, mutations in brca and brca are rare, probably accounting for less than % of breast cancers and % of ovarian cancers in the population [ , ]. the frequency of brca and brca mutation carriers in women with breast and/or ovarian cancer is dependent on the study population, and is highest in young women with breast cancer who have a strong family history of breast and/or ovarian cancers. an essential issue for testing is the probability that an individual, with breast or ovarian cancer or with a family history of cancer, will carry a mutation in brca or brca . probabil- ity models have been developed to predict the likelihood of being a mutation carrier before testing [ – ]. prior proba- bilities vary depending on the model used. for genetic testing, there are several advantages to knowing the founder mutation(s) in a population. first, a more accurate estimate of the prior probability of carrying a mutation should be possible. second, for mutation detec- tion, testing can be targeted to the founder mutation, allow- ing for a more rapid and less expensive test. third, most of the mutation detection techniques are unable to detect large deletions and insertions, so that these types of muta- tions, which may account for – % of deleterious muta- tions, would be undetected. if one of these mutations is table examples of brca and brca founder mutations population mutation reference african–americans brca ins [ , ] brca m r ashkenazi jews brca delag [ , , ] brca insc brca delt belgians brca ivs + a>g [ ] dutch brca delaa [ , ] brca ivs - del brca ivs - del brca insa finns brca delt [ ] brca ivs - a>g brca del brca ivs - a>g french–canadians brca r x [ , ] brca delag germans brca insc [ ] brca c g icelanders brca del [ ] latvians brca c g [ ] brca insc brca dela norwegians brca dela [ – ] brca insa russians brca insc [ ] brca dela swedes brca q x [ ] brca ins brca del brca delc brca delg http://breast-cancer-research.com/content/ / / known in the population, however, a technique that detects it can be used for mutation screening. for instance, there are two large deletion founder mutations in the dutch that would not be detectable with standard techniques [ ]. age-specific penetrance once an unaffected mutation carrier is identified, the question becomes what is the likelihood that she will develop cancer by a given age (age-specific penetrance). it is especially difficult to answer, because not all factors that contribute to the development of cancer are known. a proportion of individuals who carry mutations will not develop breast cancer or any other cancer. on the basis of estimates from population-based studies of women aged years or younger to estimates from high-inci- dence breast cancer families of northern european descent, the cumulative risk of breast cancer by age years for brca and brca mutation carriers is between and % [ – ]. mutation-specific differ- ences may also be important. there are regions in brca and brca in which mutations confer higher risks for developing ovarian cancer: ′ of codon in exon of brca [ ] and a . kilobase region of exon in brca (denoted the ovarian cancer cluster region) [ ]. it is unclear whether the differences in risk for ovarian cancer are due to a difference in penetrance of the muta- tions for breast cancer or ovarian cancer, or both. for brca , it has been suggested that the breast cancer risk remains the same, but that the ovarian cancer risk increases [ ]. expression is also variable [ ]. in a popu- lation with a defined founder mutation(s), more accurate assessment of the likelihood of developing cancer for a mutation carrier should be possible. founder mutations brca and brca an example of a recurrent, founder mutation is the brca del mutation in the icelandic population. no other brca mutations have been reported in this population. the del is approximately times more prevalent ( . %) [ ] than the estimated allele frequency of brca in the general worldwide caucasian population [ ]. this mutation with the same haplotype was also found in finland [ , ]. in iceland, it was the cause of female breast cancer in the majority ( %) of high-risk breast cancer families studied [ ]. in nine of those families, male breast cancer was also present [ ]. in ice- landic breast cancer cases unselected for a family history, . % of female breast cancer diagnosed at any age and % of those diagnosed at age years or younger carried the brca del mutation [ ]. this mutation is also responsible for a proportion of prostate cancer, as it accounted for . % (in two out of individuals) of prostate cancer cases in a population-based series of cases [ ]. because this is the only brca mutation found in iceland, genetic testing can be targeted to this mutation. second, because there are a large number of individuals, both symptomatic and asymptomatic, who carry this mutation, it may be possible to develop more accurate risk estimates for mutation carriers. age-specific penetrance has been calculated to be % by age years and . % by age years [ ]. this is a lower fre- quency than that reported in other studies of brca and brca penetrance. three founder mutations have been observed in ashkenazi jewish breast and ovarian cancer patients. the brca delt mutation has been seen only in ashkenazi jews [ ], with a frequency of . – . % [ , ]. the founder brca delag mutation, with a frequency of . – . % in ashkenazi jews [ , ], is also observed in sephardic jews, indicating an older origin. the delag mutation has also been observed in individuals of english origin but on a different haplotype, which suggests a dif- ferent origin. the third founder mutation, brca insc, has a frequency of . – . % in ashkenazi jews. the insc mutation is observed in many popula- tions, and the vast majority of carriers share the same core haplotype (szabo c, personal communication). the popu- lation prevalences for these three mutations combined is – . % [ – ], which is approximately – times higher than the allele frequency in the general population. few other brca or brca mutations have been identi- fied in jewish breast or ovarian cancer cases. in this popu- lation, approximately % of breast cancers diagnosed at less than years of age and % of ovarian cancers diagnosed at less than years of age are caused by these mutations [ , ]. thus, ashkenazi jewish women with breast or ovarian cancers have a much higher proba- bility than non-jewish women of being brca or brca mutation carriers. because these mutations are so common in ashkenazi jewish women, they are commonly tested as a panel, regardless of whether a mutation has already been identified in a family member. a woman may carry a second mutation not present in the first family member tested and, by testing the panel, it is detected. without knowledge of the founder mutations, a false-neg- ative test result for an individual with a mutation-specific test could result. even among families with founder mutations, there appear to be differences in age of onset of cancer and in the type of cancers that develop [ , – ]. this suggests that there are both genetic and lifestyle factors that modify penetrance of brca and brca . by studying a cohort of individuals with the same mutation, one may be able to distinguish factors that affecting penetrance, because there will not be a confounding effect from genotype–phe- notype correlations from location of the brca /brca mutation in the individual. once a risk factor is identified in one subgroup of mutation carriers it would need to be tested across other mutation carriers. subsequently, it would need to be tested in a population-based case– control study, in order to determine how important the risk factor is in the general population. other genes brca and brca mutations are certainly important determinants of risk for breast and/or ovarian cancers, but they are not the only ones. many women, who have a family history of breast and/or ovarian cancer and do not have a brca or brca mutation, may have a mutation in undiscovered genes. after accounting for brca and brca , peto et al [ ] suggested that there are several other genes, possibly of lower risk, that account for a pro- portion of breast cancers. this complexity makes localizing additional genes problematic. studying families identified from populations in which there are likely to be founder mutations may be extremely useful for localizing additional genes. for example, in iceland researchers may have been able to localize brca by studying male breast cancer cases from high-risk families and looking for regions of the genome with excess sharing. researchers have sug- gested studying high-risk ashkenazi jewish breast cancer families that do not have a brca or brca mutation in order to localize brca . localization will be promoted by minimizing the effects of genetic heterogeneity. conclusion founder mutations allow for focused scientific studies of penetrance, expression, and genetic and environmental modifiers of risk. the results from these studies may be very useful for understanding the role that these genes play in the incidence of breast cancer in order to target genetic testing, to provide individual risk assessment, and to design better therapeutic strategies. localization studies to find brca , using founder populations, may be more successful than traditional linkage studies, which have not yet yielded positive localization results. these types of studies, utilizing founder populations and muta- tions, are not unique to breast cancer genetics, and are being used successfully to understand other diseases. acknowledgement work by the author and cited in this editorial was supported by grants from the national cancer institute (r ca- ), the department of defense (damd - -i- ), and the american cancer society (rpg- - - cce). references . kaback m, lim-steele j, dabholkar d, et al: tay–sachs disease: carrier screening, prenatal diagnosis, and the molecular era. an international perspective, to . the international tsd data collection network. jama , : – . . de la chapelle a: disease gene mapping in isolated human popu- lations: the example of finland. j med genet , : – . . diamond jm, rotter ji: observing the founder effect in human evo- lution [news]. nature , : – . . puffenberger eg, kauffman er, bolk s, et al: identity-by-descent and association mapping of a recessive gene for hirschsprung disease on human chromosome q . hum mol genet , : – . . miki y, swensen j, shattuck-eidens d, et al: a strong candidate for the breast and ovarian cancer susceptibility gene brca . science , : – . . wooster r, bignell g, lancaster j, et al: identification of the breast cancer susceptibility gene brca . nature , : – . (published erratum appears in nature , : .) . shen d, vadgama jv: brca and brca gene mutation analysis: visit to the breast cancer information core (bic). oncol res , : – . . breast cancer information core database: http://www.nhgri.nih.gov/ intramural_research/lab_transfer/bic/ . neuhausen sl, mazoyer s, friedman l, et al: haplotype and pheno- type analysis of six recurrent brca mutations in families: results of an international study. am j hum genet , : – . . neuhausen sl, godwin ak, gershoni-baruch r, et al: haplotype and phenotype analysis of nine recurrent brca mutations in families: results of an international study. am j hum genet , : – . . claus eb, schildkraut jm, thompson wd, risch nj: the genetic attributable risk of breast and ovarian cancer. cancer , : – . . peto j, collins n, barfoot r, et al: prevalence of brca and brca gene mutations in patients with early-onset breast cancer. j natl cancer inst , : – . . couch fj, deshano ml, blackwood ma, et al: brca mutations in women attending clinics that evaluate the risk of breast cancer. n engl j med , : – . . berry da, parmigiani g, sanchez j, schildkraut j, winer e: probability of carrying a mutation of breast-ovarian cancer gene brca based on family history. j natl cancer inst , : – . . frank ts, manley sa, olopade oi, et al: sequence analysis of brca and brca : correlation of mutations with family history and ovarian cancer risk. j clin oncol , : – . . schmidt s, becher h, chang-claude j: breast cancer risk assess- ment: use of complete pedigree information and the effect of mis- specified ages at diagnosis of affected relatives. hum genet , : – . . petrij-bosch a, peelen t, van vliet m, et al: brca genomic dele- tions are major founder mutations in dutch breast cancer patients. nature genet , : – . (published erratum appears in nature genet , : .) . struewing jp, hartge p, wacholder s, et al: the risk of cancer asso- ciated with specific mutations of brca and brca among ashkenazi jews. n engl j med , : – . . hopper jl, southey mc, dite gs, et al: population-based estimate of the average age-specific cumulative risk of breast cancer for a defined set of protein-truncating mutations in brca and brca . australian breast cancer family study. cancer epidemiol biomark- ers prev , : – . . ford d, easton df, stratton m, et al: genetic heterogeneity and penetrance analysis of the brca and brca genes in breast cancer families. the breast cancer linkage consortium. am j hum genet , : – . . gayther sa, warren w, mazoyer s, et al: germline mutations of the brca gene in breast and ovarian cancer families provide evi- dence for a genotype–phenotype correlation. nature genet , : – . . gayther sa, mangion j, russell p, et al: variation of risks of breast and ovarian cancer associated with different germline mutations of the brca gene. nature genet , : – . . anonymous: cancer risks in brca mutation carriers. the breast cancer linkage consortium. j natl cancer inst , : – . . thorlacius s, sigurdsson s, bjarnadottir h, et al: study of a single brca mutation with high carrier frequency in a small population. am j hum genet , : – . . claus eb, risch n, thompson wd: genetic analysis of breast cancer in the cancer and steroid hormone study. am j hum genet , : – . . vehmanen p, friedman ls, eerola h, et al: a low proportion of brca mutations in finnish breast cancer families. am j hum genet , : – . . huusko p, paakkonen k, launonen v, et al: evidence of founder mutations in finnish brca and brca families [letter]. am j hum genet , : – . breast cancer research vol no neuhausen . thorlacius s, olafsdottir g, tryggvadottir l, et al: a single brca mutation in male and female breast cancer families from iceland with varied cancer phenotypes. nature genet , : – . . sigurdsson s, thorlacius s, tomasson j, et al: brca mutation in icelandic prostate cancer patients. j mol med , : – . . thorlacius s, struewing jp, hartge p, et al: population-based study of risk of breast cancer in carriers of brca mutation. lancet , : – . . neuhausen s, gilewski t, norton l, et al: recurrent brca delt mutations in ashkenazi jewish women affected by breast cancer. nature genet , : – . . roa bb, boyd aa, volcik k, richards cs: ashkenazi jewish popula- tion frequencies for common mutations in brca and brca . nature genet , : – . . oddoux c, struewing jp, clayton cm, et al: the carrier frequency of the brca delt mutation among ashkenazi jewish individu- als is approximately %. nature genet , : – . . struewing jp, abeliovich d, peretz t, et al: the carrier frequency of the brca delag mutation is approximately percent in ashkenazi jewish individuals. nature genet , : – . (published erratum appears in nature genet , : .) . levy-lahad e, catane r, eisenberg s, et al: founder brca and brca mutations in ashkenazi jews in israel: frequency and dif- ferential penetrance in ovarian cancer and in breast-ovarian cancer families. am j hum genet , : – . . abeliovich d, kaduri l, lerer i, et al: the founder mutations delag and insc in brca and delt in brca appear in % of ovarian cancer and % of early-onset breast cancer patients among ashkenazi women. am j hum genet , : – . . friedman ls, szabo ci, ostermeyer ea, et al: novel inherited muta- tions and variable expressivity of brca alleles, including the founder mutation delag in ashkenazi jewish families. am j hum genet , : – . . tonin p, serova o, lenoir g, et al: brca mutations in ashkenazi jewish women [letter]. am j hum genet , : . . simard j, tonin p, durocher f, et al: common origins of brca mutations in canadian breast and ovarian cancer families. nature genet , : – . . mefford hc, baumbach l, panguluri rc, et al: evidence for a brca founder mutation in families of west african ancestry [letter]. am j hum genet , : – . . gao q, neuhausen s, cummings s, luce m, olopade oi: recurrent germ-line brca mutations in extended african american fami- lies with early-onset breast cancer [letter]. am j hum genet , : – . . claes k, machackova e, de vos m, et al: mutation analysis of the brca and brca genes in the belgian patient population and identification of a belgian founder mutation brca ivs + a > g. dis markers , : – . . peelen t, van vliet m, petrij-bosch a, et al: a high proportion of novel mutations in brca with strong founder effects among dutch and belgian hereditary breast and ovarian cancer families. am j hum genet , : – . . tonin pm, mes-masson am, narod sa, ghadirian p, provencher d: founder brca and brca mutations in french canadian ovarian cancer cases unselected for family history. clin genet , : – . . backe j, hofferbert s, skawran b, et al: frequency of brca muta- tion insc in german breast cancer patients. gynecol oncol , : – . . csokay b, tihomirova l, stengrevics a, sinicka o, olah e: strong founder effects in brca mutation carrier breast cancer patients from latvia. mutation in brief no. . online. hum mutat , : . . andersen ti, borresen al, moller p: a common brca mutation in norwegian breast and ovarian cancer families? [letter]. am j hum genet , : – . . borg a, dorum a, heimdal k, et al: brca dela and insa account for one third of norwegian familial breast-ovarian cancer and are associated with later disease onset than less frequent mutations. dis markers , : – . . dorum a, hovig e, trope c, inganas m, moller p: three per cent of norwegian ovarian cancers are caused by brca dela or insa. eur j cancer , : – . . gayther sa, harrington p, russell p, et al: frequently occurring germ-line mutations of the brca gene in ovarian cancer families from russia [letter]. am j hum genet , : – . . johannsson o, ostermeyer ea, hakansson s, et al: founding brca mutations in hereditary breast and ovarian cancer in southern sweden. am j hum genet , : – . author’s affiliation: division of genetic epidemiology, department of medical informatics, university of utah school of medicine, salt lake city, utah, usa correspondence: susan l neuhausen, genetic epidemiology, chipeta way, suite d- , salt lake city, ut , usa. tel: + , + ; fax: + ; e-mail: susan@episun .med.utah.edu http://breast-cancer-research.com/content/ / / abstract introduction prevalence of mutations in brca and brca assessment of risk genetic screening age-specific penetrance founder mutations brca and brca other genes conclusion acknowledgement references author’s affiliation: correspondence: abstract a water informatics approach to exploring the hydrological systems of basins with limited information; the case of the bustillos lagoon, chihuahua, mexico. by hugo luis rojas villalobos, m.e.e. a dissertation submitted to the graduate school in partial fulfillment of the requirements for the degree doctor of philosophy major: water science and management concentration: water informatics new mexico state university las cruces, new mexico october proquest number: all rights reserved information to all users the quality of this reproduction is dependent on the quality of the copy submitted. in the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. also, if material had to be removed, a note will indicate the deletion. published by proquest llc ( proquest ). copyright of the dissertation is held by the author. all rights reserved. this work is protected against unauthorized copying under title , united states code microform edition © proquest llc. proquest llc east eisenhower parkway p.o. box ann arbor, mi - ii iii acknowledgements foremost, i want to express my eternal gratitude to dr. christopher brown for his unconditional support and encouragement: "la vida es bella." i want to thank my doctoral committee for valuable support, time, and dedication. profe brown, dr. samani, dr. stringam, and dr. alatorre: you are responsible for who i am now :). dr. alfredo granados, thanks for encouraging me, you are also responsible for this. to my children luis ricardo and leonardo, if i did not have you, my life would be a disaster. every time i see you, i realize that i am facing the living portraits of your mother and me, you are my main motivation, my motor of life. olaya, thank you very much for your patience, dedication, and love for this family. to my parents and brother hugo, licha, and luis, who always believed in me, especially my mother, who already rests in eternity, i love you. i thank rojas and villalobos families as well as the aragones family for your constant support. to my friends and coworkers, you are the “neta” of the planet! finally, to all members of the academic department "geoinformática aplicada a procesos geo- ambientales" (uacj-ca- ). thanks to nmwrri and the nmsu department of geography for your support. part of this material is supported by the national institute of food and agriculture, u.s. department of agriculture, under award number - - . iv vita educational information december , born in mazatlán, sinaloa, méxico graduated from cbtis # high school mazatlán, sinaloa, méxico graduated from durango institute of technology computer systems engineer durango, durango, méxico specialization from kanazawa institute of technology systems designer. microcontrollers. kanazawa, japan graduated from autonomous university of ciudad juarez master of environmental engineer ciudad juárez, chihuahua, méxico employment information - operations manager principal financial group - geographic information center autonomous university of ciudad juarez - full time professor - geoinformatics autonomous university of ciudad juarez field of study major field: water science and management concentration: water informatics v abstract a water informatics approach to exploring the hydrological systems of basins with limited information; the case of the bustillos lagoon, chihuahua, mexico by student name by hugo luis rojas villalobos, m.e.e. doctor of philosophy new mexico state university las cruces, new mexico october christopher brown, phd. the analysis of hydrological basins requires information that is often not available or non-existent when the study areas are far from large urban centers. in the case of bustillos lagoon in the mexican state of chihuahua, hydrological information is limited, and government agencies do not share data with interested persons and research institutions. given this barrier, this research contributes to filling information gaps concerning the geometry of the bustillos lagoon, evaporation, and morphometric parameters through the use of current technology in remote sensors, geographic information systems, and programming techniques that are used to extract, transform and process information. chapter deals with a new methodology that vi generates a d model of the bottom of the lagoon, which uses high-precision gps surveys, bathymetry, regional digital terrain models, and satellite image time series. the analysis using the kappa coefficient demonstrates that the overall performance of the d model is more significant than . , which means that the model has a very high level of agreement. the analysis also showed that at greater depth, the agreement between the coverage of the water surface of the model and the images is relatively low ( . ), and this is due to the spatial resolution of the satellite images and strip banding errors of landsat etm +. on the other hand, on the upper level, there is an agreement close to . of the kappa coefficients. chapter presents a performance comparison between the regional evapotranspiration estimate model (reem) and the earth engine evapotranspiration flux (eeflux) model, which are evapotranspiration models based on energy balances. these models can estimate the evaporation of water bodies. after applying statistical analysis, reem performed better than eeflux in quantifying the evaporation of the bustillos lagoon. chapter proposes an iterative algorithm to calculate morphometric variables (volume-area-height) using d models of water bodies. the implementation of the algorithm in the python programming language showed that it is not necessary to develop complex equations that interrelate the morphometric variables, which by their nature, lead to more considerable uncertainty from the data source for their construction. this research document highlights the importance of cumulative multi-faceted knowledge to support and respond to regional water issues. keywords: d model, topobathymetry, remote sensing, evaporation, iterative algorithm, lagoon geomorphometry table of contents table of contents list of tables ................................................................................................................................... list of figures ................................................................................................................................. chapter ........................................................................................................................................ introduction ................................................................................................................................ research location ....................................................................................................................... chapter topobathymetric d model reconstruction of shallow water bodies through remote sensing, gps, and bathymetry ....................................................................................................... abstract ...................................................................................................................................... introduction ................................................................................................................................ materials and methods ............................................................................................................... bathymetry ............................................................................................................................. contour extraction from remote sensors ................................................................................ topography ............................................................................................................................ digital elevation model .......................................................................................................... topobathymetric d model and volume estimation .............................................................. statistical evaluation ............................................................................................................. results and discussion ............................................................................................................... conclusions ................................................................................................................................ references .................................................................................................................................. chapter comparison of evaporation estimates from reem and eeflux models in a shallow water body. case: bustillos lagoon, chihuahua, mexico. ............................................................ abstract ...................................................................................................................................... background ................................................................................................................................ reference evapotranspiration model ...................................................................................... brief description of remote sensing models ........................................................................... reem .................................................................................................................................... metric ................................................................................................................................ eeflux ................................................................................................................................... material and methods ................................................................................................................. agro-meteorological data ...................................................................................................... landsat oli selection ......................................................................................................... reem and eeflux raster ....................................................................................................... lagoon delineation ................................................................................................................. statistical evaluation .............................................................................................................. results ........................................................................................................................................ discussion .................................................................................................................................. conclusions ................................................................................................................................ references .................................................................................................................................. chapter single-input, multiple-output iterative algorithm for the calculation of volume, area, elevation, and shape using d topobathymetric models. ............................................................... abstract ...................................................................................................................................... introduction ................................................................................................................................ study area ............................................................................................................................... material and methods ................................................................................................................. results and discussion ............................................................................................................... recommendations ...................................................................................................................... conclusions .................................................................................................................................... references ...................................................................................................................................... list of tables table . collection of remote sensing data used in this article. ................................................... table . list of multispectral images used to compare d model contours. ................................ table . list of multispectral images used to compare areas between reality and d model. added images are identified with *. ............................................................................................. table . kappa coefficient values and overall accuracy between imagery (reality) and simulation ( d model). ................................................................................................................................... table . confidence interval analysis for the percentage of the matching area between the three- dimensional model and the sample images. .................................................................................. table . landsat oli imagery used to estimate eta through reem and eeflux. source: usgs ( ). ................................................................................................................................ table . comparative table of errors between the reference evaporation and the models based on remote sensors (reem and eeflux). source: rojas villalobos. ................................................. table . summary of the ranked results of the comparative statistical indicators applied to the reem and eeflux versus s-penman. source: rojas villalobos. ................................................ table . result of the calculations of the implementation of the algorithm in python language. study site: the bustillos lagoon, chihuahua, mexico. error threshold = . %. * input data. source: rojas villalobos............................................................................................................... table . iterative model processing times with various storage volume input values using two dtms with different pixel dimensions. pixel spatial resolution: meters. source: rojas villalobos. ..................................................................................................................................... list of figures figure . location of cuauhtemoc basin and bustillos lagoon (source: rojas villalobos with data retrieved from google maps and national institute of statistics and informatics – inegi, ). ............................................................................................................................................ figure . the study area of laguna de bustillos, chihuahua. source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). .................................................................. figure . schematic of the workflow to generate the d model. source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). .......................................................... figure . components to calculate the height of the lake bottom above sea level. source: rojas villalobos. ..................................................................................................................................... figure . demonstration of matching areas between water surface extracted from a multispectral satellite image and the d model at the same reference level. source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). .................................................................. figure . map showing bathymetry, gps points, derived curves from multispectral rs, and regional contours (inegi). source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). ................................................................................................................ figure . triangulated irregular network is representing the topobathymetric d model of laguna de bustillos. source: rojas villalobos............................................................................. figure . d perspective of laguna de bustillos ( times height exaggeration for better visualization). source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). .......................................................................................................................................... figure . graph showing the behavior of the intersection percentage between the surfaces of the d model and the areas of rs images along elevation. ................................................................ figure . graphs of the surface and volume equations adjusted to the d model. .................... figure . rs time series contours. the dark contour delimits the outer areas with greater d model performance and the internal area with less accuracy. source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). .................................................................. figure . schematic flow chart of the process of comparing the reem and eeflux models to obtain e estimations of water bodies by comparing the s-penman equation. source: rojas villalobos . ............................................................................................................................ figure . location of the bustillos lagoon and the agro-meteorological station. source: rojas villalobos with data retrieved from inegi ( )....................................................................... figure . evaporation values of s-penman, reem, and eeflux during the agricultural season for the bustillos lagoon. source: rojas villalobos with data retrieved from unifrut ( ), usgs landsatlook viewer ( ), and eeflux ( ). ............................................... figure . comparative graphic of residuals predicted e on rs map models versus observed e (s-penman). source: rojas villalobos. ........................................................................................ figure . seasonal evaporation comparison of rs models versus s-penman data from april , to september , . source: rojas villalobos. .............................................................. figure . et (crop fields) and evaporation (lagoon) comparison maps of reem and eeflux models in the cuauhtemoc valley for june , . source: rojas villalobos with data retrieved from usgs ( ) and eeflux ( ). ........................................................................ figure . study area where the algorithm was applied. the bustillos lagoon in chihuahua. source: rojas villalobos with data retrieved from inegi ( ). .............................................. figure . dtm of the bustillos lagoon. source: rojas villalobos with data retrieved from rojas-villalobos et al. ( ). ...................................................................................................... figure . the schematic diagram shows single-inputs and multiple-output data for iterative algorithm. source: rojas villalobos. ............................................................................................ figure . equations to calculate average depth and maximum depth. .................................... figure . flowchart of the iterative algorithm to compute hydrologic characteristics using single-input data. source: rojas villalobos. ................................................................................. figure . water surface coverage map at different heights above sea level of the bustillos lagoon. sources: rojas villalobos with data from rojas-villalobos ( ). ............................. figure . comparative graph of volume, surface area, average depth, and maximum depth according to the height above sea level. source: rojas villalobos. ............................................. chapter introduction the base of the economy of the cuauhtemoc region in the mexican state of chihuahua is based on the apples, forage, and dairy products. in the early th century, one of the concerns of the mexican government was the sparse population in the northwest, which was isolated after the mexican revolution in , so the government implemented an immigration program to attract foreigners interested in agriculture. in march , the canadian mennonite exodus began to populate the cuauhtemoc region under the protection of mexican government that offered: no conscription, no oath to the country, and no restrictions to exercise their religious principles. they would be allowed to create their schools with their teachers, and they would have an independent economic regime. when this community arrived at cuauhtemoc, they had to change the agriculture techniques to be able to plant; therefore, they studied the soils to choose which kind of crop they would apply. at that time, alfalfa, apple orchards, barley, beans, corn, cotton, oats, wheat, and other fruit trees were planted on the soil with more humidity; the land with saline soils was utilized for grazing. currently, most of the land with the best soil to plant, is owned by private, and ejidos own some of the reminder. the big private owners are mennonites, and they have many financial resources to buy irrigation technology. on the other hand, many farmers are mennonites and mestizos that have not yet modernized their cultivation techniques ( % of irrigation areas). these farmers still use flood irrigation since they arrived in the region; also, this type of irrigation is used to cover areas as long as , feet, causing loss of water by the hydrologic wedge effect. these traditional irrigation methods, combined with the type of crops and intensive agricultural productivity employed in this region, have had a high impact on the static water table of the aquifer. by , the national water commission (conagua) had forecasted that the water table would decrease by - meters ( - feet) by if the current conditions of recharge and extraction remain (ibañez hernandez, ). however, another study made by conagua in indicated that the aquifer depletion was . meters per year. the first effect on the city was scheduled water shortages in the entire city, especially in lands at higher elevation. in order to cover the water demand, two public wells were extended meters depth ( feet) in . studies in recent years have demonstrated the rapid depletion of the cuauhtemoc aquifer due to various factors that come together in this water resource: the massive amount of extracted water, the low aquifer recharge rates, several droughts, and the irrigation techniques. the extractions of water in the cuauhtemoc basin are heterogeneous according to land use. excessive use of water is associated with large agricultural areas distributed throughout the basin, and in some other areas, the aquifer level is likely stable. these variations are due to the different velocities of groundwater flows and physical soil conditions (díaz caravantes, bravo peña, alatorre cejudo, & sánchez flores, ). according to the groundwater balance of cuauhtemoc basin published in the official journal of the federation (dof, ), the groundwater inflow is mm , vertical recharge precipitation is . mm , water return from irrigation is . mm , and extraction is . mm . the official document indicates a yearly deficit of mm of water across the basin. moreover, technical data of the study area is almost non-existent, the government are opaque in how they generate the water information, and the information that exists is inconsistent. for instance, ortiz and amado ( ) cite a document from the national water commission in where the bustillos lagoon has an area of km , but landsat image (nov , ) showed that the area of the waterbody is km . amado et al. ( ) cited a portal web of conagua where the basin of bustillos lagoon is , km , but actually, the area is , km . in some other official documents, government official only describe the physiography of the lagoon location (inegi, ). given this challenging panorama, the analysis of water balance in a region involves a complex interaction of natural and anthropogenic processes that affect the quality of groundwater and long-term availability. that is why in the next three chapters of this research, three factors that assist in planning and forecasting the future state of the regional aquifer are addressed: the storage capacity of the bustillos lagoon, the evaporation occurring in the bustillos lagoon, and techniques to estimate quickly and efficiently the geomorphological variables (volume, area, and depth) of this water body. research location the enclosed basin of bustillos lagoon is in the municipality of cuauhtemoc and situated in the central-west region of the state of chihuahua in the transition zone between the plateau and the mountains, with an area extent of , km , as depicted in figure . it is at º ' '' north, º ' '' west, and an altitude of , meters above sea level. cuauhtemoc municipality is bounded by the municipalities of namiquipa to the north, riva palacio to the east, cusihuiriachi and gran morelos to the south, and bachiniva and guerrero to the west (figure )(inegi ). the climate is warm semi-dry since it is in a transition zone between the semi-humid climate of the mountains and the desert of chihuahua (garcía ). the geology is composed of extrusive igneous rock: rhyolite-tuff acid ( . %), basalt ( . %), andesite ( . %), and volcanoclastic. the plains are composed of conglomerate ( . %) and sandstone-cluster ( . %). the average annual temperature is between ° c and ° c. the average annual rainfall varies between and mm per year (inegi ). figure . location of cuauhtemoc basin and bustillos lagoon (source: rojas villalobos with data retrieved from google maps and national institute of statistics and informatics – inegi, ). chapter topobathymetric d model reconstruction of shallow water bodies through remote sensing, gps, and bathymetry article submitted: january , . accepted: november , . journal: tecnociencia chihuahua. http://tecnociencia.uach.mx/numeros/v n /data/topobathymetric_ d_model_reconstruction_l aguna_de_bustillos.pdf abstract since there are no mathematical models that can calculate the laguna de bustillos’ water storage levels, water balance requires this data to understand the connectivity between this water body and the cuauhtemoc aquifer. this article presents a new three-dimensional reconstruction technique based on a time series of multispectral remote sensing images, bathymetry, a topographic survey with high precision gps, and regional contours. with the images of landsat etm+/oli and sentinel a from to , , and , the contours of the water surface were extracted using the mndwi and were associated with an elevation received from gps. an autonomous surface vehicle was also used to obtain the bathymetry of the lake. a topographic survey was carried out using gps in populated areas, and the contour lines extracted from the inegi continuous elevations model . . a dem was constructed using arcgis . . , and surfaces and volumes were calculated at different elevations and compared with landsat tm/etm+/oli multispectral images from to . the results showed that the mean of the average intersection area between the test images and the area extracted from the d http://tecnociencia.uach.mx/numeros/v n /data/topobathymetric_ d_model_reconstruction_laguna_de_bustillos.pdf http://tecnociencia.uach.mx/numeros/v n /data/topobathymetric_ d_model_reconstruction_laguna_de_bustillos.pdf model is above . % according to the confidence interval, kappa overall accuracy . – . %, and a coefficient . – . %. this model proved to be very accurate on a regional scale when the water level exceeded . meters above mean sea level and useful to evaluate and administer water resources. introduction the laguna de bustillos is in a region that has a high demand for groundwater for the agricultural industry, making the cuauhtemoc aquifer the largest over-exploited aquifer in northwest mexico (comisión nacional del agua, ). it is necessary to provide updated data to the water balance of the basin to improve water management in the region. because there are no known mathematical models that calculate water storage, it is imperative to develop a new technique or method that allows us to estimate the water volume contained in water bodies. the calculation of water storage of shallow water bodies requires the construction of d models of the terrain including the surrounding areas. integrating techniques based on sound, spectral analysis of satellite imagery, and gps allow researchers to increase the accuracy of the existing d models and expand them from the reservoir representation to a topobathymetric integrated model. topobathymetry is a geospatial concept that integrates bathymetric and topographic data from different spatial scales, time, and sensors. the terrain model is applied to monitor coastal erosion, sea level rise, flood impact reduction programs, and coral barrier studies (gesch et al., ). digital terrain models, topography, bathymetry, and the use of water body contours are essential sources for integrating this model. some research tried to get d models, but only one or two data sources were used in comparison with those applied in this research. the delimitation of water bodies is an indirect way of getting contour lines through differentiating the spectral response between the green band (g) and the bands near infra-red (nir) or the infra-red short- wave band (swir). the normalized difference water index (ndwi) (mcfeeters, ) and the modification of normalized difference water index (mndwi) (xu, ) have been used to monitor (lu et al., ) changes in the extent of the lakes (ma et al., ), and the location of water bodies (rana and neeru, ). sonar is a technique that uses sound waves to calculate water depth (knott and hersey, ) and has advantages such as high accuracy (± . m), low cost, and the device can be mounted on any boat. several types of research have used sound for mapping water bodies (mcpherson et al., ; popielarczyk and templin, ; giordano et al., ). leon and cohen ( ) modeled the volume of lake eyre in australia using bathymetry and remote sensing. the authors used surveys realized in and with the precision of ± . m in the vertical component and up to ± m in the horizontal component, which proved to be a very limited and inaccurate method. water storage has two components: groundwater and surface water (lakes, ponds, or reservoirs) (brooks et al., ). some variations in water storage in the reservoirs are due to an underground hydraulic connection between aquifers and water bodies (isiorho et al., ; winter, ). these variations in the volume of water can be so drastic that large reservoirs dry up in a short time like laguna de bustillos had in years to and (nasa, ). although there is a geohydrological study that supports recharge deficit in the aquifer, there is no information about the storage capacity of laguna de bustillos. the lack of information encourages the main objective of this research to generate a new technique to generate a d topobathymetric model that contributes to the generation of updated data, which allows the deduction of variables, such as underground infiltration from the catchment area of laguna de bustillos. despite these models of volumetric estimation of water bodies, the combination of more than two different topobathymetric measurement techniques had not been explored. this document proposes a unpublish new method integrating three methodologies to generate a more robust and accurate three-dimensional model. materials and methods this study was conducted between and the first semester of in the spatial applications and research center at the new mexico state university. the study area of laguna de bustillos is in the quadrant between the coordinates ° ' ''n – ° ' ''n and ° ' ''w – ° ' ''w in the municipality of cuauhtemoc, in the state of chihuahua (figure ). figure . the study area of laguna de bustillos, chihuahua. source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). this region’s climate is warm and semi-arid since it is in a transition zone between the semi-humid climate of the mountains and the chihuahua desert (kottek et al., ). the average annual temperature ranges from . to °c, with an average annual rainfall of about mm per year (servicio meteorológico nacional, ). the authors designed a new four-stage method to develop a -d topobathymetric model for the purpose of determining water storage: i) extract contour lines through a time series of remote sensing; ii) determine bathymetry; iii) perform a topographic survey (gps-rtk); and iv) extract contours from the regional terrain digital model. also, it was included a regression analysis in determining the two equations that provide the volume and surface area using water height. the flowchart below (figure ) shows the modeling process. figure . schematic of the workflow to generate the d model. source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). bathymetry the new mexico water resources research institute (wrri) funded a project to build an autonomous surface vehicle (asv) to generate bathymetric data for shallow water bodies. a pvc center frame was attached to a two-hulled catamaran boat, propelled by two motors, and equipped with a gps on the top to receive signals via satellite to provide the direction and location. an ardupilot® system automated the catamaran navigation through an arduino® mega board to receive the gps signal while the sonar data bus decoded and recorded the information on an sd card. subsequently, the recorded points were downloaded to a computer for processing. the transducer was a garmin® intelliducer thru-hull nmea- , which does not require the previous calibration and can measure from cm to m with a . m accuracy (rojas-villalobos, ). to construct a d model of the region including the bottom of the lake, the bathymetry data (depth) was transformed into topographic data (height). figure shows the schematic of the surveying process to transform to the correct topographic points. figure . components to calculate the height of the lake bottom above sea level. source: rojas villalobos. the following equation ( ) was developed to calculate the altitude above sea level for each bathymetric point: ( ) here, abp is the height of the bathymetric point, asnm is the altitude above sea level of the reference level, ps is the depth of the sonar, and pr is the recorded depth. the bathymetry consisted of trajectories, and the data were adjusted through the above equation using the reference levels of the survey days. a gps-rtk was used to establish the fixed reference point corresponding to the height of the lake contour and was linked to the bathymetry obtained that day. contour extraction from remote sensors since the spatial resolution of remote sensing is the most important factor for delineating the contours of water bodies, landsat etm +, landsat oli (operational land and imager), and sentinel a (table ) were chosen to build the mndwi. table . collection of remote sensing data used in this article. sensor acquisition date bands (µm) spatial resolution (m) landsat etm+ (usgs, a) may ; june ; june ; january ; february ; february (green . - . ) (swir- . - . ) (panchromatic) landsat oli (usgs, a) august ; june , august ; september (green . - . ) (swir . - . ) (panchromatic . - . ) sentinel a (esa, ) march ; june august (green . - . ) (swir . - . ) these images are available for free on the landsatlook viewer websites of the united states geological survey (usgs, a) and the copernicus open access hub of the european space agency (esa, ). seven images were selected with the lowest possible cloudiness over the study area during the time the lake had gradually dried (march – august ). also, six recent images were downloaded to establish the maximum lagoon extent and baseline curves for the bathymetry data (june – september ). using the semiautomatic classification extension (congedo, ) in qgis®, atmospheric correction was applied to the images using the method of subtraction of dark objects (chavez, ). then, a fusion of images was performed with the panchromatic band (etm + and oli) using the brovey transformation (johnson et al., ) to increase the spatial resolution to m before the mndwi construction. the normalized difference water index (ndwi) was created to identify landsat water bodies. the high relative reflectance of green (g) in the electromagnetic spectrum contrasts with the high absorption of the nir in clear water (mcfeeters, ). excessive suspended matter in the water increases reflectance measurements in the nir band (ruddick et al., ), thus dramatically reducing the difference between the g-nir bands, which makes it difficult to distinguish between water and non-water surfaces. therefore, the ndwi method is not fit for laguna de bustillos due to the turbidity of water. the mndwi suppresses this problem by replacing the nir band with an infrared shortwave band (swir) because the water absorbs energy and the reflectance is low. the equation that determines the mndwi (xu, ) is: ( ) where g is the green band of the electromagnetic spectrum and swir is the short-wave band of the infrared spectrum. the possible mndwi values are from - to . in arcgis®, the raster calculator was used to apply the mndwi equation to landsat and sentinel images. according to the mndwi method, positive values represent water and negative values the surface without water. therefore, the resulting raster was reclassified by assigning to those values greater than and to values less than or equal to . from the reclassified images, the contours were extracted and examined through visual interpretation. this procedure ensures that the extracted contours correspond to the edge of the lake using false infrared color composite images and avoids errors due to the influence of the vegetation. a failure of the slc (scan line corrector) introduced strips with missing data in the landsat etm+ images captured on may st, (usgs, b). due to this error in the sensor, only segments were vectorized corresponding to the edge of the water surface. an orthometric height was assigned to the contours using the closest abp to the contour line (< . meters). when there were no bathymetry points near the line, points were selected in a buffer of to m on each side of each contour. the contour took the mean height following the classic central limit theorem (erdös and rényi, ; dowdy et al., ). according to this theorem, when the sample size increases, the average sample will approximate a normal distribution. this procedure reduces the uncertainty and variability of bathymetric data due to boat sway and sonar accuracy (krause and menard, ; eltert and molyneux, ; schmitt et al., ). topography the gps points were measured using two sokkia grx gnss devices with a horizontal accuracy of mm and mm on the vertical axis. a gps was established as base at the coordinate ° ' . "n and ° ' . "o at the height of . on the wgs ellipsoid of . topographic points were collected and transformed to the mexican gravimetric geoid (ggm ) to generate altitude above the mean sea level (inegi, ). digital elevation model a contour was extracted at every meter from the mexican elevation continuation . (cem . ) of the national institute of statistics and geography (inegi, ). on september th, , the water level of the lake was . m above sea level (masl). for this reason, contour lines below m were eliminated from the regional dem. topobathymetric d model and volume estimation an mde with a spatial resolution of m was created using the four sources of elevation data using the topo-to-raster tool contained in the d analysis module of arcgis. this tool allows the creation of hydrologically correct lifting meshes based on the anudem program (hutchinson et al., ). since the triangulated irregular network (tin) generates more accurate volumetric calculations (mi et al., ; hanjianga et al., ), the dem was converted into a tin. the volume and water surface were calculated from . m to . masl every mm using the arcgis polygon volume tool. statistical evaluation since there is no previous model to evaluate the lake storage, areas of water coverage of different scenes were extracted through remote sensing (rs) when the lake was drying (real area) ( table ). table . list of multispectral images used to compare d model contours. sensor acquisition date water surface (km ) landsat tm (usgs, a) june- - may- - june- - march- - april- - abril- - november- - september- - december- - , , , , , , , , , , , , , , , , , , landsat etm+ (usgs, a) january- - may- - august- - , , , , , , landsat oli (usgs, a) may- - june- - august- - october- - , , , , , , , , the area of each scene was used to extract the corresponding contour line from the d model and generate the area. using arcgis, the intersection of the two layers was the area of a coincidence that was statistically evaluated (figure ). figure . demonstration of matching areas between water surface extracted from a multispectral satellite image and the d model at the same reference level. source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). some landsat etm + and oli images were replaced with recent sentinel images (early ) to distribute the extracted contours along the height through the d model ( table ). this procedure is used to evaluate the model accuracy (reality vs. model). table . list of multispectral images used to compare areas between reality and d model. added images are identified with *. sensor acquisition date water surface (km ) landsat tm (usgs, a) june- - may- - june- - march- - april- - , , , , , , , , , , landsat etm+ (usgs, a) january- - may- - august- - , , , , , , sentinel (esa, ) may- - * july- - * january- - * april- - * , , , , , , , , because of the surface area changes according to the elevation of the water surface, it is not possible to evaluate the efficiency of the model directly. for this reason, the relationship between the coincidence surface and the reference area of the satellite image were used. the maximum possible relation between both areas is % because the level curves obtained from the d model are directly related to the waterbody contours. the water/non-water coverage maps of the model and the satellite images of each year ( table ) were analyzed using the kappa statistic (k-hat) through qgis (qgis, ) and semi- automated classification plugin (congedo, ). the kappa coefficient and overall accuracy allows us to know the degree of agreement between the d model and the water body surface (card, ; jensen, ; congalton and green, ; lillesand et al., ) . also, the t- statistical distribution was applied to find the lower limit of the % confidence interval and estimated the range of acceptable match surface values (from table ) according to the sample mean (dowdy et al., ) ( ). ( ) where x is the mean of the sample, α is the level of significance, ν is the degrees of freedom (n - ), s is the standard deviation, and n is the sample size. finally, two equations were generated representing the area of the water surface and the volume contained in the lake according to the elevation of the water surface. results and discussion figure shows the sources of data used for the reconstruction of the topobathymetric model: contours from remote sensors, , bathymetry points, , gps points, and inegi contours. figure . map showing bathymetry, gps points, derived curves from multispectral rs, and regional contours (inegi). source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). as a result of the reconstruction data process, figures and show the d topobathymetric model and a d perspective of the laguna de bustillos. the results show that the deepest point of the lake is at . masl, the maximum depth is . m when the water level reaches the masl, the water storage is . mm , and the average depth is . m. figure . triangulated irregular network is representing the topobathymetric d model of laguna de bustillos. source: rojas villalobos. figure . d perspective of laguna de bustillos ( times height exaggeration for better visualization). source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). since the kappa statistic shows the difference between classified values of the satellite image (reference data) and the surface of water body generated by the d model, the coincidence is expected to be high. typically, kappa values greater than . represent a strong match between the compared data. the result of the comparison shows an overall accuracy higher than . % and the k-hat coefficients above . . table shows the increase of the values of overall accuracy and the kappa coefficient when the water level is higher. table . kappa coefficient values and overall accuracy between imagery (reality) and simulation ( d model). date sensor surface (km ) elevation (m) depth average (m) k-hat overall accuracy (%) / / landsat tm . . . . . / / landsat etm+ . . . . . / / landsat tm . . . . . / / landsat tm . . . . . / / landsat tm . . . . . / / landsat tm . . . . . / / landsat etm+ . . . . . / / landsat etm+ . . . . . / / sentinel . . . . . / / sentinel . . . . . / / sentinel . . . . . / / sentinel . . . . . it is observed that the values of elevation that are between . and . have a value of k-hat less than . and are associated with water coverage less than km . when the water level rises above . m, the kappa indicator increases its value above . , reaching levels of . . also, low k-hat values ( . – . ) are associated with low depth averages (< . m) in contrast to those k-hat values above . that are in depth averages greater than . m. conversely, with a confidence level of %, the mean of the percentage of matching areas between the satellite images and the d model is greater than . % (table ). table . confidence interval analysis for the percentage of the matching area between the three- dimensional model and the sample images. mean . degree of freedom standard error . α . median . t . , . standard deviation . t . , std. error . simple variance . ic . : δ - t . , std. error . sample size below the contour . m, four of the six comparisons are below the lower limit of the confidence interval (figure ). figure . graph showing the behavior of the intersection percentage between the surfaces of the d model and the areas of rs images along elevation. the mean area intersected below the reference level is only . %, while in the upper range, it is . %. two equations were generated that estimated the area of water coverage according to the depth of the lake. the first equation calculated the volume below the . masl and the second equation calculated the remaining volume above it. similarly, two other equations were generated estimating the amount of water in the lake. the determination coefficients (r ) for the estimated equations are greater than . ; this indicates that the equations obtained are suitable for the topobathymetric model within the extent limits of the lake (figure ). figure . graphs of the surface and volume equations adjusted to the d model. conclusions four different techniques, such as bathymetry, gps-rtk points, and contour lines extracted from the remote sensors, were decisive in creating this new three-dimensional modeling methodology for water bodies. its efficiency is demonstrated after the statistical analysis applied. according to the results obtained in the kappa analysis and the confidence interval, the d model is a robust and precise model (kappa> . ). three processes were important in the construction of the model: • the use of high precision gps helped in fixing the reference height points of the contours of the most recent satellite images ( – ) with great precision and accuracy. • the bathymetric points linked to the current height of the water level of the lake were instrumental in establishing the height above sea level at the bottom of the lagoon. • the related height between the bathymetric points and the levels closest to the bottom of the lake was extracted from the satellite images ( – ). additionally, it was observed that the segments of the contours extracted from the landsat etm+ images with an error in the slc (usgs, b) influenced the relative low efficiency ( . < kappa < . ) of the model below . masl. on the other hand, effectiveness in the top height ranges from . to masl was as a result of the spatial resolution of the satellite images of landsat oli ( m panchromatic) and sentinel ( m) (figure ). figure . rs time series contours. the dark contour delimits the outer areas with greater d model performance and the internal area with less accuracy. source: rojas villalobos with data retrieved from landsatlook viewer (usgs, a). although this d hydrological model is very robust to be used in the administration of water in the basin, special care must be taken in forecasting floods in rural-urban areas. the model simulates much of the flooded areas of mennonite farmers, but the d model should not be used to prevent flood risks due to the topographic complexity with dams and ditches. in future work, researchers should continue the bathymetric survey with greater data density using a sonar with increased accuracy to further the model’s efficiency. the acquisition of more bathymetric data will allow replacing contours extracted from the oldest images such as landsat et and etm +. additionally, the photogrammetric triangulation could be of great benefit in urban and agricultural zones to delineate more accurate topography. this development is the first step to estimate the volume of water in the laguna de bustillos as this work produces estimates that approximate the actual values and such research is relevant to water management in the region. references brooks, k.n., p.f. ffolliott, and j.a. magner . hydrology and the management of watersheds. john wiley & sons. iowa. p. card, d.h. . using known map category marginal frequencies to improve estimates of thematic map accuracy. photogramm. eng. remote sens : – . chavez, p.s. . image-based atmospheric corrections-revisited and improved. photogramm. eng. remote sens : – . comisión nacional del agua, . estadísticas del agua en méxico. secretaría de medio ambiente y recursos naturales, méxico. congalton, r.g., green, k., . assessing the accuracy of remotely sensed data: principles and practices. crc press. congedo, l., . semi-automatic classification plugin for qgis. sapienza univ. rome. dowdy, s., wearden, s., chilko, d., . statistics for research. john wiley & sons. eltert, j.f., molyneux, j.e., . the long-distance propagation of shallow water waves over an ocean of random depth. j. fluid mech : – . erdös, p., rényi, a., . on the central limit theorem for samples from a finite population. publ math inst hung. acad sci : – . esa, . copernicus open access hub [www document]. url https://scihub.copernicus.eu/ (accessed . . ). gesch, d.b., brock, j.c., parrish, c.e., rogers, j.n., wright, c.w., . introduction: special issue on advances in topobathymetric mapping, models, and applications. j. coast. res : – . giordano, f., mattei, g., parente, c., peluso, f., santamaria, r., . microvega (micro vessel for geodetics application): a marine drone for the acquisition of bathymetric data for gis applications. int. arch. photogramm. remote sens. spat. inf. sci : . hanjianga, x., limina, t., longa, s., . a strategy to build a seamless multi-scale tin-dem database. int. arch. photogramm. remote sens. spat. inf. sci . hutchinson, m.f., xu, t., stein, j.a., . recent progress in the anudem elevation gridding procedure. geomorphometry , – . inegi, . continuo de elevaciones mexicano . (cem . ) [www document]. datos relieve. url http://www.inegi.org.mx/geo/contenidos/datosrelieve/continental/continuoelevaciones.as px (accessed . . ). inegi, . el geoide gravimétrico mexicano . instituto nacional de estadística y geografía, méxico. isiorho, s.a., matisoff, g., wehn, k., . seepage relationships between lake chad and the chad aquifers. groundwater : – . jensen, j.r., . remote sensing of the environment: an earth resource perspective /e, nd ed, prentice hall series. pearson education. johnson, b.a., tateishi, r., hoan, n.t., . satellite image pansharpening using a hybrid approach for object-based image analysis. isprs int. j. geo-inf : – . knott, s.t., hersey, j.b., . interpretation of high-resolution echo-sounding techniques and their use in bathymetry, marine geophysics, and biology. deep sea res ( ): – . kottek, m., grieser, j., beck, c., rudolf, b., rubel, f., . world map of the köppen-geiger climate classification updated. meteorol. z. , – . krause, d., menard, h., . depth distribution and bathymetric classification of some sea- floor profiles. mar. geol. , – . leon, j.x., cohen, t., . an improved bathymetric model for the modern and palaeo lake eyre. geomorphology , – . lillesand, t., kiefer, r.w., chipman, j., . remote sensing and image interpretation. john wiley & sons. lu, s., ouyang, n., wu, b., wei, y., tesemma, z., . lake water volume calculation with time series remote-sensing images. int. j. remote sens. , – . ma, m., wang, x., veroustraete, f., dong, l., . change in area of ebinur lake during the – period. int. j. remote sens. , – . mcfeeters, s.k., . the use of the normalized difference water index (ndwi) in the delineation of open water features. int. j. remote sens. , – . mcpherson, k.r., freeman, l.a., flint, l.e., . analysis of methods to determine storage capacity of, and sedimentation in, loch lomond reservoir, santa cruz county, california, (usgs numbered series no. – ), scientific investigations report. u.s. geological survey, reston, va. mi, h., zai, j., jiang, x., . contrast and analysis of reservoir storage calculation methods [j]. surv. mapp. geol. miner. resour. , . nasa, . history landsat science [www document]. url https://landsat.gsfc.nasa.gov/about/history/ (accessed . . ). popielarczyk, d., templin, t., . application of integrated gnss/hydroacoustic measurements and gis geodatabase models for bottom analysis of lake hancza: the deepest inland reservoir in poland. pure appl. geophys. , – . qgis development team ( ). qgis geographic information system. open source geospatial foundation project. http://qgis.osgeo.org rana, h., neeru, n., . water detection using satellite images obtained through remote sensing. adv. comput. sci. technol. , – . rojas-villalobos, h.l., . d bathymetric model of a shallow lagoon measured by a solar powered low-cost autonomous surface vehicle prototype in cuauhtémoc, chihuahua, mexico. (academic research), student water research awards - . new mexico water resources research institute, las cruces, nm. ruddick, k.g., de cauwer, v., park, y.-j., moore, g., . seaborne measurements of near infrared water-leaving reflectance: the similarity spectrum for turbid waters. limnol ocean. , – . schmitt, t., mitchell, n.c., ramsay, a.t.s., . characterizing uncertainties for quantifying bathymetry change between time-separated multibeam echo-sounder surveys. cont. shelf res. , – . servicio meteorológico nacional, . información climatológica ( - ) [www document]. url http://smn.cna.gob.mx/es/informacion-climatologica-ver- estado?estado=chih (accessed . . ). usgs, a. landsatlook viewer [www document]. url https://landsatlook.usgs.gov/ (accessed . . ). usgs, b. slc-off products: background | landsat missions [www document]. url https://landsat.usgs.gov/slc-products-background (accessed . . ). winter, t.c., . relation of streams, lakes, and wetlands to groundwater flow systems. hydrogeol. j. , – . xu, h., . modification of normalized difference water index (ndwi) to enhance open water features in remotely sensed imagery. int. j. remote sens. , – . chapter comparison of evaporation estimates from reem and eeflux models in a shallow water body. case: bustillos lagoon, chihuahua, mexico. article submitted: november , . status: in review. journal: tecnología y ciencias del agua (imta). abstract water body evaporation (e) within endorheic basins in semiarid areas is a critical factor for the determination of the water balance. unfortunately, the bustillos lagoon has dried up completely six times during this century, and there are no records of the evaporation rate. furthermore, accurate e measurements can provide valuable information for the sustainable management of water resources for protecting wild habitat in the face of climate change scenarios. evaporation can be estimated, however, through methods as efficient as penman using variables from agroclimatic stations, such as wind velocity, net radiation, relative humidity, and air temperature, which have a spatiotemporal variability. within the evaporation models based on remote sensors (rs) is the surface energy balance model (seb), which has been applied to different methodologies and extends the measurements of evapotranspiration (et) at a regional level. seb-based methodologies use physical principles with minimal weather data requirements to estimate et. hence, this article compares two methodologies that estimate evaporation using rs: the regional evapotranspiration estimate model (reem) and the earth engine evapotranspiration flux (eeflux). the comparison of et measurements obtained from reem and eeflux for seven landsat oli scenes in the agriculture cycle of april to september applied against to the simplified penman equation showed that the reem performed better (d= %) than the eeflux (d= %) for the indicated period. although the comparison of reem and eeflux shows accurate e measurements (reem), gridded weather data (eeflux) need to be improved by increasing the scale using local information. introduction the bustillos lagoon is the largest water body (~ km ) in the cuauhtemoc valley (in chihuahua, mexico), which is in an endorheic basin ( , km ).the climate is semiarid, and agriculture is intensive. high competition for water resources among stakeholders (díaz caravantes, bravo peña, alatorre cejudo, & sánchez flores, ) has exerted high pressure on the aquifer. according to mexican authorities, this phenomenon has caused the aquifer to be overexploited (diario oficial de la federación, ). for this reason, farmers have made dams and ditches to divert and retain a small part of the tributary flows before they reach the bustillos lagoon. these practices, however, limit the source of water that supplies it. the bustillos lagoon, like any water body, is essential for its thermoregulatory climate function in the region as it absorbs heat fluxes and releases moisture (rooney & bornemann, ; subin, murphy, li, bonfils, & riley, ). in addition, it is ecologically important as a resting place for migratory waterbirds (mireles & mellink, ). aquatic systems in semiarid areas are susceptible to drastic variations in water levels, which affects the aquatic life (amado-Álvarez, pérez cutillas, ramírez valle, & alarcón cabañero, ) that feeds waterbirds. if water resources are not correctly managed, regional sustainability will be jeopardized, causing the desiccation of water bodies such as the aral sea between kazakhstan and uzbekistan (gross, ), lake chad in the borders of niger, nigeria, cameroon and chad (okpara, stringer, dougill, & bila, ) and lake urmia in iran (aghakouchak et al., ). these water bodies are drying up because of the diversion of tributary rivers to agricultural fields, droughts, and upstream competition for water. evaporation data of the lagoon are required to establish administrative water resource policies to avoid catastrophic scenarios and to conserve the water balance in the cuauhtemoc basin evapotranspiration (et) is a process that combines the evaporation of water surfaces, the evaporation of soil moisture, and the transpiration of vegetation (erickson et al., ). evaporation is part of et, which is governed by aerodynamic and energy equations (penman, ). under this approach, it is possible to estimate the evaporation of a water body through the calculation of et using remote sensing techniques. the most effective (and costly) techniques for measuring evapotranspiration are lysimeters or eddy covariance flux stations (hirschi, michel, lehner, & seneviratne, ), which do not exist in the study area. because of this situation, it is necessary to explore emerging alternative methodologies for measuring et. rohwer ( ) developed evaporation coefficients (kpan) for the evaporation pan method (u.s. class a pan) for each month of the year. the problem with this approach is that the method used lakes in the state of colorado as research sites. these sites contained clear water, and the physical aspects of the metal pan container affected evaporation measurements (fu, charles, & yu, ; rayner, ). in addition, a pan coefficient is a function of depth and surface area of the lake that is being estimated. the bustillos lagoon has particular characteristics that make it different from other lagoons and lakes. for example, in addition to being a shallow lagoon, turbidity is high, caused by the content of suspended material (Álvarez, cutillas, valle, & cabañero, ; amado-alvarez et al., ). radiation flux from the sun penetrates deeply into the water column in clear water conditions, absorbing energy (smith & tyler, ). under conditions of turbidity and low depth (< m) (rojas-villalobos, alatorre-cejudo, stringman, samani, & brown, ), solar radiation is scattered by suspended particles on the surface layer. therefore, the water temperature is increased, resulting in more evaporation (kirk, ). under these conditions, it is not possible to apply pan evaporation coefficients, since the physical characteristics change in each lake or lagoon. the methods for calculating evaporation can be classified into those based on: daytime air temperature range such as that of papadakis (papadakis, ); air temperature and day length such as hamon (hamon, ), and blaney-criddle (blaney & criddle, ); solar radiation and air temperature such as jensen-haise (jensen & haise, ), makkink (makkink, ), and stephens-stewart (stephens & stewart, ); heat flux and water vapor flux (combination) such as priestley-taylor (priestley & taylor, ), de bruin-keijman (de bruin & keijman, ), penman (penman, ), brutsaert-stricker (brutsaert & stricker, ), and de bruin (de bruin, ). although these methods can offer good evaporation approximations, estimates are local at the point of the reference weather station. given this limitation, remote sensing (rs) techniques expand measurements to the regional scale in a cost-effective way. there are different satellite-based methods established on physical relationships and theoretical foundations. zhang, kimball, & running ( ) classified et retrieval methods in eight groups: i) penman-monteith (pm) (cleugh, leuning, mu, & running, ; li et al., ); ii) priestley-taylor (pt) (martínez pérez, garcía-galiano, martin-gorriz, & baille, ); iii) water-carbon linkage (wcl)(fisher et al., ); iv) water balance (wb) (reitz, senay, & sanford, ); v) maximum entropy production (mep)(h. wang, tetzlaff, & soulsby, ); vi) surface energy balance (seb)(senkondo, munishi, tumbo, nobert, & lyon, ); vii) ts-vi space (tvi) (zhu, jia, & lv, ); and viii) empirical and other methods (eo). each physical-theoretical basis reported by these groups has advantages and restrictions. for instance, pm models have a robust physical base, but on the other hand, the forcing of meteorological variables induces and propagates uncertainty in the evaporation estimate. the simplified pm model is the theoretical basis of pt as a primary governing equation by adding semiempirical equations. the estimations of the water-carbon linkage method use the advantages of carbon processes, which increases uncertainty in carbon fluxes caused by forcing climatological data. the theory of nonequilibrium thermodynamics is the basis of the mep model, which requires few enforced climatological variables but requires continuous surface temperature measurements. the seb models require minimum local weather data and rs, but they are susceptible to temperature deviations and need clear-sky conditions. tvi models have low-temperature sensitivity but require clear-sky conditions, and they oversimplify tvi space relationships. a weak theoretical base of empirical models does not make them a robust option for application in water management policies. within the seb classification, there are two methodologies with a strong physical- theoretical bases: the regional evapotranspiration estimate model (reem) (hewitt, fernald, & samani, ; kıvrak, bawazir, samani, steele, & sönmez, ; a. samani & bawazir, ; z. samani, bawazir, bleiweiss, et al., ; z. samani, skaggs, & bleiweiss, ) and the earth engine evapotranspiration flux (eeflux) (allen et al., ; ayyad, al zayed, ha, & ribbe, ), which is a version of mapping evapotranspiration at high resolution with internalized calibration (metric) (allen, tasumi, & trezza, ; allen, tasumi, trezza, et al., ). reem and metric use the same physical basis of surface energy balance algorithms for land (sebal) (bastiaanssen, menenti, feddes, & holtslag, ; bastiaanssen, pelgrum, et al., ) but with some differences in sensible heat flux (h) estimation and net radiation (rn). eeflux is an integration of the metric model in the google earth engine platform, which uses landsat satellite images, nldas and cfsv gridded weather data (the united states and rest of the world, respectively) for calibrating the metric model (allen, tasumi, & trezza, ; allen, tasumi, trezza, et al., ; irmak et al., ). also, remote sensors can estimate the evaporation of water bodies through the relationship with the reference evapotranspiration of agroclimatological stations and thus have the basis for establishing policies about consumptive water use. because of the particular semiarid climatic conditions of the cuauhtemoc valley, as well as the turbidity and shallowness of the bustillos lagoon, the objective of this paper is to examine the effectiveness and performance of two evapotranspiration models based on remote sensors (reem and eeflux) against the simplified penman (s-penman) equation (valiantzas, )(derived from the penman equation) to estimate the e of this water body. background reference evapotranspiration model a well-known proven method for estimating evaporation from a free water surface is the penman (penman, ) equation, which is widely used around the world (bozorgi, bozorg- haddad, sima, & loáiciga, ; cabrera, anache, youlton, & wendland, ; b. wang, ma, ma, su, & dong, ). this research used a simplified version of the penman (s-penman) equation, which uses standard climatological records, such as solar radiation, air temperature, relative humidity, and wind speed at a -m height above the ground surface (valiantzas, ), as noted below: ( ) where e is the evaporation (mm d- ), α is albedo ( . for water), rs is the solar radiation data estimated from measured daytime hours (mj m- d- ), t is the mean air temperature (ºc), ra is the extraterrestrial solar radiation (mj m- d- ), rh is the mean relative humidity (%), au is equal to when the wind function is used from the original penman equation( ), and u is the average wind velocity (m s- ). brief description of remote sensing models the surface energy balance equation (bastiaanssen, menenti, et al., ; bastiaanssen, pelgrum, et al., ) is the foundation of et models based on remote sensors such as reem (samani et al., ; samani, bawazir, bleiweiss, skaggs, & schmugge, ) and eeflux (allen et al., ; allen, tasumi, & trezza, ), which determines the latent heat flux that represents the residual of the surface equation of energy used in the process of evapotranspiration. the equation can be expressed as ( ) where le is the latent heat flux of vaporization, rn is the net radiation at the surface, g is the soil heat flux, and h is the sensible heat flux into the air. for reem, the units of the surface energy balance equation are in mj m- day- ), while eeflux uses wm- . the different components of the equation can be solved separately through energy flux models. below are the fundamental descriptions of the reem, metric, and eeflux models and their main features. reem samani and other researchers developed a methodology to calculate rn (z. samani, bawazir, skaggs, et al., ; z. samani, bawazir, bleiweiss, et al., ): ( ) where rn is the daily net radiation (mj m- day- ), rni is the instantaneous clear sky net radiation (w m- ), rs the daily shortwave solar radiation (mj m- day- ), rsi the instantaneous shortwave solar radiation (w m- ), ta is the mean daily temperature (°k), and ti is the instantaneous air temperature (°k). the instantaneous net radiation is the difference between incoming and outgoing fluxes and is estimated (bastiaanssen, ) as ( ) where rni is the instantaneous net radiation (w m- ), α the surface albedo (nondimensional), rsi is the instantaneous incoming shortwave radiation (w m- ), rl↓ is the instantaneous incoming longwave radiation (w m- ), rl↑ is the instantaneous outgoing longwave radiation (w m- ), and ε is the surface emissivity (nondimensional). the detailed process to obtain rni is outlined by samani et al. ( b). the instantaneous soil heat flux (gi) was calculated at the time when the satellite overpassed the study site using a normalized difference vegetation index (ndvi) (z. samani, sammis, skaggs, alkhatiri, & deras, ) by the next equation: ( ) the aerodynamic equation (bastiaanssen, ) and the monin–obukhov similarity theory (monin & obukhov, ) were combined to estimate instantaneous sensible heat flux. the aerodynamic equation is expressed as ( ) where ρa is the air density (kg m- ), cp is the specific heat of air ( , j (kg - k- )), t is the aerodynamic surface temperature (°k), ta is the air temperature (°k), rah is the aerodynamic surface resistance, and dt is the air temperature gradient calculated through a bastiaanssen ( ) equation. moreover, dt needs a and b constants for a calibration, for which they were empirically computed by selecting two pixels called “hot and cold pixels” taken from the image. these pixels represent extreme conditions: one of aridity (latent heat flux close to zero for dry soil) and the other of humidity (sensible heat flux close to zero for well-irrigated crop), respectively. the hi equation was used to calculate dt. the cold pixel took the sensible heat value. because there is no et on dry bare soil, instantaneous latent heat was set to zero, and rni and gi could be calculated. the hot pixel was estimated as the hi value by calculating the residual of the energy balance: ( ) the ground surface wind speed data ( m) was extrapolated to m, and an iterative stability correction model based on the monin–obukhov similarity theory was used to estimate the aerodynamic resistance (rah) (allen, tasumi, & trezza, ; bastiaanssen, ) for each pixel. the hi and dt were calculated for each pixel after calibration constants were estimated. the gi and rni were calculated at the time of the satellite overpass for the study area. the detailed process for obtaining the et is outlined by samani et al. ( , a, b). metric the net radiation (rn) is the balance of all outgoing radiant fluxes and all incoming radiant fluxes, including solar radiation and radiation in the thermal band. metric uses the same rn equation as the reem: ( ) where the net radiation is in w m- , rs is the incoming solar radiation (w m- ), α is the albedo of surface (nondimensional), rl↓ is the incoming longwave radiation (w m- ), rl↑ is the outgoing longwave radiation (w m- ), and ε is the thermal emissivity of the surface (nondimensional). metric uses the same algorithms to compute rn as the reem. the process to determine rn is detailed by allen et al. ( a, b). in metric, g is estimated by the following equations defined by tasumi et al. ( ), which depend on the net radiation and the leaf area index (lai) vegetation: ( ) ( ) where ts is the temperature on the near surface (°k). in addition, “cold” and “hot” pixels are used in metric, which employs the same algorithm to calculate h in eq. but with differences in pixel selection. because surface wetness has higher values than other surrounding vegetation crops, the cold pixel assumes . times etref, which is calculated from the standardized asce penman-monteith equation (asce– ewri, ). as in reem, the hot pixel is anchored to a dry agricultural surface free of vegetation, which assumes that latent heat flux is equal to . a detailed process can be found in allen et al. ( a, b). eeflux the algorithms used in metric were adapted to the eeflux using javascript and python apis to compute the et automatically. while metric uses a weather station to calibrate the model at the runtime, the eeflux uses gridded weather data sets from external sources to estimate at-surface reflectance, autocalibration, and the daily soil-water evaporation process. these sources are the nldas (with a -km grid size), the gridmet, and daymet data sets for the united states. furthermore, cfsv (with a -km grid size) provides gridded weather data for the rest of the world. irmak et al. ( ) and allen et al. ( ) outlined the implementation of the metric equations in eeflux. material and methods the processes that integrate the methodology for comparing the performance of reem and eeflux with the s-penman are noted below in figure : figure . schematic flow chart of the process of comparing the reem and eeflux models to obtain e estimations of water bodies by comparing the s-penman equation. source: rojas villalobos. study area this study was conducted during the agricultural cycle from april to september in the cuauhtemoc valley. the bustillos lagoon is a shallow endorheic freshwater body in the municipality of cuauhtemoc, in the mexican state of chihuahua. the lagoon is in latitude ° ’ . ” n and longitude ° ’ . ” w. the lagoon has an approximately oval shape, of which the major axis is km, and the minor is kilometers with an average depth of . m. in addition, the area can fluctuate to around km (figure )(rojas-villalobos et al., ). currently (august ), the surface of bustillos lake is . km ; moreover, it stores . hm and has an average depth of . m. the turbidity of the lagoon water is closely related to the shallow depth and high concentrations of sediment carried by the tributaries. additionally, surface water erosion in the region is mainly due to extensive agriculture, sparse riparian vegetation, and the deforestation of the slopes of the mountain ranges that delimit the basin (Álvarez et al., ; amado-alvarez et al., ). figure . location of the bustillos lagoon and the agro-meteorological station. source: rojas villalobos with data retrieved from inegi ( ). agro-meteorological data an agroclimatic station, adcon™, located . kilometers west of the bustillos lagoon at ° ' . "n, ° ' . "w and m.a.s.l provided hourly meteorological data that reem required to calculate the et for each date from downloaded landsat oli satellite images. in addition, the agroclimatic station provided data for computing e by using the standardized s-penman equation (valiantzas, ) through tr combi sensors for temperature and relative humidity, as well as pyranometers (sp lite and cmp ), and wind speed. landsat oli selection seven landsat oli images (table ), from two different paths were chosen for continuity in the temporal and geographical space between the beginning (april) and the end (september) of the agricultural cycle in the cuauhtemoc basin. additionally, the images met no cloud criteria (clear-sky) in the study area. for this reason, the intersection strip between path and path was used to estimate the et. table . landsat oli imagery used to estimate eta through reem and eeflux. source: usgs ( ). date doy overpass time (local time) scene - - : : lc lgn - - : : lc lgn - - : : lc lgn - - : : lc lgn - - : : lc lgn - - : : lc lgn - - : : lc lgn reem and eeflux raster the satellite images were radiometrically calibrated and atmospherically corrected using the envi® software through the fast line-of-sight atmospheric analysis of hypercubes (flaash™) tool. once the satellite images were processed for obtaining the eta through the reem, the eta layers of the eeflux model were downloaded from the web portal (http://eeflux- level .appspot.com/). lagoon delineation the sampling was carried out through a lagoon polygon that was created using the modified normalized difference water index (mndwi), which discretizes the water surface from the rest of the image (xu, ). the outline of the polygon of the lagoon was adjusted by meters to reduce water detection errors on the shore caused by expanding and contracting throughout the agricultural cycle. statistical evaluation statistical comparison was performed using the relationship between the observed values (oi)(s-penman) and the estimated or predicted values (pi) (reem and eeflux). a set of statistical indicators were applied to evaluate the performance of each model. a linear regression analysis (y=ax+b) was applied to obtain the (a) slopes and (b) intercept variables; moreover, a residual analysis was performed to see if there were atypical values that affect the models. according to chai and draxler ( ), it is a good practice to include mean absolute error (mae) and root mean square error (rmse), because they are indicators that integrate the main differences between observed and estimated values. the variance (sd ) was calculated to know how much difference there was between observed and predicted values. the mean bias error (mbe) was included to find if there was a systematic error. the consistent error between the distance of linear regression and the : line is known as systematic rmse (rmses). unsystematic rmse (rmseu) is when the error is randomized, caused by an unknown source. when an unsystematic rmse has low values, and the systematic rmse value is close to rmse, the model can be considered valid (willmott et al., ). the efficiency model (ef) was applied by using the predicted and observed measured variations (greenwood, neeteson, & draycott, ; nash & sutcliffe, ). finally, an agreement index (d) (willmott, , ; willmott & wicks, ) was estimated for comparing between hydrological models. lower is better lower is better closer to , better closer to , better closer to , better closer to , better where oi +is the observed value (s-penman) in the record i, pi is the predicted value from the reem and eeflux models in area i, n is the number of observations ( ), and n is the number of season days ( ). furthermore, p'i and o'i were obtained as results the plotted results of e (s-penman), mean e from the reem and the eeflux for the bustillos lagoon are shown in figure . figure . evaporation values of s-penman, reem, and eeflux during the agricultural season for the bustillos lagoon. source: rojas villalobos with data retrieved from unifrut ( ), usgs landsatlook viewer ( ), and eeflux ( ). according to table , the eeflux had significant variations at the beginning of the season on april and april ( . % and - . %, respectively),as well as at the end of the cycle on june and september (- . % and - . %), while the reem had sensitive variations on september ( . %). in the case of the reem, the percentage variations represented a difference of less than . mm of evaporation except for may and june , which were . and . mm, respectively. the eeflux presented variations greater than . mm of evaporation for of the seven days. for april , april , may and may , the variations for the models tested were between . and . mm of the reference model. table . comparative table of errors between the reference evaporation and the models based on remote sensors (reem and eeflux). source: rojas villalobos. date doy e reference (mm) reem eeflux mm error (%) mm error (%) apr- - . . . . . apr- - . . . . - . apr- - . . - . . - . may- - . . - . . - . may- - . . - . . - . jun- - . . - . . - . sep- - . . . . - . average - . - . although the coefficient of determination (r ) was relatively high ( . ) to indicate that the reem model produces evaporation values close to observed ones, , the slope (a = . ) of the regression line does not ensure continuous linearity of predictions with the reference line. the intercept coefficient (b= . ) indicates overestimation of modelled data over observed values. the slope of the eeflux (a= . ) regression line closely matches the : reference of the observed data (s-penman). furthermore, the interception coefficient is negative (b = - . ), and r is low ( . ), which suggests an underestimation and high variance of the values predicted by the model. both models concentrate on underestimation and overestimation values (eeflux and reem, respectively) in the range of . to . mm of daily evaporation. figure shows that the variance of the eeflux model is not constant: while predicted evaporation values were low, the residual values were atypically high. in the residual analysis, evaporation is related to time. in other words, in april and september, the net radiation and temperatures were low, and as a result, there was less evaporation than that determined between may and august. when comparing the residuals between the two et models, the reem errors concentrate on the strip of ± . mm, which is quite acceptable, while more than % of the eeflux residuals approximately exceed the range of ± . mm and ± . mm. figure . comparative graphic of residuals predicted e on rs map models versus observed e (s-penman). source: rojas villalobos. the regression and residual analysis did not provide enough information to measure and compare the performance of the models studied. a more in-depth analysis was required for determining substantial differences between the comparison of the data of the predictive models with the reference ones. table shows the ranked analytical results for comparing the performance of et models. for statistical indexes in complex evaluation systems, a weighting coefficient separately calculated is required. table . summary of the ranked results of the comparative statistical indicators applied to the reem and eeflux versus s-penman. source: rojas villalobos. index reem (rank) eeflux (rank) mae (mm d- ) . ( ) . ( ) rmse (mm d- ) - . ( ) . ( ) sd (mm d- ) . ( ) . ( ) mbe (mm d- ) - . ( ) - . ( ) rmseu (mm d - ) . ( ) . ( ) rmses (mm d - ) . ( ) . ( ) ef . ( ) - . ( ) r . ( ) . ( ) d . ( ) . ( ) a (intercept) . ( ) . ( ) b (slope) . ( ) . ( ) the rmse has been criticized for being inappropriate and misinterpreted in environmental and climate analyses (willmott & matsuura, ), but the results of the rmse and mae enrich the interpretation of the evaluated models (chai & draxler, ). in this study, the mae and rmse indicators agreed that the reem presented a lower average error (mae = . and rmse = - . both in mm d- ) among the data. sd confirms the high variability that the eeflux had ( . mm) in predicting the daily eta in comparison to the reem ( . mm). the bias indicator (mbe) agreed with the initial linear regression analysis as it showed a slight underestimation of the values calculated by reem (- . mm) in comparison with the higher underestimation of the values predicted by the eeflux (- . mm). the rmseu results suggested that noise from an unknown source promoted a poor performance of the eeflux model ( . mm). in contrast, the same index showed a lower influence of unknown variables in the reem model ( . mm). according to the ef index, values close to correspond to a model that predicts values close to the observed data. if the index is less than , the mean observed data is a better predictor than the values estimated from the et model (nash & sutcliffe, ; pushpalatha, perrin, moine, & andréassian, ). therefore, according to the above, reem (ef= . ) had a higher performance than eeflux (ef= - . ). the statistical indicator of agreement "d" indicates the tendency of the previous indexes by suggesting that the reem ( . ) is a better predictor of eta than the eeflux ( . ). the total e for the three models in the agricultural reference season was compared using daily estimations. in the case of the reem and eeflux, a linear interpolation technique was used to calculate the e between the dates of the seven available satellite images. the meteorological records of the aforementioned agroclimatic station were used for the computation of the daily e- reference through the s-penman equation (figure ). the variability (see) was . - and . - mm day- for reem and eeflux, respectively. the total e for s-penman was mm, and mm for reem, with mm for eeflux, which is equivalent to . , . , and hm of water, respectively. figure . seasonal evaporation comparison of rs models versus s-penman data from april , to september , . source: rojas villalobos. discussion statistical results suggested a better predictive performance of the evaporation of water bodies of the reem model versus the eeflux model for the agricultural cycle. the residue analysis showed more considerable variability in the low ranges of e reference. this variability may be induced by solar radiation, air temperature, relative humidity, and wind because they are weather variables that have a strong influence on et (valipour, ). the metric model uses these variables to estimate h, employing the alfalfa reference et by using the asce penman-monteith equation, and the model assumes that the cold pixel has a sensible heat flux (h) equal to zero. the reem uses the same local variables by employing regression equations to calculate h and rn. figure displays an et and e comparison map of the reem and eeflux from agricultural fields and the bustillos lagoon (dated june , ). figure . et (crop fields) and evaporation (lagoon) comparison maps of reem and eeflux models in the cuauhtemoc valley for june , . source: rojas villalobos with data retrieved from usgs ( ) and eeflux ( ). the first difference between the application of metric within the eeflux was that in eeflux gridded weather data sets were used instead of climate data from the field. point data such as from agroclimatic stations and interpolated data such as gridded data sets have significant spatial differences. although the interpolation models used to generate gridded weather data sets have improved, there is still a degree of uncertainty because of the distance between the meteorological reference stations. for instance, the global land data assimilation system (gldas- ), the north american land data assimilation system (nldas- ), the climate forecast system version (cfsv ), gridmet, the real-time mesoscale analysis (rtma) and the national digital forecast database (ndfd) are gridded data sets with spatial resolution ranges between to km (allen et al., ). regarding gridded data, blankenau ( ) found that there were biases and inconsistencies in the gridded climatic data potentially caused by the distances and the location of the interpolated points. the databases were built using weather stations located at airports, which do not represent the weather conditions of an agricultural area (colder and wetter). in addition, et underestimations occurred because the gridded data did not integrate the effects of humidification and cooling near the surface when agricultural fields were irrigated. since atmospheric conditions vary during the day, instantaneous weather data were obtained through linear regression from hourly values according to the time when the satellite passed over the study area. if the instantaneous data were generated from a large spatial resolution grid that integrates biases and errors, the uncertainty was propagated to the predicted data (et) (kauffeldt, halldin, rodhe, xu, & westerberg, ; lobell, ; phillips & marks, ). the daily evaporation variability of the rs models and the value measured in the season was high since the coefficient of variation was . % for reem and . % for eeflux. the daily e variability between the rs models and the value measured in the season was high since the coefficient of variation was . % for reem and . % for eeflux. similarly, the reem overestimated e by . % when compared to reference values, while eeflux underestimated e by . % for the same period. in the segment from may to september ( - doy), there were significant differences in the coefficients of variation when reem obtained % and eeflux %. the differences between the predicted values and the observed values were particularly high because of the large gaps between the dates of the acquired satellite images. conclusions in this study, seven landsat images were used during the agricultural cycle from april to september , when the reem and eeflux evapotranspiration models were compared with the reference et to estimate the daily evaporation of the bustillos lagoon. et estimation methods by remote sensors are sensitive to variations in weather conditions. in the interpolated grid of climatic parameters, there are regions where there are significant differences between observed and interpolated data. these regions are far from the interpolation source points, and the physical-environmental conditions are different. gridded data should aggregate additional data source points where there are significant variations of the climatic parameters. an anchor weather station can improve the predictions of the evaporation of a water body as observed in the reem model. the location of the weather station is a determining factor in the computation of the et. in this study, an agroclimatic station located . km from the bustillos lagoon recorded weather conditions where the prevailing winds (sw-nw) pass before reaching the lake, which establishes the physical conditions for water evaporation. the temporal resolution of the satellite scenes is a determining factor for the estimation of the total e since the gap between the dates of the images reduce data time uncertainty in order to obtain accurate values and a better performance of the rs models through interpolation methods. references aghakouchak, a., norouzi, h., madani, k., mirchi, a., azarderakhsh, m., nazemi, a., … hasanzadeh, e. ( ). aral sea syndrome desiccates lake urmia: call for action. journal of great lakes research, ( ), – . doi: . /j.jglr. . . allen, r. g., morton, c., kamble, b., kilic, a., huntington, j., thau, d., … robison, c. ( ). eeflux: a landsat-based evapotranspiration mapping tool on the google earth engine. asabe / ia irrigation symposium: emerging technologies for sustainable irrigation - a tribute to the career of terry howell, sr. conference proceedings, – . doi: . /irrig. allen, r. g., tasumi, m., & trezza, r. ( ). satellite-based energy balance for mapping evapotranspiration with internalized calibration (metric)-model. ( ), – . doi: . /(asce) - ( ) : ( ) allen, r. g., tasumi, m., trezza, r., wright, j. l., bastiaanssen, w., kramber, w. j., … robison, c. ( ). satellite-based energy balance for mapping evapotranspiration with internalized calibration (metric)—applications. journal of irrigation and drainage engineering, ( ), – . doi: . /(asce) - ( ) : ( ) Álvarez, j. p. a., cutillas, p. p., valle, o. r., & cabañero, j. j. a. ( ). water resources degradation in a semiarid environment. bustillos and los mexicanos lagoons (chihuahua, méxico). papeles de geografía, ( ), – . amado-Álvarez, j. p., pérez cutillas, p., ramírez valle, o., & alarcón cabañero, j. j. ( ). degradación de los recursos hídricos en un ambiente semiárido. las lagunas de bustillos y de los mexicanos (chihuahua, méxico). retrieved from https://digitum.um.es/digitum/handle/ / amado-alvarez, j., pérez-cutillas, p., alatorre-cejudo, l. c., ramírez-valle, o., segovia- ortega, e. f., & alarcón-cabañero, j. j. ( ). multispectral analysis to estimate the turbidity as an indicator of the quality of water in reservoirs in chihuahua state, mexico. revista geográfica de américa central, ( ), – . doi: . /rgac. - . asce–ewri. ( ). the asce standardized reference evapotranspiration equation. reston, va: asce–ewri standardization of reference evapotranspiration task committee rep. ayyad, s., al zayed, i. s., ha, v. t. t., & ribbe, l. ( ). the performance of satellite-based actual evapotranspiration products and the assessment of irrigation efficiency in egypt. water, ( ), . doi: . /w bastiaanssen, w. g. m. ( ). regionalization of surface flux densities and moisture indicators in composite terrain: a remote sensing approach under clear skies in mediterranean climates (sc-dlo). retrieved from https://library.wur.nl/webquery/wurpubs/ bastiaanssen, w. g. m., menenti, m., feddes, r. a., & holtslag, a. a. m. ( ). a remote sensing surface energy balance algorithm for land (sebal). part . formulation. journal of hydrology, – , – . doi: . /s - ( ) - bastiaanssen, w. g. m., pelgrum, h., wang, j., ma, y., moreno, j. f., roerink, g. j., & van der wal, t. ( ). a remote sensing surface energy balance algorithm for land (sebal). part : validation. journal of hydrology, – , – . doi: . /s - ( ) - blaney, h. f., & criddle, w. d. ( ). determining consumptive use and irrigation water requirements (technical bulletin no. ; p. ). retrieved from united states department of agriculture website: https://naldc.nal.usda.gov/download/cat /pdf bozorgi, a., bozorg-haddad, o., sima, s., & loáiciga, h. a. ( ). comparison of methods to calculate evaporation from reservoirs. international journal of river basin management, ( ), – . doi: . / . . brutsaert, w., & stricker, h. ( ). an advection-aridity approach to estimate actual regional evapotranspiration. water resources research, ( ), – . doi: . /wr i p cabrera, m. c. m., anache, j. a. a., youlton, c., & wendland, e. ( ). performance of evaporation estimation methods compared with standard m tank. ( ), – . doi: doi.org/ . / - /agriambi.v n p - chai, t., & draxler, r. r. ( ). root mean square error (rmse) or mean absolute error (mae)?–arguments against avoiding rmse in the literature. geoscientific model development, ( ), – . doi: . /gmd- - - cleugh, h. a., leuning, r., mu, q., & running, s. w. ( ). regional evaporation estimates from flux tower and modis satellite data. remote sensing of environment, ( ), – . doi: . /j.rse. . . de bruin, h. a. r. ( ). a simple model for shallow lake evaporation. journal of applied meteorology, ( ), – . doi: . / - ( ) < :asmfsl> . .co; de bruin, h. a. r., & keijman, j. q. ( ). the priestley-taylor evaporation model applied to a large, shallow lake in the netherlands. journal of applied meteorology, ( ), – . doi: . / - ( ) < :tptema> . .co; diario oficial de la federación. ( , july ). acuerdo por el que se da a conocer el resultado de los estudios técnicos de aguas nacionales subterráneas del acuífero cuauhtémoc, clave , en el estado de chihuahua, región hidrológico administrativa río bravo. retrieved from http://www.dof.gob.mx/nota_detalle.php?codigo= &fecha= / / díaz caravantes, r. e., bravo peña, l. c., alatorre cejudo, l. c., & sánchez flores, e. ( ). análisis geoespacial de la interacción entre el uso de suelo y de agua en el área peri- urbana de cuauhtémoc, chihuahua. un estudio socioambiental en el norte de méxico. investigaciones geográficas, boletín del instituto de geografía, ( ), – . doi: . /rig. erickson, a. j., gulliver, j. s., hozalski, r. m., mohseni, o., nieber, j. l., wilson, b. n., & weiss, p. t. ( ). evaporation and evapotranspiration | stormwater treatment: assessment and maintenance. in assessment of stormwater best management practices (p. ). retrieved from https://conservancy.umn.edu/bitstream/handle/ / /cfans_asset_ .pdf?se quence= fisher, j. b., melton, f., middleton, e., hain, c., anderson, m., allen, r., … wood, e. f. ( ). the future of evapotranspiration: global requirements for ecosystem functioning, carbon and climate feedbacks, agricultural management, and water resources. reviews of geophysics, – . doi: . / wr @ . /(issn) - .comhes fu, g., charles, s. p., & yu, j. ( ). a critical overview of pan evaporation trends over the last years. climatic change, ( ), . doi: . /s - - - greenwood, d. j., neeteson, j. j., & draycott, a. ( ). response of potatoes to n fertilizer: dynamic model. plant and soil, ( ), – . doi: . /bf gross, m. ( ). the world’s vanishing lakes. current biology, ( ), r –r . doi: . /j.cub. . . hamon, w. r. ( ). estimating potential evapotranspiration (thesis, massachusetts institute of technology). retrieved from https://dspace.mit.edu/handle/ . / hewitt, i. c., fernald, a. g., & samani, z. a. ( ). calculating field-scale evapotranspiration with closed-chamber and remote sensing methods. jawra journal of the american water resources association, ( ), – . doi: . / - . hirschi, m., michel, d., lehner, i., & seneviratne, s. i. ( ). a site-level comparison of lysimeter and eddy covariance flux measurements of evapotranspiration. hydrology and earth system sciences, ( ), – . doi: https://doi.org/ . /hess- - - irmak, a., allen, r. g., kjaersgaard, j., huntington, j., kamble, b., trezza, r., & ratcliffe, i. ( ). operational remote sensing of et and challenges. evapotranspiration - remote sensing and modeling. doi: . / jensen, m. e., & haise, h. r. ( ). estimating evapotranspiration from solar radiation. proceedings of the american society of civil engineers, journal of the irrigation and drainage division, , – . kauffeldt, a., halldin, s., rodhe, a., xu, c.-y., & westerberg, i. k. ( ). disinformative data in large-scale hydrological modelling. hydrology and earth system sciences, , – . doi: . /hess- - - kirk, j. t. ( ). effects of suspensoids (turbidity) on penetration of solar radiation in aquatic ecosystems. hydrobiologia, ( ), – . doi: https://doi.org/ . /bf kıvrak, c., bawazir, s., samani, z., steele, c., & sönmez, b. ( ). using plant phenology and landsat- satellite data to quantify water use by onion crop in the mesilla valley, new mexico. international journal of crop science and technology, ( ), – . doi: . /ijcst. li, f., cao, r., zhao, y., mu, d., fu, c., & ping, f. ( ). remote sensing penman–monteith model to estimate catchment evapotranspiration considering the vegetation diversity. theoretical and applied climatology, ( ), – . doi: . /s - - - lobell, d. b. ( ). errors in climate datasets and their effects on statistical crop models. agricultural and forest meteorology, , – . doi: . /j.agrformet. . . makkink, g. f. ( ). testing the penman formula by means of lysimeters. journal of the institution of water engineers, ( ), – . martínez pérez, j. Á., garcía-galiano, s. g., martin-gorriz, b., & baille, a. ( ). satellite- based method for estimating the spatial distribution of crop evapotranspiration: sensitivity to the priestley-taylor coefficient. remote sensing, ( ), . doi: . /rs mireles, c., & mellink, e. ( ). use of laguna de bustillos, chihuahua, by waterbirds during the – wintering season. the american midland naturalist, ( ), – . doi: . / - - . . monin, a., & obukhov, a. ( ). basic laws of turbulent mixing in the atmosphere near the ground. tr. akad. nauk sssr geofiz. inst, ( ), – . nash, j. e., & sutcliffe, j. v. ( ). river flow forecasting through conceptual models part i — a discussion of principles. journal of hydrology, ( ), – . doi: . / - ( ) - okpara, u. t., stringer, l. c., dougill, a. j., & bila, m. d. ( ). conflicts about water in lake chad: are environmental, vulnerability and security issues linked? progress in development studies, ( ), – . doi: . / papadakis, j. ( ). potential evapotranspiration. soil science, , . doi: . / - - penman, h. l. ( ). natural evaporation from open water, bare soil and grass. proceedings of the royal society of london. series a. mathematical and physical sciences, ( ), – . doi: . /rspa. . phillips, d. l., & marks, d. g. ( ). spatial uncertainty analysis: propagation of interpolation errors in spatially distributed models. ecological modelling, ( ), – . doi: . / - ( ) - priestley, c. h. b., & taylor, r. j. ( ). on the assessment of surface heat flux and evaporation using large-scale parameters. monthly weather review, ( ), – . doi: . / - ( ) < :otaosh> . .co; pushpalatha, r., perrin, c., moine, n. l., & andréassian, v. ( ). a review of efficiency criteria suitable for evaluating low-flow simulations. journal of hydrology, – , – . doi: . /j.jhydrol. . . rayner, d. p. ( ). wind run changes: the dominant factor affecting pan evaporation trends in australia. journal of climate, ( ), – . doi: . /jcli . reitz, m., senay, g., & sanford, w. e. ( ). combining remote sensing and water-balance evapotranspiration estimates for the conterminous united states. remote sensing, ( ), . doi: . /rs rohwer, c. ( ). evaporation from free water surfaces (no. ; p. ). retrieved from united states department of agriculture website: https://naldc.nal.usda.gov/download/cat /pdf rojas-villalobos, h. l., alatorre-cejudo, l. c., stringman, b., samani, z., & brown, c. ( ). topobathymetric d model reconstruction of shallow water bodies through remote sensing, gps, and bathymetry. tecnociencia chihuahua, ( ), – . doi: . /zenodo. rooney, g. g., & bornemann, f. j. ( ). the performance of flake in the met office unified model. tellus a: dynamic meteorology and oceanography, ( ), . doi: . /tellusa.v i . samani, a., & bawazir, s. ( ). improving evapotranspiration estimation using remote sensing technology (technical completion report no. ; p. ). retrieved from https://nmwrri.nmsu.edu/wp- content/swwa/reports/bawazir/june final/report.pdf samani, z., bawazir, a. s., skaggs, r. k., bleiweiss, m. p., piñon, a., & tran, v. ( ). water use by agricultural crops and riparian vegetation: an application of remote sensing technology. journal of contemporary water research & education, ( ), – . doi: . /j. - x. .mp .x samani, z., bawazir, s., bleiweiss, m., skaggs, r., piñon, a., & tran, v. d. ( ). estimating daily net radiation over vegetation canopy through remote sensing and climatic data. journal of irrigation and drainage engineering, ( ), – . doi: . /(asce) - ( ) : ( ) samani, z., bawazir, s., bleiweiss, m., skaggs, r., & schmugge, t. ( ). estimating riparian et through remote sensing. presented at the agu fall meeting, san francisco. samani, z., sammis, t., skaggs, r., alkhatiri, n., & deras, j. ( ). measuring on-farm irrigation efficiency with chloride tracing under deficit irrigation. journal of irrigation and drainage engineering, ( ), – . doi: . /(asce) - ( ) : ( ) samani, z., skaggs, r., & bleiweiss, m. ( ). regional et estimation model, reem. proc. st intl. symposium on remote sensing from satellite. presented at the proc. st intl. symposium on remote sensing from satellite, tucson, ar. senkondo, w., munishi, s. e., tumbo, m., nobert, j., & lyon, s. w. ( ). comparing remotely-sensed surface energy balance evapotranspiration estimates in heterogeneous and data-limited regions: a case study of tanzania’s kilombero valley. remote sensing, ( ), . doi: . /rs smith, r. c., & tyler, j. e. ( ). optical properties of clear natural water*. josa, ( ), – . doi: . /josa. . stephens, j. c., & stewart, e. h. ( ). a comparison of procedures for computing evaporation and evapotranspiration (pp. – ). fort lauderdle, florida. subin, z. m., murphy, l. n., li, f., bonfils, c., & riley, w. j. ( ). boreal lakes moderate seasonal and diurnal temperature variation and perturb atmospheric circulation: analyses in the community earth system model (cesm ). tellus a: dynamic meteorology and oceanography, ( ), . doi: . /tellusa.v i . unifrut. ( ). resumen de las estaciones meteorológicas por municipios. retrieved february , , from http://unifrut.com.mx/rem/ valiantzas, j. d. ( ). simplified versions for the penman evaporation equation using routine weather data. journal of hydrology, ( ), – . doi: . /j.jhydrol. . . valipour, m. ( ). importance of solar radiation, temperature, relative humidity, and wind speed for calculation of reference evapotranspiration. archives of agronomy and soil science, ( ), – . doi: . / . . wang, b., ma, y., ma, w., su, b., & dong, x. ( ). evaluation of ten methods for estimating evaporation in a small high-elevation lake on the tibetan plateau. theoretical and applied climatology, ( ), – . doi: . /s - - - wang, h., tetzlaff, d., & soulsby, c. ( ). testing the maximum entropy production approach for estimating evapotranspiration from closed canopy shrubland in a low- energy humid environment. hydrological processes, ( ), – . doi: . /hyp. willmott, c. j. ( ). on the validation of models. physical geography, ( ), – . doi: doi.org/ . / . . willmott, c. j. ( ). some comments on the evaluation of model performance. bulletin of the american meteorological society, ( ), – . doi: https://doi.org/ . / - ( ) < :scoteo> . .co; willmott, c. j., ackleson, s. g., davis, r. e., feddema, j. j., klink, k. m., legates, d. r., … rowe, c. m. ( ). statistics for the evaluation and comparison of models. journal of geophysical research: oceans, (c ), – . doi: https://doi.org/ . /jc ic p willmott, c. j., & matsuura, k. ( ). advantages of the mean absolute error (mae) over the root mean square error (rmse) in assessing average model performance. climate research, ( ), – . retrieved from jstor. willmott, c. j., & wicks, d. e. ( ). an empirical method for the spatial interpolation of monthly precipitation within california. physical geography, ( ), – . doi: https://doi.org/ . / . . xu, h. ( ). modification of normalized difference water index (ndwi) to enhance open water features in remotely sensed imagery. international journal of remote sensing, ( ), – . doi: doi.org/ . / zhang, k., kimball, j. s., & running, s. w. ( ). a review of remote sensing based actual evapotranspiration estimation. wiley interdisciplinary reviews: water, ( ), – . doi: . /wat . zhu, w., jia, s., & lv, a. ( ). a statistical analysis of the remotely sensed land surface temperature–vegetation index method for the retrieval of evaporative fraction over grasslands in the southern great plains. ieee journal of selected topics in applied earth observations and remote sensing, – . doi: . /jstars. . chapter single-input, multiple-output iterative algorithm for the calculation of volume, area, elevation, and shape using d topobathymetric models. article submitted: november , . status: in review. journal: investigaciones geográficas (unam). abstract most methods for estimating the morphometric values of water bodies use equations derived from hypsographic curves or digital terrain models (dtms) that relate depth, volume (v), and area (a) and that model the uncertainty inherent in the complex underwater morphology. this research focuses directly on the use of topobathymetric models that include the bathymetry and topography of the surrounding area next to the water body. the projection of the water surface height (h) on each dtm pixel generates a water column with intrinsic attributes such as volume and area. the process is replicated among all cells and estimates the total area and volume of the water body. if the v or a is the input data, an algorithm that iterates height values is used to generate the new data, which is compared with the entered value that functions as a reference. if the difference between the reference value and the calculated value is less than an error threshold, the iteration stops, and the maximum and average depths are calculated. in addition, the raster and the shape that represent the body of water are created. the cross comparison of h-v-a showed that there is an error between . % and . % when any of the parameters are used as input data. performance tests determined that pixel dimensions are directly proportional to the processing time for each iteration. the results of the implementation of this algorithm were satisfactory since, for the dtm of bustillos lagoon, chihuahua, mexico, the simulation took less than seconds in at most iterations. introduction calculating physical characteristics of water bodies such as volume, surface area, and shape is a challenging process because of the complex underwater topography. the water bodies floor is usually irregular, with elevations and depressions that do not follow a specific pattern and therefore are difficult to model with mathematical equations. the height of the water level (h), volume (v), surface area (a), and the shape of the surface area are parameters that are not linearly interrelated. determining these parameters, using a known value from the previously mentioned parameters (h, v, or a), will allow erosion modelers, hydrologists, geohydrologists, and ecologists, among others, to use morphological parameters in their simulations. currently, geographic information systems (gis) are able to deploy programming languages to develop tools that respond to complex problems. this approach generates information about the storage capacity in a dynamic way to support management policies dealing with flood risk zones and minimum water levels for maintaining ecologically healthy areas and other water resource issues. several methodologies exist to calculate morphometric parameters, such as height, volume, area, maximum depth, and the average depth of water bodies. the first studies that relate volume-area-depth used the radius between average depth and maximum depth in addition to sinusoidal parameters (such as lake bottom profile) to do so (lehman, ; neumann, ). sima and tajrishy ( ) presented a model that relates volume-area-elevation using data from remote sensors and analytical procedures such as a power model and a truncated pyramid model. this approach results in highly parameterized equations that relate morphometric values. moreno-amich and garcia-berthou ( ) used echo sounding to relate morphometric characteristics of depth-area measurements for developing hypsographic curves and generating a bathymetric map. johansson et al. ( ) proposed two new mathematical models that interrelate morphometric values: the volume development, which is an equation based on the a-v relationship curve (vd) and the hypsographic development parameter, which is the integration of a-depth and v-depth relation curves (hd). these models require three inputs: v, maximum depth, and a. recent methodologies that use autonomous aerial vehicles measure the height of the terrain through lidar (laser imaging detection and ranging) and surface water vehicles that measure the depth (bathymetry) through high-resolution echo sounding. these data sources are processed in gis and generate accurate dtms (erena, atenza, garcía-galiano, domínguez, & bernabé, ). regardless of the methodology, however, the equations that relate the morphometry variables inherit the uncertainty of the complexity and spatial variability of underwater topography (rode et al., ). chen et al. ( ) presented a method that uses d geometry of a dam with which the volume and floodplains are calculated. the algorithm uses precipitation and water stage values as input data. it then simulates the floods in two sections: the floodplain and the d model from which the morphological parameters are obtained. despite being an efficient model, it is limited as to what input data it will accept. thus, none of the methods shown above are capable of offering solutions where morphological values interact with each other to respond to the needs of hydrologists. to address these uncertainties, this study develops a technique that fully estimates the h- v-a of water bodies using computational techniques through d models that include bathymetry and the surrounding terrain topography. this technique used the water column below the level of the water surface projected onto each pixel of the dtm; this calculation was applied to the entire study area to delineate the extension of the water body. the v or a was the reference variable deployed in an iterative algorithm until the error threshold was met. study area the bustillos lagoon is in the endorheic cuauhtémoc basin, and the lagoon has an area of , . km . a mountain range, called sierra azul, surrounds it in the north-northeast; on the western flank are mennonite colonies where the terrain slope is below %. in addition, the town of anahuac is in the south. the bustillos lagoon is between the quadrant coordinates ° ' ' 'n - ° ' '' n and ° ' ' 'w - ° ' '' w in the cuauhtémoc municipality in the mexican state of chihuahua (figure ). figure . study area where the algorithm was applied. the bustillos lagoon in chihuahua. source: rojas villalobos with data retrieved from inegi ( ). because the cuauhtémoc basin is between the semi-humid climate of the sierra madre occidental and the chihuahuan desert, the region's weather is warm and semi-dry (kottek, grieser, beck, rudolf, rubel, ). the approximate elevation of the cuauhtémoc region is , m above sea level (m.a.s.l), and the average annual temperature ranges from . to ° c, with an average annual rainfall of about mm y- (servicio meteorológico nacional, ). material and methods this methodology employed a personal computer with an intel i - . ghz processor, gb ram, and two ssd of tb each. for this computational development in gis, it is essential to have a dtm that includes the bathymetry of the study area for generating the hydrological characteristics of the water body - the d topobathymetric model of the bustillos lagoon (spatial resolution of meters)(rojas-villalobos, alatorre-cejudo, stringman, samani, & brown, ) (figure ). figure . dtm of the bustillos lagoon. source: rojas villalobos with data retrieved from rojas-villalobos et al. ( ). the software used for gis processing was arcmap® version . of environmental systems research institute, esri (arcmap, ). the d process tool called surface volume, which requires the dtm and the height of the water level as input data, performed v and a calculations (numerical results), and python® version . . was the language to encode the algorithm (python language reference, ). the algorithm can capture one of the various input data, and as a result, it can generate the rest of the output data; for this reason, the algorithm is cataloged as a single-input, multiple- output data algorithm. the algorithm uses one of the following input values: the height of the water level, the storage v, or the a of the water body (figure ). all calculations are in the international system of units. figure . the schematic diagram shows single-inputs and multiple-output data for iterative algorithm. source: rojas villalobos. the algorithm was designed using the following criteria. the algorithm is divided into two sections and depends on the input data: i) water height in meters above sea level (m.a.s.l) and ii) v (m ) or a (m ). some of the process used in the second section refers to procedures in the first section. the surface volume tool used the height value and the dtm to calculate the v and a of the water body. these two results were used to obtain the maximum and average depth (figure ) figure . equations to calculate average depth and maximum depth. where ad is average depth (m), v is the volume (m ), a is the surface area of the water body (m ), md is maximum depth (m), h is the height of water level (m), and hmin is the height of the water body floor (m), which was extracted from the properties of the raster. the map algebra tool, included in arcmap®, was used to perform the extraction of the raster that represents the water surface filtering of all pixels that were less than or equal to h. a conversion tool then saves the raster of surface water as a polygon (vector data) in a shapefile format or geodatabase. when the second process starts, the user captures (or by default) an error threshold (et)(%) that is required to stop the iteration process and the value of v or a used to compute output information. v or a assumes the value of reference (ref) that is used to compare with the new iterated values (v or a). the threshold limit (tl) is the value that stops the iteration and is the product of v or a, multiplied by et. three initial variables were as follows: step equal to used to increase or decrease h, h equal to meter above the bottom of the lagoon, and direction (dir) equal to “upward.” the iteration starts with the h and the surface volume tool that calculates new data (nd = v or a). if the absolute value of the difference between ref and nd is less than tl, the algorithm proceeds to execute the procedures for calculating the output information such as raster image and polygon shape of the lagoon. otherwise, h continues increasing and generating nd until the absolute difference between ref and nd is less than tl (e.g., m or m ). if nd surpasses ref, h decreases at the halfway point of the previous step (e.g., . m.) until the absolute difference between nd and ref is less than tl. if the tl is not accomplished and the nd surpasses ref, h starts to increase with a new step (e.g., . m.). this iteration stops when the absolute difference is less than tl, and the algorithm calculates output data. the algorithm diagram is shown in figure . figure . flowchart of the iterative algorithm to compute hydrologic characteristics using single-input data. source: rojas villalobos. results and discussion table shows the results of three simulations with different data input. for the second and third models, the data resulting from the first simulation were used as input data (v and a) for the cross comparison since the v-a estimates are calculated directly from the height, and it is not necessary to iterate data. table . result of the calculations of the implementation of the algorithm in python language. study site: the bustillos lagoon, chihuahua, mexico. error threshold = . %. * input data. source: rojas villalobos. error threshold area km height masl volume hm area km average depth m maximum depth m iterations processing time s . . * . . . . . . . . * . . . . . . . . * . . . the results of the cross comparison of h-v-a showed that the differences are . , . , and . %, respectively. these values are below the established error threshold of . % and represent a height differential of less than one micrometer, which is negligible in the lagoon modeling scale. the dtm covers an area of . km , which contains the entire lagoon and the surrounding area in a buffer greater than meters. the lagoon has a storage capacity of . hm and a surface area of . km before extending to the floodplains at . m.a.s.l. the processing time depends directly on the number of pixels of the dtm used in the modeling and not on the lagoon area itself. two dtms were modeled with different pixel dimensions: dtma) . (width) x . (height) corresponding to . km and dtmb) . (width) x . (height) equivalent to . km . each pixel maintains a spatial resolution of meters. the number of iterations varies between and because of variations in the calculated volume, which does not exceed the reference volume in each of the iterations. these variations can decrease or increase the number of iterations and, consequently, the calculation time (table ). the dimension of the dtm is directly and linearly related to the processing time in each iteration. the dtma model is . times larger than dtmb, and this ratio is repeated in the average runtime of . seconds per iteration for the dtma and . seconds per iteration for dtmb. this advantage can be exploited by hydrological modelers that require real-time results because they do not have to consider the simulation area but rather the number of pixels contained in the dtm. table . iterative model processing times with various storage volume input values using two dtms with different pixel dimensions. pixel spatial resolution: meters. source: rojas villalobos. dtm tested area (km ) volume (m ) iterations processing time (s) seconds per iteration . (dtma) . . . . . . . . . . . . . . . (dtmb) . . . . . . . . . . . . . . the advantage of the iterative model is that it uses three-dimensional models based on measurements such as bathymetry and topography that represent reality at a given spatial resolution. the accuracy of the algorithm results, as well as the raster and flood shape, depend on three factors: accurate data for constructing the dtm, the spatial resolution of the pixel, and the selected error threshold. the complexity of underwater morphometry is shown in figure . four layers of the water surface are superimposed at every centimeters in height in a stack to distinguish the nonlinearity of morphometric characteristics geographically. figure . water surface coverage map at different heights above sea level of the bustillos lagoon. sources: rojas villalobos with data from rojas-villalobos ( ). the value of morphometric variables as the height of the water surface rises above the dtm does not show a constant pattern that can define a precise correlation between them (figure ). figure . comparative graph of volume, surface area, average depth, and maximum depth according to the height above sea level. source: rojas villalobos. the inflection points of the area and the volume in the previous graph, however, are in . and . m.a.s.l correspondingly. in this way, it is possible to establish equations by segments for each of the parameter, but not a system of equations that integrates the five variables as determined by the algorithm. recommendations the iterative algorithm proved efficient in finding every one of the morphometric values of the bustillos lagoon within the proposed error threshold. the following recommendations, however, are listed. • the purpose of this document is not to evaluate the quality of dtm. to obtain accurate morphometric data and detailed and realistic coverage maps, however, the dtm must meet geographic accuracy (lowest error) in all three axes (x, y, and z). • use reasonable pixel dimensions of the study area. when there are more pixels, the processing time is greater. • this iterative model is not restricted to using a dtm; it is possible to replace with a triangulated irregular network (tin), which is composed of triangles where the vertices are elevation points. • the algorithm can be implemented in any programming language that handles spatial components, such as python-gdal®, r® statistics, or magik smallworld®. • despite the pc's computing capacity, the algorithm can be applied to any computer with minimum requirements: gb ram, hd with enough space to store the simulations ( - gb) and a fast processor ( . ghz +). references arcmap (version . . ) [english, windows]. ( ). retrieved from http://www.esri.com chen, w., nover, d., he, b., yuan, h., ding, k., yang, j., & chen, s. ( ). analyzing inundation extent in small reservoirs: a combined use of topography, bathymetry and a d dam model. measurement, , – . https://doi.org/ . /j.measurement. . . erena, m., atenza, j. f., garcía-galiano, s., domínguez, j. a., & bernabé, j. m. ( ). use of drones for the topo-bathymetric monitoring of the reservoirs of the segura river basin. water, ( ), . https://doi.org/ . /w ge corporation. ( , september ). mdt magik development tools. retrieved september , , from https://www.mdt.net/ inegi. ( ). mapa digital de méxico. retrieved january , , from https://www.inegi.org.mx/temas/mapadigital/ johansson, h., brolin, a. a., & håkanson, l. ( ). new approaches to the modelling of lake basin morphometry. environmental modeling & assessment, ( ), – . https://doi.org/ . /s - - -z kottek, m., grieser, j., beck, c., rudolf, b., & rubel, f. ( ). world map of the köppen- geiger climate classification updated. meteorologische zeitschrift, ( ), – . https://doi.org/ . / - / / lehman, j. t. ( ). reconstructing the rate of accumulation of lake sediment: the effect of sediment focusing. quaternary research, ( ), – . https://doi.org/ . / - ( ) - moreno-amich, r., & garcia-berthou, e. ( ). a new bathymetric map based on echo- sounding and morphometrical characterization of the lake of banyoles (ne-spain). hydrobiologia, ( ), – . https://doi.org/ . /bf neumann, j. ( ). maximum depth and average depth of lakes. journal of the fisheries research board of canada, ( ), – . https://doi.org/ . /f - open source geospatial foundation. ( ). gdal — gdal documentation. retrieved september , , from https://gdal.org/ python language reference (version . . ) [english, windows]. ( ). retrieved from http://www.python.org r foundation. ( ). r: the r project for statistical computing. retrieved september , , from https://www.r-project.org/ rode, m., arhonditsis, g., balin, d., kebede, t., krysanova, v., griensven, a. van, & zee, s. e. a. t. m. van der. ( ). new challenges in integrated water quality modelling. hydrological processes, ( ), – . https://doi.org/ . /hyp. rojas-villalobos, h. l., alatorre-cejudo, l. c., stringman, b., samani, z., & brown, c. ( ). topobathymetric d model reconstruction of shallow water bodies through remote sensing, gps, and bathymetry. tecnociencia chihuahua, ( ), – . https://doi.org/ . /zenodo. servicio meteorológico nacional. ( ). información climatológica por estado. retrieved january , , from https://smn.conagua.gob.mx/es/informacion-climatologica-por- estado?estado=chih sima, s., & tajrishy, m. ( ). using satellite data to extract volume–area–elevation relationships for urmia lake, iran. journal of great lakes research, ( ), – . https://doi.org/ . /j.jglr. . . conclusions this document combines three lines of research that are directly interrelated. the d model of the bustillos lagoon uses known variables such as volume, area, and depth, to estimate the volume of evaporated water according to the evaporation rates obtained by remote sensors. the iteration algorithm uses as a basis the d model to compute volume and area that, together with evaporation, indirectly estimate other water balance variables such as water infiltration into the aquifer from the lagoon. at the end, this document integrates useful tools and applicable knowledge in the real world. the databases generated for the region fill gaps of information that is necessary for the analysis of the water balance and the administration of water in the basin. the results obtained will be public for those researchers, government agencies, institutions of higher education, and people interested in these issues. when this dissertation was proposed to the doctoral committee, i was warned of how complex, demanding, and challenging it could be; they were not wrong. the developments and processes that took each of the chapters required knowledge and skills from areas as diverse as electronics, programming, hydrology, physics, mathematics, geography, autonomous aerial vehicles, geographic information systems, and remote sensing. it is crucial to establish that the skills mentioned above, and knowledge are the results of a cumulative learning process along many years of study, an intense desire to acquire knowledge, and a strong curiosity of how hydrologic process occur. references diario oficial de la federación. ( , july ). acuerdo por el que se da a conocer el resultado de los estudios técnicos de aguas nacionales subterráneas del acuífero cuauhtémoc, clave , en el estado de chihuahua, región hidrológico administrativa río bravo. retrieved from http://www.dof.gob.mx/nota_detalle.php?codigo= &fecha= / / díaz caravantes, r. e., bravo peña, l. c., alatorre cejudo, l. c., & sánchez flores, e. ( ). geospatial analysis of land use and water interaction in the peri-urban area of cuauhtémoc, chihuahua: a socio-environmental study in northern mexico. investigaciones geográficas, ( ), – . garcía, e. ( ). modificaciones al sistema de clasificación climática de koppen ( th ed., vol. ). mexico: unam. ibañez hernandez, o. ( ). manejo del acuífero de cuauhtémoc, chih. por el comité técnico de aguas subterráneas. brasilia, brazil: programa de las naciones unidas para el medio ambiente. retrieved from http://bva.colech.edu.mx/xmlui/bitstream/handle/ / /ag .pdf?sequence= inegi. ( ). censo de población y vivienda . retrieved november , , from inegi website: http://www.inegi.org.mx/est/contenidos/proyectos/ccpv/cpv /default.aspx inegi. ( ). anuario estadístico y geográfico de chihuahua . retrieved from http://www.inegi.org.mx/prod_serv/contenidos/espanol/bvinegi/productos/anuario_ / .pdf inegi. ( ). continuo de elevaciones mexicano . (cem . ). retrieved march , , from datos de relieve website: http://www.inegi.org.mx/geo/contenidos/datosrelieve/continental/continuoelevaciones.as px ortiz franco, p. o., & amado alvarez, j. p. ( ). uso del agua de la laguna de bustillos para la producción de maíz. terra lationamericana, ( ), – . quintana s., v. m. ( ). nuevo orden alimentario y disputa por el agua en el norte de méxico. apuntes: revista de ciencias sociales, ( ), – . wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ unravelling stakeholder perceptions to enable adaptive water governance in dryland systems this is a repository copy of unravelling stakeholder perceptions to enable adaptive water governance in dryland systems. white rose research online url for this paper: http://eprints.whiterose.ac.uk/ / version: accepted version article: lopez porras, g orcid.org/ - - - , stringer, lc orcid.org/ - - - and quinn, ch orcid.org/ - - - ( ) unravelling stakeholder perceptions to enable adaptive water governance in dryland systems. water resources management, ( ). pp. - . issn - https://doi.org/ . /s - - - © , springer science+business media b.v., part of springer nature. this is an author produced version of a paper published in water resources management. uploaded in accordance with the publisher's self-archiving policy. eprints@whiterose.ac.uk https://eprints.whiterose.ac.uk/ reuse items deposited in white rose research online are protected by copyright, with all rights reserved unless indicated otherwise. they may be downloaded and/or printed for private study, or other acts as permitted by national copyright laws. the publisher or other rights holders may allow further reproduction and re-use of the full text version. this is indicated by the licence information on the white rose research online record for the item. takedown if you consider content in white rose research online to be in breach of uk law, please notify us by emailing eprints@whiterose.ac.uk including the url of the record and the reason for the withdrawal request. mailto:eprints@whiterose.ac.uk https://eprints.whiterose.ac.uk/ unravelling stakeholder perceptions to enable adaptive water governance in dryland systems gabriel lopez porras , lindsay c. stringer , claire h. quinn abstract adaptive water governance seeks to increase a social-ecological system’s adaptive capacity in the face of uncertainty and change. this is especially important in non-linear dryland systems that are already exposed to water scarcity and increasing degradation. conservation of water ecosystem services is key for increasing adaptive capacity in drylands, however, how stakeholders perceive water ecosystem services greatly affects how they are managed, as well as the potential for adaptive water governance. this paper focuses on identifying the system’s potential for enabling adaptive water governance by analysing different stakeholder perceptions on water ecosystem services. it takes the rio del carmen watershed as a case study, offering important insights for an increasing number of water-scarce regions. semi-structured interviews were conducted with key stakeholders in the watershed in order to unravel their perceptions and understand the governance context. we found disparities in how stakeholders perceive water ecosystem services have led to water overexploitation and several conflicts over water access. our results indicate that stakeholder perceptions have a major influence on the system’s adaptability, as they shape the acquisition of water ecosystem services. divergent stakeholder perceptions act as an important barrier to collaboration. generating and sharing knowledge could facilitate the development of a common vision, allowing all actors to co- gabriel lopez porras eegilp@leeds.ac.uk sustainability research institute, school of earth and environment, university of leeds, woodhouse lane, leeds ls jt, uk. mailto:eegilp@leeds.ac.uk create information about water ecosystem services and the system state, engaging them in a participatory process, suitable for their context, and that will better support adaptive water governance. keywords social-ecological resilience · water scarcity · agricultural systems · knowledge sharing · conflicts · mexico introduction adaptive water governance (awg) integrates collaboration and learning processes to increase system adaptive capacity in the face of uncertainty and changing social-ecological conditions (decaro et al. ). awg suits contexts such as drylands, which are naturally exposed to droughts, land degradation, and desertification. implementing awg in drylands is challenging given complexities inherent to these social-ecological systems (ses), requiring deep understanding of the governance context (chaffin et al. ; gunderson et al. ). societal perceptions of what is important reflects how governance and institutions influence and shape ses (díaz et al. ). governance models must consider society’s priorities and risks in order to achieve development, human well-being, and secure the ecosystem services on which livelihoods rely (mortimore et al. ). this is vital in a dryland context, because people have different perceptions of “water scarcity”, shaped by their political, cultural and economic biases (forouzani et al. ). an important step towards awg is unpacking the formal and informal rules that underlie system interactions, establishing boundaries and identifying linkages and feedbacks between stakeholders (stringer et al. ). social constraints that underpin linkages, are called institutions (north ). institutions establish how governance systems operate, influencing the values stakeholders give to water ecosystem services (wes), and how individuals use natural resources. by understanding these institutions and governance systems they can be intentionally directed to halt wes losses (díaz et al. ). increasing conflicts over water access and overexploitation of scarce water resources are indicators of management failures and an undesirable state of water governance ( chaffin et al. ). for instance, access to water rights in the rio del carmen watershed, located in the most arid part of the chihuahuan desert in mexico, have been closed since (diario oficial de la federacion ) in an attempt to avoid overexploitation or damage to the watershed. water use rights have been issued using technical studies that guarantee water volumes for existing rights and the ecological balance of the watershed (diario oficial de la federacion ). nonetheless, overexploitation has increased since . water depletion, along with recent droughts and other environmental changes, have encouraged water conflicts, demonstrating inefficient water management (quintana ) underpinned by governance failures. to transform this into an opportunity for awg, an analysis is needed of system rules, linkages, and feedbacks shaping the ses (chaffin et al. ). this paper identifies a system’s potential for enabling awg, by analysing different stakeholder perceptions about wes, using the rio del carmen watershed as a case study. targeting this aim, we ask: ) who are the key stakeholders in the rio del carmen watershed? ) which communities and economic activities have access to water and why? and ) how do different stakeholders in rio del carmen perceive wes? unravelling how stakeholders perceive wes, how they are organized, and the institutional constraints that underlie social-ecological interactions, will help identify how awg might emerge in water-scarce contexts (young ), which are increasing globally (huang et al. ). research design and methodology governing water in dryland systems to balance multiple water demands across different stakeholder groups faces many challenges (cosens ). the rio del carmen watershed offers a useful example. this watershed is largely supported by aquifers: santa clara, flores magon villa ahumada and laguna de patos. literature suggests the first two aquifers are overexploited, while laguna de patos has a concession volume similar to the annual recharge volume (diario oficial de la federacion ). the watershed has a dam (las lajas), located on the santa clara river, with a total capacity of . million m y- (inegi ). the watershed’s main environmental problems are land use change (loss of grasslands due to conversion to agriculture), desiccation and groundwater overexploitation (conabio ). the social context is complex: different conflicts over water access have arisen, and authorities have been unsuccessful in solving the social and ecological crisis (quintana ; athie ). exploration of the social context regarding water access and the perceptions of wes that shape water governance helps to identify barriers to awg and incompatibilities in future collaboration and learning processes (gunderson et al. ; medema et al. ). we started with stakeholder analysis (reed et al. ) to understand the formal and informal interactions among stakeholders, the diverse perceptions in the watershed, and how water shapes the social context, using a qualitative approach. stakeholder analysis followed an iterative research process where semi-structured interviews were conducted during june across different stakeholder categories: government agencies, university, ngo, industry group and agricultural communities. categories were designed based on information from quintana ( ) and manzanares rivera ( ), and prior experience of the first author in the watershed. interview participants nominated others using snowball sampling, identifying more interviewees from different stakeholder categories (bhattacherjee ). interviews had multiple starting points so all stakeholder categories were properly represented, assuring all views were captured. an interview protocol was developed covering water access, governance and wes. the interviewer nevertheless followed up on other important issues raised during interviews (dicicco-bloom and crabtree ). interviews were recorded in spanish, transcribed into english and anonymised. the dataset was analysed and deductively coded (bernard ). this involved classification and coding under headings of: conflicts and trade-offs in water use, water access, water governance and perception of wes in the watershed, in line with the research questions. secondary data on the watershed’s average annual water availability, natural recharge, and social conflicts were collected using datos.gob.mx/ and www.infomex.org.mx. these data were analysed qualitatively using the same themes as for the interviews. findings were triangulated (kohlbacher ). contradictions between sources were noted and resolved according to the contingent factors or personal experiences that shaped the differences (bhattacherjee ). results . identification of key stakeholders in the rio del carmen watershed three stakeholder groups emerged as most important regarding water governance in the rio del carmen watershed: the national water commission (conagua), the mennonite community and mexican farmers. conagua is the mexican government agency in charge of national water management, through application of the national water law (athie ). when we refer to conagua we refer to its chihuahua local directorate, which is directly linked to water governance in the watershed. in mexico, water access is a human right guaranteed in its political constitution, and its conservation, as well as conservation of vital ecosystems linked to water resources, are file:///c:/users/earlst/appdata/local/microsoft/windows/temporary% internet% files/content.outlook/ co krm /datos.gob.mx/ http://www.infomex.org.mx/gobiernofederal/home.action considered public utilities . the literature identifies that conagua has several institutional deficiencies, limited economic and human resources, and an inadequate legal framework that has not allowed proper water management (athie ). officials within conagua noted this too: there is no control over the watershed, the legal framework is not respected by mennonites or by the water users from the lower part of the watershed, and the water use rights are not respected (conagua official b). conagua needs more human and economic resources, we need comprehensive water reform, with specialized courts, as they are largely unaware of the topic (conagua official d). these issues, along with water scarcity, have contributed towards conflicts over water access, where conagua needs to get involved. given its inability to monitor compliance with the law, punish those who do not comply, and to control corruption (murillo-licea and soares- moraes ; athie ), conagua sometimes participates as an arbiter and sometimes as part of the problem. according to the transparency unit of the federal judicature council of the federal judicial branch, in chihuahua state alone, lawsuits were filed against conagua in a period of months, for not solving citizens’ requests (cjf ). a conagua official said that: many times we have reached favourable agreements, but on other occasions, we have received legal demands which are out of the conciliation process. in these cases, the courts are the ones who must decide who is right, and according to the ruling, conagua must abide by what is dictated (conagua official c). the character that acquires a public good when it is fundamental for the government to satisfy collective social and economic needs. this situation has increased distrust in conagua, causing displeasure for several farmers. some of them blame conagua for the crisis that the watershed is experiencing (quintana ). both mennonite and mexican farmers stated that conagua “is closed to the complaints and needs of farmers” (mennonite a), and “[does] not have the technical or human capacity to attend to the situation in the watershed” (mexican farmer a). another important group in rio del carmen’s water governance is the mennonite community. mennonites are located principally in the upper part of the watershed, in the santa clara aquifer. around , mennonite colonies arrived in chihuahua, initially establishing in the laguna de bustillos watershed. population growth caused them to expand, including the rio del carmen watershed (personal communication, conagua official b). the mennonite community is very traditional, religious, peaceful and hardworking (quintana ). nevertheless, they have been involved in several conflicts with mexican farmers over water access. mexican farmers accuse mennonites of construction of illegal dams and wells (athie ). as a consequence, combined with conagua’s inactivity in addressing the problem, in a significant conflict arose when mexican farmers started to destroy dams supplying the mennonites. despite there being “about conflicts, more or less” (mennonite a) between mennonites and mexican farmers, the conflict in “was the only serious conflict” (mennonite b), which resonated in national and international media (quintana ; burnett ). additionally, mennonites in the watershed have been involved in several legal challenges. according to one conagua official: there are many legal complaints against the upper part of the watershed [where the mennonites are located] because of change of land use from grassland to irrigation, also semarnat has lodged several complaints against those persons because they do not have the authorizations for changing land use. unfortunately, those are processes where farmers have found weaknesses in the law and they can obtain some protection from the courts (conagua official b). as they have expanded, the mennonite community has become more heterogeneous, with both traditional and modern mennonites. traditional mennonites are said to be “more conscious about the situation and the consequences of overexploitation, however, mennonites in the rio del carmen watershed are not the most conscious, they are the most materialistic” (state government official b). a private farmer said this new generation of mennonites “over- exploits the aquifers and has monopolized most of the volume of water of chihuahua” (mexican farmer b). mennonites in the rio del carmen watershed do not consider there to be water scarcity, stating that: “underground water does not affect nature, it comes from deep” (mennonite b), “the water levels have not dropped a lot in that area, the wells have not gone down” (mennonite a). consequently, modern mennonites do not consider their agricultural activities are damaging the watershed or those who live in it; on the contrary, they see their activities having a positive effect. one mennonite said: all people have benefited from this, for example, if a neighbour needs workers, he employs to persons at the time of sowing, it benefits the population, several families, not just himself as the owner of the farm, but all the people who are searching for jobs (mennonite b). modern mennonites are recognised by the economic prosperity they have achieved as a result of their agricultural activities (manzanares rivera ), which are designed on “building a semarnat the acronym in spanish for the ministry of the environment and natural resources. family heritage” (mennonite b). some of their only complaints are that some mexican farmers do not want to let them access water: “they do not let us work, do more things, they do not let us improve” (mennonite a). nevertheless, given their peaceful culture, they believe they have not increased social tension, for instance when “once they [mexican farmers] broke a dam…, we could not do anything” (mennonite a). despite this, an interviewee stated that “now we have more communication with them [mexican farmers] because they understand that it is family heritage, we are working to live, to progress, nothing else” (mennonite b). the third stakeholder group identified are mexican farmers, made up of ejidatarios and private farmers. many of these farmers are organized into an irrigation district called el carmen , created in when closed access was established to secure water exploitation (diario oficial de la federacion ). additionally, a section of the district has exclusive water rights to , million m y- from the las lajas dam by presidential decree from (diario oficial de la federacion ). the irrigation district and most mexican farmers are located in the flores magon-villa ahumada aquifer, downstream of the santa clara aquifer and the mennonites. around , when mexican farmers began to notice reduced water availability, and detected upstream exploitation, they self-organized, giving rise to a social movement ‘defenders of the water of the chihuahuan desert’. they called upon the authorities to remove illegal exploitation, enforce the law on illegal conversion of grasslands to farmlands, eliminate economic support to those who exploit water illegally, and not to provide them with electricity (quintana ). when the authorities failed to solve the problem, they began occupying government offices and blocking roads and railroad tracks. at one point in this contestation, they were able to ejido members; ejidos are agricultural communities that manage their land collectively. coordinate actions with congagua to demolish dams and close wells. however, conflicts are not over. within this group, a grassroots (militant activist) organization called el barzon has been most concerned about and committed to the conflicts over water access. its leadership has been key in the organization of mexican farmers dissatisfied with the environmental state of the watershed and water management (quintana ). el barzon has been fighting illegal water use in the santa clara aquifer, a situation that a mexican farmer described in an interview: there are main conflicts: the use of surface water that is a tributary of the carmen river that is illegally retained by the mennonites. another problem are illegal wells, more than wells have been detected and do not have authorization from conagua. also, there is overexploitation of the aquifer that mennonites do; they use more water than they are allowed to. this aquifer [santa clara] has a concessioned volume of water of ha of irrigation, approximately, however, there are , ha irrigated (mexican farmer b). however, mennonites say that when they began to sow, before all these conflicts over water access in the watershed, conagua never asked them to obtain any authorization for water exploitation: “at that time we did not need any permits or water rights to use the water, we could extract it without anyone telling us anything” (mennonite a). this is unlikely because the state holds the original overarching property right to water resources. water cannot be used without government authorization. even in areas where water extraction is not limited, conagua must be notified of planned exploitation. in this case, formal norms and rules were not respected by the modern mennonite’s agricultural practices. this is due to: lack of awareness on the part of mennonites, and conagua’s lack of presence in water management and law enforcement. following this, mennonites in the watershed began to look for ways to acquire water rights, so they started buying the few remaining water rights in the santa clara aquifer, and divided them to legalise their water exploitation. a conagua official reported: those were water rights that allowed use of thousand m y- of water per year, each one, and they were bought and divided into several water rights for wells of , or , m y- , however, we know that they are extracting around , m y- of water in each well (conagua official c). athie ( ) says that extracting a higher volume of water than that allowed by water rights is not unique to mennonites. mexican farmers have also done this, having seen there are no consequences for breaking the law. consequently, there have been several attempts to solve the conflicts in chihuahua; from coordinated inter-institutional actions designed to identify and stop illegal water exploitation, to mediation processes. a state government official said: i was asked in to organize a mediation meeting between el barzon and the mennonite community. we had two meetings. the problem was that only the most conscious members of the mennonite community [those not engaged in agriculture] went to the meeting, not members that are using the water illegally. so, the meetings did not have effective results (state government official b). another interviewee added: we sat down twice with the mennonite central committee, which has contact with the leaders of the mennonite colonies. however, we could not advance because the traditional mennonite community is overtaken by modern mennonites (mexican farmer b). due to lack of resolution and coordination between mexican farmers and modern mennonites, along with conagua's lack of interest in and ability to solve the problem, “many farmers were discouraged and stopped participating, they are no longer trying to solve the problem in the watershed” (mexican farmer a). for this reason, el barzon raised their efforts above the chihuahua local directorate of conagua. an ejidatario said: we have received international protection: the inter-american commission on human rights issued precautionary measures to some members of el barzón, and with this, we have managed to force the authorities to sit at an inter-institutional table to design an operation for the closure of illegal wells (mexican farmer a). . water access in the rio del carmen watershed in mexico, water is divided into consumptive uses: agricultural, public supply, self-supply for industry, and thermoelectric; and non-consumptive use for hydroelectric plants (athie ). the main water use in the watershed is agricultural. in the flores magon-villa ahumada aquifer it represents . % of water use, in the santa clara aquifer it represents %, and in the laguna de patos aquifer it represents . % (conagua ). cultural diversity has created different models of agricultural production, and the interests that underlie each one are antagonistic, adding complexity to the system (manzanares rivera ). for instance, modern mennonites use an agricultural model that manzanares rivera ( ) called highly specialized emerging developments, which consists of the execution of very intensive farming practices implemented through technologies that optimize agricultural production. modern mennonites state their agriculture is sustainable and brings great benefits. when asked whether they considered their agricultural developments could continue over the next years, they replied “yes, i think there is enough water and there are not so many wells in the area” (mennonite b), “i believe it is going to get better” (mennonite a). this agricultural model has made chihuahua one of the main agricultural producers and exporters in mexico (manzanares rivera ), producing tonnes of maize ha- y- (quintana ). implementation of high-efficiency irrigation practices and technologies to access groundwater resources is expensive, as a conagua official said: a kilometre of electrical cabling costs , pesos approximately, drilling of wells costs , pesos approximately, plus water well equipment of , pesos, and the irrigation system that costs , pesos per hectare; this is a big investment (conagua official b). however, this agricultural model puts pressure on scarce water resources, (quintana ), since it underlies “a business vision with large-scale agricultural production” (mexican farmer a). given these circumstances, and experiences of this agricultural model in other aquifers where mennonites have settled, this intensive water use has several negative effects on wes, risking the continuity of agricultural activities and neglecting sustainability (manzanares rivera ). there are also the mexican farmers. according to manzanares rivera, ( ) ejidatarios do not use water resources intensively, and commonly their agricultural practices are oriented towards subsistence. however, quintana ( ) noted, from to the irrigation district el carmen increased its irrigation area by %, with the mexican farmers in the flores magon-villa ahumada increasing their agricultural area by . % per year. in principle, this should not have happened, as the irrigation district has had the same water rights since its creation. an ejidatario said: we have a water use right granted based on the land that was given to the ejido founders. those are plots of ha for each ejidatario, which is entitled to make use of , m y- of groundwater per year; according to technical data and irrigation sheets, that volume of water should be sufficient. as for the surface water that corresponds to the las lajas dam, we are at the mercy of rainfall and the rain catchment in the dam, so from the ha only to ha at most are sown, so we always have land without irrigation for lack of water at the dam (mexican farmer a). finally, there are the private farmers who have a traditional production model. they conserve their grasslands for livestock or mix rainfed agriculture with water exploitation. however, some have been encouraged to investment in irrigation systems that allow more intensive use of water resources, since they have seen the large profits made by modern mennonites (quintana ). a state government official stated that: although they [mexican farmers] have the right to use water, that does not give them the right to abuse water resources. farmers in the rio del carmen watershed are sowing a huge number of walnuts, which will cause a water collapse in the area; it is necessary to impose a plan that achieves the sustainability of the watershed, which mennonites and mexican farmers should abide (state government official b). some private farmers have modified their practices, expanding into more water-demanding crops, because of the profits they generate. the massive planting of these species is unsustainable, as a conagua official said “those crops are very likely to collapse, due the watershed typology where the average extraction per well is litres per second, which is insufficient for plots of ha” (conagua official b); yet, the private farmers planting them see these crops as “patrimonial since they can last years producing, so my children can inherit them, and so on” (mexican farmer b). six main problems regarding water access have shaped water overexploitation in the watershed (the relationship of each stakeholder group with these problems is shown in table ): . unsuitable cropping: the main crops are chilli, alfalfa, walnut, cotton, sorghum, and corn, but because of the high water quantities they require they are not suitable for the watershed (personal communication, conagua official c). . illegal removal of grasslands: illegal land use change, where grasslands have become cultivation plots, has placed significant pressure on water resources. according to the ministry of the environment and natural resources, there are no records of any authorization for land use change regarding the creation of irrigation plots in the rio del carmen watershed (semarnat ); so land conversion after was carried out illegally. . non-compliance with the law: according to a conagua official “conflicts should be attacked through legality. farmers already have an inclination to solve problems through the law” (conagua official c). however, law enforcement has been difficult due to corruption within conagua (murillo-licea and soares-moraes ; athie ), and legal procedures are “only simulation acts without any consequences for those who break the law” (mexican farmer a). . poor water management: as a conagua official stated: the problem is that we have many budget cuts, so the problem of chihuahua, being a dryland state... with several issues due to drought, we need more personnel, we have very few inspectors, and they are not enough for the number of water exploitations or the number of inspection visits they should make… we cannot properly manage water with the limited personnel we have (conagua official d). this is the year in which the general law of sustainable forest development was issued, which establishes the requirements for changing the use of land. . climate change: the watershed has suffered increased drought, “which means the watershed does not produce the minimum water amount established in law for its availability” (conagua official c). . perverse incentives for overexploitation: water for agricultural use has no taxation (athie ), the cost of electric power for water exploitation is subsidised and farmers have access to grants. water use and extraction is therefore very cheap, contributing to its overexploitation. these economic incentives mean that water cannot be adequately valued since they encourage excessive use, altering adversely the way wes are perceived (quintana ; athie ). table relationship between stakeholder groups and indentified problems in the rio del carmen watershed stakeholder group identified problem conagua mennonites mexican farmers unsuitable crop species there is no crop regulation in the watershed legal framework. “i started with alfalfa and cotton, but now i sow corn” (mennonite b). “the crops that are developed in the region are jalapeno chilli, red chilli, alfalfa and walnut” (mexican farmer a). illegal removal of grasslands semarnat is in charge of grassland management. this situation is taking place in the santa clara aquifer, as the mennonites have access to loans and machinery to convert grasslands to farmland. increase of the agricultural frontier has been carried by both mennonites and mexican farmers (athie ). poor water management “we still have not managed to measure how much water is being extracted in the watershed” (conagua official c). mennonites do not participate in any water management processes. mexican farmers have been trying to create and establish working groups for improving water management. non-compliance with the law water depletion shows conagua’s inefficiency in law enforcement. the closed access declaration has failed to guarantee water “mennonites have many legal advisers, they have filed requests for defence to stop administrative processes against some mexican farmers have begun to break the law, as they have witnessed there are no consequences for doing so. exploitation to the irrigation district, and water availability does not meet the minimum required by law. them” (conagua official b). climate change “water rights were granted in a regular or average state of the watershed, under other environmental conditions, and given the decrease in runoff, conflicts have increased” (conagua official c). “in the last few years there has been no drought problem, it has rained for the farmers” (mennonite a). “we have been having problems with the crops, this year we did not have the frosts that the walnut needs, and we had atypical hailstorms that damaged our crops” (mexican farmer a). perverse incentives for overexploitation electric subsidies and grants can be obtained only by water right holders. they benefit from these economic incentives. they benefit from these economic incentives. . stakeholders’ perceptions of wes in the rio del carmen watershed wes are the benefits that contribute to human well-being, obtained from freshwater ecosystems, like rivers, lakes, groundwater, and wetlands (martin-ortega et al. ). they are divided into: ) supporting services like soil formation and nutrient cycling, ) regulating services like water and climate regulation, ) provisioning services such as water and food supply, and ) cultural services like recreation, tourism and cultural identity (safriel et al. ). informal institutions such as stakeholders’ perceptions and formal institutions like the water legal framework (prell et al. ), shape the way these services are procured and thus the way water is accessed and managed (díaz et al. ; gunderson et al. ). conagua cannot go beyond what the legal framework establishes, so its institutional perception of wes is firmly limited to what is established in national water law. accordingly, in this law, water has no environmental value, only a fiscal value, hence it has a coercive economic procedure – an administrative process through which the government requires citizens to comply with their fiscal obligations – which separates it from environmental law (personal communication, garcia de icaza, ). indeed, the only penalties that the national water law applies are pecuniary (athie ), which do not guarantee or pursue the restoration of water or its related ecosystem services. therefore, conagua is restricted to the economic management of water resources. in addition, within conagua, perceptions of the watershed’s environmental condition differ among officials. while one interviewee said that there is no ecological deterioration in the area. we have been monitoring groundwater quality, and no variation or deterioration in water quality caused by overexploitation has been detected. the same quality of water has been maintained for many years (conagua official c); another stated that: there have been a lot of changes since , we have more drought occurrences in the watershed, which has meant that the watershed does not produce the water that the nom- establishes for the availability of water… downstream, now there is the presence of iron and fluorine, and we have evidence that arsenic is increasing. at this rate, we will have to discard these sources of water supply (conagua official b). water quality is paramount in dryland systems. disparities within conagua make it very difficult to conserve water regulating services that allow infiltration processes that both improve water quality and sustain its quantity. nevertheless, some conagua officials recognise the relationship between vegetation loss and provisioning and regulating services: · mexican official standard which states the determination method for water availability, which includes the natural discharge compromised to secure ecosystem functions. more grasslands are being removed and more shrubs, oaks, conifers are being felled, which influences the lack of water and fosters climate change. if there is no water production, then the aquifer is not recharged, nor is there any runoff for the las lajas dam (conagua official b). furthermore, the differences in how modern mennonites and mexican farmers perceive wes (figure ) are reflected in the way they use water for agriculture. modern mennonites perceive wes as an inexhaustible source of inputs for agricultural production. this relates to their religious beliefs that water is limitless because god provides it (burnett ). also, their education plays an important role. schooling is provided until secondary level in low german, after which they work on the farms, so not all of them can read and write in spanish (personal communication, mennonite b). this limits their access to updated information related to watershed state: “they are a closed group, they provide their own schooling, they do not receive education on natural sciences or issues related to water and hydrologic cycles” (mexican farmer a). these two reasons would explain why mennonites in the watershed do not account for or recognise wes. moreover, they also explain why it makes no sense to mennonites that conagua and mexican farmers want to restrict their water access; hence attempts to solve the conflicts in the watershed through the conciliation process fail. although mexican farmers’ economic activities rely on water use, most of them recognize the value of wes in supporting their livelihoods, including the relationship between grasslands and water resources. as an ejidatario said “there are fewer plants in the soil, and with the torrential rains there is no infiltration, a lot of soil loss, and less water. with good grassland management water would be allowed to permeate and recharge the aquifers, but they are running out” (mexican farmer a). even so, mennonites perceive those agricultural practices as inefficient, as an interviewee said “they [ejidatarios] don't want us to irrigate our lands, they don’t want us to use water, they want all the water for themselves but in the end, they do not even use it” (mennonite a). mexican farmers recognise the finite nature of wes, and their importance in provisioning and regulating water, as well as supporting soil formation. despite this, some private farmers are starting to prioritize economic benefits by using crops that are unsuitable for the current context of the rio del carmen watershed, which increases the pressure on water resources and generates another area of conflict (figure ). figure stakeholder perceptions, compatibilities and conflict areas for restoration of water ecosystem services. discussion this paper has identified the key stakeholders in the rio del carmen watershed; unravelled water access; highlighted the main drivers that have shaped it; and examined how wes are perceived by key stakeholders. it provides an important contribution to discussions regarding the required conditions for an adaptive model of governance to be successful, by understanding the governance context and the institutions that comprise it. the main problem is that some farmers have suffered from overexploitation of water, causing conflicts over its access. the water access crisis is a consequence of unsuitable crop species, illegal removal of grasslands, non-compliance with the law, poor water management, climate change, and perverse incentives for overexploitation (table ). this water governance failure is a clear barrier to system adaptation, since degradation of wes substantially restricts dryland systems' adaptive capacity (mortimore et al. ). stakeholder participation is critical for increasing adaptability (folke et al. ), hence, farmers have a significant role in the governance of wes, as they are selecting crops, removing grasslands and extracting water (chaffin et al. ). as resource users, farmers must be involved in water regulation, cooperate in monitoring, participate in decision-making processes, collaborate and generate knowledge for improving water governance, however, there are barriers. lack of awareness about the importance of wes for the perpetuation of freshwater ecosystems has resulted in non-compliance with formal institutions that seek to protect the rio del carmen watershed, and their relevance is ignored. informal institutions, like modern mennonites’ agricultural practices, have not changed despite the existing water legal framework because of a lack of awareness of ecological processes, and because “informal constraints that are culturally derived will not change immediately in reaction to changes in the formal rules” (north, , p. ). hence, modifying stakeholders’ perceptions by generating and sharing knowledge is an entry point for enabling awg, but also, an important principle that needs to be embedded to avoid undesired states and to better understand social processes (stringer et al. ). mennonites’ beliefs and perceptions determine their intentions, which are externalized through their behaviours in order to obtain desired outcomes (schlüter et al. ), like building family heritage through intensive farming practices. most mexican farmers like ejidatarios do not share those intentions because they have opposing perceptions about wes. this results in two incompatible behaviours creating a major obstacle for solving conflicts. co-creating knowledge between conagua, mennonites, and mexican farmers offers potential for understanding decision-making behaviours and improving social learning, as well as engaging them in processes in which their perceptions are considered. learning processes that allow a shared vision of the wes to be established, offer potential to facilitate collaboration between stakeholders (medema et al. ). collaboration is key as it can mitigate current conflicts, create networks, and enhance participation in decision-making: basic elements of adaptive governance (decaro et al. ). moreover, conagua’s lack of resources and its inability to enforce the law has led to a quasi-open access regime, where informal institutions have surpassed the formal institutions that seek to regulate water access. accordingly, governance failures have driven some stakeholders to take action (pahl-wostl et al. ). el barzon has been most active, looking to change the undesirable state by taking on a leadership role. leadership is a critical factor for social learning (garmestani and benson ), but it needs to be directed towards creating networks and building trust between stakeholders, enabling collaboration and allowing emergence of an adaptive governance model (chaffin et al. ). el barzon have already taken the initiative to reconcile conflicts and collaborate with mennonites, and currently, they have convened an inter-institutional roundtable to try to solve the problems. however, barriers in their processes have not allowed them to reach favourable results. first, this is taking place in an “unmanageability” context, with lack of participation or "action" from key stakeholders in the watershed. this means el barzon is framing and structuring the problem according to their own perceptions, without other stakeholder inputs (pahl-wostl et al. ), so their processes lack legitimacy, accountability and representativeness (chaffin et al. ). even though el barzon is trying to remedy conagua’s deficiencies in conserving wes, informal networks require legitimacy to design and implement formal measures that will address the problem (Österblom and folke ). conagua needs to start getting involved in these participatory processes and encourage the participation of mennonites, which ultimately will increase acceptance of and compliance with formal institutions (cosens ). lack of participation and collaboration by mennonites can be attributed to two issues: ) stakeholders will not participate if they feel they are considered responsible for the problem, and ) lack of awareness of water issues decreases stakeholders’ interest to participate (medema et al. ). despite the potential for creating a common vision through knowledge co-creation, it is paramount that communication during these processes is facilitated by experts in community engagement and participatory processes; preserving that shared vision in situations with opposite views and conflicts between stakeholders (medema et al. ). besides el barzon’s interest and leadership, capacities and resources from both mennonites and conagua are required for this collaborative process to succeed. another barrier is el barzon’s militant characteristics. conceptual differences hinder good relationships with the other groups. however, developing mutual goals for addressing a collective problem should help to foster greater openness. an ejidatario said that “as an organization, we always bet on dialogue, sometimes with actions of civil resistance but alwa ys willing to make proposals and resolve the conflicts” (mexican farmer a). a similar situation was experienced in the klamath river in the usa. after legal, political and physical conflicts over water access and no positive outcomes, key stakeholders took the lead to solve their problems by developing a common vision (chaffin et al. ). to legitimize this process in the watershed, conagua needs to play its role and establish a formal process that allows rapprochement between mennonites and mexican farmers. it needs to be clear for all stakeholders that water is finite and running low in the rio del carmen watershed. if economic profit is prioritised in the use of wes, it is necessary to have better control over water access, at least until a balance is achieved between recharge and extraction, and ultimately, to preserve the economic value of the watershed. unpacking the governance context is necessary to find the system’s potential to apply awg (gunderson et al. ). several structural and institutional complexities constitute obstacles (e.g. incompatible perceptions; poor management on conagua’s part). knowledge co- creation is critical for increasing adaptability, but unravelling stakeholder perceptions and how they shape water access demonstrates how this process is a real and necessary entry point for enabling awg. however, recognising the system’s potential by understanding how society accesses and perceives wes, is only the first –necessary – step for enabling awg in a water scarce context. investigating the complexities of the relationships between governance actors, along with assessing the legal system that regulates the structures, capacities and processes of the governance system, are subsequent steps (chaffin et al. ; cosens et al. ), and would apply in both the rio del carmen and beyond. conclusion conservation of wes is imperative to build adaptive capacity in dryland systems. success of awg is based on recognition of the environmental state and stakeholders’ perceptions of wes, which ultimately indicate how and why water is accessed. this paper has three major conclusions. first, informal institutions like stakeholders’ perceptions that are shaped by their cultural heritage can have a major influence, even more so than formal institutions. these perceptions of wes have led to the breach of formal institutions through illegal water exploitation and illegal conversion of grasslands, resulting in social and environmental crisis in the watershed. second, undesirable states can foster the emergence of leadership among stakeholders in order to change system conditions. for instance, the social movement “defenders of the water of the chihuahuan desert”, where the grassroots organization el barzon has participated actively in the conflicts over water access, has emerged as a consequence of this situation. third, even in ses with poor water management carried out by inefficient authorities, by unpacking societal perceptions and their underlying institutional context, entry points for enabling awg can be found. it is important to be aware of the issues that led the system to an undesirable state in order to address and avoid them via participatory processes. deeply rooted perceptions, lack of information and incompatibility among stakeholders are key barriers identified in the rio del carmen watershed. however, the ability of key stakeholders to unify and develop a common vision in the watershed is a pre-requisite to conserve wes and increase system adaptive capacity. acknowledgments the first author acknowledges financial support from conacyt-secretaria de energia-sustentabilidad energetica grant no. . references athie k ( ) el agua, ayer y hoy. camara de diputados lxiii legislatura, mexico city bernard hr ( ) research methods in anthropology鳥: qualitative and quantitative approaches, th edn. altamira, maryland bhattacherjee a ( ) social science research: principles, methods, and practices, book . textbooks collection burnett v ( ) mennonite farmers prepare to leave mexico, and competition for water. new york times a chaffin bc, garmestani as, gosnell h, craig rk ( ) institutional networks and adaptive water governance in the klamath river basin, usa. environ sci policy : – . doi: . /j.envsci. . . chaffin bc, gosnell h, cosens ba ( ) a decade of adaptive governance scholarship: synthesis and future directions. ecol soc : . doi: . /es- - cjf ( ) consejo de la judicatura federal. respuesta a solicitud de informacion . http://www.plataformadetransparencia.org.mx/web/guest/inicio?p_p_id=buscadoresportl et_war_buscadoresportlet&p_p_lifecycle= &p_p_state=maximized&p_p_mode=view &p_p_col_id=column- &p_p_col_count= &_buscadoresportlet_war_buscadoresportlet_action=buscardores po. accessed oct conabio ( ) comisión nacional para el conocimiento y uso de la biodiversidad. la biodiversidad en chihuahua: estudio de estado. mexico conagua ( ) disponibilidad por acuíferos: comision nacional del agua. https://www.gob.mx/conagua/acciones-y-programas/chihuahua- . accessed sep cosens b ( ) application of the adaptive water governance project to the management of the lake eyre basin and its connections to the great artesian basin, report to flinders university and the goyder institution. adelaide, south australia cosens ba ( ) legitimacy, adaptation, and resilience in ecosystem management. ecol soc : . doi: . /es- - cosens ba, craig rk, hirsch sl, et al ( ) the role of law in adaptive governance. ecol soc : . doi: . /es- - decaro da, chaffin bc, schlager e, et al ( ) legal and institutional foundations of adaptive environmental governance. ecol soc : . doi: . /es- - diario oficial de la federacion ( ) acuerdo que establece el distrito de riego de el carmen, en san buenaventura y villa ahumada, chih., y declara de utilidad pública la construcción de las obras que lo formen y la adquisición de los terrenos necesarios para alojarlas y operarlas. diario oficial de la federacion, mexico diario oficial de la federacion ( ) acuerdo por el que se actualiza la disponibilidad media anual de agua subterránea de los acuíferos de los estados unidos mexicanos, mismos que forman parte de las regiones hidrológico-administrativas que se indican. in: dir. gen. la com. nac. del agua, Órgano adm. desconcentrado la secr. medio ambient. y recur. nat. http://dof.gob.mx/nota_detalle.php?codigo= &fecha= / / . accessed aug diario oficial de la federacion ( ) resolucion sobre dotación de aguas, solicitada por vecinos del poblado denominado benito juarez, antes enriquez y punta de alamos, municipio de buenaventura, chih. in: el pres. const. los estados unidos mex. http://www.dof.gob.mx/nota_detalle.php?codigo= &fecha= / / . accessed sep díaz s, demissew s, carabias j, et al ( ) the ipbes conceptual framework — connecting nature and people. curr opin environ sustain : – . doi: . /j.cosust. . . dicicco-bloom b, crabtree bf ( ) the qualitative research interview. med educ : – . doi: . /j. - . . .x folke c, hahn t, olsson p, norberg j ( ) adaptive governance of social- ecological systems. annu rev environ resour : – . doi: . /annurev.energy. . . forouzani m, karami e, zamani gh, moghaddam kr ( ) agricultural water poverty: using q-methodology to understand stakeholders’ perceptions. j arid environ : – . doi: . /j.jaridenv. . . garmestani a, benson m ( ) a framework for resilience-based governance of social- ecological systems. ecol soc : . doi: . /es- - gunderson lh, cosens b, garmestani as ( ) adaptive governance of riverine and wetland ecosystem goods and services. j environmenal manag : – . doi: . /j.jenvman. . . huang j, yu h, guan x, et al ( ) accelerated dryland expansion under climate change. nat clim chang : – . doi: . /nclimate inegi ( ) síntesis de información geográfica del estado de chihuahua. aguascalientes, mexico kohlbacher f ( ) the use of qualitative content analysis in case study research. forum qual sozialforsch / forum qual soc res : – manzanares rivera jl ( ) hacer florecer al desierto: análisis sobre la intensidad de uso de los recursos hídricos subterráneos y superficiales en chihuahua, méxico. cuad desarro rural : – . doi: http://dx.doi.org/ . /javeriana.cdr - .hfda martin-ortega j, ferrier r, gordon i, khan s ( ) water ecosystem services: a global perspective. cambridge university press, cambridge medema w, adamowski j, orr c, et al ( ) building a foundation for knowledge co- creation in collaborative water governance: dimensions of stakeholder networks facilitated through bridging organizations. water : . doi: . /w mortimore m, anderson s, union. i--twc, et al ( ) dryland opportunities鳥: a new paradigm for people, ecosystems and development. iucn, iucn鳥; london鳥: iied鳥; new york鳥: undp, gland, switzerland murillo-licea d, soares-moraes d ( ) el péndulo de la gobernabilidad y la gobernanza del agua en méxico. tecnol y ciencias del agua : – north dc ( ) institutions, institutional change, and economic performance. cambridge university press, cambridge Österblom h, folke c ( ) emergence of global adaptive governance for stewardship of regional marine resources. ecol soc : . doi: . /es- - pahl-wostl c, holtz g, kastens b, knieper c ( ) analyzing complex water governance regimes: the management and transition framework. environ sci policy : – . doi: . /j.envsci. . . prell c, reed ms, racin l, hubacek k ( ) competing structure, competing views: the role of formal and informal social structures in sahping stakeholder perceptions. ecol soc : . doi: quintana vm ( ) nuevo orden alimentario y disputa por el agua en el norte de méxico. apunt rev ciencias soc : – . doi: . /apuntes. . reed ms, graves a, dandy n, et al ( ) who’s in and why? a typology of stakeholder analysis methods for natural resource management. j environ manage : – . doi: . /j.jenvman. . . safriel u, adeel z, niemeijer d, et al ( ) ecosystems and human well-being: current state and trends. island press, washington dc schlüter m, baeza a, dressler g, et al ( ) a framework for mapping and comparing behavioural theories in models of social-ecological systems. ecol econ : – . doi: . /j.ecolecon. . . semarnat ( ) secretaria de medio ambiente y recursos naturales. respuesta a solicitud de informacion stringer lc, reed ms, fleskens l, et al ( ) a new dryland development paradigm grounded in empirical analysis of dryland systems science. l degrad dev. doi: . /ldr. young or ( ) institutional dynamics: resilience, vulnerability and adaptation in environmental and resource regimes. glob environ chang : – . doi: . /j.gloenvcha. . . book reviews the most important of six factors in bringing about the decision. he asserts t h a t allied propaganda accentuated many of these factors, but t h a t i t would not have borne f r u i t without receptive soil. unfortunately, except f o r t h c defense of neutral rights, the majority of hoosiers gave little thought to the relation of belligerency and american foreign policy. “their failure was of little consequence in the prosecution of the w a r , f o r they agreed well enough on the immediate target. but what was unessential in w a r might be crucial in making peace.” the farmer’s last frontiey, agriculture, - . by fred a. shannon (volume v of t h e economic history of the united states, f a r r a r & rinehart, inc., new york, c. , pp. xii, . text edition, $ . , t r a d e edition, $ . .) with the appearance of this volume a new co-operative economic history is introduced. the series is to contain nine volumes. the period before will be described i n two general volumes, the years from to will be treated in a volume devoted to agriculture and another to industry, the period from to will also be covered i n this manner, while the present century will be described in three general volumes. if the others meet the high standards set by this one, history will be enriched by a significant and thorough treatment of the economic development of the united states. the absence of a work of this type has been a notable defect of historical literature. this volume is f i r s t of all a comprehensive account of agricultural developments from the beginning of the civil w a r to the end of the century. it also summarizes i n the excellent footnote citations and in the final bibliographical chapter the scholarly literature and much of the source ma- terial concerning the subject. occasionally one fails to find a n important work included, but t h a t is rarely true. it sets f o r t h conclusions and interpretations at variance with older works particularly in relation to the national land policy. after noting t h a t the fundamental basis of the farmers’ difficulties on the last frontier were the differences of soil, climate, and distance, the author described the rapid settle- ment which was often influenced by artificial stimulants max p. allen. indiana imagazine o f history supplied by t h e railroads, states, and land companies. the corporations, railroads, cattle and lumber barons, and land companies were the chief beneficiaries of t h e land laws ac- cording to the author’s analysis. his judgments a r e reflected in a group of quotations. “in its operations the homestead act could hardly have defeated the hopes of the enthusiasts of - more completely if the makers had actually drafted i t with t h a t purpose uppermost i n mind [p. .” “it tempted settlers out to the arid stretches where a quar- t e r section was barely enough f o r t h e grazing of two or three cattle [p. .” “the [railroad] companies were not only given their railroads-they were given a bonus [usually land] to accept them [p. .” “some $ , , were paid to indian tribes to quiet their claims, and then t h e land was turned over t o speculators a t less t h a n cost [p. .” the agricultural reorganization of the south a f t e r with its labor system of tenant f a r m e r s and s h a r e croppers and its credit system of crop mortgages is also critically examined. “the outright confiscation of large p a r t s of es- tates created by slave labor, to make f a r m s f o r freedmen, would in the long r u n have created more prosperity f o r t h e section t h a n the growth of land monopolization t h a t took place instead, and t h e simultaneous establishment of a sys- tem of quasi serfdom t h a t left the toilers without ambition and t h e landlord with ruined soils and finances [pp. - ].” the classes of the south where the crop-lien system predom- inated were “the landlord-merchant-banker-capitalist group, numbering approximately a sixth of t h e total population and having all t h e political power; [and] . . . t h e bulk of field workers, living from enfeebled hand t o empty mouth [p. .” even in the north central states “a remarkable growth in tenancy” occurred which was not checked by t h e mechan- ization of the farms. the expansion of prairie agriculture in t h e great plains led to the plowing of t h e g r a s s lands t h a t should have been reserved f o r grazing. both t h e “little fellow” and the “bonanza f a r m e r ” often failed. the live- stock frontier ,was another story of injustice a n d special privilege, and the cowboy was f a r less romantic t h a n usually pictured. problems of the west a r e discussed in the light of the agrarian revolt and t h e co-operative movement which a r e also described sympathetically. eastern adjustments, the declining position of the f a r m e r s in the nation, and his book reviews social life a r e not overlooked in completing the story. perhaps some views of t h e author have been over- emphasized, but one can scarcely avoid t h e feeling t h a t he has offered a few judgments t h a t a r e somewhat extreme in his treatment of the great plains and the south. his analysis is skillful and scholarly and the total picture may not be overdrawn. the illustrations and charts a r e excel- lent. the binding of the textbook edition is not attractive and is so light in color t h a t it will soil readily and become less attractive. although much of the volume is not con- cerned with t h e middle west, i t presents the background f o r understanding the agricultural development of this region. w a r , peace, and nonresistance. by guy franklin hersh- berger. (the herald press, scottdale, pennsylvania, , pp. xv, . $ . .) the history of nonresistance and t h e scriptural and doctrinal teachings upon which it is founded f o r m the sub- ject of this volume. i t s preparation was undertaken some years ago a s a commission from t h e peace problems commit- tee of the mennonite church. its purposes were t o clarify the position of the church from its beginning to the present war and to strengthen the members in maintaining t h a t position a s individuals. the author i s professor of history and sociology a t goshen college, a mennonite college at goshen, indiana. the work is significant to the historian as a n historical account of the mennonites’ reaction against w a r from t h e sixteenth century to the present, and a s a resume of other important pacifist attitudes, but more especially as a means of understanding the mennonites and their unique position in indiana and in other states and nations. some historical material is included in the f i r s t f o u r chapters which give the doctrinal basis of nonresistance. these chapters review “war in history,” “peace a n d w a r in the old testament,” “nonresistance in the new testament,” and peace and war and the church. the mennonites trace their origin to the anabaptists in switzerland in . f r o m here they spread to holland, germany, france, and russia, often fleeing from persecution. those most interested in preserving the nonresident way of life came t o america, john d. barnhart. chh volume issue cover and front matter church history studies in christianity & culture american s o c i e t y of church history s e p t e m b e r core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core the american society of church history president peter w. williams, miami university president-elect ronald l. numbers, university of wisconsin-madison secretar y-treasurer henry w. bowden, rutgers university assistant secretary melissa b. kirkpatrick, the american university editors elizabeth a. clark richard p. heitzenrater h a n s j . hillerbrand grant wacker duke university members of the council class of lewis v. baldwin mary f. bednarowski ralph keen- mark r. valeri rebecca h. weaver class of yvonne chireau philip krey amanda porterfield m \ r k g. toulouse charles i. wallace class of j o h n h. erickson alan hayes evelyn kirkley amy oden john piper the society was founded in by philip schaff, was reorganized in , and was incorporated by act of the legislature of the state of new york in . core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core vol. september no. church history studies in christianity & culture published quarterly by the american society of church history © , the american society of church history core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core church history studies in christianity and culture editors elizabeth a. clark richard p. heitzenrater hans j. hillerbrand grant wacker senior assistant to the editors jay s. f. blossom assistants to the editors caroline t. schroeder anne blue wills duke university associate editors william adler north carolina state university david aers duke university peter iver kaufman university of north carolina at chapel hill laurie f. maffly-kipp university of north carolina at chapel hill robert bruce mullin the general theological seminary russell e. richey duke university david c. steinmetz duke university thomas a. tweed university of north carolina at chapel hill advisory editors jon butler yale university caroline walker bynum columbia university averil cameron keble college, oxford university robert e. frykenberg university of wisconsin-madison nathan o. hatch university of notre dame christine leigh heyrman university of delaware e. brooks holifield emory university hartmut lehmann max planck institute, university of gottingen patricia cox miller syracuse university heiko a. oberman university of arizona robert a. orsi indiana university andrew porter king's college, university of london john h. van engen university of notre dame merry wiesner-hanks university of wisconsin-milwaukee church history (issn - ) core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core articles the role of godly magistrates in the church: melanchthon as luther's interpreter and collaborator james m. estes madame guyon and experiential theology in america patricia a. ward theology as entertainment: oral debate in american religion e. brooks holifield french politics and alfred loisy's modernism harvey h i l l the shift from character to personality in mainline protestant thought, - heather a. warren books book reviews and notes kiley, mark, et al., eds., prayer from alexander to constantine: a critical anthology william r mcdonald sharer, peter, judeophobia: attitudes toward the jews in the ancient world paula fredriksen early church fathers: book collection on cd-rom james j . o'donnell hultgren, a r l a n d j . , a n d steven a . h a g g m a r k , eds., the earliest christian heretics: readings from their opponents gary r. brower salisbury, j o y c e e., perpetua's passion: the death and memory of a young roman woman a m y g. oden perkins, judith, the suffering self: pain and narrative representation in the early christian era dennis e. trout elliott, t. g., the christianity of constantine the great charles odahl b u r r u s , virginia, the making of a heretic: gender, authority, and the priscillianist controversy richard valantasis macmullen, ramsay, christianity and paganism in the fourth to eighth centuries averil c a m e r o n urbainczyk, theresa, socrates of constantinople: historian of church and state richard lim amory, patrick, people and identity in ostrogothic italy, - michael m a a s power, kim, veiled desire: augustine on women maureen a. tilley o'rourke boyle, marjorie, divine domesticity: augustine of thagaste to teresa of avila merry wiesner-hanks l e m a i t r e , j e a n - l o u p , michel dmitriev, a n d pierre g o n n e a u , eds., moines et monastères dans les sociétés de rite grec et latin: Études publiées avec le concours de la fondation singer-polignac david paul hester core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core potts, cassandra, monastic revival and regional identity in early normandy charles b. paris epstein, marc michael, dreams of subversion in medieval jewish art and literature kalman p. bland vauchez, andre, and jean birrell, trans., sainthood in the later middle ages maiju lehmijoki-gardner voolstra, sjouke, menno simons: his image and message william c. ringenberg maag, karin, ed., the reformation in eastern and central europe gregory j. miller o'reilly, terence, from ignatius loyola to john of the cross: spirituality and literature in sixteenth-century spain carlos m. n. eire chatellier, louis, and brian pearce, trans., the religion of the poor: rural missions in europe and the formation of modern catholicism, c. - kathleen m. comerford boersma, owe, and auke j. jelsma, eds., unity in multiformity: the minutes of the coetus of london, , and the consistory minutes of the italian church of london, - peter iver kaufman schutte, anne jacobson, transc, transl., ed., cecelia ferrazzi: autobiography of an aspiring saint charmarie j. blaisdell wiesner-hanks, merry, ed., joan skocir, and merry wiesner-hanks, trans., convents confront the reformation: catholic and protestant nuns in germany marygrace peters, o.p. parnham, david, sir henry vane, theologian: a study in seventeenth-century religious and political discourse jameela lares coffey, john, politics, religion and the british revolutions: the mind of samuel rutherford dewey d. wallace jr. swatland, andrew, the house of lords in the reign of charles ii gary s. de krey hinds, hilary, god's englishwomen: seventeenth-century radical sectarian writing and feminist criticism paul wesley chilcote herrick, james a., the radical rhetoric of the english deists: the discourse of skepticism, - charles wallace jr. kaufman, peter iver, prayer, despair, and drama: elizabethan introspection norman jones butler, jon, and harry s. stout, eds., religion in american history: a reader mark a. noll stout, harry s., and d. g. hart, eds., new directions in american religious history robert bruce mullin gilpin, w. clark, a preface to theology e. brooks holifield shriver, george h., ed., dictionary of heresy trials in american christianity david r. bains faull, katherine m., trans., moravian women's memoirs: their related lives, - catherine a. brekus helmstadter, richard, ed., freedom and religion in the nineteenth century charles d. cashdollar compton, todd, in sacred loneliness: the plural wives of joseph smith gerald e. jones vogel, dan, ed., early mormon documents. vol. thomas g. alexander weaver, j. denny, keeping salvation ethical: mennonite and amish atonement theology in the late nineteenth century steven m. nolt howard, victor b., the evangelical war against slavery and caste: the life and times of john g. fee marty g. bell evans, christopher hodge, social gospel liberalism and the ministry of ernest fremont tittle: a theology for the middle class merrill m. hawkins jr. fahey, david m., temperance and racism: john bull, johnny reb, and the good templars william l. fox core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core denton james a., rocky mountain radical: myron w. reed, christian socialist david b. mccarthy emmons, terrence, alleged sex and threatened violence: doctor russel, bishop vladimir, and the russians in san francisco, - marks. still klejment, anne, and nancy l. roberts, eds., american catholic pacifism: the influence of dorothy day and the catholic worker movement maryj. oates knotts, alice g., fellowship of love: methodist women changing american racial attitudes, - linda m. martin chaves, mark, ordaining women: culture and conflict in religious organizations randi jones walker miller, keith graber, wise as serpents, innocent as doves: american mennonites engage washington richard g. kyle blodgett, jan, protestant evangelical literary culture and contemporary society james g. moseley dorgan, howard, in the hands of a happy god: the "no hellers" of central appalachia samuel s. hill gilbert, james, redeeming culture: american religion in an age of science michael s. hamilton miller, donald e., reinventing american protestantism: christianity in the new millennium jackson w. carroll brown, michael r, the channeling zone: american spirituality in an anxious age kelly jarrett hanegraaff, wouter, ]., new age religion and western culture: esotericism in the mirror of secular thought evelyn a. kirkley jeffrey, david lyle, people of the book: christian identity and literary culture wesley a. kort terray, laszlo g., and erik w. gritsch, trans., he could not do otherwise: bishop laps ordass, - tandy mcconnell burgess, john, the east german church and the end of communism johns. conway xing, jun, baptized in the fire of revolution: the american social gospel and the ymca in china: - jane harris munro, doug, and andrew thornley, eds., the covenant makers: islander missionaries in the pacific robert a. schneider wiles, maurice, archetypal heresy: arianism through the centuries harry o. maier prokurat, michael, alexander golitzin, and michael d. peterson, historical dictionary of the orthodox church john l. boojamra zwi werblowsky, r. ]., and geoffrey wigoder, eds., the oxford dictionary of the jewish religion shaye j. d. cohen books received society notes core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/ . /s downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge https://www.cambridge.org/core/terms https://doi.org/ . /s https://www.cambridge.org/core kear.chp:corel ventura the virtuous circle of facts and values in the new western history gerry kearns department of geography, university of cambridge, cambridge, uk the relations between facts and values in the writing of historical geography need to be mutual and reinforcing. i explore this point by examining the work of a group of historians who have foregrounded the relations between facts and values. these new western historians take up themes such as social justice, regionalism, and environmentalism that have been central to the concerns of historical geographers, but they are more explicit than many historical geographers about both the political motivations behind the questions they ask and their choice of subjects to study. i consider the work of two historians, william cronon and donald worster, who have made environmentalism the core of their historical writing, and two others, richard white and patricia limerick, for whom questions of social justice inform historical interpretation. i conclude by exploring how attention to the interplay between facts and values might rekindle the utopian dimension of explicitly political historical geographies. key words: environmentalism, new western history, social justice. the new western history is a recent devel-opment that has garnered a wide audiencefor academic history by reexamining the crucial importance of the west to the political identity of the u.s. under its inspiration, public exhibitions such as the smithsonian’s “the west as america” (washington, dc, ), have questioned the central myth of the fron- tier as the place where civilization overcame savagery. this exhibition drove one senator to bewail the smithsonian’s sponsorship of “per- verted history.” as hughes ( : ) re- marked, “[s]tarting with daniel boorstin, the former librarian of congress, a whole crowd of politicos and right-wing columnists put on their boots and started kicking.” the central myth the exhibition questioned is inherently historical and geographical. it finds, as a source of the values and energy of the u.s., the process of colonization, whereby so - called “empty” space was gradually incorporated into the new republic. the “new western history” (so termed by historian patricia limerick) accuses the mythmakers of downplaying environmental destruction, injustices to native peoples, and the race, class, and gender conflicts at the heart of the imperialist process of taking the land for the new, big country. to point toward how a new historical geography of the west might attend to a new series of political agendas arising out of the new western history, this paper examines the work of contemporary historians william cronon, don- ald worster, richard white, and limerick. the new western history takes up issues that are major concerns of human geography, such as regionalism (morris ; thrift ), environ- mentalism (williams ), and social justice (smith ; harvey ). these issues, then, are not new to human geography, or even to work on the historical geography of the u.s. carl sauer ( ) posed questions about the environmental destruction entailed by the industrial civilization that displaced native american peoples from most of the continent. richard jackson ( ) has described the politics of land-use regulation. donald meinig ( , ) has put the creation of regional diversity and its political implications at the core of his account of the shaping of north america and, furthermore, has not shrunk from describing the violent taking of the land as “im- perialism.” the new western history also coa- lesces with some of the most interesting recent historical-geographical scholarship on north america, such as nostrand ( ) on the u.s.- mexico borderlands and wishart ( ) on the fate of the native peoples of nebraska. a special issue of ecumene ( [ ], ) is devoted to the discussion of some of the relations between geog- raphy and the new western history. at least one of the historians i discuss has engaged in debate annals of the association of american geographers, ( ), , pp. – © by association of american geographers published by blackwell publishers, main street, malden, ma , and cowley road, oxford, ox jf, uk. d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t with geographers. in the pages of antipode, wil- liam cronon has been attacked for being insuf- ficiently marxist, while in the journal of historical geography, he has been taken to task as insuffi- ciently postmodernist. these two sets of criticisms focus in rather different ways on the question of the relations between facts and values that is at the heart of this paper. yet there is something distinctive about the explicitly political nature of the historical agenda in the new western history that has rarely been confronted in human geog- raphy. geographers have been more willing to note the inevitability of personal bias and interest in the selection of subjects for study (wishart ) than to subject their substantive, theoreti- cal, and methodological choices to explicitly po- litical or moral review. the new western history takes cognizance of the broadening horizons of social history as the latter engages with under-researched areas such as race and gender. these topics have, in large part, forced their way onto the academic agenda by virtue of the political visibility and self- confidence of the new social movements that campaigned on behalf of their political salience in the s and s. the supposed value neutrality of historical scholarship has been fa- tally wounded by the development of social his- tory engagé (novick ; nash et al. ), opening up the prospect of two-way traffic be- tween political and historical scholarship (scott ). geographers have much to learn from debates within history, and historical geographers have certainly kept abreast of the flourishing field of social history. race and gender, for example, are topics to which jeanne kay has previously drawn the attention of historical geographers ( , , ). yet when social historians explicitly address the study of the past to the concerns of the present, few historical geographers have fol- lowed with enthusiasm. in the new western his- tory, the values of historians past and present become an explicit part of the study. because a mythology of the west is such an important part of the self-consciousness of the people of the u.s., this questioning of values has been contentious. making the circle virtuous the frontier has been the central feature of the historiographical and mythological connection between landscape and identity in the u.s. in gunfighter nation, slotkin charts the continual reworking of the frontier myth in american poli- tics and culture during this century. according to slotkin, the prevailing version of the frontier thesis has not been that of frederick jackson tu r n e r, b u t o f u. s. p r e s i de n t t h e o d o r e roosevelt. while turner stressed the impor- tance of democratic processes in frontier farming communities, roosevelt emphasized the earlier stage of the hunter securing space against “sav- agery.” it is roosevelt’s account of the origin of truly american values that has held sway in the political culture of the u.s.: a legacy of conquest, race -war, and colonialism. slotkin writes: “[w]hile turner locates the crucial dynamism in a democratic collectivity, roosevelt locates it in a successive class of heroes emerging from the strife of races to earn a neo-aristocratic right to rule” ( : ). there are, then, different values and conceptions of the good polity, and different stories are available to support them. slotkin’s analysis highlights these tangled but important connections between description and prescrip- tion, between is and ought; his work thus raises the complex question of the place of values in scholarly inquiry. most scholars today would agree that theoreti- cal categories are imbued with normative con- cerns. my interest is in making the circle between facts and values a virtuous one. in other words, what we learn about the world should inform our choice of appropriate political and moral stances. beyond the most basic of commitments, moral and political questions frequently rest on certain claims about how the world (or society) works. similarly, we need to set up theoretical categories so that we can draw ethically relevant conclu- sions from our studies. as hirst ( ) has ar- gued, blanket charges of relativism or objectivism can help us little here, for neither position is defensible or operationalizable. where two ac- counts of the same aspect of social reality are in empirical contradiction, it will not do to defend their incompatibility on the grounds of political or theoretical pluralism, nor will it do to resolve the contradiction by appealing to one’s affinity with the theoretical or empirical position of either writer of those accounts. doing so places political and theoretical concerns beyond empirical em- barrassment. unless our politics and theory are vulnerable when they engage with the empirical world, they can have little purchase on that world. the relativist might claim that empirical work cannot decide moral issues, and thus a kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t plurality of political and theoretical positions must be allowed. yet to claim that empirical work has nothing to contribute to the evaluation of political strategy is to sever the link between utopia and reality in a way that is politically dangerous and contradicted by the evident em- beddedness of all political movements, including new social movements. that embeddedness should be a matter of reflection, not denial. on the other hand, for the objectivist to suggest that one’s moral outlook should not dictate one’s sub- stantive work is also a dogmatic evasion of the dialectical interplay with which we are concerned here. i agree that empirical work cannot be judged on the basis of the political or moral sign under which it has been written. something is not to be judged as true or false simply because we agree or disagree with the political spin the writer places upon the study or even with the spin which, in a spirit of “hermeneutical suspicion” (jones : ), we imagine the writer incites us to place upon the study. it would, however, be impossible to sustain the claim that intellectual agendas are not shaped by theoretical preconcep- tions. there is a middle ground between objectiv- ism and relativism where facts and values meet, mingle, and mutually reinforce or contradict one another. we need to negotiate the middle ground, and it is here that the new western history offers some instructive examples of a virtuous circle of facts and figures (see figure ). the vanguard in this essay, i examine the relations between normative and empirical concerns in the work of perhaps the four most prominent of the new western historians, “the vanguard” (shoemaker : ): cronon, worster, white, and limer- ick. by explicating the moral concerns of their work, i intend to further explain how their nar- ratives are structured and thus open a critique that shuttles between facts and values, examining their necessary interdependence. the vanguard new western historians, by engaging with the political purposes of environmental history, ex- emplify the interdependence between facts and values in ways that are directly relevant to geography. each of these historians is concerned with environmental history in one form or another. cronon and worster may be paired as concerned with the politics of nature, while white and lim- erick are both concerned with the nature of poli- tics itself. i begin my analysis by examining figure . the virtuous circle of facts and values. the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t cronon’s differences with marxism, showing that divergent political concerns produce narratives with contrasting emphases. marx’s labor theory of value is normative in much the same way as cronon’s natural theory of value. both embody empirical claims about the world, which in turn inform political choices. there are both empirical and political contrasts between cronon and marx. i am unwilling to dismiss cronon as “ideo- logical” and “wrong” simply because he is non- marxist and thus “unscientific.” i am also denying myself the comfort of simply celebrating the di- versity of perspectives and stories. i argue that there are real differences of substance between the explanations that cronon and marx offer of the central dynamic of the colonial american economy. there are conflicting factual claims in their work that i will highlight but not claim to resolve. i then turn to the conceptions of nature, science, and capitalism in the work of worster, who is likewise concerned to establish his dis- tance from marxism. i argue that his work is based on an unhelpful demonization of tech- nology and a poorly explored vision of an alter- n a t i v e p l a u s i b l e p r e s e n t t h a t w e m i g h t conceivably inhabit. again, i argue that there are both empirical and political claims at stake here and that we can meaningfully examine their interrelations. although, like cronon and worster, white and limerick have written what might be termed environmental histories, their political concerns are less well defined as “green.” over time, white has become more explicitly concerned with questions of justice, while limerick has increasingly focused on issues of regionalism and citizenship. white is acutely aware of the dialectic between facts and values, although in drawing attention to the provisional nature of the first and the multiplicity of the second, he is keen to avoid subordinating his empirical studies to the advocacy of any particular politi- cal position. nevertheless, there is some merit in making the interconnections between facts and values a central feature in evaluating his work. his use of the metaphor of the “middle ground” invites this sort of framing of his exem- plary narratives. where white is reticent, or at best guarded, about making specific connections between nor- mative and empirical concerns, limerick is clear and unambiguous. she wants both to sustain a distinct regional consciousness in the southwest u.s. and to claim for it a heightened awareness of the multiple claims to citizenship that the history of the region allows its diverse residents. this attention to the specificities of a particular region means that, for her, the west is most definitely a place rather than a process. in this, limerick stands apart from the way cronon treats the west. for cronon, the west is a term to describe the incorporation of new territories into the emerging federal u.s. the claims of process treat the whole of the u.s. as a relevant, if changing, spatial entity. in this way, cronon can even present the study of colonial new england as part of the same frontier story. for limerick, as we will see below, this residual frontierism in cronon bespeaks a geographical bias that treats american history as having one privileged trajectory, that from the east coast to the west. instead, she claims only to be able to understand the multiculturalism of the southwest u.s. by giving equal attention to his- panic movements from the south and native american displacements to the north, as well as to the traditional frontier movement from the east. in her attention to the southwest as a dis- tinctive place, she is particularly interested in the ways that engaged art can both express historical lessons and enliven regional consciousness. a concept of citizenship serves as a yardstick, allow- ing these lessons to be drawn in her own historical writing. norms and utopias finally, i conclude by connecting the world of facts and values around the realms of norms and utopias. the connections across this pair of po- larities inflect each other. we judge the past be- cause we think it helps us to make the case that things might be different in the present. there would be no point judging the past were the course of history inevitable, fully determined, or located only in the past. thus there is a connec- tion between a belief in plausible worlds for the future and the exploration of counterfactuals in history. this is the form that historical lessons often take. furthermore, our belief in possible alternative presents and futures informs our po- litical commitments and attendant strategies (hawthorn ). yet such strategic thinking rests upon the feasibility of the alternatives we propose. historical work is one way of exploring questions of feasibility. because we think we understand why various options were closed kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t down in the past, we achieve some sense of the difficulties that might attend their pursuit in the present. these are not the only ways that political thought can be advanced, but they remain useful ones. stories about space, environment, and regions are central to many aspects of political identity and manifest destiny—which is to say that geographical imaginations shape political ones. this is a dialectic to which the new western history directs our attention, and it is quite proper that we should attend to it. theories of value william cronon is an environmental historian with strong connections to geography. among other things, he holds a joint appointment in history, geography, and environmental studies at the university of wisconsin-madison and is on the editorial board of the journal of historical geography. his two monographs, changes in the land and nature’s metropolis, concern, respec- tively, the transformation of the environments of colonial new england and of the hinterland of nineteenth-century chicago. both books are concerned with the frontier process that has been so important to the u.s. experience. he has writ- ten extensively on environmentalism, conserva- tion, and the idea of the west as a process rather than exclusively a place. the commodification of nature in all sorts of ways, cronon’s work displays a friendly respect for marxist scholarship. indeed, many of his central categories sound very marx- ist: capital, exploitation, value, and commod- ity, to name a few. changes in the land is, among other things, an account of primitive accumu- lation in new england. nature’s metropolis is, again among many other things, an examina- tion of the cultural consequences of the com- modification of nature. i want to begin, however, by establishing as irreducible and legitimate the different strategies between cronon and marx, after which i will explore the terms on which the two frameworks may be usefully brought to en- gage one another. marx’s politics aimed at the liberation of labor, whereas cronon develops a politics based on the central importance of na- ture. marx subscribed to a labor theory of value, whereas cronon is committed to a natural theory of value. for cronon, people’s relations with nature are dramatically reorganized through com- modification: the net result [of the commodification of nature] was to redefine the resources of the alaskan land- scape, pushing them beyond the needs of local sub- sistence into the realm of the market, where any good could be transformed into any other. at the same time the act of economic consumption came to be increasingly separated from the place of eco- logical production, distancing people from the con- sequences of their own acts and desires. a kind of alienation from nature was the inevitable result ( b: ). it is this alienation from nature that allows people to consume nature without paying any heed to environmental consequences. for cronon, this is a pressing concern: “[l]ike other environmental- ists, i am troubled by the many ways in which people alienate themselves from the natural world on which their lives depend” ( a: ). such a reading of alienation is related to but not quite the same as that of marx, who described how the commodification of labor power alienated workers from the products of their labors, which now confronted them as autonomous commodi- ties owned by others: [t]he worker is related to the product of his labor as to an alien object. . . . the worker places his life in the object [the commodity]; but now it [his life] no longer belongs to him, but to the object. . . . the externalization of the worker in his product means not only that his labor becomes an object, an external existence, but that it exists outside him, inde- pendently of him and alien to him, and begins to confront him as an autonomous power; . . . the life . . . bestowed on the object confronts him as hostile and alien ( [ ]: ). for marx, capital is a social relation of produc- tion rather than a physical factor of production. given a social arrangement where the means of production are privately owned as property by capitalists, while human work to produce goods is done by the propertyless, capital is the where- withal for employing wage labor. because the commodities the laborer produces belong to the capitalist, the process of production not only re- sults in the alienation of the worker; it also repro- duces the social relations of the propertied and the propertyless: the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t since the process of production is also the process of the consumption of labor-power by the capitalist, the worker’s product is not only constantly con- verted into commodities, but also into capital, i.e., into value that sucks up the worker’s value-creating power, means of subsistence that actually purchase human beings, and means of production that em- ploy the people who are doing the producing. there- fore the worker himself constantly produces objective wealth, in the form of capital, an alien power that dominates and exploits him; and the capitalist just as constantly produces labor-power, in the form of a subjective source of wealth which is abstract, exists merely in the physical body of the worker, and is separated from its own means of objectification and realization; in short, the capital- ist prod uces the worker as a wage -laborer ( [ ]: ). furthermore, for marx, “value” is the form of worth of a commodity in relation to other com- modities, what it can be exchanged for in mone- tary terms. this is in contrast to its “natural form,” what it can be used for ( [ ]: ). the difference between what the inputs to the pro- duction process can be exchanged for and what the outputs from the production process can be exchanged for is the value-added in production. this value added by work is the value of labor. it equals the wages paid to the worker (which are used to meet the worker’s subsistence needs, to reproduce the worker’s capacity for labor, also known as variable capital or the exchange value of labor power) plus the surplus value which accrues to the capitalist (pp. – ). given a circumstance in which production rests upon capitalist relations, the source of value, then, is labor. this is what the value form, as opposed to the natural form, is measuring. the value of the material inputs to the production process, then, equals the labor embodied in their earlier produc- tion, the value of dead labor. for cronon, however, capital takes on a dis- tinctly green hue. in nature’s metropolis, he writes that chicago’s growth rested upon the exploita- tion of the natural abundance of the prairie. he concludes that: “[m]uch of the capital that made the city was nature’s own” ( : – ). this, he tells us, is where value comes from. cronon also remarks that, from an ecological point of view, marx’s relations of production might better be seen as “relations of consumption, since all human labor consumes ecosystemic energy flows in the process of performing physiological and mechanical work” ( : ; emphasis in origi- nal). production, then, rests on a set of nonhu- man energies and resources that have value. cronon concludes that we “have to assign a much larger role to nature in the creation of such use value” ( : ). this belief shares similarities with but is differ- ent from marx’s formulation. in taking issue with marx, cronon is asserting one normative concep- tion of value against another: alienation from nature, not alienation of labor; natural capital, not capital as dead labor; a natural theory of value, not a labor theory of value. furthermore, cronon is quite explicit about the need for history to articulate such normative concerns, suggesting that “[i]t is because we care about the conse- quences of action that narratives—unlike most natural processes—have beginnings, middles, and ends” and that “[t]he difference between beginning and end gives us our chance to extract a moral from the rhetorical landscape. our nar- ratives take changes in the land and situate them in stories whose endings become the lessons we wish to draw from those changes” ( c: ). it is no real answer to cronon simply to show that all the points he makes are recoverable within the orthodox marxist account, by, for example, arguing that using up the natural abundance of the prairie might be understood through the concept of differential rent and its d e t e r m i n a t i o n b y s o i l f e r t i l i t y ( m a r x a[ ]: – ). nor is it enough to show that marx drew a distinction between value and use value ( [ ]: – ) that precisely captures cronon’s distinction between labor and nature. cronon and marx provide parallel though compatible accounts based on parallel but irreducible value orientations. marx was con- cerned with a utopia in which the control of labor power would be taken from the capitalist and returned to the worker: “[l]et us . . . imagine, for a change, an association of free men, working with the means of production held in common, and expending their many different forms of labor-power in full self-awareness as one single social labor force” ( [ ]: ). it is this vision, the possibility of which marx saw as im- manent in contemporary social trends (and thus as a plausible utopia), that shaped marx’s indict- ment of the capitalist relations of production under which his laboring contemporaries were starved, broken, humiliated, and reduced. cronon is likewise focused upon a better world, one where ecological sustainability and respect for all life, human and nonhuman, is paramount. his vision rests upon a sense of place, a commit- kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t ment to the local world as our home, and a recognition that we are engaged in a continuous dialogue with the earth we live in: “[h]owever we come to our love of the land . . . the important thing is that we learn to care for it as more than an abstraction. . . . the great challenge we face is to do right by the land we have made our own” ( – : ). to draw attention to the im- perative to respect nature, cronon organizes his work around a theory that valorizes nature in the present. cronon and marx thus offer two different analyses of society’s central problems, different agendas for change, and different theories of value. the natural theory of value in cronon’s work demands an intellectual engagement with society’s central problems and not just the asser- tion of a purer marxist alternative (pace merchant ; pudup ; page and walker ; saun- ders and marston , see below). in other words, even if the labor theory of value can save the phenomena cronon highlights, it does not follow that marxist theory is thereby vindicated. given the irreducibly normative content to what we find interesting about the world, it should be clear that i cannot agree with those who bemoan the fact that nature’s metropolis does “not quite add up to a general analysis of the spatial and ecological effects of nineteenth-century capitalism in a vast, inviting tract of the new world where, through much of a century, capitalism held a particular sway” (harris : ). the dream of a politique totale is as chimerical as that of an histoire totale. i cannot agree with those who assert the theoreti- cal priority of issues of labor over those of ecology by invoking the fact that “[f]or marx, labor and nature are ‘identical expressions’ such that the exploitation of labor (human property) is insepa- rable from the exploitation of nature” (saunders and marston : ). merchant’s observa- tions are more on target: “[b]y bracketing the relations of production, cronon’s critique of the market is limited to its ecological costs. . . . [t]he ultimate outcome of the bracketing of the rela- tions of production . . . is an embracement of green capitalism. the main conclusion that we as readers are left to draw is an implied admonition that the commodification of nature must some- how be made environmentally sound” (merchant : ). on grounds of both political strategy and empirical adequacy, there may be reasons to contest the particular focus of nature’s metropolis, but it can hardly be done in the name of some other all-encompassing position. it is difficult to avoid cronon’s exasperation: all narratives are partial. all succeed by ignoring vast stretches of reality. all distort the world with their selectivity. there are no genuinely totalizing narratives, just narratives that deceive their readers an d listene rs into believ ing they are such ( a: ). nor can we avoid his claim that you might easily substitute “theory” for “narrative” in the above quotation. marx and cronon on primitive accumulation i recognize that the different normative con- cerns of marx and cronon frame different ways of looking at the world. different things are val- ued and brought into focus. here i turn briefly to the engagement with marxism in cronon’s earlier changes in the land. one thing this book offers is an account of ecological transformations of new england by european farmers. here cronon ar- gues that “economic and ecological imperialisms reinforced each other” ( : ), resulting in environmental degradation. as the new england farming economy moved from a seventeenth- century subsistence base to a market-driven nineteenth-century system in which resources were treated as commodities rather than as pro- viding subsistence (p. ), the effects on nature became more marked. these, in turn, reacted upon the economy: “[e]cological pressures brought on by overgrazing and inadequate forage reinforced economic incentives flowing more di- rectly from market demand: together, the two impelled colonial movement onto new lands” (p. ). this might appear, once again, to be little more than cronon insisting on the impor- tance of ecology to supplement alternative ac- counts that focus simply on labor. at points, cronon suggests as much: [n]ot only colonial agriculture, but lumbering and the fur trade as well, were able to ignore the problem of continuous yield because of the temporary gift of nature which fueled their continuous expansion. when that gift was finally exhausted, ecosystems and economies alike were forced into new relation- ships: expansion could not continue indefinitely (p. ). yet cronon has an economic explanation for this attitude toward nature. he argues that new en- the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t gland was an economy in which labor and capital were scarce and land was substituted for both: “[l]and in new england became for the colonists a form of capital, a thing consumed for the express purpose of creating augmented wealth” (p. ). it appears here that attitudes toward nature are being explained by way of a neoclassical account of the economy in terms of the return to immo- bile, inconvertible factors of production. yet, within such a neoclassical framework, if capital was scarce, why did not the rate of interest rise to the point at which funds would have left the european economy and been invested in new england? if labor was scarce, why did not wages at the frontier swell to the point where labor would have been lured away from european town and country? the answer is, of course, that per- fect mobility of factors of production is a highly unrealistic assumption for colonial new england. this recognition highlights the institutional and material setting of production that rarely surfaces in neoclassical accounts. even within that neo- classical framework, capital and labor scarcity might as easily be explained in terms of the low price of land that encouraged an extensive system of production. but that price, in turn, reflected a political situation in which resources could be taken from native americans at little cost to the settlers themselves, returning us once again to the material and institutional context. the costs of setting up this sort of farming economy were borne in large part by the government as a military expenditure. writing of the settling of the ohio valley, aron notes that between and , eighty percent of the federal budget of the u.s. was spent on war with the native americans of ohio ( : ). in contrast to neoclassical economics, marx was very interested in the institutional setting of what he termed capitalist relations of production. instead of factors of production, he directs atten- tion toward the political and social preconditions of the appearance of “things” as factors. it is in this sense that one may speak of cronon’s changes in the land as being about primitive accumulation—the process whereby these pre- conditions are realized. without them, inde- pendent, subsistence farming is the more likely arrangement. marx described how edward wake- field’s studies of colonization led wakefield to an appreciation of the social prerequisites for the existence of capital: wakefield discovered that, in the colonies, property in money, means of subsistence, machines and other means of production does not as yet stamp a man as a capitalist if the essential complement to these things is missing: the wage-laborer, the other man, who is compelled to sell himself of his own free will. he discovered that capital is not a thing, but a social relation between persons which is mediated through things. a mr. peel, he complains, took with him from england to the swan river district of western aus- tralia means of subsistence and of production to the amount of £ , . this mr. peel even had the foresight to bring besides, , persons of the work- ing class, men, women and children. once he ar- rived at his destination, “mr. peel was left without a servant to make his bed or fetch him water from the river.” unhappy mr. peel, who provided for every- thing except the export of english relations of pro- duction to swan river! ( [ ]: – ). marx went on to offer an explanation of these colonial conditions different from that of cronon: we have seen that the expropriation of the mass of the people from the soil forms the basis of the capitalist mode of production. the essence of a free colony, on the contrary, consists in this, that the bulk of the soil is still public property, and every settler on it can therefore turn part of it into his public property and his individual means of produc- tion, without preventing later settlers from perform- ing the same operation. this is the secret both of the prosperity of the colonies and of their cancerous affliction—their resistance to the establishment of capital ( [ ]: ). this, it seems to me, is a more adequate ac- count than one which takes the relative scarcity of the different factors of production for granted. it offers a description of how such a state of affairs arose and, moreover, highlights the institutional and geographical arrangements under which matters would soon fall out differently. if cronon wanted to offer a neoclassical explanation of at- titudes to nature, he would have done better to focus on the price of land than the scarcity of capital. but if he wanted to examine the links between ecological and economic imperialism, then marx’s emphasis on capital as a social rela- tion rather than a factor of production is more adequate than an emphasis on scarcity of land or capital. what cronon adds to marx before i leave this discussion of the relations between green and marxist critiques of capital- ism, i want to comment briefly on what cronon adds to marx’s account. first, cronon is correct kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t to note that marxists pay relatively little attention to the feedbacks from nature to society. in fact, historical materialists generally display a disturb- ing lack of interest in the organization of the material basis of society, be it in terms of ecology, demography, or communications (kearns b: ). the precise consequences of this will vary from case to case, but in the case of colonial new england, a failure to recognize the extent to which the uses made of the land by early colonists proved unsustainable would indeed compromise any account of the dynamics of the agricultural economy. second, cronon is also correct to prise apart the effects of the proletarianization of labor and of the commodification of nature in his ac- count of the expansionary dynamic of capitalism. marx conflates the two in his analyses of agricul- tural capitalism in volume of capital ( [ ]:chs. – ). cronon describes a transi- tion from a subsistence to a capitalist economy in new england between the seventeenth and nine- teenth centuries: [m]ost early farmers owned their own land, hired few wage laborers, and produced mainly for their own use. markets were hemmed in by municipal regulations, high transportation costs, and medieval notions of the just price. in none of these ways does it seem reasonable to describe colonial new england as “capitalist” ( : ). from the seventeenth century, resources began to be seen increasingly as commodities: although an earlier english meaning of the word “commodity” had referred simply to articles which were “commodious” and hence useful to people . . . that meaning was already becoming archaic by the seventeenth century. in its place was the commodity as an object of commerce, one by definition owned for the sole purpose of being traded away at a profit (p. ). items such as fish, furs, and timber were increas- ingly seen as commodities, valued not for the immediate utility they brought their possessors but for the price they would bring when exchanged at market. in trying to explain ecological changes related to these commodities, we can safely point to market demand as the key causal agent (p. ). it would appear that this market orientation is independent of the existence of generalized wage labor. in other words, capitalist forms of calcula- tion and profit, and the production of commodi- ties by commodities, can proceed on the basis of owner-occupiers and can have dramatic ecologi- cal consequences, even while the economy is not yet organized on the basis of universal wage labor. this view has implications for the account of agrarian capitalism in capital. marx’s emphasis on the subordination of labor to capital led him to theorize the emergence of english agrarian capitalism primarily in terms of the emergence of agricultural wage labor during the seventeenth and eighteenth centuries. yet, in terms of the production of commodities by commodities and the demonstrable effects that this had on patterns of land use, there is no need to tie the emergence of capitalist calculation in production to the availability of wage labor. this theoretical point has important implica- tions for empirical, historical accounts. there has been a tendency for marxist historians to illus- trate marx’s claims about the development of agrarian capitalism rather than to consider the central assumptions on which his argument rested. in fact, in the history of english agricul- ture, there was indeed a separation, historically, between the widespread organization of farming as the production of commodities by means of commodities, and the emergence of wage labor as the primary form of work in agriculture. empiri- cally, the former did not always imply the latter. tribe argues that: capitalism can be briefly summarized as a form of economy in which consumption is separated from production, enterprises are separated and in a state of competition, and the national economy is co- ordinated according to the profitability of the com- modities sold by enterprises. . . . in principle, then, the “capitalist farm” could be either a large farm in which a farmer supervises wage-laborers, or a family farm in which family labor is supervised by a house- hold head: the absence of wage-labor does not mean that a farm is non-capitalist ( : ). cronon’s identification of the commodification of nature as the prelude to the transformation of nature by economic and ecological imperialism is a more satisfying explanation than one which saw the process of primitive accumulation as being primarily one involving the commodification of labor power. with time, the further development of the productive forces in agriculture is incon- ceivable without the exploitation of wage labor. given private ownership of land, the pursuit of scale economies in the use of machinery and other expensive inputs requires a large agricul- tural proletariat. given the technological ar- rangements of nineteenth-century agriculture, the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t for example, a point would be reached in devel- oping the land productivity of agriculture where wage labor would be an essential prerequisite. this land-intensive option becomes unavoidable once the supply of so-called “free” land is re- stricted or when land values rise for some other reason (for example, by reason of the competition for the locations most accessible to market). in some ways, then, the labor theory of value and the natural theory of value imply not only different political projects but also different sets of empirical blindspots. when they are deployed in the explanation of essentially similar phenom- ena (in this case, the ecological consequences of land-use practices in new england), we can evaluate the effects of these empirical biases. cronon’s normative concerns look toward a bet- ter world where people forge a meaningful rela- tionship with the place in which they live, allowing them to cherish its natural setting and thus sustain its natural value. the bête noire of his story of colonial new england, then, is the attitude of colonial settlers to the land which he sees as the result of its commodification. these normative concerns bring certain issues into fo- cus and leaves others in the shadows. certain facts are prioritized, and others are relegated. the crediblity of cronon’s vision of a better world must rest to some extent on the adequacy of his diagnosis of the causes of the environmental problems he describes. if things did not turn out the way he describes for the reasons he gives, then we might wonder whether they would get better if we worked for a society organized around the values he espouses. cronon prioritizes the de- struction of natural value, species variety, and numbers. for cronon, commodification con- founds the sustainability implicit in subsistence economies. imperial ecology and capitalism over the past two decades, donald worster has been one of the most influential environ- mental historians in north america. his studies in the history of environmental ideas have gained an academic and popular audience. his two main historical monographs have concerned the eco- logical disasters of the dust bowl and the extrac- tion of the waters of the colorado for the benefit of some of the people of california. among the new western historians, none has been more explicit about the normative basis of their cate- gories than worster. in the case of worster, we can trace the full virtuous circle from facts to values and back again. worster is opposed to the human domina- tion of nature. he believes that being in harmony with nature would promote a natural egalitarian- ism and a form of social solidarity rooted in the recognition of ecological interdependence. this is the basis for his attack on the exploitation of nature that he finds in what he terms, following wittfogel ( ), the hydraulic society of the western u.s. by a hydraulic society, worster means one in which the taming of rivers provides the central resource for agriculture and energy: there is no freedom for nature itself, for natural rivers as free-flowing entities with their own integ- rity and order. . . . there is nothing harmonious, nothing picturesque about the western world that has developed beside the irrigation ditch. there is little peace or tidiness or care, little sense of a rooted community. there is no equitable sharing of pros- perity ( : , ). he distances himself quite explicitly from marxism. criticizing carey mcwilliams’s ( ) “standard leftist analysis” of the economy and society of california, in which mcwilliams highlighted the inequality and exploitation intrinsic to a capitalist order, worster writes that mcwilliams: [f]ailed to make room for nature, either as a histori- cal actor or as a moral issue. in that respect, leftists were no different from capitalists, both standing for the conquest of the natural world, and their visions of the future tended to converge toward the same technological utopianism. . . . his marxist-like logic tells mcwilliams that private property, not the domination of nature, is the source of all abusive power, and in agriculture, he assumes, private prop- erty must mean private, concentrated land- ownership . . . put the new-fangled hydraulic society under socialism, he suggests. make nature obey the dictates of collective ownership, and the west will be set right. power will then belong to all the people, which is to say it will cease to be a social problem ( : , ). for worster, such suggestions are a pipe dream, for domination over nature will always lead to the inequitable domination of some people over oth- ers, to ecological vandalism, and to a slight upon the integrity of nature. kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t the arcadian view of nature worster’s analysis is a cultural critique of sci- ence and capitalism. on one hand, worster criti- cizes what he terms an imperialist attitude to nature and, on the other, he rejects capitalism as a basis for organizing economic priorities. for worster, the societies of europe and north amer- ica are characterized by a fundamentally imperial attitude toward nature (see table ). nature is seen as a mechanism to be adjusted for the short- term productivity needs of society. the fullest development of this view of nature is about three hundred years old and provided the intellectual roots of industrialization. there is an older, more benign, view that worster terms arcadian. in contrast to judeo-christian societies that treat nature with technological arrogance, seeing the natural world as little more than a mechanical order, pagan, arcadian views cultivate an atti- tude of humble wonderment in the face of the unity in diversity of our ecological home. for arcadians, nature means beauty and life, best understood through natural history. it is not to be understood, as it is by imperialists, as little more than a set of resources to be mastered through laboratory science. arcadians take a romantic rather than a positivistic view of nature and aim at stability and conservation rather than at indus- trialization and the maximum use of energy (as is said to characterize the imperialists). cronon draws a helpful distinction between the narrative forms through which arcadians and imperialists express their visions of nature. he detects tragedy in the arcadian view, a falling from grace, and he notes the emphasis on progress in imperialist narratives. worster dislikes imperialism with a vengeance: “we have had enough of imperialism. . . . in this age of deadly mushroom clouds and other environmental poisons, i believe it is surely time to develop a gentler, more self-effacing ethic toward the earth” ( : ). alongside imperi- alism, the second criminal in the dock is capital- ism, defined as business attitudes, “a core of values and assumptions,” and “an enduring ethos” ( : ). for worster, imperial ecology and capitalism were responsible for the dust bowl (see figure ). both capitalism and imperialism promoted the idea that nature had no limits. america’s eco- nomic culture “never recognized any limits nor restrained the appetite for gain” ( : ), while americans’ “faith in the benignity of nature” (p. ), their belief that humanity “is a sovereign creature, independent of the restraints that plague other species” (p. ), and their expecta- tion that technological fixes could restore any temporary loss of land productivity (p. ), to- gether reinforced the idea of an irrepressible economy and a boundless natural bounty. but disasters such as the dust bowl should “challenge a society’s capacity to think” and “require it to analyze and explain and learn from misfortune” (p. ). yet the u.s. proved immune to ecological education. ameliorative government actions such as those begun in by the farm credit administration (p. ) and agricultural adjust- ment administration (p. ) froze landholding table . theories of naturea arcadian imperial spirituality pagan judeo-christian attitude to nature humble wonderment technological arrogance conception of natural order unity in diversity, mechanism of detachable parts, organic synthesis mechanical reductionism meaning of nature beauty, life productivity, resources route to understanding natural history laboratory science cultural forms naturalism, romanticism humanism, positivism practical implications conservation industrialization ecological yardstick “climax” stability trophic energy, efficiency narrative form for tragedy progress describing modernization (after cronon c) aafter worster ; cronon c. the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t arrangements, preventing even that rearrange- ment the market might have induced (pp. , ), while the soil conservation service sus- tained the resumption of environmental vandal- ism (p. ). at no point did the government “begin to touch the commercial mode of farming” (p. ). a capitalist ethic continued to prevail. a communitarian vision in more recent work, worster has moved beyond this attack on business values to articu- late a communitarian vision of a decentralized anarchist utopia (although, as far as i am aware he has not discussed this specific political philoso- phy in any detail). this value orientation informs a normative conception of democracy and auton- omy that presents big government and laissez faire as the twin evils sustaining the imperial view of nature. he has also subsequently introduced sharper ecological sensitivity into the picture, discussing both a pastoral mode of production, or “cowboy ecology” ( a), and a hydraulic mode of production ( b) in the western u.s. in the pastoral mode of production, only local control and entrenched traditions can solve the problem of overgrazing: the safest strategy over the long run appears to be one that opens decisions about using the range to as many people as possible. the most stable systems of grazing have been those in which the experience, knowledge and moral pressure of a whole community guided the individual grazier ( a: ). neither laissez faire nor remote central govern- ment succeeded in preventing overgrazing on the great plains in the s. worster’s case is clear and is readily subject to consideration both as a political blueprint (can we get to anarchist com- munitarianism from here?) and as a plausible counterfactual (were nucleated alpine-style vil- lages a realistic option on the sparsely populated great plains?). in his dust bowl, worster scans the southern plains for alternative ways of making a living on the land. he believes that what is required is some sort of ideological vaccination against the blan- dishments of capitalist, modern society. only when land ceases to be seen as a commodity, and only when community is identified in some strong sense with the land itself, can true ecological adaptation develop: when both the identity of self and community become indistinguishable from that of the land and its fabric of life, adaptation follows almost instinc- tively. . . . this is genuine adaptation, and it implies much more than shallow managerial skill. it comes from having a sense of place, which is at once a perception of what makes a piece of land function as it does and a feeling of belonging to and sharing in its uniqueness ( : ). this is suggestive rather than persuasive, since instinctive adaptation remains unexplained. nevertheless, the exploration of once-existing and perhaps even still-surviving alternatives is an important way of bringing empirical concerns to discussion of values. this is what yeo recognized when he wrote that: z figure . the dust bowl (after worster ). kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t from a conservative point of view, one uninterested in change or in history except as a ratification and celebration of the present, attempts are always being made to collapse “ways of life” into a single “society” or “system.” and then the way is open to say that the ways we meet, define, multiply or divide needs, constitute a single “culture”—“our” way of life, the system. . . . the function of so doing is to remove from view ownership, power, struggle, interests. it is to conceal alternative, latent potentials and achievements, in the interests of existing, manifest facts and ideologies. above all, it is to devalue memory and collectivization in history. competi- tion and struggle involve loss and defeat as well as growth: presents involve running over unrealized but partly surviving pasts and temporarily blocked futures ( : ). in this sense, the most radical pages of dust bowl may be the brief remarks upon the farming successes of the mennonites. worster contrasts the mennonites and moral puritanism, both of which he sees as forms of resistance to modern capitalism that promised to build new relations with the land in the hope of instinctive adapta- tion. he is impressed with the mennonites, who: “[i]n their communalism, their stability, their careful husbandry, and their high degree of self- sufficiency . . . presented some alternative an- swers to the challenges of the dust bowl thirties” ( : ). on the other hand: nurtured by itself, a moral rigidity toward booze and sexual freedom—and that was essentially all puri- tanism here meant—was not equivalent to a genu- ine indigenous cultural base. it contributed nothing to environmental adaptation, nothing to a sense of place. in fact, it worked to mask the extent to which those things were lacking (p. ). yet many other religious groups also failed to establish viable farming communities. worster would presumably not be comfortable with the observation that the mennonites were simply better farmers than the rest (white b: ), but these few brief pages do not really provide a causal explanation of how religious ideas, a genu- ine indigenous cultural base, and instinctive eco- logical adaptation are related. for bogue, the crucial advantage of mennonite communities was not a different attitude to the land but, in- stead, a strain of winter wheat they brought with them to the u.s. from russia (bogue : ). szasz and szasz remark on the mutability of men- nonite institutions in the u.s., noting that, rather than a response to the physical environment, it was the more tolerant political and cultural envi- ronment that encouraged many mennonites to forsake banding together in tight communities in favor of a more dispersed settlement pattern: “although some branches of mennonites re- tained the communal emphasis, the majority be- came individual farmers” ( : ). resisting the hydraulic society in his few pages on the mennonites, worster fails to deliver on his promise to draw persuasive lessons from the historical study of alternatives to modern capitalism. neither does worster begin to explain how resisting the modern age might be made attractive to americans. elsewhere he has promised that “[a] stable rural society in equilib- rium with the processes of nature cannot allow much freedom or self-assertiveness to the individ- ual” ( b: ). he does not flinch from spelling out the full implications of properly recognized ecological constraints: of course, all those restraints put a ceiling on the amount of private wealth that any one person in the community can accumulate. they limit creativity. they make rural life conservative and hidebound. but they prevent most of the failures caused by misjudgment, egotism, ignorance, ambition, experi- mentation, excitement, and fantasy (p. ). nevertheless, worster’s use of history to explore alternatives to imperial ecology is an intriguing way to connect facts and values. in a recent paper, worster called for a history of adaptation to na- ture rather than of its technological conquest: [i]f nothing else [it saves] us from gloom and exces- sive pessimism. we need new kinds of heroes, a new appreciation of nature’s powers of recovery, and a new sense of purpose in this region—all of which means we need a new past, one with the struggle for adaptation as its main narrative, one that regards successful adaptation as a kind of heroism too ( c: ). it is in his account of the hydraulic society of the great west (another conquest narrative) that worster’s political values are most prominent. here he makes an explicit case that the drive to dominate nature inevitably entails dominating people (harvey ). he employs wittfogel’s hydraulic civilization and horkheimer and adorno’s instrumental reason to define a political economy of science in which decentralized com- munitarianism has no chance to survive, but yet the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t stands out all the more starkly defined as the utopian alternative to technology gone mad and nature laid to waste. this thumbnail sketch does scant justice to the verve and panache of rivers of empire. nevertheless, i want to high- light a few of the empirical and conceptual difficulties to which this particular normative framework gives rise. first, the notion of ecological stability by which the hydraulic empire is found wanting is problem- atic. worster notes the difference between euro- american and native american attitudes to nature, suggesting that the native peoples of the plains might have delivered the following lesson to the early euro-american settlers: “[f]irst con- trol your numbers . . . then simplify your wants and see the earth as everybody’s mother rather than as a piece of property to be divided by competing individuals” ( : ). but worster sees the ecological sustainability of native ameri- can food demands as leaving so light an impress upon the land that it was almost as if they were not there at all. in a testy response to the claims of pyne, who, he said, wanted “to reduce all environmental history, preindustrial and post- industrial alike, to a common pile of ashes” ( b: ), worster is impatient with the claim that the american environment in the west had been substantially altered before the arrival of euro-americans: “without bogging down in pe- dantic wrangles over definitions, we can say that before contact the native peoples were dwelling on a largely undomesticated continent, wild or nearly wild over much of its extent” ( a: ). unless the environment was at climax stability beforehand, the destructive impact of imperial- ism would be difficult to register. as willems- braun ( ) notes, this marginalizes native peoples by placing them at a traditional pole outside the challenges and possibilities of moder- nity, while also corralling them in village spaces detached from a pristine nature too easily pre- sented as a freely available suite of resources upon which no prior claims have been made. but wal- ton is persuaded that paiute native americans, at least in owens valley, california, were practic- ing irrigated agriculture ( : – ), and even if pyne exaggerates the effects of fire, it seems easier to acknowledge the importance of fire than to dismiss it altogether. worster’s conclusion is questionable: “after several thousand years of [native american] habitation, the [great] val- ley’s ecological order was still more or less intact” ( : ). worster himself has noted the difficulty ecologists now have with concepts of climax and equilibrium ( : , b), but the impor- tance of these concepts to rivers of empire is clear. even if partly correct, worster’s suspicion that much of the attack on what he sees as ecological verities is motivated by a right-wing social dar- winist backlash against conservation offers little security against the empirical arguments ad- vanced. the second problem with the analysis con- cerns the lack of any serious attention to resis- tance. worster maintains that both localities and nature are crushed by the juggernaut of big busi- ness and big government. the only resistance he can envisage comes from arcadian ecologists (subversive scientists and a modern, ecofriendly public). yet something like his arcadianism has been an enduring tradition in the american southwest, one built on an appreciation of native american myths and practices, in the tradition of thoreau. this tradition, as rudnik describes it, has been broadly feminist. it is a tradition that saw in the region: [a] new world whose terrain, climate and indige- nous peoples offered a model of ecological, spiritual and artistic integration to an alienated and decadent western civilization. [these women’s] perceptions were rooted in their ideal of a multiethnic democ- racy that recognized the long-ignored social, eco- nomic and cultural contributions of women, hispanics and indians to the life of the region and the nation (rudnik : ). the apparent resistance of the land to imperial- ism echoed the resistance of women to patriarchy. there is a tradition of resistance that runs from mary austin to patricia limerick and that con- tinues to nourish environmentalism and conser- vation, as merchant has recently reminded worster: “[t]he efforts of thousands of women were directly responsible for many of the coun- try’s most significant conservation achievements. women writers on nature such as isabella bird, mary austin, and rachel carson have been among the most influential commentators on the american response to nature” ( : ). related to this failure to recognize feminist resistance to imperialism (leaving his romantic arcadianism alone in the lists against capitalism) is a simplistic notion of the relations between big government and localities that underwrites a de- spairing politics, one that rejects all forms of government beyond mutual aid in the village. worster thereby simplifies central government and ignores how local forces used it. these dia- kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t lectical relations are, however, central to other work on the water politics of the western u.s. for example, pisani draws attention to the diversity of water laws in the west throughout the second half of the nineteenth and well into the twentieth century. the significance of this diversity lies not in some antiquarian objection to generalization, but, rather, in the continuing extent of local autonomy in the face of widespread fears of mo- nopoly and federal interference with property rights. under these conditions, local control was preferred by many. pisani concludes that: at the state level, the diversity of western water laws was potent evidence of the power of localism. in fact, virtually all water law reforms were undertaken not in the name of rationality and bureaucratic order, but rather, because one group of water users sought dominance over another, or one community, region, or state sought to gain a competitive advan- tage over another ( : ). in trying to referee local conflicts, central govern- ment was drawn into and became a resource in those struggles. at least in the case of water policy, it did not roll over locality and variety in the name of instrumental reason or bureaucratic fiat. walton goes even further in raising problems for worster’s treatment of resistance. in a study of water use in owens valley, he notes how central government involvement in the conflict between locals and the city of los angeles legiti- mized resistance even as it asserted interference. in constructing a justice argument around re- source use, the government deployed essentially contestable terms, circulating a rhetoric of inter- vention that could be appropriated as a rhetoric of resistance. thus, theodore roosevelt pro- moted the “progressive” state by promising to use state power to drive the development of moral capitalism. as such, the water needs of the urban center of los angeles took priority in strictly utilitarian terms, but the owens valley citizens presented themselves as pioneers of moral capi- talism in exactly these terms. they presented small-town society and agricultural smallholders as the very backbone of the moral economy. in ensuring obedience and coping with opposition, the state both enlarged its competence and arro- gated to itself more responsibilities. these re- sponsibilities, however, subsequently became resources with which the locality fought both incorporation and exploitation. in the s, this expansion of state activity took the form of wel- farism, and again it could be used either to insist on the rights of the conurbation of los angeles or to assert the contrary claims of the people of owens valley, this time in the language of environmentalism and the protection of col- lective natural assets. the legitimacy of central- government intervention is thus seen to rest on justice, but then justice must in some measure be seen to be impartial. as walton notes, “the state in modern society is both a relation of domination and an invitation to protest” ( : ). that invitation will be accepted, in part, according to the strengths of local traditions of resistance, traditions that historical work might uncover and nurture. it is an invitation that worster’s pessi- mism leaves untheorized and unrecognized. finally, there is something distinctly nostalgic about worster’s evocation of an earlier, kindlier, arcadian view of nature. as cronon ( c) shows, it replaces the “progress” narratives with “tragic” ones (see table ). these tragic visions rest upon, as white ( : ) argues, the “de- monization of modern machines and the senti- mentalization of archaic forms of labor allow[ing] a bifurcation of work into the relatively benign and even instructive, and the modern and de- structive.” as white also suggests, this attitude may be an adequate basis for gardening, but it can hardly serve to address the sort of work from which people can make a living. white is surely right to argue that this leaves the world of modern work to the propagandists of large corporations, who are thus able to gather about them the shabby ecological virtue of “wise use” in a stand off where too many environmentalists argue for leisure amenities over any sort of productive work. the rigid dualism of this environmentalist perspective, as cronon ( b: ) has pointed out, ultimately leaves us with no place to think about humans as part of nature: “we thereby leave ourselves with little hope of discovering what an ethical, sustainable, honorable human place in nature might actually look like.” para- doxically, this strand of environmentalism re- mains within the tragic vision of the frontier thesis: “the frontier narrative was about settling a new land; it offered little wisdom about how best to live once the settling was done and the new land had become old” (cronon d: ). in these ways, we may see how evaluating worster’s historical writings may, in turn, inform a critique of his values; how the circle between facts and values may be made virtuous through a consideration of how values direct inquiry but the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t also of how inquiries should revise values. worster is quite clear about this aspect of the new west- ern history: “the history of this region, if it wants to be vital and listened to, cannot be kept isolated from public controversy, struggles over power, the search for moral standards, or the ongoing human debate over fundamental principles and values” ( : ). worster’s excavation and explication of those principles have been largely shaped by the arcadian view of nature that he set out in his earliest work, but it would be unfair to give the impression that he only pays attention to social justice insofar as it is implicated in imperial atti- tudes towards nature. in a recent essay, worster has contrasted native american and european settlers’ views of property rights. he argues that the american government violated the agree- ments they made with the lakotas when they took their land. there are thus legitimate grounds for the lakotas’ claim on the use of the black hills. this claim need not rely upon religious attitudes to nature or upon historical precedence in occupying land. more simply, “[a] deeply felt wound that has festered for a hundred years might be healed and we could get on with the task of living with one another in mutual respect” ( d: ). it is to such normative issues of fairness, redress, and social justice that i now turn. justice and the middle ground richard white has been concerned mainly with the history of native american peoples and with the transformation of their ecologies under the impress of the frontier process. like worster, white echoes horkheimer and adorno ( ) in noting how the control of nature by some people may be the vehicle for the social control of other people. the monopolization of environmental resources by the new european settlers prevented the reproduction of the native american way of life, leaving the aboriginal people, in economic terms, a dependent people. but white speaks from a more nuanced ecological and political position than has characterized some of the criti- cisms of industrial society that have animated worster’s work. commenting on a paper by wor- ster ( a), white ( a) drew attention to some of the problems with worster’s ecological critique of capitalism and, in particular, to the difficulty of treating ecological climax as a stable measure against which the destruction wrought by human action might be measured. white has noted that historians have shown how extensive human modifications of the natural world have been over a very long period of time and have made “questions of climax and succession seem abstractions with few equivalents in the actual landscape” ( a:xvii). he has also argued that just as environmental “causality” is complicated, so must be the “moral emphasis” of the historian ( a: ). (cronon has remarked that “white’s favorite . . . way of describing the past is to say that it is ‘complex’ ” [ a:xv]). the de- velopment of white’s work shows an increasing unease with some forms of ecological foundation- alism and a growing recognition that the “[i]ssues of language, of discourse, of texts, and of creation of the subject that so occupy postmodernist schol- arship are quite serious ones” ( a:xvii). white’s work, however, also rests on a belief that “[t]here was, and remains, a tangible physical world that sometimes affirmed but often mocked the representations designed to constrain it. for all the power of the postmodernist critique, it neglects this physical, tangible world, a world of substantial bodies, and trivializes our experience in it” ( b: ). as a result of both of these views, white urges historians to explore the “in- terplay of ideational and material elements” ( a: ) in the replication and change of regional assemblages of people, animals, and plants. this interaction between culture and en- vironment is a central theme of his work: nature is at once a physical setting where living beings exist in complex relationships with each other, and a human invention. humans create a shifting set of cultural concepts about the physical world and identify these concepts as nature. when they act, humans do so on the basis of these cultural formulations, but their actions rebound on an actual physical world. recreating these cultural formula- tions for any given period is the problem ( : ). it might seem that this leaves little room in his- torical writing for explicitly normative concerns, and in rejecting reductionist accounts of the role of culture in environmental change, white un- derlines the problems this poses for the moral stance of writers such as worster: “historians would still lack the overarching standards by which we should judge change, but it is a pipe dream that we shall find such standards in either nature or history” ( a: ). nevertheless, value judgments remain intrinsic to the histories white writes, and their negotiation is of special interest given his recognition of the force of both kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t the antifoundational critique of ecology and the postmodernist critique of meaning. white accepts the moral intentions of the en- vironmentalist critique of modern american so- ciety, although he is unwilling to cast the attack in terms of a fall from pristine, natural grace. his argument appears to be that euro-american at- titudes to nature are so reckless of the demands of variety, sustainability, and security that acting upon them surely courts danger. more important, the euro-american transformation of north american land has had tragic consequences for native americans that, alongside questions relat- ing to nature, are pressing issues of social justice. justice is the key term in understanding white’s work. operationalized in various ways, it con- nects both a moral critique of the consequences of the transformation of nature and modern political imperatives of redress owing to native americans to an empirical account of the cultural context of environmental change. justice is to be found neither in nature nor in history, rather, it is something that we bring to our evaluation of the actions of human beings both in the past and the present. much as worster has done, white understands the hubris of euro-american attitudes toward nature. these attitudes entail dividing nature into those species that are useful to euro- americans and those that are not. species, then, are of no intrinsic value. in his study of island county, washington, white notes that: “ameri- cans reduced the complex view of the indians to a few simple categories. the new farmers saw most native plants as simply ‘weeds’ or ‘brush.’ land that grew these plants was, in the words of the census, ‘unimproved’ ” ( : ). this treat- ment of nature as resources and, given the nature of the economy, as commodities, directed the american gaze over the land. it embodied clear political choices in favor of certain uses (and users) of the land over others. for example, when, in exploring the american west in the late nine- teenth century, clarence king “chose to use the united states geological survey primarily to sur- vey mineral deposits (rather than dam sites and water sources for irrigation), he chose to empha- size resources whose ultimate development would benefit mining corporations and not western farmers” ( b: ). similarly, in viewing their domesticated animals as “sentient tools” ( a: ), euro-americans defined by default those other animals not subject to their will as useless enemies, creating a “biological monarchy where humans reigned, where uselessness among lesser living things was a crime punishable by death, and where enterprise was the reigning virtue” (p. ). being ruled by enterprise entailed the production of a narrow range of species and crops, the latter of which were selected based on market prices rather than on immediate subsis- tence needs ( : – ). as cronon has argued, property relations partly connote ecological relations ( : ). the creation of euro-american titles to land largely mirrors the more general story of capital- ism’s primitive accumulation. white concurs with this assessment, noting that: “americans believed that how they distributed the public domain determined the kind of society they were creating” ( b: ). land allocation was a contested act of remaking society after an agrar- ian ideal. yet that ideal took many forms, from large ranches to small farms and from petty com- modity production to wage and slave labor. with- out regard for aridity or for the competing demands of grazing, logging, and mining, north- ern republicans tried to allocate land in the west to homesteads of the size that had proved accept- able in the humid east. the demand for these homestead plots was limited by the failure of many small farms in the west. yet loggers, ranch- ers, and miners continued to move onto public lands. the forms of access this latter set of users were eventually recognized as having still left the federal government with large property holdings in the west, in stark contrast to its much smaller holdings in the east. the survival of this public domain in the west owed much to the conflict between different varieties of the agrarian ideal, and to ecological realities such as the unsustain- ability of certain land uses given the physical conditions prevailing in parts of the west. white traces the dominant role played by the federal government in directing economic devel- opment in the west to the retention of a large public-lands domain. this, in turn, was partly sustained by what many have seen as a fundamen- tally new attitude toward nature among early twentieth-century americans: conservation. but here, white sees less discontinuity, linking con- servation to an embedded instrumentalism char- acterizing american attitudes toward nature more generally. for him, conservation is simply a newly profitable use of nature as urban leisure ground: the attempt to preserve these tokens of the natural world does not seem the outgrowth of any significant the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t new attitude toward nature. the same basic stand- ard, economic value, still governed the attempts at preservation. remnants of the older natural systems have attained greater value as they grew more scarce and as urban dwellers gained the time and the means to enjoy them ( : ). white thus appears to endorse john muir’s criti- cisms of the utilitarian notion of monumentalism that motivated the preservation of certain natural landscape features in the u.s. he remarks that muir “wanted nature protected so that humans might momentarily escape their human condition by mystical communion with forces greater than themselves” ( b: ). as part of the conser- vation ethic, women and children were encour- aged to appreciate nature as a repository in which “cute animals” were saved. yellowstone park, “[a]lthough presented as a salvaged remnant of aboriginal america, . . . by the late twentieth century came more to resemble a petting zoo with a highway running through it” ( a: ). for men, on the other hand: sportsmen, as distinct from hunters, began to argue that a particular kind of virtue—hardiness, bravery, self-reliance—impossible to cultivate in an urban, industrial environment, was the true product of the hunt . . . by the early twentieth century, they had clearly won their battle to pro- tect game populations. by dying so that american males could maintain their virility and virtue, game animals achieved a symbolic utility and protected status (p. ). the reference to muir suggests some grounds for the implicit critique, but let us consider an- other line of criticism developed in these studies. in particular, white wants to draw attention to the survival of plant and animal species attendant with the euro-american attitude to nature. some consequences are unintended, many are indirect, and all are complicated. he believes that ameri- can society has not developed or empowered institutions that could monitor and control them: “historically, the farmer, the lumberman, and the fisherman have proved more adept at refining technologies and increasing the scope and rate of environmental change than the larger society has been in gauging the consequences of the tech- nologies and in creating institutional means to control them” ( : ). in the absence of in- stitutional checks, ecological crisis has proven a stern teacher. euro-americans have had to “put their ideological formulations of nature at risk in the physical world” ( b: ). in this view, americans have paradoxically learned about nature from their failure to domi- nate it, whereas it is out of their subjugation of the native americans that their historical un- learning has sprung. at first, native americans and euro-americans “regarded each other as alien, as other, as virtually nonhuman” (white a:ix). although this view of the native peo- ples remained current back in europe, immi- grants and aboriginal peoples soon met on more equal terms in north america and forged a “com- mon, mutually comprehensible world” (white a:ix). later, after breaking the autonomy of native american peoples, euro-americans no longer feared nor felt any need to reach accom- modation with them, and could then recreate “the indians as alien, as exotic, as other” (p. x). at this stage: the fact that indians actually starved because colo- nizers had come, that they died in such prodigious numbers from disease in part because colonizers had wrecked their subsistence systems, and that these subsistence systems themselves were inextricably intertwined with the political, social, and cultural relations colonizers set out to undermine subverted the more beneficent rationale that colonialism brought a better life to all. colonialists, therefore, tended to prefer imaginary pasts and more benign presents (white : ). in this imaginary past, native americans had not substantially changed the natural world: “[s]ince humans had not shaped the west into a landscape familiar to expectations conditioned by western europe and eastern north america, they concluded that humans had not shaped the land at all” (white b: ). the view that native americans merely passed over the land without leaving any trace has a number of consequences, one of which white mentions in his conversation with cronon: actually this idea demeans indians. it makes them seem simply like an animal species, and thus de- prives them of culture. it also demeans the environ- ment by so simplifying it that all changes come to seem negative—as if somehow the ideal is never to have been here at all. it’s a crude view of the environment, and it’s a crude view of indians (cronon and white : ). faced with such unjust characterizations of indians, the first task of the historian is to restore the dignity of historicity and culture to the native americans. e. p. thompson made this point most eloquently when he spoke of “seeking to rescue” kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t the artisans whose trades had been abolished during the industrial revolution, from “the enor- mous condescension of posterity” ( : ). the hopes and aspirations of these people were mean- ingful in terms of their own experience and it is an abuse of hindsight to represent them as little more than doomed bystanders at the history of their own period. the right to a just hearing in historical writing is even more important in the case of native americans because, of course, they still live in america. their survival and even, over the last century, their renewed increase in num- bers, present a particular challenge to histories premised upon assumptions of white racial supe- riority or the inevitable disappearance of native peoples. as berkhofer has written, this recogni- tion changes the agenda of native american history from a study solely of the relations be- tween aboriginal peoples and european arrivals to one that explores cultural resilience on its own terms ( ). white’s own approach is under- pinned by just such an appreciation of native american culture: “[t]he bridges, franks, and other families of the fishing rights struggles on the nisqually and puyallup rivers of western wash- ington first allowed me to realize the quite differ- ent ways indian peoples can have of perceiving and organizing the world, and how tenacious and creative seemingly powerless people can be in fighting to maintain a way of life” ( :xii). so, beyond the condescension that posterity brings, there is also a need to consider issues of justice in the present. redress and fairness i suggest that empirical questions are involved in these questions of justice, and that empirical research provides guidance in resolving matters of justice. to begin this task, i introduce two principles from the work of john rawls: those of redress and fairness. first, redress: this is the principle that undeserved inequalities call for redress; and since inequalities of birth and natural endowment are undeserved, these inequali- ties are to be somehow compensated for. thus the principle holds that in order to treat all persons equally, to provide genuine equality of opportunity, society must give more attention to those with fewer native assets and to those born into less favorable social positions (rawls : ). second, fairness: this principle holds that a person is required to do [their] part as defined by the rules of an institution when two conditions are met: first, the institution is just (or fair), . . . and second, one has voluntarily accepted the benefits of the arrangement or taken advantage of the opportunities it offers to further one’s interests (rawls : – ). white’s work shows, first, that the unfavorable social positions occupied by native americans are undeserved, intentional consequences of euro-american aggression and, second, that in no sense can native americans be said to have voluntarily accepted the arrangements under which they find themselves placed. the history of native peoples since the arrival of europeans sustains claims on their behalf to a more generous settlement from euro-americans on the grounds both of fairness and redress. that realization, rather than being a concession to a more nuanced historical understanding, has actually come from the continued vitality and demands of the first nations themselves. just as the agenda of social history more generally has been shaped by the demands of the new social movements, so writing about native americans has been shaped by their demands. a book such as david wishart’s an unspeakable sadness is decisively framed by the cases put by native peoples to the indian claims commission after . the claims process, which invited final settlement of outstanding grievances through providing compensation for earlier forced, illegal, or unfair land sales, assisted in the reassertion of native rights and identities that has forced itself upon the attention of histo- rians and historical geographers. instead of the final settlement resulting in the complete ab- sorption of native peoples into the federal pol- ity, it has in fact produced a deeper pluralism and separatism. writing of the indians of island county, wash- ington, white notes that: “[t]hrough observation and tradition, indians altered natural communi- ties to fit their needs without, in the process, destroying the ability of those communities to sustain the cultures that had created them” ( : ). at several points, he comments on the way some groups of native peoples used different resources, often in different places and at differ- ent seasons, to secure a living from the land. in some cases, they farmed part of the year and the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t hunted the rest. in many cases, they had both a primary and a secondary food cycle so that if one set of food sources failed them, they could get by with others. seeking food security rather than maximizing production, native americans had a number of ways of ensuring sustainability. they regulated the exhaustion of the land by moving their fields after a period. they controlled fertility through hunger and, in some cases, infanticide. the game they hunted thrived in the contested borderlands between indian tribal groups or vil- lages. in killing game, they took what they needed for survival. this was all very different from the attitudes of euro-americans. for example, in contrast to the euro-americans’ instrumental view of animals: indian religions made hunting holy and gave human-animal relations a depth and complexity largely lacking among europeans. in hunting, some persons died so that others might live. ceremonies preceded the kill. animals consented to die; they, or more powerful beings—holy people, keepers of the game, or other supernaturals—pitied the hunter and instructed him in the rules and rituals necessary to kill them. indians killed game as much by prayer, pleading, and reverence as by the arrow or spear. they recognized the obvious wariness of game and the reluctance of animals to die, but they explained it in terms of previous ritual abuse by humans or even supernaturals. the difficulty of obtaining the con- sent of animals only made strict observance of hunt- i n g r i tu al s a l l t h e m o r e n e c e s s ary (white a: – ). european colonization made it impossible for native americans to continue with this way of life. euro-americans granted themselves exclu- sive title to parts of the natural world that were crucial to the spatially dispersed, complementary food cycles of the indians: “[i]n a society in which law, rather than tradition or religion, increasingly defined man’s relationship with the land and sea, the salish became a people literally without rights. they were cut off by law from centuries- old fishing grounds, and the state allocated their catch to white commercial fishermen” (white : ). settlers’ farms hemmed in native american periodic and dispersed land clearances, leaving them nowhere to move when the soil neared exhaustion. ultimately, attacks on the religions of native peoples made their regulation of population numbers impossible. a conscious policy of creating dependence among the native americans through debt and alcohol allowed euro-americans to secure ever more furs from some groups of native peoples, enhancing the importance of warriors over peacekeepers and further compromising subsistence activities. this deepening involvement with the fur trade in the great lakes region “gradually created new mean- ings and altered the meanings of old objects” so that, for example, while anyone could move into tribal territories and kill game if they were hungry, only people with local rights were permitted to take away the furs, which could then be ex- c h a n g e d f o r e u r o p e a n g o o d s ( w h i t e a: – ). the stabilizing institutions of in- dian society that ensured ecological sustainability were undermined, and “[a]lthough they had once been able to feed, clothe, and house themselves with security and comfort, indians gradually re- sorted to whites for clothing and food,” until “[i]n the end, whites specified what was to be ex- changed, how it was to be exchanged, what the indians were to receive, and how they were to use it” (white :xix). to reach this point, the settlers had waged explicit war upon native american subsistence systems. preventing na- tive americans from gathering food, for example, was often a bitterly effective tactic against such militarily powerful, recalcitrant tribes as the lak- ota (white b: ). peoples such as the sal- ish were gradually forced out of the wider american society and consigned to the refuge of small, dedicated reservations (white : ). before this point was reached, native peoples had made many creative attempts to adjust to euro-american demands for resources and to military and biological threats. their sustainable agricultural systems did not collapse from within in some malthusian fashion (white : ). rather than passive impediments to european expansion, native americans sought many and varied forms of accommodation with the imperi- alists. historians do them an injustice when they fail to recognize this, treating native americans as an ahistorical entity mired in traditional, inter- necine strife (white : ). political forms such as villages, tribes, nations, republics, and ultimately ethnicities were institutions shaped and reshaped out of this creative adaptation. to restore this complexity to the historical picture is not only to do the indians descriptive justice, it is also to document the explicit aggression by which native americans were forced off the middle ground of compromise and coexistence and mar- ginalized as part of a social contract they can hardly be said to have chosen. the story of how native american society was underdeveloped, kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t then, serves as an explicit rebuke to the supposed equality of all before the law. nevertheless, white’s studies also provide empirical grounds for maintaining that alternative arrangements are imaginable in the present. this is true both of the importance of native american theories of na- ture and of the tenuous achievements of the middle ground. i now turn to these two lessons of history. two history lessons for white, the contrast between native and euro-american ways of relating to natural re- sources is an instructive one: “[w]e can’t copy indian ways of understanding nature, we’re too different. but studying them throws our own as- sumptions into starker relief and suggests short- comings in our relationships with nature that could cost us dearly in the long run” (cronon and white : ). clearly, these lessons include the importance of sustainability, but white is also anxious to contrast the views of native peoples with those of romantic conservationists: “one thing that has impressed me about indians i’ve known is their realization that this is a harsh planet, that they survive by the deaths of other creatures. there’s no attempt to gloss over that or romanticize it” (p. ). the second historical lesson drawn by white concerns what he terms the middle ground. on this middle ground, until the autonomy of indians had been broken, whites and indians found ways to share notions of jus- tice, price and fair play despite the very different repertoire of cultural resources they brought to the exchange, a tribute to the ability of people to empathize with each other’s frames of reference sufficiently to make themselves comprehensible in terms of each other’s presuppositions. this rapprochement undermines the pessimism im- plicit in radical cultural relativism. it provides grounds for both a recognition and a suspension of difference that allows us to respect and grant rights to the “other.” culture shapes our treat- ment of other people, as well as our treatment of the environment, but this is not a view of culture as incommensurability: we can find ways to ac- cept alterity and still reach a mutually compre- hensible and acceptable accommodation with the “other.” in a recent paper, white has documented how general custer and sitting bull became central elements in the respective mythologies of euro- and native americans, while also showing how the mythologized custer and sitting bull migrated across this divide and became reworked elements in the stories of both cultures. invoking a sense of history as storytelling, white suggests that “[t]hese stories we tell about the west matter. they not only reveal how we think about our- selves, they help determine how we choose to act towards each other” ( b: ). the meander- ing of stories between cultures suggests that while myths and legends “told about the frontier and the west have certainly not always been told with democratic intent . . . they have had democratic consequences. attempts to close them off, to confine their possession to certain groups, have failed. they have become democratic stories in- habited by diverse americans and open to multi- ple retellings . . .” (p. ). this “imaginative coherence” speaks to the possibility of a tolerant pluralism. in this sense, by telling the story of native american peoples in terms of their own understanding of social and environmental change, white is providing the empirical basis for justice claims of fairness and redress. he is pro- viding a just description, restoring agency and dignity to the native peoples about whom he writes. he is providing the prescriptive basis for justice claims of redress. native americans con- tinue to be without full equality of opportunity in the u.s. due to the imposition by force of a social contract to which they did not assent. white is, finally, helping establish the bonds of common humanity (empathy) and plurality (solidarity) which enable those justice claims to be heard. this is a subtle interweaving of empirical and normative concerns, but i believe it offers more than a naive ecological foundationalism or a post- modern cultural relativism. citizenship and regionalism patricia limerick has been a staunch critic of the legacy of turner for its ethnocentrism, its narrow view of the economy, its omission of women, its cavalier disregard of environmental degradation, its severance of nineteenth-century history from twentieth-century politics, and, fi- nally, because it “blurs the fact of conquest and throws a veil over the similarities between the story of american westward expansion and the planetary story of the expansion of american empires” ( a: ). she has contended that all attempts to rescue the turnerian emphasis on the american west as a process, such as those of the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t aron ( ) and cronon et al. ( ), inevitably privilege the anglo-american movement from east to west over all other population movements and ethnic identities, including not simply native americans, but also latinos, asian-americans, and african-americans. yet, in a recent paper, she offers a definitional truce on the grounds that a survey of the uses made of the term “frontier” in some four thousand newspaper headlines has convinced her that the american public cares little for these academic squabbles and continues to use the term “frontier” in an overwhelmingly positive manner. the “frontier” has become “a kind of multicultural common property” that “works as a cultural glue—a mental and emo- tional fastener that, in some very curious and unexpected ways, works to hold us together” (limerick a: ). this is somewhat similar to white’s emphasis on the imaginative coherence offered by common stories, but limerick is more explicitly concerned than white with the links between this public consumption of history and the public role of the historian. i argue that the central normative concern of limerick’s work is with citizenship, and that she seeks to ground the claims of citizenship in an avowedly regional po- litical community. the public intellectual limerick is anxious to engage in a debate on the nature of western history beyond the acad- emy, and is delighted to find that increasingly possible: “[a]ll around the west, the public is eager to join in this discussion, giving western historians in the late twentieth century the finest opportunity imaginable to revive the role of the western public intellectual” ( a: ). this will only occur, however, if historians face some pain- ful realities and become more self-consciously engaged, and this will involve a transformation of history itself: “the transition from a historical profession intoxicated with the dream of objec- tive, neutral, value-free inquiry to a historical profession aware of, and honest about, the un- avoidable reality of subjectivity, is, under- standably, an awkward and uncomfortable one” ( a: ). indeed, limerick notes that those who have wished to restore the old western history have done so largely in the name of historical objectivity, yet: “[a]lthough they thought of themselves as rigorously neutral, with- out ideology or bias, they had in fact placed their sympathies with english-speaking male pioneers and then called that point of view objectivity” ( a: ). for example, in a paper on the work of ray allen billington, limerick documented the way his historical studies treated all ethnici- ties other than anglo-american as barriers to american progress, giving minorities little atten- tion in their own right. she recognizes billington’s personal “rejection of bigotry,” but she notes that this led him to avoid recognizing adequately the importance of racial difference in historical inter- pretation: “[e]ven if we should prove able to write of our future without reference to racial differ- ences, we will never gain that license in the writing of the actual, not the imagined, past” ( b: ). on the other hand, she has nothing but praise for wallace stegner, whose wartime propaganda book, one nation ( ), looked without blinking at the racism of contemporary society and warned americans of its insidious effects: “we are much in his debt because he said these things so clearly and so forcefully, before many others were saying them, or even thinking them” ( b: ). public intellectuals, then, must recognize and articulate their personal sub- jectivity in the context of a wider field of subjec- tivities and experiences. in limerick’s case, an individual voice is grounded in her upbringing in banning, califor- nia. at several points, she insists that the roman- tic myths of the turnerian frontier find no purchase in banning: “[t]ailored to fit portage, wisconsin, turner’s frontier theory simply won’t fit banning, regardless of how you trim and stitch, tighten and loosen” ( c: ). her childhood bore testimony to a different story: i grew up in banning, california, where one town patriarch made much of his money providing the prostitutes for the workers building the aqueduct taking colorado river water to los angeles. out- side banning was the morongo indian reservation, and kids from the reservation were with us in school until about the eighth grade, and then, when we graduated from high school, most of the indian kids had dropped out. how, in other words, could i have acquired illusions about western history? illusions? in banning? (worster et al. : – ). it is clear, however, that this is the product of retrospective reflection, for elsewhere she says of her childhood that: “i took the landscape for granted, and i had no uncertainties about water, even if i also had no idea where it came from” (limerick : ). this retrospective reflection is through the lens of her subsequent political kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t education. to a large extent, the values that inform limerick’s history come from an acceptance of the liberal agenda of the s. she refers to herself as a “palaeo-liberal” (worster et al. : ), remarking of the new western his- tory: “the influence of perspectives originating in the s is unmistakable” (limerick et al. :x). the new western history registers the effect of the new social movements on the agenda of social history: “in the broadest sense, the ‘new western history,’ is simply the aggregation of studies of race, gender, class, community, eco- nomic dependency, and the environment in the west conducted over the last twenty-five years” (white c: ). yet feminism, multiculturalism, and environ- mentalism make legitimate claims upon the his- torian’s attention, claims that go beyond both the band-aid of a parenthetical “political correctness” and the “conjunction school of historical revi- sion” (limerick a: ), which simply adds new sections to old textbooks. the exclusions and elisions in the old western history result in explanations of the past that are inadequate even on their own terms, and which fail to confront the historical construction of political identities in the present. what i have described as the virtu- ous circularity of facts and values, limerick refers to as a spiral. writing of the work of the landscape photographer, mark klett, she remarks that “[t]hrough his experience in the rephotographic survey project, klett came to know, first-hand, that we live in a relativistic universe, where an individual photographer can, by the choice of his vantage point, change what we think of as real- ity”; but by looking again, longer and harder: “[t]he path of perception of the american west thus traces a spiral, as euro-americans have, over time, gotten ‘warmer,’ closer to the center, but by no means all the way there” ( b: – ). elsewhere, and more ingeniously, limerick uses the metaphor of conversation for this relationship between perspective and scholarship. conversations on the “new” despite her despair about the influence that academic debates over the meaning of the “fron- tier” are having on the uses of the term in public discourse, limerick is anything but pessimistic about the potential importance of clear historical writing for the contemporary construction of po- litical identities. limerick coined the phrase “new western history” for a symposium held to launch a touring exhibition about the history of the west. the phrase, and the brief explanation she offered about the movement, were taken up in a variety of news media including the washing- ton post, the new york times, and national public radio (limerick a: ). even more dramatically, the revisionism of the new western history was on display at the smith- sonian institution national museum of ameri- can art in washington, in an exhibit entitled “the west as america: reinterpreting images of the frontier, – ,” where it offended the patriotism of some americans still basking in the aftermath of the gulf war. the labels in the exhibit “redefined many western artists as apolo- gists for manifest destiny who ignored or were culturally blind to the displacement of indigenous people and to the environmental degradation that accompanied the settling of the west” (gul- liford : ). the media uproar was exten- sive. more than seven hundred people entered their reactions in the comment books, the major- ity being positive (truettner and nemerov : ). yet critics were bothered by the sugges- tion that great art was anything but objective reporting and america’s frontier not the leading edge of world civilization. daniel boorstin char- acterized the exhibition as “perverse, historically inaccurate, destructive” (gulliford : ). on the five-hundredth anniversary of columbus, the american public objected so strongly to a section on “inventing the indian” that the text on the labels was toned down. this public interest suggests at least the possibility of a conversation. conversation is important to limerick. she celebrates dialogue: “each incident . . . in which westerners of these various backgrounds and convictions defy the odds and choose not to attack each other, nor to evade each other, but to converse—each of these incidents seems to me powerfully freighted with hope” (limerick d: ). the development of a responsible and democratic politics in the west depends upon such a dialogue: “the human diversity of the west remains . . . a conversation waiting to hap- pen” (holthaus et al. : ). this is where she places her hope: “although there is no reason to argue that residents of the west now live with an enlightened regional self-consciousness based on . . . elements of commonality, there is also no reason to argue that they could not or should not” (limerick a: ). a more adequate under- standing will require a true appreciation of the dis- the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t tinctiveness of the west as well as an appreciation of the experiences and expectations of the diverse human groups sharing the land. in a sense, lim- erick wants regional identity to suspend ethnic difference. the west should thereby define an imagined community to which all could belong. in this view, stegner is a sympathetic figure not only because he urged the cause of antiracism against the danger of the u.s. “balkanizing,” but also because he longed, in his own words, for “a past to which [he] could be tribally and emotion- ally committed” (quoted in limerick b: ). here, the legacy of turner seems particularly pernicious. in treating the west as a process of frontiering ending in , turner not only cut the modern west off from its past but also made it the temporary adjunct of a story of national history which returned to the east and, especially, to the midwest. limerick complains that too many modern history textbooks do much the same as turner in this regard: “[r]egardless of the politics, the methods, or the ages of the textbook’s authors, the west registers as a transitory phase of national history and not as a permanent place” ( c: ). the marginal place given to the west in national history offends her regional pride. limerick believes, further, that it is only upon a version of regional pride that an enlight- ened tribalism might be founded. she finds this resurgent self-confidence in environmental sci- ence, literature, painting, and photography; hence her enthusiasm for the work of mark klett: “[i]ntentionally or not, the rephotographic sur- vey project rejected the abstract, shifty definition of the west as a frontier, and saw the west as a set of solid and continuous places. the project by its very nature assumed a connection between the w e s t e r n p r e s e n t a n d t h e w e s t e r n p a s t ” ( b: ). for limerick, this is the cultivation of “hindsight without smugness” and is “the use of the mind that western historians, as well as westerners in general, most need to develop” (p. ). the west was and continues to be important, at least in part, because its past and present teach the fundamentally multicultural and environ- mentally grounded character of american soci- ety: “with our variety of ethnic backgrounds, occupations, lengths of residence, passions, con- victions, ambitions, expectations, and regrets, we are in this land, and in it together” ( b: ). for limerick, the task of the historian is to pro- mote that sharing of experience. referring to the west as a babel of different languages, she writes of the “spirited intellectual effort of communica- tion” ( d: ). yet dialogue has all too often been wrecked upon the shoals of western experience: “first, americans came west with high hopes for im- proved personal fortune, hopes that carried both the seeds of disappointment and frustration and, not far beyond, the need for someone to blame. second, scapegoats were everywhere at this cross- roads of the planet, the meeting ground of europe, asia and latin america” (limerick : ). the historian can at least restore to all groups an acknowledgment of their joint work in shaping the region. by emphasizing the idea of the west as a meeting ground, she suggests, “we would have an equitable and accurate way of giving all the participants their due” (worster et al. : ). turner’s story left one group in the field as conscious actors and the rest as mere friction to the progress of civilization. on the other hand, “the complete story of the invest- ment of human consciousness in the american landscape requires attention to the whole set of participants—indigenous people as well as invad- ers, eastward-moving asian-american people as well as westward-moving euro-american people. with anything less, the meaning of the landscape i s f r a g m e n t e d a n d t r u n cate d” (lim e rick e: ). using the western landscape worster raises an important question when he asks whether limerick’s legacy of conquest pre- sents the west as primarily a failure of democracy or of ecological sustainability (worster et al. : ). the environment is certainly a cen- tral concern of limerick’s work, but the tragedy of environmental destruction is not the leitmotif of her work as it is of worster’s. in desert passages ( ), limerick looks at writings about the de- serts of the southwest u.s. and documents the various ways the desert has been presented as obdurate and initially uncooperative nature. in thinking about the effect of aridity on attitudes to nature, for example, limerick offers the desert as an occasion to think about limits. it is not aridity, as such, but reflections upon natural limits to which it has given rise that interest her, and which give her hope that people in the region might learn and impart lessons about the dangers of imperial attitudes toward nature. this recogni- tion of limits is now available to the nascent kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t regional self-consciousness to which she wants to contribute. thus, while recognizing that it does not cover all of the region, she insists on aridity a s a d e f ining cha ra cteris tic of the we st ( : ). aridity has been important at vari- ous points in defining the historical trajectory of large parts of the west; it has been one of an important set of contingent differences marking the west from the rest of the country (see also white c: – ). there is something to be learned from the legacy of aridity, just as there is something to be learned from the legacy of ethnic diversity, and limerick’s western self- consciousness needs to be fueled by both. her concern to use the landscapes of the west as a corrective to smug histories of anglo-american success informs another collaboration with mark klett on the mining “ghost town” of rhyolite. noting that c. vann woodward had declared that, in its confrontation with failure, the history of the south taught distinctive and serious lessons to all americans, she offers the west as a land- scape teaching related lessons in failure: although the two kinds of regional failure are very different, ghost towns give the west its most visible credentials in failure. the impermanence of many western enterprises confronted many people with the frustration of failed expectations and ambitions. add the fact that the gain of any individual or group in the west often rested on a corresponding loss for another individual or group, and the west, as well as the south, can act as a corrective to the idea that u.s. history is a “very monotonous repetition of successes.” the west becomes, thereby, what the south has long been—a region to take seriously (limerick b: ). the town of rhyolite, then, rested upon “the narrow and precarious foundation of extractive industry and unrestrained economic ambition” and its failure stands as testimony against both in this manner: “haunted by this hard-edged, un- compromising ghost town, one is encouraged to consider other, firmer foundations for society” (limerick b: ). there is, then, in limer- ick’s work, an urgent wish to teach the lessons of the contradiction between unrestrained eco- nomic expansion and the limits set by aridity and finite resources. these aspects of environmentalism, though important, are not the dominant themes in her reflections upon the history of the landscapes of the southwest. for that, limerick turns to land- scapes as the common ground of ethnic diversity. she claims that: “[t]he strategy of keeping a focus on the place and its physical conditions allows an author to include indians and euro-americans as people of equal significance and dignity” (worster et al. : ). such common ground becomes sacred ground: “where people have labored, suf- fered, struggled, or even just survived, they have planted seeds of memory as directly as farmers sow crops, and memory has its roots in the soul” (limerick e: ). the historian needs to engage with the contestable tangle of memo- ries—the ghosts of our landscapes—and through taking up the landscape perspectives of the many different groups involved in the making of those landscapes, the historian can advance a conver- sation about democratic politics. this is a particu- lar obligation on euro-american historians, since they have benefitted from a truncated conversa- tion that legitimizes their privileges. indeed, the anglo-american obsession with constructing community out of written law may now provide resources with which indian legal activists can reanimate treaties formerly honored most fre- quently in the breach, using them to press new claims (limerick : ). landscapes provide both the common ground of a shared history and the object of much conflict, plunder, and litiga- tion. language, community, and contract; these define citizenship in the western babel. histori- ans can join activists in breathing life into scle- rotic contracts, in translating diverse experiences into claims on common decency, in lending an ear and a voice to the subaltern. in this spirit, limerick moves between modern politics and new western history, directing both to the di- lemmas of the structured inequality of western multiculturalism. in summary, limerick wants to use something akin to citizenship as a yardstick against which the multiculturalism of the modern west is meas- ured and found wanting, and she wants to use the idea of a common regional history to build bridges across the ethnic divides. given her emphasis on conversation and on landscapes in common, the major difficulties with her approach to the virtu- ous circle between facts and values lie in the extent to which a genuine regional self-consciousness can become politically effective and the extent to which landscape can do service as a metaphor for actions with commonly shared ends without be- coming too vague. the first stage in her model of paradigm change in history, which involves demonstrating that history’s claims to objectivity are spurious, has largely been achieved. the sec- ond stage involves changing the public’s view of the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t history. here she can point to the publicity around the new western history as evidence that the argument has leaked out of the ivory tower and is now being engaged with by a broader public. she might even claim that the book com- missioned by the western governors associa- tion, beyond the mythic west ( ), suggests that politics with a capital “p” has been influenced by these academic debates. the virtuous circle of facts and values i have argued that cronon’s work is informed by the priority that an ethics based on sustainable development might give to environment in the description of social and economic development. i have proposed that worster’s account of na- ture’s fall from grace under euro-american im- p e r i a l i s m r e s t s u p o n a d e m o n i z a t i o n o f technology. i have suggested that white’s con- cern with justice for native americans directs his attention towards the common ground on which such claims might be heard. i have described the way citizenship serves in limerick’s work as a yardstick, calling the sins of the past to account in the claims of the present. i have shown that these normative frameworks produce narratives that pose both empirical and ethical challenges. when cronon adopts a neoclassical account of the way nature is embedded in economy, i find the explanation less satisfying than the attention given elsewhere in his work to the social context of resource use. when worster demonizes tech- nology, he leaves little scope for recognizing the forces of resistance on which our hopes for the future might be based. white’s reticence about the moral conclusions he draws from his work can give the impression that empirical complexity is the inevitable nemesis of social justice. limerick’s focus on conversation prioritizes the develop- ment of consciousness over an account of the material changes that the consciousness is at- tempting to articulate. in conclusion, i suggest that in the scholarship of the new western historians, we can discern two moments in the virtuous move from facts to values. to do so, i draw on seyia benhabib’s terms of norm and utopia ( ; see table ). social critique based on norms holds society up to its self-professed principles and measures how far it falls short, rather like limerick’s evaluation of how ethnic diversity is treated today. beyond that, we might look to the new values that are not yet the consensus but that form the basis for new agendas that go beyond what is already implicitly conceded in principle even if not in practice. this norm-based form of critique benhabib terms im- manent, for it anticipates little more than the fulfillment of the currently declared social pro- ject. in contrast, utopian critique is anticipatory. it projects a future based on the transfiguration of the current agenda. benhabib describes the nature of immanent critique in hegel and marx where the human subject, which was to be the bearer of historical change, was an individual who either thought (hegel) or worked (marx). ben- habib argues that, in the case of marx, this work model of human action privileged humanity as individual tool user over all other conceptions of humanity. in particular, she argues that marx left undeveloped those parts of his work that dealt with language as the model of the individual- in-social relations. language presupposes a com- munity of language users. communication is inherently participatory and collective. these ar- eas based on intersubjective interaction suggest an alternative set of relations beyond the essen- tially juridical concerns of holding society to its declared principles. beyond the world of rights and entitlements, there is one based on needs and solidarities that anticipates a future world where table . critique, norm, and utopia according to benhabib basis of critique norm utopia form of critique immanent anticipatory orientation to current social project fulfillment transfiguration human activity work participation world of values rights and entitlements needs and solidarity human subject collective singularity participatory pluralism conception of the “other” generalized concrete kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t plurality is recognized and a communicative eth- ics has a fuller chance to develop. this division has obvious implications for the earlier discussion about the shortcomings of the emancipatory project implicit in the marxist labor theory of value, which, in benhabib’s terms, is a normative rather than utopian critique of capi- talist society. whereas the project of communi- cative ethics that she takes from the work of jürgen habermas promotes citizenship as partici- pation in a social conversation, marx’s labor the- ory of value treats labor as a universal class that can act in the name of society as a whole to end exploitation by recovering alienated labor or capi- tal for the proletariat. this view, according to benhabib, is fundamentally dogmatic. it denies the plurality of identities in society, many of which serve as the basis for experiences of solidar- ity and respect which equally anticipate utopian needs going beyond what the currently recog- nized principles of rights and entitlements would allow. instead of the collective singularity of the proletariat with all the authoritarianism and sub- jection of means to ends that this entails, ben- h a b i b u r g e s a t t e n t i o n t o t h e p r o j e ct o f participatory pluralism. this position finds echoes in the work of cronon and worster, and the emphasis on par- ticipatory pluralism and society as an ongoing moral conversation speaks to some of the central concerns of white and limerick. cronon is ex- plicit about the way environmentalist history might “teach us the stories . . . that will help us to live better, more responsible lives” ( a: ) and “keep us morally engaged with the world by showing us how to care about it and its origins in ways we had not done before” ( c: ). i did not, however, introduce this brief account of the work of benhabib simply to reinforce those nor- mative orientations nor to reinforce my claims about the limitations of the marxist normative project. rather, the nature of the moral conver- sation, according to benhabib, creates a special role for the sort of empirical contextualization that good historical and geographical explanation provides. benhabib argues that we have reached the point in the development of the moral con- versation where it is possible to recognize that it entails universal moral respect and egalitarian reciprocity ( : ). the moral conversation will produce ethically correct conclusions if all are entitled to be heard and if all can raise topics for consideration. participation in such a conversa- tion will deepen people’s sense of civic friendship and solidarity (p. ). people will come to take account of what would be the point of view of the other participants in the conversation both be- cause they feel this sense of solidarity and because they know they need to get the informed consent of the “other” to any proposals they raise. not everyone will be persuaded that a common moral conversation can indeed build consensus on substantive ethical and political issues. for example, willems-braun ( ) questions the likelihood of the suspension of political and eco- nomic inequalities or the supersession of biased “common sense” in fora such as environmental roundtables: “although these arenas do often increase possibilities for participation, they do not by themselves mitigate the relations of power that are inscribed into public debate through the cate- gories and identities by which conflicts are organ- ized and understood” ( : – ). there is clearly a dangerous essentialism were one to see the ideal speech situation as uncovering rather than merely helping constitute an ethical com- mon ground. yet, the antiessentialist position comes quite close to that sketched out by ben- habib when mouffe follows rawls in speaking of overlapping consensus, of “creating a link be- tween recognized principles and hitherto unfor- mulated demands” ( : )—and even more strongly when she describes politics as a language game that is about finding “new usages of the key terms of a given tradition, and of their use in new language games that make new forms of life pos- sible” (p. ). the major difference comes when we turn to examine the proposed content of this overlapping consensus. for mouffe, it is primarily procedural. people need to develop a commit- ment to the fact of political conversation in its democratic variant. as long as they share the conversation, they suspend the potential violence of the differences that brought them onto the conflictual terrain of politics. yet, if democratic subject positions are to be rendered attractive by showing how they address the needs of the over- lapping groups of subjugated persons, i see, with limerick, no reason why that should not translate into the perception of overlapping material inter- ests in fairness and in a more egalitarian economic order. to some extent, mouffe acknowledges this in noting that democracy exists in a field of ten- sion between equality and liberty. yet she is very suspicious of any suggestion that rational debate might converge on a common conception of what might constitute the good life. society is too pluralist for that. yet, in benhabib’s defense, it the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t might be suggested that the other-regarding di- mension of civility need not entail loyalty to a single vision of the good life but might allow overlapping gestures of egalitarianism which ac- knowledge certain common claims of the human- ity we accept as fellow citizens in our polity. some of these claims may well be material (to shelter, to food, to education, to a tolerable standard of living) but, whatever form they might take, it seems obvious that they will only develop out of the common feeling that comes from interaction and mutual knowledge of the conditions of life across different sets of identities. this is very much like white’s discussion of the middle ground. but the importance of empirical work takes us further than this. an under- standing of the “other’s” point of view entails recognizing both the specific differences that frame worldviews and the particular context in which those framings take place. beyond the broad respect and particular rights due to the generalized other, there must be, asserts ben- habib, a recognition of those entailments due to the concrete or specific “other.” that recognition, in turn, requires the skills of contextual judgment (p. ), skills that rest upon a sensitivity to the particular—a sensitivity that good historical and geographical explanation can advance. empathy can allow us to imagine when we need to extend the rights of the generalized “other” in any par- ticular context, but empathy too readily erases differences. only the voice of the other can ade- quately alert us to plurality and difference. histo- rians of subjugated ethnic groups and of women have persistently made this point and, as limerick explicitly concedes, have made possible the new syntheses through which the new western his- torians have confronted some of the central myths of anglo-american identities. if historical and geographical writings can build on this work of the new western historians and continue to attend to the sets of agenda of those groups in subjugated positions, then the circle between facts and values will indeed have turned virtuous. acknowledgments i would like to thank stuart corbridge, bill cronon, david demeritt, jim duncan, ken hillis, steve hoel- scher, phil howell, hannah moore, pete morris, yi-fu tuan, and jeff zimmerman for their help. i would also like to thank don mitchell for the invitation to present this paper to the association of american geogra- phers’ annual meeting in san francisco, in april, . notes . in this paper, i shall take up the first set of criti- cisms in some detail but shall say less about the second. the very possibility of the virtuous circle of facts and values that i describe is denied by the more radical versions of postmodernism. the po- sition implicit in my remarks here might perhaps be termed neopragmatic. in general terms, i am something of a falsificationist, although in practi- cal terms, the verifactionist calls the glass half full, whereas the falsificationist says it is half empty. i believe that value positions rely upon making claims about the consequences of certain actions based upon conclusions drawn from observations of similar actions in other contexts. these obser- vations are subject to empirical falsification, and the conclusions drawn from them are subject to objection on grounds of logic or plausibility. i develop this point a little more fully in the con- clusion. . white ( b) describes the roosevelt position as buffalo bill cody’s, and sees a complementary tension between turner and buffalo bill. between them, the arguments of cody (or roosevelt) and turner prefigure the whole discussion of the fron- tier in this century. regardless of precedence, the central point still stands that the two positions construct different stories from different points of view. . merchant ( ) is among the many historians who share this view of the development of the u.s. as essentially a frontier process. indeed her two ecological revolutions, the colonial and the capi- talist, succeed each other in each place as the frontier moves westwards. in her terms, cronon’s changes in the land is essentially about the colo- nial ecological revolution, whereas his nature’s metropolis is essentially about the capitalist eco- logical revolution. . marx would not have used the term “utopia” in the way i do here, for it was precisely the implau- sibility of the dreams of some socialists that led him to distinguish their “utopian” approach from one such as his own that was grounded in the material tendencies/possibilities of the contempo- rary age and thus perhaps deserved the term “sci- entific.” in commenting on bakunin’s attack on his work, marx noted that the phrase “scientific socialism” was “only used in opposition to utopian socialism, which wants to attach the people to new delusions, instead of limiting its science to the knowledge of the social movement made by the people itself” ( b [ – ]: ). engels, f r om socialism: utopian and scientific ( [ ]) onwards, made explicit use of this distinc- tion. i want to retain the term utopian, however, to describe the imagined future world that helps us to think critically about our own times. i also kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t use it to stress the degree of choice involved in normative issues so that we avoid the implication that a better future is somehow inevitable. . even here, i am disturbed by the dogmatism and disciplinary chauvinism of some of cronon’s crit- ics in geography. to suggest that if cronon had written about a later period, he would not have been able to avoid issues raised by chicago’s tran- sition to an industrial economy, seems to me to be beside the point (pudup ). page and walker’s attempt to correct cronon’s “unsustainable as- sumptions about the primacy of intraregional trade” by asserting that “[t]his point was made d efin itively by ge ographers decades ago” ( : ; referring, i suppose, to the work of allan pred) ignores the work in economic history that has at least kept the question open (e.g., lindstrom and sharpless ). . in recognizing the links between questions of strategy and those of truth, i do not want to allow the one to be collapsed into the other. this is what demeritt proposes in his “politics of truth,” sug- gesting that we need “to evaluate competing ac- counts, not in terms of their truth or falsehood, but in terms of their likelihood to produce the kind of world we hope to live in and leave behind us” (demeritt a: , ). drawing on wolff and resnick’s work, graham makes much the same case for marxist economic geography (wolff and resnick ; graham ). yet discourse, it seems to me, should only strive to produce a better world by persuading people of the truth claims it makes. as cronon replies to demeritt: “without some faith that our descriptions of reality bear at least tangential relationship to that reality, it makes little sense to worry about reality at all” ( b: ). i am not willing to allow that the distinctiveness of cronon’s position is purely metaphorical. i find much of value in demeritt’s account ( b) of the consequences of various metaphors of nature in the work of cronon and, particularly, of wor- ster. demeritt suggests that there are ontological and epistemological chasms between the environ- mental historians’ metaphor of nature as an active agent and the new cultural geographers’ metaphor of landscape as text. the two positions see differ- ent things and accept different procedures of ex- emplification and verification. this particular distance may well be reduced by searching for a common metaphorical ground, one that demeritt believes can be taken from the work of bruno latour and donna haraway, where he finds “a new language to describe nature as both a real actor in human history and as a socially con- structed object of these histories” ( b: ). demeritt claims to show that cronon’s treatment of ecology as not simply a metaphor but an objec- tive account of first nature, illustrates the dangers haraway finds in naïve realism. yet, as demeritt notes also ( b: ), haraway is equally harsh about naïve relativism, dismissing both realism and relativism as “god-tricks” ( : ). to abandon truth with a capital “t” still leaves one with the truth claims of “partial perspectives” to be evaluated on the basis of “shared conversa- tions in epistemology”. taking up the invitation implicit in the “cyborg vision”, we can explore further a shared conversation between marx and cronon about the nature of the colonial ameri- can economy. we might talk about the knowledge they articulate and not only about the different situations from which they speak. . there are, of course, alternatives to both cronon and marx. two recent studies of the transforma- tion of the colonial and postcolonial agrarian of new england illustrate the same issues about the interplay between norms and narratives. mer- chant ( ) emphasizes the relationship be- tween changing ideas about the place of women in nature, on one hand, and changing systems of property relations on the other. proletarianization, for merchant, is a response to the inherent con- tradictions of this new ideological and legal order. in contrast to the socialist feminism of merchant, rothenberg ( ) advocates on behalf of the productivity gains achievable under a market economy. merchant sees a better future in the supercession of “[p]atriarchy, capitalism, and the domination of nature” ( : ), whereas rothenberg holds up the success of capitalist ag- riculture in postcolonial new england as a posi- tive example of the benefits of market relations, an example, she is happy to find, many formerly socialist countries now following. . since i am critical of what i see as the central normative concerns in worster’s work, i should immediately add that i think his politics lead him more frequently to overstatement than misstate- ment, although examples of the latter can be found. furthermore, not all his work is consistent with what might be termed his central line of reasoning. he has expressed doubts himself about his ecological model ( b) and has developed a much more nuanced argument about the role of culture in some places (see, especially, d). . i owe this observation to bill cronon. . rose ( : ), in reviewing the condition of postmodernity, criticizes harvey’s “constant paren- thetic incantation of ‘and women, blacks and other oppressed groups.’ ” examples of this inade- quate parenthetical political correctness abound in philo and kearns ( ). . now, however, limerick seems less confident about the possibility of regional identities and shared regional pasts serving as a sort of social glue: “ten years ago, by sheer will, i was able to see in region a form of loyalty and identification that could cross over the barriers of race, ethnic- ity, gender, and, most astonishing, class. now i the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t strain to see even the outlines of that vision of union through region, or through anything else” ( : – ). references aron, s. . lessons in conquest: towards a greater we s t e rn h i s to r y . pacific historical review : – . benhabib, s. . critique, norm, and utopia: a study of the foundations of critical theory. new york: columbia university press. ———. . situating the self: gender, community and postmodernism in contemporary ethics. new york: routledge. berkhofer, r. . the political context of a new i n d i a n h i s t o r y . pacific historical review : – . bogue, a. g. . an agricultural empire. in the oxford history of the american west, ed. c. a. milner ii, c. a. o’connor, and m. sandweiss, pp. – . oxford: oxford university press. corbridge, s. . marxisms, modernities and mo- ralities: development praxis and the claims of distant strangers. environment and planning d: society and space : – . cronon, w. . changes in the land: indians, colo- nists, and the ecology of new england. new york: hill and wang. ———. . modes of prophecy and production: placing nature in history. journal of american history : – . ———. – . landscape and home: environ- mental traditions in wisconsin. wisconsin maga- zine of history : – . ———. a. nature’s metropolis: chicago and the great west. new york: w. w. norton & co. ———. a. foreword. in land use, environment, and social change: the shaping of island county, washington, nd ed., ed. r. white, pp. xi–xvi. seattle: university of washington press. ———. b. kennecott journey: paths out of town. in under an open sky: rethinking america’s west- ern past, ed. w. cronon, g. miles, and j. gitlin, pp. – . new york: w. w. norton & co. ———. c. a place for stories: nature, history, and narrative. journal of american history : – . ———. d. telling tales on canvas: landscapes of frontier change. in discovered lands, invented pasts: transforming visions of the american west, ed. j. d. prown, pp. – . new haven: yale univer- sity press. ———. a. on totalization and turgidity. an- tipode : – . ———. b. cutting loose or running aground? journal of historical geography : – . ———. a. introduction: in search of nature. in uncommon ground: toward reinventing nature, ed. w. cronon, pp. – . new york: w. w. norton & co. ———. b. the trouble with wilderness; or, get- ting back to the wrong nature. in uncommon ground: toward reinventing nature, e d . w. cronon, pp. – . new york: w. w. norton & co. cronon, w.; miles, g.; and gitlin, j. . becoming west: toward a new meaning for western his- tory. in under an open sky: rethinking america’s western past, ed. w. cronon, g. miles, and j. gitlin, pp. – . new york: w. w. norton & co. cronon, w., and white, r. . indians in the land. american heritage / : – . cutler, a.; hindess, b.; hirst, p.; and hussain, a. . marx’s “capital” and capitalism today, vol. . lon- don: routledge & kegan paul. demeritt, d. a. ecology, objectivity and critique in writings on nature and human societies. jour- nal of historical geography : – . ———. b. the nature of metaphors in cultural geography and environmental history. progress in human geography : – . engels, f. [ ]. socialism: utopian and scientific. london: bookmarks. graham, j. . theory and essentialism in marxist geography. antipode : – . gulliford, a. . exhibition review. the west as america: reinterpreting images of the frontier, – , national museum of american art, smithsonian institution, washington. journal of american history : – . haraway, d. . simians, cyborgs, and women: the reinvention of nature. london: routledge. harris, c. . from turner and von thünen to marx and leopold. antipode : – . harvey, d. . justice, nature and the geography of difference. oxford: blackwell. hawthorn, g. . plausible worlds: possibility and understanding in history and the social sciences. cambridge: cambridge university press. hirst, p. . an answer to relativism. new forma- tions : – . holthaus, g.; limerick, p. n.; and wilkinson, c. f. . introduction. in a society to match the scenery: personal visions of the future of the ameri- can west, ed. g. holthaus, p. n. limerick, c. f. wilkinson, and e. s. munson, pp. – . boulder: university press of colorado. horkheimer, m., and adorno, t. w. [ ]. the dialectic of enlightenment. london: verso. hughes, r. . culture of complaint: the fraying of america. london: harpercollins. jackson, r. h. . land use in america. london: edward arnold. jones, e. . growth recurring: economic change in world history. oxford: clarendon press. kay, j. . western women’s history. journal of historical geography : – . kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t ———. . the future of historical geography in the united states. annals of the association of american geographers : – . ———. . landscapes of women and men: re- thinking the regional historical geography of the united states and canada. journal of historical geography : – . kearns, g. a. closed space and political practice: halford mackinder and frederick jackson turner. environment and planning d: society and space : – . ———. b. making space for marx. journal of historical geography : – . limerick, p. n. . desert passages: encounters with the american deserts. albuquerque: university of new mexico press. ———. . the legacy of conquest: the unbroken past of the american west. new york: w. w. norton & co. ———. a. the trail to santa fe: the unleashing of the western public intellectual. in trails: to- ward a new western history, ed. p. n. limerick, c. a. milner ii, and c. e. rankin, pp. – . lawrence: university of kansas press. ———. b. persistent traits and the persistent historian: the american frontier and ray allen billington. in writing western history: essays on major western historians, ed. r. w. etulain, pp. – . albuquerque: university of new mex- ico press. ———. c. what on earth is the new western history? in trails: toward a new western history, ed. p. n. limerick, c. a. milner ii, and c. e. rankin, pp. – . lawrence: university of kan- sas press. ———. d. progress or decline? judging the his- tory of western expansion. in a society to match the scenery: personal visions of the future of the american west, ed. g. holthaus, p. n. limerick, c. f. wilkinson, and e. s. munson, pp. – . boulder: university press of colorado. ———. a. the multicultural islands. american historical review : – . ———. b. second views and second thoughts: mark klett and the re-exploration of the ameri- can west. in revealing territory: photographs of the southwest by mark klett, m. klett, pp. – . albuquerque: university of new mexico press. ———. c. the case of the premature departure: the trans-mississippi west and american his- tory textbooks. journal of american history : – . ———. d. making the most of words: verbal activity and western america. in under an open sky: rethinking america’s western past, ed. w. cronon, g. miles, and j. gitlin, pp. – . new york: w. w. norton & co. ———. e. disorientation and reorientation: the american landscape discovered from the west. journal of american history : – . ———. a. dancing with professors: the trouble with academic prose. new york times book re- view, october : – . ———. b. precedents to wisdom. montana: the magazine of western history / : – . ———. a. the adventures of the frontier in the twentieth century. in the frontier in american culture, ed. j. r. grossman, pp. – . berkeley: university of california press. ———. b. haunted by rhyolite: learning from the landscape of failure. in the big empty: essays on western landscapes as narrative, ed. l. engel, pp. – . albuquerque: university of new mex- ico press. ———. . region and reason. in all over the map: rethinking american regions, e. l. ayers, p. n. limerick, s. nissenbaum, p. s. onuf, pp. – . baltimore: johns hopkins university press. limerick, p.; milner, c. a.; and rankin, c. e. . preface. in trails: toward a new western history, ed. p. n. limerick, c. a. milner ii, and c. e. rankin, pp. ix–xv. lawrence: university of kan- sas press. lindstrom, d. and sharpless, j. . urban growth and economic structure in antebellum america. research in economic history : – . marx, k. a[ ]. capital: a critique of political economy, vol. . moscow: progress publishers. ———. b[ – ]. conspectus of bakunin’s “statism and anarchy.” in the first international and after, k. marx, pp. – . harmondsworth, u.k.: penguin books. ———. [ ]. economic and philosophical manuscripts. in early writings, k . m a r x , pp. – . harmondsworth, u.k.: penguin books. ———. [ ]. capital: a critique of political economy, vol. . harmondsworth, u.k.: penguin books. mcwilliams, c. . factories in the field: the story of migratory farm labor in california. santa barbara, ca: peregrine. meinig, d.w. . the shaping of america: a geo- graphical perspective on years of history, vol. : atlantic america, – . new haven, ct: yale university press. ———. . the shaping of america: a geographical perspective on years of history, vol. : continen- tal america – . new haven, ct: yale university press. merchant, c. . ecological revolutions: nature, gender, and science in new england. chapel hill: university of north carolina press. ———. . gender and environmental history. journal of american history : – . ———. . william cronon’s “nature’s metropo- lis.” antipode : – . morris, p. . where is the american west? creating a base map for a new regional history. paper the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t presented at the association of american geog- raphers annual meeting, san francisco. mouffe, c. . the return of the political. london: verso. nash, g. b.; crabtree, c.; and dunn, r. e. . history on trial: culture wars and the teaching of the past. new york: a. a. knopf. nostrand, r. l. . the hispano homeland. norman: university of oklahoma press. novick, p. . the noble dream: the “objectivity” question and the american historical profession. cambridge: cambridge university press. page, b., and walker, r. . “nature’s metropolis”: the ghost dance of christaller and von thünen. antipode : – . philo, c., and kearns, g. . culture, history, capi- tal: a critical introduction to the selling of places. in selling places: the city as cultural capi- tal, past and present, pp. – . london: pergamon. pisani, d. . to reclaim a divided west: water, law, and public policy, – . albuquerque: uni- versity of new mexico press. p u d u p , m. b. . tra d i n g p l ac e s . antipode : – . rawls, j. . a theory of justice. oxford: oxford university press. rose, g. . book review: d. harvey, condition of postmodernity, and e. soja, postmodern geogra- phies. journal of historical geography : – . rothenberg, w. b. . from market-places to a mar- ket economy: the transformation of rural massa- chusetts, – . chicago: university of chicago press. rudnik, l. . re-naming the land: anglo expatri- ate women in the southwest. in the desert is no lady: southwestern landscapes in women’s writing and art, ed. v. norwood and j. monk, pp. – . new haven: yale university press. sauer, c. . the agency of man on earth. in man’s role in changing the face of the earth, ed. w. i. thomas, pp. – . chicago: university of chi- cago press. saunders, r. h., and marston, s. a. . review of william cronon’s nature’s metropolis. antipode : – . scott, j. . gender and the politics of history. new york: columbia university press. shoemaker, n. . regions as categories of analysis. perspectives. american historical association news- letter / : – . slotkin, r. . gunfighter nation: the myth of the frontier in twentieth-century america. new york: harpercollins, harper perennial. smith, d. . geography and social justice. oxford: blackwell. stegner, w. . one nation. boston: houghton mifflin. szasz, f. m., and szasz, m. c. . religion and spirituality. in the oxford history of the american west, ed. c. a. milner ii, c. a. o’connor, and m. sandweiss, pp. – . oxford: oxford univer- sity press. thompson, e. p. . the making of the english working class, rev. ed. harmondsworth, u.k.: penguin. thrift, n. . taking aim at the heart of the region. in human geography: society, space and social science, ed. d. gregory, r. martin, and g. smith, pp. – . london: macmillan. tribe, k. . genealogies of capitalism. london: macmillan. truettner, w., and nemerov, a. . what you see is not necessarily what you get: new meaning in images of the old west. montana: the maga- zine of western history / : – . walton, j. . western times and water wars: state, culture, and rebellion in california. berkeley: uni- versity of california press. white, r. . the winning of the west: the expan- sion of the western sioux in the eighteenth and nineteenth centuries. journal of american history : – . ———. . land use, environment, and social change: the shaping of island county, washington. seattle: university of washington press. ———. . the roots of dependency: subsistence, environment, and social change among the choctaws, pawnees, and navajos. lincoln: univer- sity of nebraska press. ———. . american environmental history: the development of a new historical field. pacific historical review : – . ———. . frederick jackson turner. in historians of the american frontier, ed. j. r. wunder, pp. – . new york: greenwood press. ———. a. environmental history, ecology, and meaning. journal of american history : – . ———. a. the middle ground: indians, empires, an d re p ub l i c s i n t h e g rea t la k es reg io n, – . cambridge: cambridge university press. ———. b. “it’s your misfortune and none of my own”: a new history of the american west. nor- man: university of oklahoma press. ———. c. trashing the trails. in trails: toward a new western history, ed. p. n. limerick, c. a. milner, and c. e. rankin, pp. – . lawrence: university press of kansas. ———. a. preface to the edition. in land use, environment, and social change: the shaping of island county, washington, nd ed., r. white, pp. xvii–xix. seattle: university of washington press.. ———. b. discovering nature in north america. journal of american history : – . ———. c. “far west. see also frontier”: the “new western history,” textbooks, and the u.s. history survey course. perspectives. american his- torical association newsletter / : , – . kearns d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t ———. a. animals and enterprise. in the oxford history of the american west, ed. c. a. milner ii, c. a. o’connor, and m. sandweiss, pp. – . oxford: oxford university press. ———. b. frederick jackson turner and buffalo bill. in the frontier in american culture, ed. j. r. grossman, pp. – . berkeley: university of cali- fornia press. ———. . “are you an environmentalist or do you work for a living?”: work and nature. in uncommon ground: toward reinventing nature, ed. w. cronon, pp. – . new york: w. w. norton & co. willems-braun, b. . buried epistemologies: the politics of nature in (post)colonial british co- lumbia. annals of the association of american ge- ographers : – . williams, m. . the relations of environmental history and historical geography. journal of his- torical geography : – . wishart, d. . an unspeakable sadness: the dispos- session of the nebraska indians. lincoln: university of nebraska press. ———. . the selectivity of historical presenta- tion. journal of historical geography : – . wittfogel, k. . oriental despotism: a comparative study of total power. new haven, ct: yale univer- sity press. wolff, r. d., and resnick, r. s. . economics: marxian vs. neoclassical. baltimore: johns hop- kins university press. worster, d. . nature’s economy: a history of eco- logical ideas. sierra club books, cambridge: cam- bridge university press, . ———. . dust bowl: the southern plains in the s. oxford: oxford university press. ———. . rivers of empire: water, aridity, and the growth of the american west. new york: random house, pantheon books; oxford: oxford univer- sity press, . ———. a. transformations of the earth: toward an agroecological perspective in history. journal of american history : – . ———. b. seeing beyond culture. journal of american history : – . ———. . beyond the agrarian myth. in trails: toward a new western history, ed. p. n. limerick, c. rankin, and c. a. milner ii, pp. – . lawrence: university of kansas press. ———. a. cowboy ecology. in under western skies: nature and history in the american west, d. worster, pp. – . oxford: oxford university press. ———. b. new west, true west. in under west- ern skies: nature and history in the american west, d. worster, pp. – . oxford: oxford university press. ———. c. a country without secrets. in under western skies: nature and history in the american west, d. worster, pp. – . oxford: oxford university press. ———. d. the black hills: sacred or profane? in under western skies: nature and history in the american west, d. worster, pp. – . oxford: oxford university press. ———. a. the nature we have lost. in the wealth of nature: environmental history and the ecological imagination, d. worster, pp. – . ox- ford: oxford university press. ———. b. the ecology of order and chaos. in the wealth of nature: environmental history and the ecological imagination, d. worster, pp. – . oxford: oxford university press. worster, d.; armitage, s.; malone, m. p.; weber, d. j.; and limerick, p. n. . the legacy of conquest by patricia nelson limerick: a panel of appraisal. western historical quarterly : – . yeo, s. . state and anti-state: reflections on social forms and struggles from . in capi- talism, state formation and marxist theory, ed. p. corrigan, pp. – . london: quartet books. correspondence: department of geography, university of cambridge, downing place, cambridge cb en, u.k. the virtuous circle d ow nl oa de d by [ m ay no ot h u ni ve rs it y l ib ra ry ] at : a ug us t res .. religious studies http://journals.cambridge.org/res additional services for religious studies: email alerts: click here subscriptions: click here commercial reprints: click here terms of use : click here (ad-)ventures in faith: a critique of bishop's doxastic- venture model amber l. griffioen religious studies / firstview article / november , pp - doi: . /s x, published online: november link to this article: http://journals.cambridge.org/abstract_s x how to cite this article: amber l. griffioen (ad-)ventures in faith: a critique of bishop's doxastic-venture model. religious studies, available on cjo doi: . /s x request permissions : click here downloaded from http://journals.cambridge.org/res, ip address: . . . on nov (ad-)ventures in faith: a critique of bishop’s doxastic-venture model amber l. griffioen department of philosophy, university of konstanz, po box , konstanz, germany e-mail: amber.griffioen@uni-konstanz.de abstract: while some philosophical models reduce religious faith to either mere belief or affect, more recent accounts have begun to look at the volitional component of faith. in this spirit, john bishop has defended the notion of faith as a ‘doxastic venture’. in this article, i consider bishop’s view in detail and attempt to show that his account proves on the one hand too permissive and on the other too restrictive. thus, although the doxastic-venture model offers certain advantages over other prominent views in the philosophy of religion, it still falls short of providing us with an ultimately satisfactory account of religious faith. introduction the current literature in the philosophy of religion contains no shortage of models of religious faith. while some models attempt to reduce faith to mere belief or mere affect, more recent accounts have turned their attention to the volitional component of faith, maintaining that it also appears to involve a willing risk of some kind. in this spirit, john bishop has defended the notion of theistic faith as a ‘doxastic venture’. in what follows, i will consider bishop’s view in detail and show that it falls short on its own terms. i will argue that bishop’s account proves on the one hand too permissive and on the other too restrictive. thus, although the doxastic-venture model of faith has certain advantages over other prominent views in the philosophy of religion, it still falls short of providing us with an ultimately satisfactory account of religious faith. faith as doxastic venture against accounts that reduce faith to something merely passive and receptive (e.g. faith as a matter solely of belief or of affect), john bishop religious studies, page of © cambridge university press doi: . /s x http://crossmark.crossref.org/dialog/?doi= . /s x&domain=pdf (, , ) has plausibly proposed that faith contains an essentially volitional component. for bishop, this amounts to understanding faith as involving a practical commitment to certain religious beliefs which one recognizes as going beyond the evidence, an endeavour he calls doxastic venture. ‘people make a doxastic venture’, he writes, ‘if and only if they take to be true in their practical reasoning a proposition, p, that they believe to be true, while recognizing that it is not the case that p’s truth is adequately supported by their total available evidence’. here, it is important to note the distinction bishop makes between holding and taking a proposition to be true. holding p to be true denotes a person’s being ‘in a psychological state that counts as a belief that p’. taking p to be true, on the other hand, refers to a person’s wilfully employing p ‘as a true premise in reasoning’. over the former, bishop claims, we have little to no direct control, though we may at times exercise indirect control over our belief- acquisition and maintenance. however, he argues that we do often have direct control over which propositions we choose to employ in our reasoning – especially in our practical reasoning. that is, we have direct control over those propositions we take to be true. of course, it is natural and habitual that the propositions we take to be true in our reasoning are those we actually believe, but these may come apart, as when one resists the workings of a prejudice or bias of which one is aware, or when a person with deep underlying trust issues nevertheless decides to entrust a friend with a secret, despite being unable to shake off the feeling that no one can really be trusted. in such cases, bishop maintains, the subject does not allow a particular belief she holds to do the work in her reasoning that it would normally do. the same may be said when we are required to bracket or downplay certain beliefs we may hold e.g. when serving on a jury or performing a scientific experiment or enjoying a science-fiction movie. here, allowing our beliefs about reality to play their normal role in our reasoning might mean undermining the rules, objectivity, or even the very possibility of the activities in question. thus, there appears to be something voluntary about the taking-to-be-true relation that does not obtain of the holding-to-be-true relation. as bishop puts it, ‘our wider capacity to decide what propositions to take to be true in our reasoning (and what weight to give their truth) can be deployed as a capacity for control over our beliefs – a locus of direct voluntary control over how beliefs are used in practical reasoning’. however, faith as bishop understands it differs from the examples cited above, since the latter represent cases in which the subject’s voluntarily adopted reasoning process reflects something other than what she actually believes. to count as a fully doxastic venture, he claims, the faith- proposition the subject takes to be true in her practical reasoning must match up with the belief she actually holds – and it must do so despite the subject’s awareness that this requires going beyond what is supported by the evidence. further, bishop maintains that the faith-proposition in question must be affirmed a m b e r l. g r i f f i o e n ‘with full weight’ in the subject’s practical reasoning, i.e. ‘with the kind of weight that naturally’ – though, as we shall see, not necessarily – ‘goes along with straight- forwardly believing that it is true’. thus, a proposition only affirmed tentatively, hypothetically, or presumptively in one’s practical reasoning will disqualify an exercise of the above capacity from counting as a fully doxastic venture, even if the proposition does correspond to a belief one actually holds. according to bishop, then, faith is doxastic in so far as it involves ‘a specific capacity for a [doxastic] control that . . . may be used to determine whether or not beliefs qua held attitudes get given their due weight in salient practical reasoning’. and it is a venture in so far as it involves taking the epistemic risk of knowingly going beyond the evidence. likewise, faith remains receptive in so far as one does not generally have direct control over what one believes, but it is active in so far as it involves one’s wilfully allowing beliefs that go beyond the evidence to play a role in one’s practical reasoning. despite the former, more passive aspect of faith, over which we have little control, bishop maintains that faith is (or ‘should be’) ‘broadly reasonable in the sense that exercising the capacity for faith should be in harmony with the exercise of our rational capacities’. (this rules out those fideist views on which it is a mark of faith that it be either irrational or arational.) indeed, that religious faith may be both practically and epistemically rational turns out to be crucial for bishop. he argues that since religious beliefs have a morally significant impact on our actions and ways of living, ‘the question of the justifiability of taking a religious belief to be true in one’s practical reasoning is ultimately a moral question’. but bishop’s ethics of belief lead him to tie the morality of faith to its rationality via his endorsement of what he calls the moral-epistemic link principle – namely that ‘people are morally entitled to take their beliefs to be true only if they are epistemically entitled to do so’. so if the kind of venturing necessarily involved in faith turns out to be epistemically irrational, it will also thereby lack moral standing. and any theory that is forced to characterize faith as necessarily immoral (or at least as never morally justified) would appear to have a prima facie strike against it from the very beginning. in short, although the notion of faith as doxastic venture highlights the importance of the volitional element of faith, it does so at the risk of losing the rational element. but if the rational element is lost, by bishop’s standards so is the morality of faith. thus, it will be important to look more closely at the way in which bishop justifies the rationality of faith to see if the doxastic-venture model can be successful. is doxastic venture rational? as we have just seen, since the account of faith bishop proposes involves an ‘active venture in practical commitment’ to certain theistic faith-beliefs, and given that these theistic faith-beliefs ‘pervasively influence how people live’, (ad-)ventures in faith such commitments are open to moral evaluation. yet given the moral-epistemic link principle cited above, the burden is on bishop to show that such doxastic ventures can be epistemically rational in a way that still allows them to be venturesome. to this end, bishop makes two argumentative moves aimed at denying the central thesis of epistemic evidentialism, which claims that the rationality of a practical commitment to a belief (or, what is more or less the same: a person’s entitlement in holding it and employing it in her practical reasoning) rests upon that belief’s being evidentially justified. first, he argues that classical theism is ‘evidentially ambiguous’. second, he employs a strategy borrowed from william james to argue that where the evidence is ambiguous, it is rationally permissible to believe on a ‘passional’ basis. i shall discuss each of these moves in turn. according to bishop, subjects are evidentially justified in holding that p ‘if and only if they hold p to be true on the basis of adequate evidential support for p’s truth’. further, bishop maintains, epistemic evidentialism claims that evidential justification (and only evidential justification), understood in this way, can confer epistemic entitlement. of course, what it means to ‘hold p to be true on the basis of adequate evidential support for p’s truth’ is debatable, but bishop focuses primarily on ‘rational empiricist evidential practice’, since this is the framework within which many philosophers have assumed the evidential support for the truth of faith-beliefs should be evaluated. there are many reasons to question the plausibility of the thesis regarding rational empiricist evidential justification and thus of any version of epistemic evidentialism that rests on it. however, bishop departs from typical externalist and reformed epistemological approaches to denying or modifying this kind of evidentialism, since he is largely concerned with the rationality of faithful believers, not of the per se worth of the beliefs held. here, bishop is concerned (i think, rightly) with the more ‘agency-focused’ notion of entitlement, as opposed to externalist, ‘propositional-attitude-focused’ theories about justification. moreover, even in so far as evidentialist accounts themselves attach an ‘evidentialist imperative’ to justification, he notes that most discussions understand it as ‘a principle about the proper use of our indirect control over the formation, retention, and revision of our beliefs’ – that is, about the aetiology and maintenance of our beliefs. bishop, however, claims that ‘the evidentialist imperative should be construed as applying also – and, indeed, primarily – to our direct control . . . over what we take to be true (and with what weight) in our practical reasoning’. for our concerns here, it is sufficient to note that bishop maintains that there is good reason to suppose that classical theism is evidentially ambiguous, such that ‘the question of god’s existence is left open – perhaps even necessarily – because our overall evidence is equally viably interpreted either from a theistic or an atheistic perspective’. this is clearly not an uncontroversial claim, and there are parties of both theist and atheist persuasions that would vehemently a m b e r l. g r i f f i o e n reject it. however, bishop counters that ‘the fact that, after centuries of debate, equally intelligent and well-informed thinkers continue to disagree about how to assess the evidence for and against god’s existence does suggest . . . that the evidence on this question is indeed ambiguous’. if this is right (and it seems plausible to think it at least might be), then any account of faith resting on a version of ‘rational empiricist epistemic evidentialism’ as described above would represent a kind of irrationalist fideism, since no reflective faith-believer would be justified in holding a belief in the existence of the god of classical theism and thus would not be entitled to take the proposition ‘god exists’ to be true in her practical reasoning. further, given the moral-epistemic link principle, such a taking-to-be-true would also represent a moral failure (or, at the very least, would lack moral justification). thus, bishop must show that there are rationally legitimate ways of believing (or practically committing oneself to beliefs) that go beyond what the evidence supports. bishop’s suggestion for saving the rationality of this ‘venture’-component of faith is to take a page from william james’s playbook. he suggests that, in forced situations of genuine import in which the evidence is recognized to be ambiguous, one may legitimately believe in non-evidentially caused ways – what bishop, following james, calls passionally caused believing. passional causes may include such phenomena as emotions, wishes, desires, evaluative beliefs, affections, affiliations, and so on. this understanding of the doxastic venture, however, places two main constraints on the passional believer. first, the situation must present the believer with a genuine option, understood here in the jamesian sense. that is, it must represent a living, forced, and momentous option for belief. if the relevant option is of no significant personal or existential import to the agent, or if there is a way to ‘slip between the horns’ of the dilemma non-passionally, there is no legitimate opportunity for doxastic venture. second, bishop notes that ‘doxastic venture can be defended . . . only against the background of a general acceptance of evidentialism’. he maintains that ‘options that can be decided by rational assessment of one’s evidence fall under the moral evidentialist imperative’ and are thus not candidates for legitimate doxastic venture. indeed, bishop goes so far as to claim that – at least as far as faith-ventures are concerned – the jamesian doxastic-venture model of faith requires that the faith- believer must correctly recognize that the proposition in question is evidentially ambiguous. this ‘recognition-criterion’ is of no small import to bishop’s account, as it rules out certain candidates for faith on the doxastic-venture model. first, it excludes ambivalent believers. bishop maintains that he is only concerned with ‘reflective’ faith-believers, so those subjects who simply do not care about the evidential status of the propositions in question, or those who have simply never asked such questions, are not candidates for doxastic venture in the context of faith: ‘the venturing involved in doxastic venture is conscious venturing’. yet not only (ad-)ventures in faith must such faith-believers reflectively judge the proposition in question to be evidentially ambiguous, they must do so correctly. ‘so’, bishop writes, reflective faith-believers who incorrectly judge that their beliefs lack support and then commit themselves to their truth will not in fact be making doxastic ventures. and those who incorrectly judge the truth of their beliefs to be evidentially well supported, will in fact venture beyond their evidence in taking them to be true, contrary to their conscious understanding of their situation. these caveats may appear surprising at first, and i do not think they are unproblematic, as i discuss below. but first we must understand just why bishop thinks these qualifications are important for his account. since, for bishop, the moral justifiability of a faith-belief rests on the agency-focused notion of epistemic entitlement, agents who are not epistemically reflective and just ‘happen’ to believe passionally without any views on the nature of the evidence do not ‘do’ anything for which they could be considered rational or irrational, and thus epistemic entitlement does not obviously appear to apply. in other words, the unreflective believer doesn’t venture anything, since there is no awareness on his part of the risk he might be taking. interestingly, the same will be true of the reflective faith-believer who judges incorrectly that he has adequate evidential support for his faith-beliefs. he, too, fails to venture anything, since there is no perceived risk involved in his belief. of course, his belief itself is in fact risky, since unbeknownst to him it goes beyond what the evidence actually supports, but his believing it (or practically committing himself to it) is not. what about the (potentially hyper-reflective) faith-believer who incorrectly judges that her belief lacks evidential support and yet nevertheless practically commits herself to it? she does seem to take a conscious risk, just as the faith- believer who gets it right does. my suspicion here is that bishop does not want to count such endeavours as doxastic ventures, since in reality nothing is risked. although the believer sees herself as venturing doxastically, she doesn’t actually venture anything – like a trapeze artist who doesn’t realize there is a safety net below her. such an individual might turn out to be a wishful believer or self- deceiver or other type of doxastic ‘adventurer’ (since she does, in fact believe passionally), but she does not engage in doxastic venture, in so far as there is nothing really at stake. finally, the restriction on faith-ventures that the believer correctly identify the proposition in question as evidentially ambiguous is supposed to rule out the possibility that counter-evidential ventures such as self-deception (which would certainly be doxastically venturesome!) count as instances of faith. for bishop, faith is a supra-evidential enterprise (in going beyond the evidence) but not a counter-evidential one. thus, agents who correctly identify the evidence as indicating the falsity of a certain faith-proposition yet try to believe in the face of that evidence may venture doxastically, but not in the sense required for epistemically (and thus for morally) legitimate faith. a m b e r l. g r i f f i o e n as we have seen, bishop’s claim is that practically committing oneself to certain faith-propositions that go beyond the evidence can be epistemically rational, provided they represent genuine options for the agent, who correctly assesses them as being evidentially undecidable. this, of course, opens the door for the possibility that supra-evidential faith ventures may also be morally justifiable. however, bishop’s account of faith is not without its problems. first, it is not so clear that doxastic venturers will always be as epistemically ‘in the clear’ as bishop seems to think they are, for the threat of self-deception still looms large – and with it worries about the rationality (and thus, by bishop’s own account, the morality) of faith-believers. that is, bishop’s criteria for what counts as faith might allow for cases that might give us (or should at least give bishop himself) pause. second, and perhaps more importantly, bishop’s account appears to rule out certain candidates for religious faith that we might think quite naturally fall under this term. it is to these issues i now turn. the doxastic venture model is too permissive: worries about self- deception before raising a few objections to bishop’s account, i think it important to note that the doxastic-venture model of faith has a distinct advantage over accounts that reduce religious faith to mere passive, affective responses to the divine, or to rational belief on religious matters in accordance with the evidence, since it observes that faith is also something active, something risky, something for which we are potentially responsible. that is, it rightly moves faith towards the realm of the practical. nevertheless, bishop appears to want to have his cake and eat it too by entrenching that move firmly in the realm of the doxastic. indeed, he ultimately still understands faith as resting on epistemic rationality. yet it is not clear that this really reflects what we take to be special and significant about religious faith. further, it is precisely this requirement that might get the account into trouble on its own terms. the nature and scope of self-deception is itself philosophically contested, but it is generally agreed that it represents a paradigm case of epistemic irrationality, in which subjects acquire or maintain a favoured belief in the face of strong evidence to the contrary. there are a few ways in which self-deception might appear to threaten bishop’s account. first, one might worry that, in a pascalian- type manoeuvre, one could undertake a self-deceptive project for prudential (i.e. passional) reasons aimed at putting oneself in an emotional (or other passional state) that is likely to induce religious belief in oneself. however, bishop explicitly claims that the doxastic venture he has in mind does not apply to cases in which subjects undertake self-deception as a means of passionally acquiring a belief: engaging in such self-manipulation is not doxastic venturing . . . intentionally inducing passional causes for a certain belief in order to satisfy an essentially non-epistemic desire (ad-)ventures in faith to have that belief . . . does not amount to doxastic venture on my present account. on my present account . . . there can be occasion for doxastic venture only if there is already a passionally caused tendency to hold the proposition concerned to be true. thus, bishop adds in a footnote, pascalian endeavours ‘are not themselves to be identified as doxastic ventures’, though they may ‘bring about the occasion for doxastic venture’ if pascal’s strategy works and a theistic belief has thereby been passionally induced. of course, although bishop may exclude pascalian strategies aimed at acquiring passional beliefs from themselves counting as fully doxastic ventures, it is not so clear that he can rule them out as sub-doxastic ventures (which he also considers genuine faith-ventures), where subjects meet all the conditions required for fully doxastic venture, with the exception that they do not hold the relevant faith- proposition to be true. thus if the pascalian strategist aims for the passional acquisition of a religious belief, e.g. in the existence of god, and does so while correctly judging that the evidence cannot provide an answer on this question, then she will be venturing sub-doxastically. of course, if we think (as we said above) that self-deception is a form of believing (or attempting to believe) in the face of evidence to the contrary, then this kind of pascalian case might not even count as self-deception, and may even be admitted by bishop’s account as an epistemically rational undertaking which aspires to bring about the occasion for a fully doxastic venture. but the real problem for bishop is not that some pascalians may rationally come to hold passional beliefs which then become candidates for fully doxastic venture, but rather that some may irrationally do so. indeed, given bishop’s epistemic criteria for fully doxastic faith-ventures, the aetiology of one’s passional beliefs doesn’t appear to matter at all to the determination of whether one’s faith-venture is justified or not. all that matters is that i hold a particular faith-belief passionally, judge correctly that it is in principle evidentially undecidable, and then commit myself to its truth in my practical reasoning. if this were the whole view, then, it would seem that non-evidential beliefs, however they may be arrived at – e.g. via wishful thinking, self-deception, hypnosis, electroshock therapy, a bump on the head, and so on – may all be candidates for doxastic venturing, so long as they are held ‘passionally’ and paired with a correct judgement about their evidential ambiguity. however, bishop is concerned that the epistemic conditions he places on doxastic venturing do not, by themselves, go far enough to allow for moral justifiability. he thus adds two moral conditions, in order to rule out cases in which one practically commits oneself via doxastic venture to, e.g., the existence of nazi gods. first, one’s ‘non-evidential motivation for taking p to be true [must be] of a morally acceptable type’, and second, p itself must ‘conform with correct morality’. concerning the current worry regarding the aetiology of our passional beliefs, it will be the first of these two conditions that most explicitly interests a m b e r l. g r i f f i o e n us here. bishop does not give specific examples of what he takes to be ‘morally unacceptable’ motivations, claiming only that ‘we do clearly recognize that some non-evidential motivations are morally honourable, and others dishonourable’ and assuming that some general theory of virtuous non-evidential motivations is feasible. nevertheless, perhaps we can venture an answer on bishop’s behalf. it is unlikely that the general class to which a particular motivation belongs (e.g. wish, desire, evaluative belief, affection, affiliation, emotion, etc.) will determine a motivation’s virtuousness or lack thereof, rather this will more likely have to do with the content or object of the motivation. for example, religious beliefs passionally motivated by nietzschean ressentiment, a desire to dull the pain of existence, or an instinct to exclude a certain class of people might be considered vicious, whereas those motivated by the evaluative belief that ‘it would be good – supremely good, perhaps the only way the supreme good could be realized – if that faith-proposition were true’, or by a desire to open oneself up to experiences that contribute significantly to human flourishing, might be more virtuous. yet these considerations do not directly respond to the aetiology worry above. it may rule out those passional beliefs acquired via wishful thinking or self-deception that are viciously motivated, but what about those that are virtuously (or at least non-viciously) motivated? is the religious faith-believer entitled to practically committing herself to the truth of those beliefs? again, we might respond on bishop’s behalf by claiming that the agent is epistemically entitled to such faith-beliefs, so long as she correctly judges the truth of those beliefs to be evidentially ambiguous – and not before. an agent who (via a non-vicious motivation) acquired the passional belief that god exists via a self-deceptive project, which involved her coming to believe in the face of what she took to be strong counter-evidence, is not epistemically entitled to her belief or to any ventures that she should undertake with it, since this would be a counter- evidential venture, and as we have seen bishop excludes counter-evidential ventures from faith-ventures. if, on the other hand, the agent changes her mind about the force of the evidence, concluding now that it is ambiguous, it would seem that, on bishop’s view, she is now (and only now) entitled to continue to take her passional beliefs to be true, since she is no longer believing counter to the evidence. thus, what was once an irrationally (counter-evidentially) held passional belief might now be a rationally (supra-evidentially) held one. however, this leaves room for a kind of self-deceptive project that – while not itself presuming to be a faith-venture – could be employed in the service of faith. consider the case of a hyper-reflective epistemologist, call her hildy. hyper- reflective hildy was raised in a mennonite community by mennonite parents. she went to mennonite schools, attended (and still attends) mennonite churches, and so on. thus, hildy’s ‘default’ belief, so to speak, has always been a passional belief in the existence of god, one motivated by her upbringing in and her strong affiliation with the mennonite culture. however, hildy has always had an (ad-)ventures in faith inquisitive nature, and when she goes off to university she decides to study philosophy. hildy studies the major arguments for the existence of god, and to her surprise finds them relatively unconvincing (especially once she hears the objections to them). she also studies several of the ‘great atheists’, and finds their arguments significantly more persuasive. after years of study and careful consideration, she comes to the considered conclusion that the evidence points markedly against the existence of god. yet she cannot shake the feeling that god exists – and in her private life, she still attends church and takes this belief to be true in her practical reasoning. further, she reflectively believes that certain human goods could only be attained if god were to exist (but also that this fact does not itself provide sufficient evidence for god’s existence). we can imagine hildy running across bishop’s believing by faith – or perhaps, as bright as she is, gleaning the point directly from james himself. she realizes that were she able to conclude sincerely that the evidence for god’s existence is essentially ambiguous, not only could she continue to commit herself to her passional belief with good conscience, she could even be said to exercise the virtue of faith, a trait any theist would think it good to have. here, we can imagine hyper-reflective hildy embarking on a kind of self- deceptive pascalian enterprise, aimed at getting herself to believe that the evidence is ambiguous. yet to do so requires her to commit a kind of ‘epistemic sabotage’ in order to bring about a change in her evidential standards (or at least in what she takes the evidence to show). in the service of this ‘irrational project’, then, there are several strategies she may adopt. she may selectively attend to pro- jamesian-flavoured texts and ignore those likely to raise objections. she may filter through the literature, taking extensive notes on those arguments more likely to confirm her desired belief that the evidence is ambiguous and neglecting to write down any other arguments. she may be careful to try to attend anti-evidentialist conferences and thereby avoid opponents of her favoured view. she may even take on as her thesis adviser a known non-evidentialist. now although this might require hildy to be a little less hyper-reflective than she was in her earlier academic days, she may see this sacrifice as being well worth the reward. and by habituating herself to such unreflective ‘scholarly’ techniques, she may in fact successfully undermine her earlier epistemic standards, now characterizing the former as having been part of a ‘learning process’ and thereby coming to believe that god’s existence is by its very nature evidentially undecidable. in such a case, hildy will hold a passional belief that god exists, motivated by a perfectly virtuous affiliation with the mennonite tradition (together with an evaluative belief in the value of faith), and will (assuming bishop is right) correctly judge that this belief is undecidable on the evidence. she is, then, perfectly epistemically entitled by bishop’s standards to embark upon a doxastic venture and to count as believing by faith, despite her having arrived at her (correct) judgement about the status of the evidence in an epistemically irrational and a m b e r l. g r i f f i o e n irresponsible manner. yet, in this case, it would seem odd to say that hildy is entitled to her passional belief, since she arrived at this ‘entitlement’ via self-deceptive means. now, the case of hildy may (as with many philosophical examples) appear contrived, but it shows that there might be something missing in bishop’s account of faith. if the aetiology of one’s passionally held beliefs doesn’t matter, then it seems that self-deceived (or merely epistemically lucky) agents may be able to count as having faith, despite having arrived at their beliefs via epistemically suspect means. thus, bishop’s account may seem too permissive on this point. if having faith has something to do with epistemic virtue (as it appears to on bishop’s account), then we should hope that it cannot be arrived at via epistemically vicious means. the doxastic-venture model is too restrictive: unreflective and disagreeing believers whereas the above considerations point to the possibility that bishop’s doxastic-venture model of faith fails to rule out cases he himself might want to dismiss, i now want to consider the possibility that the account ends up being too restrictive. as we saw above, believers who have not reflected on the status of the evidence for their faith-beliefs appear to be excluded from the doxastic- venture model as elucidated by bishop. now bishop himself admits that he is intentionally restricting his discussion to the realm of ‘reflective faith-believers, who are interested in the question of whether they are morally justified in taking, or continuing to take, the relevant faith-beliefs to be true in their practical reasoning’. he also notes that ‘[n]ot all faith-believers are “reflective”, of course’, and he even concedes that perhaps not every faith-believer ought to be (or become) reflective: ‘a life of “simple faith” may (under some conditions, anyway) be at least blameless and even fully virtuous’. yet it is not clear here what ‘simple faith’ would look like on bishop’s view. from the outset, he has assumed that faith must essentially involve more than mere belief, since otherwise it would be merely passive and receptive. however, if faith does involve more than just believing certain propositions – if it involves a practical commitment to those propositions – then questions of moral justifiability would appear to apply to reflective and unreflective faith-believers alike, and bishop basically admits as much. but as we have seen above, given that bishop endorses the moral- epistemic link principle, it is by no means clear that unreflective faith-believers believe with epistemic entitlement, even if it turns out their faith-beliefs them- selves might be, e.g., the result of a reliable belief-forming process or otherwise have epistemic worth. so it is hard to see how such ‘simpletons’ could be said to have faith on bishop’s view, unless the kind of faith he has in mind is either (a) of a completely different kind from that of reflective faith-believers, or (b) of the same (ad-)ventures in faith kind but somehow epistemically (and thus morally) less praiseworthy. if the former, then bishop owes us an account of how ‘simple faith’ is also venture- some (and thus counts as genuine faith). if the latter, then it is unclear how the simpleton’s faith exhibits true virtue. take an example that bishop himself discusses: the case of abraham’s willingness to sacrifice isaac. abraham was surely not an analytic philosopher, let alone an epistemologist. it is doubtful whether he had any sophisticated philosophical views on the nature of the evidence. but perhaps this is not necessary for reflective doxastic venture. perhaps all that is required is an ‘inkling’ or a ‘dim awareness’ that one is believing beyond (but, importantly, not counter to) one’s evidence when one commits oneself practically to the truth of certain faith-propositions. or perhaps it is enough that the evidence actually be essentially ambiguous, regardless of what abraham believes about it, so long as he himself refrains from making a judgement one way or another regarding the evidence. but in either case, it is difficult to see how abraham makes a willing, epistemically entitled venture on bishop’s model. if he is only ‘dimly aware’ that his com- mitment outstrips his evidence, it is not clear he is epistemically entitled to make this ‘leap’. if he makes no judgement regarding the evidence whatsoever, he is unreflective, and it is unclear how he ventures anything willingly. interestingly, it is not just unreflective believers who run into problems. reflective believers who do not arrive at the same conclusions as bishop about the essential evidential ambiguity regarding, e.g., the existence of god (or other ‘fundamental principles’ of religious doxastic frameworks) do not appear capable of faith either. of course, if bishop’s view regarding the ambiguity of the evidence for religious belief is incorrect, then it appears that no one ever justifiably makes a supra-evidential doxastic venture in the realm of religious belief, and that we must be error theorists about faith. on the other hand, if bishop’s view is correct, and such fundamental framing principles are ‘essentially evidentially undecidable’, then a theist of the reformed-epistemology persuasion who thinks (pace bishop) that these fundamental theistic beliefs are properly basic, or a struggling intellectual theist like hyper-reflective hildy who concludes that the evidence against the existence of god outweighs the evidence for it, are incapable of having faith, since they have incorrect beliefs about the nature of the evidence. the former ventures without knowing it, and the latter ventures in the face of the supposed evidence – neither of which constitutes epistemically entitled belief for bishop. indeed, it would seem that many figures in the history of philosophy are excluded from counting amongst the faithful in this respect, including all those philosophers and natural theologians who have at some point claimed that there are persuasive demonstrative arguments for the existence of god, since they would be likely to deny that god’s existence is evidentially ambiguous. the doxastic-venture model appears to rule out those figures like abelard or meister eckhart, who thought that the teachings of scripture and christian doctrine were a m b e r l. g r i f f i o e n compatible with (or even, in the case of meister eckhart, equivalent to) the doctrines of the ancient philosophers, which can be arrived at through the exercise of reason and are thus rationally defensible. it would appear to exclude all those strands of islam, which claims that the signs of allah are found everywhere in creation, where failure to acknowledge these signs as evidence of god’s existence is understood as precisely what it is to reject faith. at any rate, to say that none of these individuals are persons of faith seems woefully unfair. thus we might be inclined to think that bishop’s theory of reflective faith is not inclusive enough. to be sure, no one said faith should be easy, but neither should it be so restrictive as to make it more difficult for a reflective evidentialist to pass through the eye of a needle than to be counted amongst the faithful. conclusion given what we have said above, bishop’s account of faith, while promising, ultimately appears lacking in two respects. on the one hand, it is too weak: it allows that believers who have arrived at their passional beliefs via epistemically irresponsible and even irrational means can still be said to have faith. on the other hand, it is too strong: it rules out certain individuals whom we might be inclined to include among the faithful. for these reasons, although i think bishop’s doxastic- venture model represents a superior account of faith to purely doxastic models, it cannot do everything that we require of a theory of faith. my own view is that bishop does not go far enough in distancing himself from doxastic accounts. i submit that a model which attempts more completely to dislodge the role of belief as a necessary component of religious faith may better correspond both to what we actually mean by the term ‘faith’ in many religious contexts and to something that we may strive for in our religious lives. while we might agree with bishop that faith is importantly volitional, we might do better to deny that the venturing involved in faith is purely doxastic. indeed, perhaps faith is not so much a doxastic venture, but rather a kind of imaginative adventure, one which aims at sincere, practical engagement with a religious tradition, even if that engagement lacks full- blown belief, passional or otherwise. but that is a story for another day. for now, we must perhaps agree with pop star george michael that we ought to ‘reconsider our foolish notion’ that faith has centrally to do with belief and ‘wait for something more’. references bishop, john () ‘belief as a doxastic venture’, religious studies, , –. () ‘on the possibility of doxastic venture: a reply to buckareff ’, religious studies, , –. () believing by faith: an essay in the epistemology and ethics of religious belief (oxford: clarendon press). () ‘faith’, in e. zalta (ed.) the stanford encyclopedia of philosophy (fall edition). url: http://plato. stanford.edu/archives/fall/entries/faith/. (ad-)ventures in faith http://plato.stanford.edu/archives/fall /entries/faith/ http://plato.stanford.edu/archives/fall /entries/faith/ http://plato.stanford.edu/archives/fall /entries/faith/ clark, kelly james & vanarragon, raymond j. (eds) () evidence and religious belief (oxford: oxford university press). james, william () the will to believe and other essays in popular philosophy, and human immortality (new york: dover). michel, christoph & newen, albert () ‘self-deception as pseudo-rational defense of belief’, consciousness and cognition, , –. schÄlike, julius () ‘willensschwäche und selbsttäuschung’, deutsche zeitschrift für philosophie, , –. wood, william () blaise pascal on duplicity, sin, and the fall: the secret instinct (oxford: oxford university press). notes . john bishop’s article on ‘faith’ in the stanford encyclopedia of philosophy lists at least seven broad categories, each of which has its own subcategories and variations. see bishop () for his complete list. . idem (), . . ibid., . . ibid., . . bishop allows that some faith-ventures may be sub-doxastic, in the sense that he thinks it possible to give a potential belief full weight in one’s practical reasoning without actually holding the belief to be true. however, his real interest lies in demonstrating the possibility of ‘fully doxastic venture’, where ‘the venture not only takes a faith-proposition to be true beyond the evidence with full weight in practical reasoning, but also actually holds it to be true’ (ibid., ). indeed, he seems to think that fully doxastic venture has certain advantages over merely sub-doxastic venture. i return to a discussion of the relationship between sub- and fully doxastic ventures below. . ibid., . . ibid., , emphasis removed. bishop notes that the wider capacity ‘to decide what propositions to take to be true in our reasoning’ is not, properly speaking, doxastic. nevertheless, this capacity as exercised in the narrower sense cited here, he thinks, ‘is properly described as doxastic’. . idem (), . . idem (), x. . ibid., . . i am using the term ‘irrational’ here as bishop does, namely as an ‘agency-focused notion’, not a ‘propositional-attitude-focused notion’ (cf. ibid., –). charges of irrationality attach to agents for believing or acting in certain ways, not to the attitudes or actions they adopt. there are no ‘intrinsically irrational’ propositions or acts – only irrationally believed propositions and irrationally performed actions. i will return to this point later. . ibid., . . ibid., . . ibid., . . rational empiricist evidential practice is defined here as ‘the evidential practice that assumes deductive and inductive standards for inferential evidential support, and allows as basically evident only incorrigible and self-evident truths . . . and truths evident in sensory perceptual experience under “normal” conditions’ (ibid., , ). . see ibid., . . see, e.g., clark & vanarragon () for a recent collection of essays on the relationship between evidence and religious belief. . bishop (), . . ibid., . . ibid., . . ibid., . . ibid., . . see ibid., . bishop wants to keep this category reasonably broad, so as to include most if not all non-evidentially motivated beliefs, such that passional causes need not always be non-epistemic causes (at least from an externalist point of view). . see james (), . a m b e r l. g r i f f i o e n . bishop (), . . ibid., . . see ibid., . . see ibid., . . ibid., . . ibid., . . one might claim here that such agents could be labelled as ‘irrational’ or at least ‘unentitled’ to their beliefs, in so far as they are perhaps epistemically negligent. that is, as potentially rational believers they ‘ought’ to be sensitive to questions regarding the evidence, and their lack of concern reflects a shortcoming or deficiency not found in rational believers. however, this would only strengthen bishop’s point that such believers should not be considered candidates for doxastic faith-ventures. . it is not clear here whether bishop intends each of the cases mentioned above to involve passional belief. if he does, then the belief of the subject who takes himself (incorrectly) to be evidentially justified might simply be overdetermined. in any case, there is still no venturesome risk involved. . see bishop (), . . for those ‘sola gratia’ fideists who worry about the potentially pelagian implications of such a view, it is important to note that to maintain that faith is something one does and is accountable for can easily be paired with an account of grace, e.g., as that which enables (or endows one with the capacity for) the exercise of that faith. . much of the debate in the self-deception literature revolves around the question whether ‘garden-variety’ self-deception may be said to be intentional or not. this is not necessarily germane to our discussion here, though if it turns out (as i maintain elsewhere) that self-deceivers may be said to deceive themselves intentionally, then the self-deceiver will end up being even more strongly responsible for her irrationality than on a non-intentionalist understanding of self-deception. for a plausible argument that self-deception requires believing in the face of the evidence, see michel & newen (). . of course, pascalian cases are not generally like this. rather, one aims at inducing a change in one’s epistemic standards, which would allow one to attain the necessary evidence for religious belief, thereby inducing a theistic belief for what the agent now takes to be good reasons. (i discuss a related pascalian move in the case of ‘hyper-reflective hildy’.) however, i do think some self-deceivers may go in for wishful thinking or passional belief, as described above, and it is only this kind of case that bishop explicitly addresses. one might further claim that pascalian cases do not represent instances of ‘garden-variety’ self-deception if they represent self-deception at all. i am inclined to think that at least some such cases fall under the concept of self-deception, but if the reader prefers to substitute another term (like ‘self-induced deception’) for ‘self-deception’, he or she may do so. for a lengthier discussion of pascal and self-deception, see wood (). . bishop (), . . ibid., n. . . see ibid., , . . this case should not strike one as all that far-fetched – especially among hyper-reflective subjects like analytic philosophers – since it may be more difficult for such subjects to continue to believe a proposition passionally once they have admitted the evidence for it to be essentially ambiguous. as bishop notes, the passional causes for faith-propositions must be able ‘to sustain belief even though the believer recognizes that the truth of the proposition believed lacks adequate evidential support’ (ibid., ). but for someone who once believed non-passionally on what she thought was good evidence, or someone who believed passionally but recently became reflective, this may simply be too psychologically taxing. thus, such an individual may have to engage in sub-doxastic venturing in order to get themselves into a position to engage in a fully doxastic venture. . ibid., . . ibid. . ibid., . bishop uses this as a possible motivation for sub-doxastic venture, but we can imagine it also motivating fully doxastic venture. . this might be what tips the subject’s scales in favour of deceiving herself along the lines of the james–bishop route, as opposed to that of evidentialism. it might also simply be less psychologically (ad-)ventures in faith taxing to come to believe that the evidence is ambiguous, given her current belief that the evidence supports atheism, than to believe that the evidence supports theism. . actually, in some sense she must be somewhat more careful concerning what she regards as evidence and what not. but regarding her own motivations, she must obviously pay less attention if her self-deceptive enterprise is to succeed. . success in such self-deceptive projects often hinges on purely contingent psychological and environmental factors. assuming hildy is not so hyper-reflective as to be unable to habituate herself to untoward scientific practices, and assuming no catastrophically damaging counter-evidence is able to make its way in from outside, it is not unreasonable to suppose that hildy’s self-deceptive project might be successful. for a more detailed account of self-deception as a project of epistemic sabotage, see schälike (). . of course, bishop could perhaps remedy his account by adding an additional requirement regarding the aetiology of either the faith-belief in question or the belief regarding the nature of the evidence (or both), but it is easy to see that things appear to be getting very complicated for the reflective faith-believer. . bishop (), . . ibid. . ibid., . . see ibid., –. . bishop might respond here that the moral-epistemic link principle only applies to those who reflect on their beliefs and that simple faith gets its moral justification from other sources. but this double standard might make it appear that it is not better to be ‘socrates dissatisfied’ than an ignorant or otherwise unreflective believer satisfied. indeed, if unreflective faith turns out to be easier, then it might provide me with a motivation to keep myself epistemically in the dark regarding religious propositions. . if anything, sarah seems more a proponent of strict evidentialist standards than abraham, as indicated by her laughter when told she would bear a son in her advanced age. . interestingly, what bishop himself says regarding the abraham case makes no reference to what abraham himself actually judges regarding the evidence: ‘what requires venture essentially beyond his evidence’, he writes, is abraham’s taking it to be true that the living god has his will revealed in an inner voice that commands the sacrifice of isaac . . . abraham could not have had evidence that would have enabled him to make this decision purely rationally. . . . in fact, interpreting any experience as conveying divine messages requires going beyond what could non-question-beggingly be settled on the basis of evidence. (ibid., ) . ibid., . . interestingly, bishop () claims that aquinas might be best interpreted as holding a version of the doxastic-venture model because of the latter’s insistence that faith involves not mere conviction but rather ‘inner assent’, which is ‘under the control of the will’ (ibid., ). still, even if aquinas endorses a form of doxastic-venture model, it may be quite different from bishop’s own model, since although assent may be needed for faith, the volitional act of assent does not appear to be posterior to (or have as its object) a passional belief, as on bishop’s account. further, aquinas appears to think there is sufficient evidence for the truth of at least some faith-propositions, whether this takes the form of demonstrative proof or divine revelation. indeed, bishop himself admits that interpreting aquinas as a proponent of an evidential proportion model may also be ‘viable’ (ibid., ). in any case, it is not at all clear that aquinas is not excluded by bishop’s model. . even if we restrict claims about evidential decidability to abductive, a posteriori arguments (e.g. the argument from design), it is not clear how those who think it is possible to argue a priori for the existence of god would (knowingly) risk anything doxastically, at least on bishop’s understanding of what it is to venture. . see, e.g., qur’an :: indeed, in the creation of the heavens and earth, and the alternation of the night and the day, and the [great] ships which sail through the sea with that which benefits people, and what allah has sent down from the heavens of rain, giving life thereby to the earth after its lifelessness and a m b e r l. g r i f f i o e n dispersing therein every [kind of] moving creature, and [his] directing of the winds and the clouds controlled between the heaven and the earth are signs for a people who use reason. (saheeh international translation (latest version, ) ) . however, here bishop might admit that these individuals do not have faith that god exists but maintain that they exhibit faith regarding other framing propositions (e.g. regarding specific divine attributes or commands). . i should note here, however, that for bishop faith seems much less like a general character trait or virtue than a capacity exercised in a particular circumstance or with regard to a specific proposition. thus, it seems almost inappropriate on his account to talk about a ‘person of faith’ or a ‘faithful theist’, unless this merely refers to a person whose religious commitments are undergirded or otherwise framed by cases of genuine doxastic venture. bishop himself notes in a footnote that ‘the doxastic venture model is a model of what is involved in “believing by faith” – that is, of what is involved in a certain kind of cognitive commitment essential to faith’, and that it is thus consistent with models that view faith as a virtue or disposition of character (bishop (), , n. , my emphasis). but if ‘believing by faith’ is, as bishop suggests, necessary (though perhaps not sufficient) for faith understood as a virtue, then the figures mentioned here still will not count as persons of faith, given that they do not reflectively believe by faith. still, this is not to maintain that bishop cannot respond to such worries or that i have not misunderstood the restrictions on his view. it is only to ask for more clarification on whether or not (and, if so, how) these types of believers can count amongst the faithful. . the reference is to michael’s song, ‘faith’. michael himself appears to endorse a view of faith as something like hope, but i shall save my critique of such a view for a later date. i would further like to thank jochen briesen, dina emundts, jeanine diller, russell re manning, ursula renz, and an anonymous reviewer for their comments on earlier drafts of this article, and to express my gratitude to the ‘barmherzige schwestern vom heiligen kreuz’ at kloster hegne for providing the tranquil surroundings that offered me the requisite peace of mind to get these ideas down on paper. (ad-)ventures in faith sharing the load: amish healthcare financing healthcare article sharing the load: amish healthcare financing kristyn rohrer and lauren dundes ,* department of sociology, kutztown university of pennsylvania, kutztown, pa , usa; krohr @live.kutztown.edu department of sociology, mcdaniel college, westminster, md , usa * correspondence: ldundes@mcdaniel.edu; tel.: + - - - academic editor: sampath parthasarathy received: september ; accepted: december ; published: december abstract: when settling healthcare bills, the old order amish of lancaster county, pennsylvania rely on an ethos of mutual aid, independent of the government. consonant with this philosophy, many amish do not participate in or receive benefits from social security or medicare. they are also exempted from the affordable care act of . this study expands the limited documentation of amish hospital aid, an amish health insurance program that covers major medical costs. interview data from amish adults in lancaster county depict how this aid program supplements traditional congregational alms coverage of medical expenses. the interview data delineate the structure of the program, its operation, and how it encourages cost containment and community interdependence. the manner in which the amish collaborate to pay for medical expenses provides a thought-provoking paradigm for managing health care costs. keywords: amish; obamacare; healthcare; insurance; exemptions; amish hospital aid; alms; community . introduction . . purpose of study this study amplifies the limited documentation of amish hospital aid (established in ) that helps amish members pay for health care. published reports of their unique system can also supplement understanding of the amish whose evolving code of rules and conduct (the ordnung), varies by subgroup and lacks systematic or explicit written rules. specific information about the structure of amish hospital aid and its role in how amish pay for healthcare can inform discussions of how to innovate mainstream us healthcare. . . background since , members of religious groups that conscientiously oppose social security benefits may apply for an exemption from the self-employment tax (according to the medicare segment of the social security act). the exemption applies to old order amish, and other religious groups that conscientiously object to insurance, if the sect has been in existence since december [ ]. amish are part of the “plain” community, a term that distinguishes amish and other anabaptists from outsiders who are called english, fancy people, or white folk. amish people, whose origins date back to the anabaptist movement that began in zurich, switzerland in , now live in the united states and ontario, canada. (the last amish church in europe closed in [ ]). since the amish first began to immigrate to north america in the s, their population grew to , by and to , in u.s. states [ , ]. members of exempted religious groups—including the amish—also must have a reasonable means of caring for their own elderly or dependent members, obviating the need for retirement communities or nursing homes, when each family takes care of its own [ , ]. healthcare , , ; doi: . /healthcare www.mdpi.com/journal/healthcare http://www.mdpi.com/journal/healthcare http://www.mdpi.com http://www.mdpi.com/journal/healthcare healthcare , , of amish commonly believe that commercial insurance plans undermine the religious duty of community accountability [ ]. their sense of community is strengthened by the belief that most modern technology brings a worldliness that detracts from their lifestyle. amish are increasingly likely to use telephones (even cell phones), while televisions, bicycles, gas-powered tractors, and owning vehicles are still forbidden [ ]. the exemptions allow self-employed amish to avoid paying the combined employee and employer social security tax for religious reasons (irs form : application for exemption from social security and medicare taxes and waiver of benefits is for followers of established religious groups that are “conscientiously opposed to accepting benefits of any private or public insurance that makes payments for the cost of medical care; or provides services for medical care”). amish who work for amish-owned employers were granted the same exemption in [ , ]. amish employed by businesses that are not owned and operated by amish, however, depend on a different exception—one for individuals who are part of healthcare-sharing ministries [ ]. the government describes a health care sharing ministry as “a tax-exempt organization whose members share a common set of ethical or religious beliefs and share medical expenses in accordance with those beliefs”. in addition, the ministry must reject all types of insurance, including social security and medicare, and must have been in existence and sharing medical expenses continuously since december [ ]. these exceptions do not extend to any other taxes, such as real estate taxes, state and federal income taxes, county taxes, and sales tax. the affordable care act of (obamacare) similarly allows exemptions from the requirement to obtain health care insurance for certain religious groups. to compensate for their lack of commercial insurance, the amish turn to their own community [ , ]. their way of managing medical costs includes amish hospital aid, an insurance program (that predates obamacare). this aid program—the focus of this study—is relatively unknown, but received more notice after the passage of the affordable care act in . access to those who administer and use amish hospital aid was facilitated by a mennonite member of the lancaster county community (referred to as “male relative” in this paper). . . amish vs. mennonite mennonites and amish (as well as hutterites) share the same roots as participants of the anabaptist movement, occurring shortly after the protestant reformation. the anabaptists split into different subgroups before settling in north america, though many of them settled within close proximity to one another. in lancaster county, there are few amish subgroups. it is almost exclusively old order amish who have remained together under the same doctrine of faith. this contrasts with mennonite groups and amish communities in other areas, which have experienced multiple religious splits [ ]. there are two major groups of mennonites: plain mennonites and assimilated mennonites. plain mennonites or old order mennonites are often confused with the amish, as they share many of the same religious beliefs and cultural ideologies. there are numerous different divisions of plain mennonites in lancaster county. some plain mennonites use horse and buggy for transportation (team mennonites), while others such as the black-bumper mennonites drive all-black cars (i.e., the chrome, bumpers, etc. are painted black). there are general differences in the guidelines and style of clothing, head coverings, and buggies within the plain community, distinguishing the amish from the plain mennonites. mennonites are also permitted to ride bicycles, while the amish are not. on the other hand, unlike the amish, plain mennonites believe other religious groups (including the amish and assimilated mennonites) are not “saved”. assimilated mennonites are essentially indistinguishable within mainstream society. they are allowed to wear contemporary clothing, use electricity and new technology, attain higher education, and do not live in community settings (as do the amish and plain mennonites). healthcare , , of . methods . . access to the amish the ability to interview members of the lancaster county amish community required special arrangements and stipulations given their reluctance to associate with and trust outsiders, known as “english”. this term refers to the language of outsiders that contrasts with the variant of german (called pennsylvania dutch) which amish speak among themselves (“dutch” is likely derived from the word deutsch meaning “german”, not dutch). since amish learn english in school, the interviews could be conducted in english. the first author received assistance from an assimilated mennonite male relative who has a -year career in business and is well known in the amish community for his integrity. his heritage also provided valuable insight into the amish culture (e.g., his mennonite grandfather in retirement refused to accept social security income beyond what he had paid into the system) the relative granted permission to include all of the information identifying him in this paper. the relative offered to approach and help interview contacts in the old order amish community of lancaster county, pa, usa (the largest amish community comprising about , persons) [ ]. he was able to advise the authors on factors critical to developing a rapport with amish interviewees, including norms for appropriate dress (ankle-length skirts for women), the prohibition on taking pictures of the amish (although photos of their homes are not forbidden), and scheduling norms (e.g., working around the wedding season in mid-october through mid-december, and the inability to schedule interviews more than a few days or hours ahead of time) [ ]. . . obtaining interviews after receiving irb approval from mcdaniel college on october , and in accordance with the rules of the declaration of helsinki of , the first author (accompanied by her male relative) interviewed individuals after they signed an informed consent form. the sample consisted of seven men and four women from nine separate households who had experienced major medical expenses or were heavily involved in the amish hospital aid program, including those in administrative positions. the relative specifically recruited interviewees to provide a variety of perspectives, both in administering and receiving amish hospital aid. a majority of the interviewees ( / ) had previously established a relationship with the male relative that facilitated interviewee recruitment, while the remaining respondents were referred to the male relative by initial respondents because of their knowledge of amish hospital aid (either due to having had major medical expenses or administrative involvement in the program). one respondent not previously acquainted with the male relative—an amish hospital aid administrator—sought additional clarification about the purpose of the study before he consented to the interview. the response rate among those approached was %. the individuals were told that the purpose of the study was to collect and publish data documenting how the amish manage health care needs within their own system (given their exemption to coverage mandated by obamacare). ten of the interviewees were members of the amish hospital aid plan at the time of the interviews, although one had only joined amish hospital aid subsequent to a major medical expense. as is normal among the amish, all of the respondents received a formal education only through th or th grade. the first author and her male relative conducted the interviews in the kitchen of interviewees’ homes or in their office/workspaces between – november . interview questions concerned their involvement in the program, participation in conventional medical care, and the operation of the amish hospital aid program. interviews lasted between – min and were documented by the first author with handwritten notes. healthcare , , of . results . . traditional ways of paying for health care although much of the information shared during interviews has not been previously documented, existing literature (when available) corroborated the findings. while the focus in the interviews was amish hospital aid (a type of amish insurance), respondents also discussed traditional ways their community helps with unmanageable healthcare costs that at times operate in tandem with amish hospital aid. one source of handling medical costs that exceed an individual’s ability to pay out of pocket is voluntary donations to congregations, called alms, which are in line with a tradition of sharing burdens in the amish community [ ]. alms are tithes or offerings donated to the congregation by its members. as with tithes in other christian churches, members are encouraged to give % of their annual income to the amish church district. church deacons, who are in charge of both disciplinary and financial matters in the congregation, visit members in need of medical assistance to see how they are faring and then distribute the alms as they see fit. in the case of more serious injuries, when an individual’s congregation cannot afford to pay the medical bills solely with their own alms funds, amish congregations may use community collections. community collections are a form of alms that are gathered from the alms of other amish congregations in the area. these funds can be requested at the discretion of a deacon. community collections were used when a man was paralyzed from the waist down after a diving accident. occasional auctions of donated food, furniture, quilts, and livestock can raise as much as three hundred thousand dollars in one evening to help supplement alms and/or community collection coverage of healthcare bills [ , ]. in extremely rare cases, the government has covered medical costs (e.g., when an uninsured driver hit a buggy). . . implementation of amish hospital aid amish hospital aid covers only major medical needs. in serious cases (normally when hospitalization is necessary), those who participate in the program contact the treasurer in charge of their district once they know the costs incurred or to be incurred. those requiring care typically pay the health care provider used, and amish hospital aid then reimburses them. members who are unable to pay upfront allow the board to make arrangements with the hospital or care facility, in order for the board to pay the provider directly. the first % of the bill is expected to be paid by the individual, while the other % is covered by the amish hospital aid plan. those who are unable to pay the first % often rely on alms money from their congregation. . . how amish hospital aid manages medical costs when ill, amish seek treatment at their local hospital and are billed the same as non-amish. the individual then requests help from the congregation and/or amish hospital aid for any unaffordable medical expenses (e.g., maternity complications, surgeries, head injuries, physical therapy, and geriatric care). the amish hospital aid board also works closely with bill negotiators at different hospitals and facilities, just like commercial or governmental insurance companies, to negotiate discounts for individuals with specific needs [ ]. incentives to provide discounts include the promptness with which bills are normally paid (within days), less paperwork, as well as assurance that the facility will not be sued (since doctors are seen as fallible but autonomous individuals doing their best) [ ]. typically, participants of amish hospital aid receive a discount slightly above medicare rates, although each medical provider has its own particular discount. not all care facilities offer a discount for members of the amish community, however. hospitals sometimes refuse to consider lower rates beyond existing negotiated rates with government or commercial insurance companies [ ]. on the other hand, health care facilities like the clinic for special children provide pediatric care, especially for genetic disorders and syndromes (in strasburg, pennsylvania) for amish and old order mennonites, who may travel a great distance to reach the facility in order to receive healthcare , , of state-of-the-art care and save money on treatment. the clinic offers substantial reductions in health care costs by such means as lowering the price of testing, gauging when expensive treatment is warranted, and sometimes by devising treatments that prevent costly disability [ , ]. (a short video ( : ) about the clinic is available in a link in a wall street journal article [ ].) . . restrictions in amish hospital aid plan coverage the amish hospital aid plan includes limitations in its coverage, namely because it covers only major medical costs (hence the word “hospital” in its name). this discourages routine and preventive medical services—particularly by family doctors—and is a source of discontent for some interviewees. in addition, amish hospital aid does not cover physical disability costs, such as those for cerebral palsy. another amish-run organization, disability relief aid, covers costs for necessary items such as wheelchairs, ramp installations, and special bathroom installations, in addition to supplying an annual check to help with personal care costs. as with alms, disability relief aid is funded by community donations. neither amish hospital aid nor congregational alms funding cover health care needs that result from prohibited activities within the amish community. one interviewee mentioned an incident that occurred with a teenage boy in her congregation who was injured in a snowmobiling accident. the use of motor vehicles (e.g., cars, tractors, snow mobiles) is strictly forbidden in old order amish culture. even though the boy was not yet baptized into the amish congregation (and therefore still under the aegis of his parents), the deacon would not provide alms money to help pay for his hospital care. the boy’s parents also participated in the amish hospital aid plan, which likewise did not provide financial support, even though since he was under , he was covered under his parents’ plan. . . extent of participation in amish hospital aid while members of the amish community are not required to participate in amish hospital aid and may just rely on alms, a growing number of amish want the extra security provided by amish hospital aid. interviewees cited an estimated – participants in lancaster county or a participation rate of approximately %. the amish national steering committee (the plain community’s liaison to the national government) had new work as a result of obamacare. in , the committee instructed each head of household in the amish community to sign forms from health and human services (hhs) to extend their exemption to obamacare. hhs provided each deacon with the forms to be distributed to members of their church congregations. members gathered at the usual sunday service, with men sitting in groups of ten at round tables. one man explained the meaning of the forms to the others before they all signed the forms. in response to obamacare, participation in amish hospital aid increased by % from to . . . hierarchy of amish hospital aid administration the amish hospital aid plan is run by an all-male board (consisting of a chairman, vice chairman, and four treasurers). each treasurer is in charge of the funds for approximately congregations. the leaders appoint a committee man for each congregation to act as a liaison between the members and the administration. the hospital aid committee (including an estimated committee men and the board members) meets annually to discuss the program. the entire committee participates in voting, with board members holding six-year terms with no limit on reelection. current committee men are candidates for members of the board, by recommendation. those with amish hospital aid typically contact their treasurer once they receive their medical bill. in some cases, the treasurer actually contacts whoever receives the bill. since news travels fast within the amish community, if someone has been injured or hospitalized, members of the congregation will know, including the individual’s treasurer. healthcare , , of all members of the committee are men, since there are no women in administrative positions in the amish hospital aid program, as is consistent with organizations in the amish community. however, women are allowed and often encouraged to have their own personal businesses (selling quilts, fabrics, baked goods, etc.), and are sometimes in charge of the family finances instead of their husbands. . . role of unpaid administrators the amish system of paying health care bills has existed very informally, driven partly by the notable fact that administrators are not paid for their time. “remarkably, common to all these aid programs is their ability to address major needs without bureaucratic red tape, paid employees, underwriters, offices, computers, threat of lawsuits, or profits” [ ] (p. ). this system contrasts with administrative expenses among us private insurers who spend % of their budget on costs like claims processing, marketing, and general overhead [ ]. administrative costs at us hospitals are even higher, at % of total hospital expenditures [ ]. all respondents in this study were aware of and supported a lack of paid administrators. they offered comments such as, “if it ain’t broke, don’t fix it”. . . cost of amish hospital aid members pay a flat rate per person on a monthly basis. the monthly cost of $ per individual is exactly the same as what was reported in a wall street journal article seven years prior to data collection for this study [ ]. a married couple pays $ per month; however, all of their children until the age of would also be covered by the $ payment. one interviewee who complained about the high monthly cost (mentioned above) speculated that the “english” (i.e., non-amish people) “probably don’t pay nearly that much”. this interviewee was very surprised to hear that the costs for non-amish who use conventional insurance are in fact significantly higher than what he was paying for amish hospital aid (although the type of coverage provided by conventional insurance varies). the funds are payable to the committee men on the first day of every month. members tend to be very punctual with their payments and are contacted (sometimes by phone) if their check does not arrive by the due date. the committee man then transfers the funds collected to the district’s treasurer who then transfers them to the bank for later dispersal, as needed. . . complementary care used to minimize conventional care respondents were asked about ways they stayed healthy and minimized the need for health care. they mentioned attention to good nutrition and exercise, including their vigorous farm work. in addition, unmarried amish youth often participate in sports such as softball and volleyball. they frequently take natural vitamins and probiotics in order to minimize health problems, such as vitamin c for a bad cough. home remedies are typically used for less serious ailments (such as colds, minor burns, and infections, etc.), and replace visits to a family doctor. remedies mentioned included a combination of herbs and whiskey (known as tincture) for a sore throat, burdock for burns, and charcoal for infections, many of which can be found in an often-mentioned book, be your own doctor [ ] (a local health food store miller’s natural foods located in bird-in-hand, pa supplies many amish families in the lancaster county area with natural vitamins and supplies for home remedies). it is common for individuals to follow their family’s conventions in their inclinations to go to a medical doctor. nonetheless, there is a lot of variability in opinion: one respondent stated that he would go to the doctor if he had a cold he could not shake, while his wife said that for similar problems, she prefers home remedies. the continued used of complementary medicine in the amish community, however, does not preclude mainstream medical treatment (perhaps in part an acknowledgement of the limits of complementary care which is not always beneficial). healthcare , , of . . willingness to seek conventional medical care amish should not be confused with other groups loathe to seek modern health care for themselves or their children (e.g., [ ]). chiropractic care (including for infants) and phenology are especially popular [ ]. despite stereotypes that the amish are luddites—perhaps assumed because of their use of the horse and buggy—amish are generally very willing to take advantage of the most cutting-edge technology to help remedy their children’s maladies, no matter the cost to them personally [ ]. they avoid only technology that they believe detracts from their relationship with god, or family and community life. many interviewees expressed a willingness to benefit from modern health care, without moral (if not financial) reservations. many indicated that they would seek conventional care: “if something happens” or “whenever we need it”. additional related comments included: “if it’s a doctor thing, it’s a doctor thing” and “if something looks fishy, check it out”. some amish only visit their family doctor for an annual check-up, while others wait until an injury occurs. most amish praised the health care they had received, especially doctors who were good listeners and willing to “cater to the plain community” by not necessarily thinking like a medical doctor (e.g., allowing amish families to practice home remedies). one woman whose young daughter had a genetic disorder that required her to be in and out of the hospital for the first few months of her life spoke highly of the extra care that her doctors from the above-referenced clinic for special children provided to the family, including monthly visits directly to their family farm to check on her daughter. the amish approach to seeking conventional medical care also takes religion into account: “amish people are more willing to stop interventions earlier and resist invasive therapies than the general population because, while they long for healing, they also have a profound respect for god’s will. this means taking modest steps toward healing sick bodies, giving preference to natural remedies, setting common-sense limits, and believing that in the end their bodies are in god’s hands” [ ] (p. ). . . why respondents support amish hospital aid interviewees referred to amish independence in explaining the need for having their own system for health care payments. comments included: “the amish community is not in favor of government hand-outs”, “amish prefer to take care of their own”, “obamacare requires too much government involvement”, “the less government the better”. one respondent opined that “obamacare commandeers freedom of choice” and contrasts with the ability of members of the amish hospital aid plan to choose whichever medical facility best suits their needs. respondents also mentioned the benefits of assisting others and helping others while helping themselves: “we appreciate the privilege to take care of our own people”. their belief that a communal approach to covering health costs is morally right is consistent with their strong commitment to community members looking after one another. . . divisions in the amish community the amish hospital aid program is not without challenges, however, as more conservative amish (who tend to reside in the southern areas of lancaster county) are less likely to participate in the program, reflecting a well-known north–south divide in lancaster county (roughly represented by route ). one southern respondent who objected to amish hospital aid explained that “plainer amish don’t use it” and perceived it as, “the rich helping the rich”. northern lancaster county amish (e.g., those living in and around intercourse) tend to be more affluent than their more conservative southern neighbors living in towns like quarryville. relative to much more conservative amish in other parts of pennsylvania, however, the difference between northern and southern lancaster county amish is much less prominent. healthcare , , of some of the more conservative amish see the amish hospital aid plan as inappropriately progressive and institutionalized. many believe it detracts from neighbors helping each other completely voluntarily (with its set monthly fees, etc.) and view it as taking away from donations to the alms fund, a belief that remains to be substantiated. these individuals are more apt to approve only of the traditional amish alms support (akin to church tithing) for members’ medical needs [ ]. part of the appeal of alms is the reliance on voluntary donations, which bears no resemblance to standard health insurance. nonetheless, the extent of participation in amish hospital aid is growing in southern settlements of lancaster county. some northern amish prefer the amish hospital aid plan because alms are sometimes considered “poor money”, making wealthier amish feel guilty if they receive financial support from the congregation that is traditionally meant for those who are less financially stable. the question of wealth is complicated for amish who have assets in land but few liquid assets, such as cash or things they could sell quickly to pay a medical bill. one respondent frowned on wealthier amish whom he believed would be exploiting alms if they have significant funds tied up in land. he gave a hypothetical example of someone who owned a couple of farms who had a bad accident. he claimed that the congregation would not expect an individual to sell one of their farms to make the payments, so the deacon would provide alms money. he added, “i’d be a hypocrite for having two farms and taking money from the church”. this hypothetical example has similarities with the publicized case of jesse martin, an old order mennonite farmer from denver, pennsylvania who received national news coverage in because of his struggles to pay for healthcare. because martin did not sell any part of his two valuable farms, he was unable to pay bills totaling hundreds of thousands of dollars for nine of his children who had serious genetic disorders including hirschsprung disease and maple syrup urine disease [ ]. in cases where there are many high medical bills, even a combination of personal resources, alms, and amish hospital aid can be insufficient [ ]. nevertheless, these cases are the exception. according to a health survey of lancaster county old order amish (response rate: %), their system is adequate: only % of amish surveyed had delayed care in the past months (most commonly because of the expense), and only % (vs. % of county residents) rated their health as fair or poor [ ]. . . limitations this research relies on a small but select sample of individuals in a limited geographical area who were able and willing to discuss the administration of amish hospital aid and its advantages and shortfalls. although the sample was biased based on the male relative’s business connections, individuals were selected for their knowledge and insight on the topic, as well as a commitment to providing new in-depth and candid information about the amish. it is important, however, to acknowledge that the small sample size limits the generalizability of these findings, despite the thoughtfulness of respondents’ answers. data from a random sample would likely have revealed different reactions to amish hospital aid, although a random sample would have yielded a significantly lower response rate from those outside of the social network of the community shared by amish and mennonites. in addition, given that the data provided were confidential, but not anonymous, some interviewees may have limited what information they disclosed during the interview. nevertheless, because the main goal of the study was to understand the structure of amish hospital aid, interviewees may have felt more comfortable than if the research were designed to assess the program’s popularity or effectiveness. . discussion this paper describes a unique community-based approach to healthcare financing. the amish have achieved and sustained a large measure of self-sufficiency in their own system for managing costs that reflects the spirit of mutualism. the amish approach provides a stark contrast to the healthcare , , of current mainstream healthcare environment, where there is significant federal government control over healthcare decision-making and a pressing need to curtail spending. the amish also provide a small-scale example of healthcare rationing by implementing a program that covers only major medical needs. by limiting coverage, they have devised a manageable system bolstered by a strong sense of personal and group responsibility. because members of amish hospital aid can, if necessary, seek help to pay their % share of a bill through alms, they must be cognizant of their standing in the community, since coverage of an individual’s share is subject to review. this facet of the system reinforces amish inter-connectedness, as they face healthcare challenges collectively, mindful that judicious use of health care resources—including preventative measures—benefit the community. in the amish system, individuals are more likely to understand that it is impossible to cover all medical desiderata. in contrast, in the mainstream healthcare system, there is no way for patients to see that spending money on one individual perforce reduces the amount that can be spent on others. amish insight into this equation helps to provide an incentive on an individual level to limit care or costs that are otherwise very abstract. collaborative efforts by the amish to manage healthcare costs could inspire new ways of thinking about containing costs while building community. . conclusions the amish norm of reciprocal assistance without government interference is the basis for a system of paying for healthcare that builds on existing resources while limiting coverage. this article elucidates the unique way that a sample of old order amish of lancaster county manage healthcare financing by providing never-before reported information about the organization and administration of amish hospital aid. this information was obtained through the assistance of a trusted mennonite community liaison, imperative to elicit the level of candor needed to learn the kinds of details contained in the interview data presented in this article. although the sample size is small, interviewees include persons very familiar with the inner workings of amish hospital aid. documenting the unorthodox manner in which the amish community collaborates in managing healthcare costs could inform innovative alternatives to mainstream healthcare financing. acknowledgments: the authors are grateful to the department of sociology, mcdaniel college for covering the costs to publish in open access. author contributions: kristyn rohrer and lauren dundes conceived and designed the study; kristyn rohrer collected and transcribed the data; kristyn rohrer and lauren dundes analyzed the data; lauren dundes and kristyn rohrer wrote the paper. conflicts of interest: the authors declare no conflict of interest. references . social security administration. available online: https://faq.ssa.gov/link/portal/ / / article/ /are-members-of-religious-groups-exempt-from-paying-social-security-taxes (accessed on september ). . kraybill, d.b.; johnson-weiner, k.m.; nolt, s.m. the amish; johns hopkins university press: baltimore, md, usa, . . the young center. amish studies. young center for anabaptist and pietist studies at elizabethtown college. available online: http://groups.etown.edu/amishstudies/ (accessed on november ). . hurst, c.e.; mcconnell, d.l. an amish paradox: diversity and change in the world’s largest amish community; johns hopkins university press: baltimore, md, usa, . . palmer, c.v. the health beliefs and practices of an old order amish family. j. am. acad. nurse pract. , , – . [pubmed] https://faq.ssa.gov/link/portal/ / /article/ /are-members-of-religious-groups-exempt-from-paying-social-security-taxes https://faq.ssa.gov/link/portal/ / /article/ /are-members-of-religious-groups-exempt-from-paying-social-security-taxes http://groups.etown.edu/amishstudies/ http://www.ncbi.nlm.nih.gov/pubmed/ healthcare , , of . crable, a. cell phones, computers more and more part of lancaster county amish’s real world. lancaster online, may . available online: http://lancasteronline.com/news/local/cell-phones- computers-more-and-more-part-of-lancaster-county/article_ d c-def -- e -- e -- a bcf . html (accessed on september ). . social security administration. “if you are self-employed”. social security administration ssa publication no. - . icn . june . available online: https://www.ssa.gov/pubs/en- - .pdf (accessed on september ). . kraybill, d.b. the amish of lancaster county; stackpole books: mechanicsburg, pa, usa, . . some amish opt out of government-sponsored insurance. available online: http://www.npr.org/ templates/story/story.php?storyid= (accessed on september ). . how to claim an exemption for members of a health care sharing ministry. available online: https: //www.healthcare.gov/exemptions-tool/#/results/ /details/healthcare-sharing-ministry (accessed on september ). . fisher, k. lessons learned while conducting research within an amish community. j. multicult. nurs. health , , – . . weyer, s.m.; hustey, v.r.; rathbun, l.; armstrong, v.l.; anna, s.; ronyak, j.; savrin, c. a look into the amish culture: what should we learn? j. transcult. nurs. , , – . [crossref] [pubmed] . yost, b.; abbott, c.; harding, j.; knittle, a. among the amish: interviewing unique populations on sensitive topics. available online: https://www.researchgate.net/profile/berwood_yost/publication/ _among_the_amish_interviewing_unique_populations_on_sensitive_topics/links/ c f cf c f c .pdf (accessed on december ). . talpos, s. what the amish can teach the rest of us about modern medicine. mosaic, may . available online: https://mosaicscience.com/story/amish-healthcare-medicine (accessed on september ). . worden, a. small lancaster county clinic treating amish, breaking ground on genetics. available online: http://www.readingeagle.com/ap/article/small-lancaster-county-clinic-treating-amish- breaking-ground-on-genetics (accessed on november ). . strauss, k.a.; puffenberger, e.g.; morton, d.h. one community’s effort to control genetic disease. am. j. public health , , – . [crossref] [pubmed] . anand, g. opting out; ‘old order’ mennonites and amish who shun insurance face rising bills; should hospitals cut them a break? wall street journal. june . available online: http://www.wsj.com/ articles/sb (accessed on september ). . wikler, e.; basch, p.; cutler, d. paper cuts: reducing health care administrative costs. center for american progress. . available online: https://cdn.americanprogress.org/wp-content/uploads/issues/ / /pdf/papercuts_final.pdf (accessed on september ). . himmelstein, d.u.; jun, m.; busse, r.; chevreu, k.; geissler, a.; jeurissen, p.; thomson, s.; vinet, m.; woolhandler, s. a comparison of hospital administrative costs in eight nations: us costs exceed all others by far. health aff. , , – . [crossref] [pubmed] . weaver, r. be your own doctor; share-a-care publications: reinholds, pa, usa, . . johnson, d. trials for parents who chose faith over medicine. new york times. january . available online: http://www.nytimes.com/ / / /us/ faith.html?_r= (accessed on september ). . miller, k.; yost, b.; abbott, c.; thompson, s.; dlugi, e.; adams, z.; schulman, m.; strauss, n. health needs assessment of plain populations in lancaster county, pennsylvania. j. commun. health . [crossref] [pubmed] © by the authors; licensee mdpi, basel, switzerland. this article is an open access article distributed under the terms and conditions of the creative commons attribution (cc-by) license (http://creativecommons.org/licenses/by/ . /). http://lancasteronline.com/news/local/cell-phones-computers-more-and-more-part-of-lancaster-county/article_ d c-def -- e -- e -- a bcf .html http://lancasteronline.com/news/local/cell-phones-computers-more-and-more-part-of-lancaster-county/article_ d c-def -- e -- e -- a bcf .html http://lancasteronline.com/news/local/cell-phones-computers-more-and-more-part-of-lancaster-county/article_ d c-def -- e -- e -- a bcf .html https://www.ssa.gov/pubs/en- - .pdf http://www.npr.org/templates/story/story.php?storyid= http://www.npr.org/templates/story/story.php?storyid= https://www.healthcare.gov/exemptions-tool/#/results/ /details/healthcare-sharing-ministry https://www.healthcare.gov/exemptions-tool/#/results/ /details/healthcare-sharing-ministry http://dx.doi.org/ . / http://www.ncbi.nlm.nih.gov/pubmed/ https://mosaicscience.com/story/amish-healthcare-medicine http://www.readingeagle.com/ap/article/small-lancaster-county-clinic-treating-amish-breaking-ground-on-genetics http://www.readingeagle.com/ap/article/small-lancaster-county-clinic-treating-amish-breaking-ground-on-genetics http://dx.doi.org/ . /ajph. . http://www.ncbi.nlm.nih.gov/pubmed/ http://www.wsj.com/articles/sb http://www.wsj.com/articles/sb https://cdn.americanprogress.org/wp-content/uploads/issues/ / /pdf/papercuts_final.pdf https://cdn.americanprogress.org/wp-content/uploads/issues/ / /pdf/papercuts_final.pdf http://dx.doi.org/ . /hlthaff. . http://www.ncbi.nlm.nih.gov/pubmed/ http://www.nytimes.com/ / / /us/ faith.html?_r= http://dx.doi.org/ . /s - - - http://www.ncbi.nlm.nih.gov/pubmed/ http://creativecommons.org/ http://creativecommons.org/licenses/by/ . /. introduction purpose of study background amish vs. mennonite methods access to the amish obtaining interviews results traditional ways of paying for health care implementation of amish hospital aid how amish hospital aid manages medical costs restrictions in amish hospital aid plan coverage extent of participation in amish hospital aid hierarchy of amish hospital aid administration role of unpaid administrators cost of amish hospital aid complementary care used to minimize conventional care willingness to seek conventional medical care why respondents support amish hospital aid divisions in the amish community limitations discussion conclusions wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ short report genetic heterogeneity in rapid onset dystonia- parkinsonism: description of a new family k kabakci, k isbruch, k schilling, k hedrich, p de carvalho aguiar, l j ozelius, p l kramer, m h r m schwarz, c klein . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . j neurol neurosurg psychiatry ; : – . doi: . /jnnp. . rapid onset dystonia-parkinsonism (rdp) is a rare movement disorder with autosomal dominant inheritance, characterised by sudden onset of dystonic spasms and slowness of movement. to date, three families have been described that share linkage to the same location on chromosome q , designated dyt . very recently, mutations in the atp a gene at the dyt locus have been demonstrated in seven unrelated patients, including the three previously linked families. a large rdp family is reported here, with eight definitely and one possibly affected members, that is not linked to the dyt region and has no mutation in the atp a gene. predominant cranial-cervical involvement of dystonia occurred in this family, which has also been described in patients with idiopathic torsion dystonia linked to the dyt region on chromosome and is a rare finding in dyt dystonia. molecular genetic analysis also excluded linkage to the dyt locus and the gag deletion in dyt , suggesting at least one additional rdp gene. r apid onset dystonia-parkinsonism (rdp) is an auto- somal dominant movement disorder with reduced penetrance. rdp is characterised by sudden onset of orofacial dystonia, dysarthria, dysphagia, and involuntary dystonic spasms, predominantly of the upper limbs, along with signs of parkinsonism such as bradykinesia, rigidity, and postural instability. symptoms usually manifest over hours to weeks and are followed by no or only moderate progression. onset of symptoms is in adolescence or young adulthood. – the rdp gene was mapped to an cm region on chromosome q (between markers d s and d s ; highest multipoint lod score of . at d s ) in two rdp families with affected members. this locus was subsequently confirmed but not further refined in a third rdp family from ireland with a detailed clinical descrip- tion. in addition, one apparently sporadic case from spain was reported. very recently, the rdp locus was refined to a . cm region and six different mutations in the na+/k+-atpase a (atp a ) gene have been demon- strated in seven unrelated families, including all previously reported cases. predominant cranial-cervical involvement of dystonia, as a characteristic feature of rdp, has also been described in patients with idiopathic torsion dystonia linked to the dyt region in two mennonite families and is a rare finding in dyt dystonia. in this report we describe the clinical and genetic evaluation of a four generational german rdp family with eight definitely affected and one possibly affected members. methods patients after obtaining informed consent, all available family members underwent a detailed neurological examination, and videotaping was carried out on the index patient (iii. ) and her mother (ii. ). information on deceased individuals was obtained by reviewing medical records or by interview of family members. the diagnosis of rdp was established according to the current clinical criteria and rated using the rdp rating scale. clinical investigations of the index patient included routine laboratory testing, copper and caeruloplas- min analysis, eeg, and brain magnetic resonance imaging (mri). dna analysis the index patient was screened for the gag deletion in dyt . linkage analysis was carried out on all available family members at the dyt and dyt loci using the following microsatellite markers: n dyt : d s ( . cm) – d s ( . cm) – d s ( . cm) – d s ( . cm) – d s ( . cm) – d s ( . cm) – d s ( . cm) – d s ( . cm); n dyt : d s ( . cm) – d s ( . cm) – d s ( . cm) – d s ( . cm) – d s ( . cm) – d s ( . cm). primer sequences were taken from the genome database (www.gdb.org). in addition, following the identification of the rdp gene at the dyt locus, we sequenced the atp a gene in our index patient as described. statistical analysis the computer program vitesse was used for the lod score analysis. results patients this german rdp family consists of identified family members, of whom could be examined, including all four living definitely affected members (fig ). information on the remaining individuals was obtained by interview of relatives. eight family members (four male, four female; mean (sd) age at onset, . ( . ) years, range to ) were definitely affected, five in generation ii and three in generation iii. in addition, individual i. (generation i) was affected by history and rated as possibly affected. mode of inheritance appeared autosomal dominant. no affected individual has been identified in generation iv as yet (current mean (sd) age, . ( . ) years; range to ). of note, three individuals (ii. , ii. , and iii. ) were abbreviations: rdp, rapid onset dystonia-parkinsonism www.jnnp.com o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jn n p .b m j.co m / j n e u ro l n e u ro su rg p sych ia try: first p u b lish e d a s . /jn n p . . o n m a y . d o w n lo a d e d fro m http://jnnp.bmj.com/ born preterm and died of unknown cause in their first year of life. three of the eight subjects with definite rdp developed renal failure with fatal outcome at ages of , , and years, respectively (ii. , ii. , ii. ). very recently, the index patient (iii. ) was diagnosed with hypoplastic kidneys at age years. her mother (ii. ) has a history of renal cysts going back over several years. the clinical features of the eight family members definitely affected by rdp are given in table . a short case report on the index patient is given below. index case when aged six years, patient iii. had acute onset (over- night) of difficulty in speaking and moving her tongue, along with dystonic spasms of the left hand, following febrile bronchitis. symptoms rapidly progressed over the next few days. she developed severe dysphonia and dysphagia, requiring transient nasogastric feeding, orofacial dystonia, and dystonia of all four extremities. in addition, she showed an expressionless face, drooling, and generalised slowness of movement. symptoms initially remained stable for about three weeks and were followed by partial remission. a levodopa trial was of no benefit. on neurological examination years after disease onset, the patient showed severe dysarthria and generalised dystonia, most pronounced on the left hand side and in the upper body half, with predominant orofacial involvement. parkinsonian signs had resolved with the exception of mild hypomimia and bradykinesia. the remainder of the neurological examination was normal. routine laboratory tests, including copper and caeruloplas- min, were normal, as were an eeg and brain mri. a lumbar puncture was not done. molecular analysis the gag deletion in dyt was excluded in the index patient. linkage analysis was carried out in all four living affected members and in the unaffected members, and excluded the dyt and dyt loci on chromosomes q and p-q in this family. specifically, all two point lod scores for the chromo- some q and p-q markers were , . (at h = . ) and provide clear evidence against linkage in this family across both regions. in addition, mutations in the atp a gene were also excluded by direct sequencing of the coding region and exon– intron boundaries in the index patient. discussion we describe the first family with rdp that is not caused by mutations in the atp a gene although it is clinically similar to the three previously described rdp pedigrees and to the spanish sporadic case, and conforms to the rdp diagnostic criteria. in particular, our family also showed a combination of dystonic and parkinsonian signs with abrupt or subacute onset, predominant bulbar involvement, and no response to levodopa treatment. rdp onset was preceded by a febrile illness in three of the eight definitely affected individuals in our family. similarly, a trigger (stress/trauma) was reported in four of eight members of the irish rdp family. our family also confirms the intrafamilial variability of symptoms and disease course. it should be borne in mind that the current rdp diagnostic criteria are based on only two rdp families. in this context, several distinguishing features of our family are worthy of note. first, the mean age of onset of about seven years was lower than in the previously described families, in whom the disease mostly started in adolescence. surprisingly, no member of generation iv has become affected as yet. this may in part be explained by the fact that at least some individuals may not yet have reached the age of onset. second, three family members were born preterm and died in their first year of unknown cause, and three of the eight definitely affected individuals had fatal renal failure. in addition, the index patient and her mother also suffer from kidney disease (table ). the age of onset of this renal disorder was in adulthood and therefore it was not a trigger of their rdp. this suggests an as yet unidentified familial renal disorder; however, its potential relation to the rdp in this family remains elusive. third, linkage to the rdp locus (dyt on chromosome q) and mutations in the atp a gene were excluded in our family. because of the predominant orofacial involvement in dyt dystonia that is somewhat reminiscent of the ‘‘bulbar dystonia’’ in rdp, we considered involvement of the dyt gene. this, however, also turned out to be negative. owing to the early onset and broad spectrum of dyt dystonia, we tested for the gag deletion in the dyt gene, and this was excluded as well. overall, our genetic results suggest the presence of at least one additional dominantly inherited gene causing rdp or a different disease mechanism in our family. the possibility of a mitochondrial (mtdna) point mutation was investigated in a previous study but no disease causing mutation was found. as all affected individuals in our family inherited the disease from their mother, the mode of inheritance would be compatible with maternal transmission or with an autosomal dominant inheritance, possibly of a maternally expressed gene. this observation may thus warrant both analysis of the mtdna and an investigation of the known paternally imprinted genes to identify a novel rdp gene in our family. i: i: ii: ii: ii: l- ii: ii: ii: ii: ii: ii: ii: ii: ? ii: ? iii: iii: iii: iii: iii: iii: iii: iii: iii: iii: iii: iii: l- l- l- l- l- l- l- l- l- l- l- iii: iii: iii: iiv: l- iv: iv: iv: l- l- l- iv: iv: iv: iv: iv: iv: iv: iv: iv: l- iv: l- l- l- iii: iii: iii: iii: iii: iii: ii: iii: ? figure this four generational pedigree shows all eight definitely affected (black) and the possibly affected (grey) family members. the index patient is indicated by an arrow. the three individuals with a question mark died within their first year of life of unknown cause. the three affected members marked with a ‘‘+’’ had fatal renal failure. dna for molecular genetic analyses was available for the individuals with an ‘‘l’’ number only. genetic heterogeneity in rapid onset dystonia-parkinsonism www.jnnp.com o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jn n p .b m j.co m / j n e u ro l n e u ro su rg p sych ia try: first p u b lish e d a s . /jn n p . . o n m a y . d o w n lo a d e d fro m http://jnnp.bmj.com/ acknowledgements we would like to thank the family for participat- ing in this study and sylwia dankert for technical support. this work was supported by the deutsche forschungsgemeinschaft (kl- / - ) and the deutsche dystonie gesellschaft e. v. authors’ affiliations . . . . . . . . . . . . . . . . . . . . . . . . . k kabakci, k hedrich, c klein, departments of neurology and human genetics, university of lübeck, lübeck, germany k isbruch, m h r m schwarz, department of neurology, klinikum dortmund, dortmund, germany k schilling, p l kramer, departments of neurology, and molecular and medical genetics, oregon health sciences, university, portland, oregon, usa l j ozelius, p de c aguiar, department of molecular genetics, albert einstein college of medicine, new york, usa conflicting interests: none declared correspondence to: dr christine klein, department of neurology, university of lübeck, ratzeburger allee , lübeck, germany; klein_ch@ neuro.mu-luebeck.de received june in revised form september accepted september references dobyns wb, ozelius lj, kramer pl, et al. rapid-onset dystonia-parkinsonism. neurology ; : – . brashear a, farlow mr, butler ij, et al. variable phenotype of rapid-onset dystonia-parkinsonism. mov disord ; : – . brashear a, deleon d, bressman sb, et al. rapid- onset dystonia-parkinsonism in a second family. neurology ; : – . kramer pl, mineta m, klein c, et al. rapid-onset dystonia-parkinsonism: linkage to chromosome q . ann neurol ; : – . pittock sj, joyce c, o’keane v, et al. rapid-onset dystonia-parkinsonism: a clinical and genetic analysis of a new kindred. neurology ; : – . webb dw, broderick a, brashear a, et al. rapid onset dystonia-parkinsonism in a -year-old girl. eur j paediatr neurol ; : – . linazasoro g, indakoetxea b, ruiz j, et al. possible sporadic rapid-onset dystonia-parkinsonism. mov disord ; : – . kamm c, leung j, joseph s, et al. refined linkage to the rdp/dyt locus on q . and evaluation of grik as a candidate gene. mov disord:published online, mar, . de carvalho aguiar p, sweadner kj, penniston jt, et al. mutations in the na+/k+ atpase alpha gene atp a are associated with rapid-onset dystonia parkinsonism. neuron ; : – . almasy l, bressman sb, raymond d, et al. idiopathic torsion dystonia linked to chromosome in two mennonite families. ann neurol ; : – . o’connell jr, weeks d. the vitesse algorithm for rapid exact multilocus linkage analysis via genotype set-recoding and fuzzy inheritance. nat genet ; : – . ta b le c lin ic a l ch a ra ct er is tic s o f d ef in ite ly a ff ec te d fa m ily m em b er s c h a ra ct er is ti c p ed ig re e n o ii. ii. ii. (l - ) ii. ii. iii . (l - ) iii . (l - ) iii . (l - ) d em o g ra p h ic fe a tu re s s ex f m f m f m m f li fe sp a n o r cu rr en t a g e (y ea rs ) to to to to c h a ra ct er is tic s a t d is ea se o n se t a g e (y ea rs ) tr ig g er u n kn o w n u n kn o w n u n kn o w n u n kn o w n u n kn o w n fe b ri le b ro n ch iti s fe b ri le b ro n ch iti s fe b ri le b ro n ch iti s r a te o f o n se t u n kn o w n r a p id r a p id u n kn o w n r a p id r a p id r a p id r a p id d is tr ib ut io n o f sy m p to m s d ys a rt h ri a , d ys p h a g ia , se ve re d ys to n ia o f a ll fo ur ex tr em iti es , h yp o m im ia , b ra d yk in es ia d ys a rt h ri a , d ys p h a g ia , se ve re d ys to n ia o f a ll fo ur ex tr em iti es , h yp o m im ia , b ra d yk in es ia d ys a rt h ri a , d ys p ha g ia , d ys to n ia o f le ft h a n d , h yp o m im ia , b ra d yk in es ia (le ft . ri g h t) d ys a rt h ri a , d ys to n ia o f b o th h a n d s, h yp o m im ia m ild d ys a rt h ri a a n d d ys p h a g ia , d ys to n ia o f b o th h a n d s, b ra d yk in es ia d ys a rt h ri a , d ys to n ia o f a ll fo ur ex tr em iti es , h yp o m im ia , b ra d yk in es ia , ri g id ity d ys a rt h ri a , d ys p h a g ia , d ys to n ia o f a ll fo ur ex tr em iti es (le ft . ri g h t) , b ra d yk in es ia , ri g id ity s ev er e d ys a rt h ri a , d ys p h a g ia , d ys to n ia o f a ll fo ur ex tr em iti es a n d fa ce , b ra d yk in es ia , ri g id ity ti m e to st a b ili sa tio n u n kn o w n fe w w ee ks fe w w ee ks , d a y , d a y fe w w ee ks fe w d a ys fe w d a ys r d p se ve ri ty sc a le c h a ra ct er is tic s a t m o st re ce n t ex a m in a tio n a g e (y ea rs ) d ec ea se d d ec ea se d d ec ea se d d ec ea se d d is ea se d ur a tio n (y ea rs ) r es id ua l sy m p to m s d ys a rt h ri a , h yp o m im ia , b ra d yk in es ia d ys a rt h ri a , d ys to n ia o f b o th h a n d s, h yp o m im ia , m ild b ra d yk in es ia d ys a rt h ri a , m ild d ys to n ia o f le ft h a n d , h yp o m im ia , b ra d yk in es ia u n ch a n g ed u n ch a n g ed d ys a rt h ri a , d ys to n ia o f b o th h a n d s (r ig h t . le ft) , d ys to n ia o f le ft le g , h yp o m im ia , b ra d yk in es ia (le ft . ri g h t) m ild d ys a rt h ri a , d ys to n ia o f le ft h a n d , d ra g g in g o f le ft le g , h yp o m im ia , b ra d yk in es ia s ev er e d ys a rt h ri a , d ys to n ia o f le ft h a n d a n d fa ce , h yp o m im ia , b ra d yk in es ia r d p se ve ri ty sc a le ? a d d iti o n a l fe a tu re s r en a l fa ilu re r en a l fa ilu re c ys ts in th e ki d n ey s r en a l fa ilu re n o n e n o n e n o n e h yp o p la st ic ki d n ey r d p, ra p id o n se t d ys to n ia -p a rk in so n is m . kabakci, isbruch, schilling, et al www.jnnp.com o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jn n p .b m j.co m / j n e u ro l n e u ro su rg p sych ia try: first p u b lish e d a s . /jn n p . . o n m a y . d o w n lo a d e d fro m http://jnnp.bmj.com/ untitled seroprevalence and correlates of toxoplasma gondii infection in yoremes (mayos) in mexico: a cross-sectional study cosme alvarado-esquivel, antonio rascón-careaga, jesús hernández-tinoco, maría alba guadalupe corella-madueño, luis francisco sánchez-anguiano, maría lourdes aldana-madrid, gerardo javier almada-balderrama, alan daniel nuñez-aguirre, oliver liesenfeld , to cite: alvarado-esquivel c, rascón-careaga a, hernández-tinoco j, et al. seroprevalence and correlates of toxoplasma gondii infection in yoremes (mayos) in mexico: a cross-sectional study. bmj open ; : e . doi: . / bmjopen- - ▸ prepublication history for this paper is available online. to view these files please visit the journal online (http://dx.doi.org/ . / bmjopen- - ). received october revised february accepted april for numbered affiliations see end of article. correspondence to dr cosme alvarado-esquivel; alvaradocosme@yahoo.com abstract objectives: we sought to determine the prevalence of anti-toxoplasma gondii antibodies in yoremes and to identify associations of t. gondii exposure with sociodemographic, clinical and behavioural characteristics of yoremes. design: a cross-sectional survey. setting: yoremes were enrolled in the locality of tierra blanca in the municipality of navojoa in sonora state, mexico. participants: we studied yoremes (mayos); they are an indigenous ethnic group living in a coastal region in northwestern mexico. primary and secondary outcome measures: we assessed the prevalence of anti-toxoplasma igg and igm antibodies in participants using enzyme-linked immunoassays. we used a standardised questionnaire to obtain the characteristics of yoremes. the association of t. gondii exposure and yoremes’ characteristics was assessed by bivariate and multivariate analyses. results: of the yoremes studied (mean age: . ± . years), ( . %) were positive for anti- t. gondii igg antibodies and ( . %) of them were also positive for anti-t. gondii igm antibodies. seroprevalence of t. gondii infection did not vary with sex, educational level, occupation or socioeconomic status. in contrast, multivariate analysis of sociodemographic and behavioural characteristics showed that t. gondii exposure was associated with increasing age (or= . ; % ci . to . ; p= . ) and consumption of squirrel meat (or= . ; % ci . to . ; p= . ). furthermore, seroprevalence of t. gondii infection was significantly higher in yoremes with a history of lymphadenopathy (p= . ) and those suffering from frequent abdominal pain (p= . ). in women, t. gondii exposure was associated with a history of caesarean sections (p= . ) and miscarriages (p= . ). conclusions: we demonstrate, for the first time, serological evidence of t. gondii exposure among yoremes in mexico. results suggest that infection with t. gondii might be affecting the health of yoremes. results may be useful for an optimal design of preventive measures against t. gondii infection. introduction toxoplasma gondii is a ubiquitous intracellular parasite. this parasite is currently infecting about one-third of humanity. infection with t. gondii is usually asymptomatic. however, t. gondii disseminates after infection to many organs and may lead to disease in the eyes, lymph nodes and central nervous system. – furthermore, primary infection with t. gondii in pregnant women is a threat for congenital disease. infection with t. gondii may lead to a life-threatening disease in immunocom- promised patients. the main routes of t. gondii infection are ingestion of food or water contaminated with oocysts shed by cats and eating undercooked or raw meat con- taining tissue cysts. the epidemiology of t. gondii infection in ethnic groups in mexico has been poorly studied. serological evidence of t. gondii infection has been demonstrated in strengths and limitations of this study ▪ this is the first cross-sectional study of toxoplasma gondii infection in the mexican ethnic group of yoremes (mayos). ▪ the seroprevalence of t. gondii infection was determined in yoremes. ▪ prevalence association with sociodemographic, clinical and behavioural characteristics of yoremes was determined. ▪ the sample size was small and the seropositivity rate was low to perform a wider analysis of the association of t. gondii exposure and character- istics of yoremes. alvarado-esquivel c, et al. bmj open ; :e . doi: . /bmjopen- - open access research o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://b m jo p e n .b m j.co m / b m j o p e n : first p u b lish e d a s . /b m jo p e n - - o n m a y . d o w n lo a d e d fro m http://dx.doi.org/ . /bmjopen- - http://dx.doi.org/ . /bmjopen- - http://crossmark.crossref.org/dialog/?doi= . /bmjopen- - &domain=pdf&date_stamp= - - http://bmjopen.bmj.com http://bmjopen.bmj.com/ mennonites, tepehuanos and huicholes in the northern mexican state of durango. however, there is a lack of knowledge about the seroepidemiology of t. gondii infection in yoremes or mayos (an indigenous ethnic group living in a coastal region in the northwestern mexican states of sonora and sinaloa). yoremes live in rural communities and work mainly in agriculture and fishing. they live in a region with a climate that is differ- ent from those in other regions where other population groups in mexico were studied for the seroepidemiology of t. gondii infection. the climate in the yoremes’ region is desert-like or subtropical, and it is unclear whether this climate (or the food habits among yoremes) may influ- ence the seroprevalence of t. gondii. indigenous people in mexico, including the yoremes, usually live in rural areas with a limited coverage of health services. the aims of the present study were to determine the seropreva- lence of t. gondii in yoremes and the association of t. gondii prevalence with the sociodemographic, clinical and behavioural characteristics of yoremes. materials and methods study design and yoremes’ population studied through a cross-sectional survey, we studied yoremes in sonora, mexico, from january to june . yoremes were enrolled in the locality of tierra blanca in the municipality of navojoa in sonora state, mexico. tierra blanca ( ° ′n ° ′w) is situated at an altitude of m above sea level and has a desert-like climate and a mean annual temperature of . °c. it blanca has a mean annual rainfall of mm. inclusion criteria for the study participants were: ( ) yoremes’ ethnicity (people who speak the yoremes’ language and identify themselves as yoremes); ( ) aged years and older and ( ) that they voluntarily accepted to participate. sample size and sampling method we calculated the sample size using a two-sided confi- dence level of %, a power of %, a ratio of unex- posed: exposed= , a reference t. gondii seroprevalence of . % in unexposed participants, and an or of . . the result of the calculation was participants. we added a % for refusals and the final sample size was participants. sampling of yoremes was performed by a convenience method. first, the authors met the yoremes leaders to provide information about the study. after obtaining permission from the leaders, they invited the people they lead. yoremes who accepted to participate in the study were gathered in two public places (a health centre and a high school) to provide a blood sample and submit a questionnaire. since this strategy was not enough to reach the sample size, the authors visited houses in the community to enrol partici- pants until the sample size was reached. this new strat- egy is not likely to influence the results since a minority of cases was obtained by this type of sampling. in total, yoremes were included in the study. sociodemographic, clinical and behavioural data data from the participants were obtained with the aid of a standardised questionnaire. this questionnaire included sociodemographic, clinical and behavioural items. sociodemographic items were age, sex, birthplace, residence, education, occupation and socioeconomic status. clinical items included current health status, history of lymphadenopathy, frequent presence of head- ache and abdominal pain, dizziness, impairments of memory, reflexes, hearing and vision, and a history of blood transfusion, transplants or surgery. in women, obstetric history was also obtained. behavioural items included contact with animals, food consumed, travel- ling, frequency of eating away from home (in restaurants or fast food outlets), contact with soil (gardening or agriculture) and type of flooring at home. data about food were type of meat consumed, frequency of meat consumption, consumption of raw or undercooked meat, dried or processed meat, and consumption of unwashed raw vegetables and fruits, unpasteurised milk or untreated water. serological tests for anti-t. gondii antibodies we obtained a blood sample from each participant. blood samples were centrifuged and serum samples were obtained. sera were stored at − ° c until analysed. serum samples were tested for anti-t. gondii igg anti- bodies with the commercially available ‘toxoplasma igg’ (diagnostic automation inc, calabasas, california, usa) enzyme immunoassay (eia). anti-t. gondii igg antibody levels were expressed as iu/ml, and a value ≥ iu/ml was used as a cut-off for seropositivity. sera positive for anti-t. gondii igg antibodies were further analysed for anti-t. gondii igm antibodies by the commercially avail- able ‘toxoplasma igm’ (diagnostic automation inc) eia. the cut-off for anti-t. gondii igm seropositivity for each assay was obtained by multiplying the mean cut-off cali- brator optical density by a correction factor (f= . – . ) printed on the label of the calibrator. all assays were per- formed following the manufacturer’s instructions, and positive and negative controls were included in each run. statistical analysis data were analysed with the aid of the software epi info v. . . and spss v. . . to avoid bias in the measure of associations, care was taken in obtaining all data about the characteristics of participants, and there were no missing data. we used pearson’s χ test and fisher’s exact test (when values were small) for initial compari- son of the frequencies among groups. multivariate ana- lysis was used to assess the association between the sociodemographic and behavioural characteristics of yoremes and the seropositivity to t. gondii. only variables with a p value ≤ . obtained in the bivariate analysis were included in the multivariate analysis. this strategy allowed us to substantially reduce the number of vari- ables in the analysis. or and % ci were calculated by logistic regression using the stepwise backward method. alvarado-esquivel c, et al. bmj open ; :e . doi: . /bmjopen- - open access o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://b m jo p e n .b m j.co m / b m j o p e n : first p u b lish e d a s . /b m jo p e n - - o n m a y . d o w n lo a d e d fro m http://bmjopen.bmj.com/ we used the hosmer-lemeshow goodness of fit test to assess the fitness of the regression model. statistical sig- nificance was set at a p value < . . results yoremes participating in the study had a mean age of . ± . years (range – years). of the yoremes studied, ( . %) were positive for anti-t. gondii igg antibodies. of these igg-seropositive patients, ( . %) were also positive for anti-t. gondii igm antibodies. of the anti-t. gondii igg-positive yoremes, ( . %) had igg levels higher than iu/ml, and ( . %) between and iu/ml. a correlation of the sociode- mographic characteristics of yoremes and t. gondii sero- prevalence is shown in table . seroprevalence of t. gondii infection did not vary with sex, birthplace, residence, edu- cational level, occupation or socioeconomic status of yoremes (table ). in contrast, seroprevalence increased significantly with age (p= . ). with respect to anti-t. gondii igm seropositivity among the igg-seropositive yoremes, seroprevalence did not vary with age (p= . ), and seropositivity was found in of males and of females (p= . ). with respect to clinical characteristics (table ), sero- prevalence of t. gondii infection was significantly higher in yoremes with a history of lymphadenopathy (p= . ) and those suffering from frequent abdominal pain (p= . ). in women, t. gondii exposure was associated with a history of caesarean sections (p= . ) and miscar- riages (p= . ). some clinical variables associated with t. gondii exposure may interact with each other, and no further regression analysis with these clinical variables was performed. the frequencies of other clinical characteristics including the presence of underlying dis- eases, suffering from frequent headaches, impairments in reflexes, hearing and vision, and a history of surgery, blood transfusion or transplant were similar among t. gondii-positive and t. gondii-negative yoremes. concerning behavioural characteristics, a number of variables showed p values ≤ . in the bivariate analysis including consumption of goat and squirrel meat, raw dried meat, beef intestines and beef brains, and alcohol- ism. other behavioural characteristics of yoremes includ- ing contact with animals, travelling, consumption of meat other than that of goat and squirrel, frequency of meat consumption, degree of meat cooking, consump- tion of untreated water, unpasteurised milk, processed meat, unwashed raw vegetables or fruits, frequency of eating out of home, contact with soil, and type of floor- ing at home showed p values higher than . in the bivariate analysis. multivariate analysis of sociodemo- graphic and behavioural variables showed that t. gondii exposure was associated only with increasing age (or= . ; % ci . to . ; p= . ) and consump- tion of squirrel meat (or= . ; % ci . to . ; p= . ). an acceptable fit (p= . ) of our regression model was obtained in the hosmer-lemeshow test. discussion the epidemiology of t. gondii infection among ethnic groups in mexico has been scantily studied. this work aimed to determine the seroprevalence and correlates of t. gondii infection in an indigenous ethnic group (yoremes) in northwestern mexico. we found a . % seroprevalence of t. gondii infection in yoremes. to the best of our knowledge, there are no previous reports of t. gondii exposure in this ethnic group. the seropreva- lence found in yoremes is lower than seroprevalences of t. gondii infection reported in other ethnic groups in the northern mexican state of durango: seroprevalences of . %, . % and . % have been reported in tepehuanos, mennonites and huicholes, respect- ively. the lower prevalence of t. gondii exposure in yoremes than in tepehuanos, mennonites and huicholes might be explained by differences in their environment or behavioural difference. seroprevalence of t. gondii infection may be influenced by environment conditions with a high seroprevalence in humid regions and a low seroprevalence in dry and hot regions. tepehuanos and huicholes live in remote communities in a mountainous region (sierra madre occidental) and mennonites in a valley region, whereas yoremes live in a desert region at low altitude. very little is known about the seroprevalence of t. gondii infection in population groups living in a desert climate. in a study in niamey, niger researchers showed that preva- lence of toxoplasmosis was higher in humid coastal regions than in dry desert areas. seroprevalence of t. gondii infection increased with age. this finding might be related to differences in sanitation and hygiene among generations. poor sanitation and hygiene have been linked to t. gondii infection in the indigenous population in brazil. improvement of these epidemio- logical factors may result in the lowering of seropreva- lence of t. gondii exposure in younger generations. we did not include minor (younger than years) partici- pants in this study because the frequency of t. gondii infection in young people is usually very low. we also analysed associations with factors other than the environ- ment. seroprevalence was found to increase with age, consistent with previous reports in rural and urban populations in northern mexico. the mean age ( . years) in yoremes was similar to that in tepehuanos ( . years). however, the mean age in yoremes was lower than the one ( . years) in huicholes and that ( . years) in mennonites. multivariate analysis also showed an association of t. gondii exposure with consumption of squirrel meat. in two previous studies in the general population in rural and urban durango, consumption of squirrel meat was also associated with t. gondii exposure. these findings show the importance of consumption of squirrel meat in the transmission of t. gondii infection in the region. although squirrel meat is usually cooked before eating, failure to obtain a thorough cooking may occur specially for thick pieces of meat. yoremes usually grill the alvarado-esquivel c, et al. bmj open ; :e . doi: . /bmjopen- - open access o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://b m jo p e n .b m j.co m / b m j o p e n : first p u b lish e d a s . /b m jo p e n - - o n m a y . d o w n lo a d e d fro m http://bmjopen.bmj.com/ squirrel meat, and this process may result in an uneven cooking. in addition, tasting of raw or undercooked meat while grilling might occur. tasting of fresh raw meat was linked to toxoplasmosis in italy. serological evidence of t. gondii infection has been demonstrated in squirrels. in addition, t. gondii has been detected in organs of korean squirrels (tanias sibericus) and grey squirrels (sciurus carolensis) with fatal toxoplasmosis. we previously investigated the presence of t. gondii in animals in durango but were unable to detect anti-t. gondii antibodies in squirrels (spermophilus variegatus) collected. however, we cannot rule out t. gondii infec- tion in squirrels in the region because the sample size was small and infection might occur in other squirrel species than the one studied. further research about the epidemiological link of t. gondii infection and consump- tion of squirrel meat including the search for t. gondii in squirrels should therefore be conducted. intriguingly, in this study, we found an association of t. gondii exposure with abdominal pain, history of lymphadenopathy, caesarean sections and miscarriages. it is well known that t. gondii infection is a cause of lymph node enlargement and miscarriages. in con- trast, t. gondii infection is not typically associated with abdominal pain, but abdominal pain has been reported in gastric toxoplasmosis in patients with aids. we also found an association of t. gondii infection with a history of caesarean section. it is not clear why women with caesarean sections had a higher seroprevalence of t. gondii infection than those without this history. interestingly, in a study of women with stillbirths in durango, mexico, t. gondii exposure was associated with a history of surgery. it raises the question whether a specific type of surgery as caesarean section or a specific population group as women might have a higher risk of t. gondii exposure than others. we did not investigate the indications for the caesarean sections or the health status of the children born by this surgical procedure, and this was a limitation of the study. several factors could be considered to explain t. gondii infections in women with caesarean sections. congenital toxoplasmo- sis may precipitate not just early delivery or induction of delivery, but it may also prompt caesarean section. – in addition, the use of contaminated surgical instru- ments or materials during caesarean sections cannot be ruled out. blood transfusion is relatively common in sur- gical patients, and infection with t. gondii by blood trans- fusion may also occur. further research about the association of t. gondii infection and caesarean section and other surgical procedures should be conducted. in this work, anti-t. gondii igm antibodies were present in a relatively high number of anti-t. gondii igg-positive table sociodemographic characteristics of yoremes and seroprevalence of toxoplasma gondii infection participants tested prevalence of t. gondii infection characteristic number number percentage p value age groups (years) or less . . – . > . sex male . . female . birthplace sonora state . other mexican state or abroad . residence area rural . . urban . educational level no education . . – years . – years . > years . occupation labourer* . . non-labourer† . socioeconomic level low . . medium . high . *labourer: agriculture, business, construction, livestock raising, professional, other. †non-labourer: student or housekeeping. alvarado-esquivel c, et al. bmj open ; :e . doi: . /bmjopen- - open access o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://b m jo p e n .b m j.co m / b m j o p e n : first p u b lish e d a s . /b m jo p e n - - o n m a y . d o w n lo a d e d fro m http://bmjopen.bmj.com/ yoremes compared with previous studies. this finding should be interpreted with caution because positive results in igm tests may indicate persistent igm anti- bodies rather than acute infection. we did not test all participants for anti-t. gondii igm antibodies. only igg-positive patients were tested because a high number of false-positive results for igm have been reported when using immunoassays. therefore, a positive igm test with a negative igg test has a limited usefulness for drawing diagnostic and epidemiological conclusions. the small sample size and the low rate of seropositivity were limitations of the study. these factors did not allow us to perform a wider analysis of the association of t. gondii exposure and the characteristics of yoremes. reaching the sample size of yoremes was challenging. however, the strategy to enrol participants by visiting table bivariate analysis of clinical data and infection with toxoplasma gondii in yoremes participants tested prevalence of t. gondii infection characteristic number number percentage p value clinical status healthy . . ill . lymphadenopathy ever yes . . no . abdominal pain frequently yes . . no . headache frequently yes . . no memory impairment yes . . no . dizziness yes . no reflexes impairment yes . . no . hearing impairment yes . . no . visual impairment yes . . no . surgery ever yes . . no blood transfusion yes . . no . pregnancies yes . . no . deliveries yes . . no . caesarean sections yes . . no miscarriages yes . . no . stillbirths yes . . no . alvarado-esquivel c, et al. bmj open ; :e . doi: . /bmjopen- - open access o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://b m jo p e n .b m j.co m / b m j o p e n : first p u b lish e d a s . /b m jo p e n - - o n m a y . d o w n lo a d e d fro m http://bmjopen.bmj.com/ them at their houses allowed us to include participants who were unable to get out of home for sampling because of illnesses or other conditions. conclusions we demonstrate, for the first time, serological evidence of t. gondii exposure among yoremes in mexico. results suggest that infection with t. gondii may be associated with specific food habits and health conditions. the optimal design of preventive measures against t. gondii infection should take our findings into consideration. author affiliations faculty of medicine and nutrition, biomedical research laboratory, juárez university of durango state, durango, mexico department of chemical and biological sciences, university of sonora, hermosillo, sonora, mexico institute for scientific research “dr. roberto rivera-damm”, juárez university of durango state, durango, mexico department of research and postgraduate in food, university of sonora, hermosillo, sonora, uk institute for microbiology and hygiene, campus benjamin franklin, charité medical school, berlin, germany roche molecular diagnostics, pleasanton, california, usa contributors ca-e, ar-c, magc-m and mla-m designed the study protocol and participated in the coordination and management of the study. ar-c, magc-m, gja-b and adn-a obtained blood samples, submitted the questionnaires and performed the data analysis. ca-e performed the laboratory tests. ca-e, jh-t, lfs-a, ar-c, magc-m, mla-m and ol performed the data analysis and wrote the manuscript. funding universidad juárez del estado de durango. competing interests none declared. patient consent obtained. ethics approval the institutional ethical committee of the university of sonora, mexico approved this study. the purpose and procedures of the survey were explained to all yoremes. participation in the study was voluntary. written informed consent was obtained from all participants and from the next of kin of minor participants. provenance and peer review not commissioned; externally peer reviewed. data sharing statement no additional data are available. open access this is an open access article distributed in accordance with the creative commons attribution non commercial (cc by-nc . ) license, which permits others to distribute, remix, adapt, build upon this work non- commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. see: http:// creativecommons.org/licenses/by-nc/ . / references . smith je. a ubiquitous intracellular parasite: the cellular biology of toxoplasma gondii. int j parasitol ; : – . . dubey jp. toxoplasmosis of animals and humans. nd edn. boca raton, fl: crc press, . . hill de, chirukandoth s, dubey jp. biology and epidemiology of toxoplasma gondii in man and animals. anim health res rev ; : – . . montoya jg, liesenfeld o. toxoplasmosis. lancet ; : – . . harker ks, ueno n, lodoen mb. toxoplasma gondii dissemination: a parasite’s journey through the infected host. parasite immunol ; : – . . maenz m, schlüter d, liesenfeld o, et al. ocular toxoplasmosis past, present and new aspects of an old disease. prog retin eye res ; : – . . oz hs. maternal and congenital toxoplasmosis, currently available and novel therapies in horizon. front microbiol ; : . . weiss lm, dubey jp. toxoplasmosis: a history of clinical observations. int j parasitol ; : – . . alvarado-esquivel c, rojas-rivera a, estrada-martínez s, et al. seroepidemiology of toxoplasma gondii infection in a mennonite community in durango state, mexico. j parasitol ; : – . . alvarado-esquivel c, estrada-martínez s, garcía-lópez cr, et al. seroepidemiology of toxoplasma gondii infection in tepehuanos in durango, mexico. vector borne zoonotic dis ; : – . . alvarado-esquivel c, pacheco-vega sj, hernández-tinoco j, et al. seroprevalence of toxoplasma gondii infection and associated risk factors in huicholes in mexico. parasit vectors ; : . . julvez j, magnaval jf, meynard d, et al. seroepidemiology of toxoplasmosis in niamey, niger. med trop (mars) ; : – . . markovich mp, shohat t, riklis i, et al. seroepidemiology of toxoplasma gondii infection in the israeli population. epidemiol infect ; : – . . . bóia mn, carvalho-costa fa, sodré fc, et al. seroprevalence of toxoplasma gondii infection among indian people living in iauareté, são gabriel da cachoeira, amazonas, brazil. rev inst med trop sao paulo ; : – . . alvarado-esquivel c, cruz-magallanes hm, esquivel-cruz r, et al. seroepidemiology of toxoplasma gondii infection in human adults from three rural communities in durango state, mexico. j parasitol ; : – . . alvarado-esquivel c, estrada-martínez s, pizarro-villalobos h, et al. seroepidemiology of toxoplasma gondii infection in general population in a northern mexican city. j parasitol ; : – . . alvarado-esquivel c, liesenfeld o, burciaga-lópez bd, et al. seroepidemiology of toxoplasma gondii infection in elderly people in a northern mexican city. vector borne zoonotic dis ; : – . . vitale m, tumino g, partanna s, et al. impact of traditional practices on food safety: a case of acute toxoplasmosis related to the consumption of contaminated raw pork sausage in italy. j food prot ; : – . . . smith dd, frenkel jk. prevalence of antibodies to toxoplasma gondii in wild mammals of missouri and east central kansas: biologic and ecologic considerations of transmission. j wildl dis ; : – . . carrasco l, raya ai, núñez a, et al. fatal toxoplasmosis and concurrent calodium hepaticum infection in korean squirrels (tanias sibericus). vet parasitol ; : – . . dubey jp, hodgin ec, hamir an. acute fatal toxoplasmosis in squirrels (sciurus carolensis) with bradyzoites in visceral tissues. j parasitol ; : – . . dubey jp, velmurugan gv, alvarado-esquivel c, et al. isolation of toxoplasma gondii from animals in durango, mexico. j parasitol ; : – . . . alpert l, miller m, alpert e, et al. gastric toxoplasmosis in acquired immunodeficiency syndrome: antemortem diagnosis with histopathologic characterization. gastroenterology ; : – . . ganji m, tan a, maitar mi, et al. gastric toxoplasmosis in a patient with acquired immunodeficiency syndrome. a case report and review of the literature. arch pathol lab med ; : – . . alvarado-esquivel c, pacheco-vega sj, salcedo-jaquez m, et al. stillbirth history and toxoplasma gondii infection in women attending public health centers in a northern mexican city. eur j microbiol immunol (bp) ; : – . . freeman k, oakley l, pollak a, et al. european multicentre study on congenital toxoplasmosis. association between congenital toxoplasmosis and preterm birth, low birthweight and small for gestational age birth. bjog ; : – . . nishikawa a, yamada h, yamamoto t, et al. a case of congenital toxoplasmosis whose mother demonstrated serum low igg avidity and positive tests for multiplex-nested pcr in the amniotic fluid. j obstet gynaecol res ; : – . . sato s, nishida m, nasu k, et al. congenital toxoplasmosis from a mother with type diabetes mellitus: a case report. j obstet gynaecol res ; : – . . alvarado-esquivel c, liesenfeld o, márquez-conde ja, et al. seroepidemiology of infection with toxoplasma gondii in workers occupationally exposed to water, sewage, and soil in durango, mexico. j parasitol ; : – . . liesenfeld o, press c, montoya jg, et al. false-positive results in immunoglobulin m (igm) toxoplasma antibody tests and importance of confirmatory testing: the platelia toxo igm test. j clin microbiol ; : – . alvarado-esquivel c, et al. bmj open ; :e . doi: . /bmjopen- - open access o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://b m jo p e n .b m j.co m / b m j o p e n : first p u b lish e d a s . /b m jo p e n - - o n m a y . d o w n lo a d e d fro m http://creativecommons.org/licenses/by-nc/ . / http://creativecommons.org/licenses/by-nc/ . / http://dx.doi.org/ . / - ( ) -c http://dx.doi.org/ . /ahr http://dx.doi.org/ . /s - ( ) -x http://dx.doi.org/ . /pim. http://dx.doi.org/ . /j.preteyeres. . . http://dx.doi.org/ . /j.preteyeres. . . http://dx.doi.org/ . /fmicb. . http://dx.doi.org/ . /j.ijpara. . . http://dx.doi.org/ . /ge- . http://dx.doi.org/ . /vbz. . http://dx.doi.org/ . / - - - http://dx.doi.org/ . /s http://dx.doi.org/ . /s http://dx.doi.org/ . /s - http://dx.doi.org/ . /s - http://dx.doi.org/ . /ge- . http://dx.doi.org/ . /ge- . http://dx.doi.org/ . /vbz. . http://dx.doi.org/ . / - x.jfp- - http://dx.doi.org/ . /j.vetpar. . . http://dx.doi.org/ . /ge- r. http://dx.doi.org/ . /ge- . http://dx.doi.org/ . /gast. .v .pm http://dx.doi.org/ . / . . http://dx.doi.org/ . / . . http://dx.doi.org/ . /j. - . . .x http://dx.doi.org/ . /j. - . . .x http://dx.doi.org/ . /jog. http://dx.doi.org/ . /jog. http://dx.doi.org/ . /ge- . http://bmjopen.bmj.com/ seroprevalence and correlates of toxoplasma gondii infection in yoremes (mayos) in mexico: a cross-sectional study abstract introduction materials and methods study design and yoremes’ population studied sample size and sampling method sociodemographic, clinical and behavioural data serological tests for anti-t. gondii antibodies statistical analysis results discussion conclusions references holmium laser-assisted endoscopic extraction of a fishhook from the male urethra at sciverse sciencedirect urological science ( ) e contents lists available urological science journal homepage: www.urol-sci.com case report holmium laser-assisted endoscopic extraction of a fishhook from the male urethra hui-ming chung a,*, sheng-hsuan chen b a department of urology, mennonite christian hospital, hualien, taiwan b department of internal medicine, taipei medical university hospital, taipei, taiwan open access under cc by-nc-nd license. a r t i c l e i n f o article history: received october received in revised form december accepted april available online may keywords: endoscopy fishhook holmium laser male urethra * corresponding author. department of urology, m min-chuan road, hualien , taiwan. e-mail address: hchung@jhsph.edu (h.-m. chung) - copyright � , taiwan urological asso doi: . /j.urols. . . a b s t r a c t a man years of age presented with frequency and dysuria. rigid cystoscopy revealed the presence of a fishhook in the anterior urethra. initial attempts to remove the fishhook in one piece by forceps or a basket were unsuccessful. the fishhook was cut into two pieces using a holmium laser via a -fr ureteroscope and removed by forceps. the anterior urethra experienced a minor tear during the procedure. he voided well without significant urethral stricture months postoperatively. an open urethrotomy is usually indicated for unsuccessful endoscopic removal of foreign bodies from the male urethra, which often leads to recurrent urethral stricture. the novel use of a holmium laser to facilitate the endoscopic removal of a fishhook from the male urethra may reduce the risk of postoperative urethral stricture. copyright � , taiwan urological association. published by elsevier taiwan llc. . introduction various kinds of foreign bodies lodged in the male urethra have been reported, and the management of such cases can be chal- lenging for urologists. first-line treatment is endoscopic extraction of the foreign body. however, the restricted space of the male urethra makes it very difficult for endoscopic instruments, such as forceps or baskets, to effectively remove a foreign body. open surgery is indicated when endoscopic extraction is unsuccessful, which often leads to significant urethral stricture or a fistula postoperatively. we herein report the successful use of a holmium laser to facilitate endoscopic extraction of a fishhook lodged in a male urethra. . case report a man years of age presented to the emergency department of our institution (mennonite christian hospital, hualien, taiwan). he had experienced dysuria and frequency for several days. on physical examination, there was a palpable mass within the ante- rior part of the urethra. initial renal ultrasonography showed hydronephrosis of the right kidney, but the plain abdominal film failed to reveal any ureteral stones. an abdominal computed tomographic (ct) scan showed calcified material in the anterior urethra (fig. ) and a radiolucent stone in the right distal ureter. the ennonite christian hospital, . ciation. published by elsevier taiw patient was not married, and his socioeconomic status was of a lower class. he had a history of mental retardation but no medical diseases. laboratory data showed that complete blood counts and blood biochemistry tests were within normal limits. urinalysis revealed hematuria and pyuria. the patient was subjected to an endoscopic procedure under general anesthesia in the operating room. with a -fr cystoscope, a fishhook was found in the urethra (fig. ). initial attempts were made to remove the fishhook in one piece by forceps or a basket; however, they were unsuccessful because the hook was snagged in the urethra. the fishhook was then cut into two pieces using a holmium laser (with a pulse energy of . j and a pulse rate of hz) via a -fr ureteroscope, and the fragments were removed with forceps using a -fr cystoscope (fig. ). the anterior urethra experienced a minor tear during the procedure. a urethral catheter was put in place to prevent post- operative urethral stricture. after the surgery, we attempted to determine how and when the fishhook became lodged in the urethra. however, neither the patient nor his caregivers could provide any meaningful information on this issue. the patient was discharged after the urethral catheter was removed on post- operative day . the patient was doing well with a normal uroflow rate at the -month postoperative follow-up. . discussion although rare, various kinds of foreign bodies in the male urethra have been described in the literature, including ballpoint pens, wires, allen keys, and pins. e the clinical presentation may vary from asymptomatic to swelling of the external genitalia, an llc. open access under cc by-nc-nd license. mailto:hchung@jhsph.edu www.sciencedirect.com/science/journal/ http://www.urol-sci.com http://dx.doi.org/ . /j.urols. . . http://dx.doi.org/ . /j.urols. . . http://dx.doi.org/ . /j.urols. . . http://creativecommons.org/licenses/by-nc-nd/ . / http://creativecommons.org/licenses/by-nc-nd/ . / fig. . computed tomography scan showing calcified material in the male urethra. fig. . realigned fragments of the fishhook. h.-m. chung, s.-h. chen / urological science ( ) e dysuria, urethral discharge, and urinary tract infection. the most commonly reported reasons for self-inflicted foreign bodies in the male urethra are of an erotic or sexual nature, especially sexual gratification or masturbation, a mental illness, or drug intoxica- tion. the patient in this case had a history of mental retardation, but it was not clear whether the fishhook was inserted by himself or by someone else. the composition, size, and origin of foreign bodies in the male urethra differ greatly, but the treatment is similar with endoscopic extraction the first-line treatment. sometimes, a foreign body can be pushed back into the urinary bladder and grasped by forceps or a retrieval basket. in this patient, it was impossible because the fishhook was snagged in the urethra. an open urethrotomy is fig. . cystoscopy revealed that a fish indicated in cases where endoscopic procedures are unsuccessful, which often leads to urethral stricture or a fistula. we tried a novel approach using a holmium laser to facilitate removal of the fish- hook. because this method is less traumatic, we hoped to avoid an open urethrotomy and possible urethral stricture. although it is possible that a high-energy laser can cause thermal injury to the urethra, the risk can be minimized with meticulous manipulation of the endoscopic procedure. in this case, the patient had a smooth recovery with no urethral stricture or fistula during the -month postoperative follow-up period. holmium lasers are used primarily for lithotripsy, but they are also used to cut soft tissues or tumors; however, the mechanisms differ. the holmium laser is highly absorbed by water. because tissues are composed mainly of water, the majority of the holmium laser energy is absorbed superficially, which results in superficial cutting or ablation. by contrast, the holmium laser can cut through hook was snagged in the urethra. h.-m. chung, s.-h. chen / urological science ( ) e metal and cause stone evaporation primarily through a photo- thermal mechanism. recently, some authors demonstrated the effectiveness and safety of using a holmium laser to cut large or complex foreign bodies in vitro and within the human urinary bladder. , however, the restricted space in the urethra makes it more challenging for endoscopic extraction. it is recommended that treatment be commenced with low-pulse energy (e.g., . j) with a pulse rate of hz and that the pulse frequency be increased as needed to facilitate treatment. to the best of our knowledge, this is one of the earliest reported cases using a holmium laser to facilitate endoscopic removal of a foreign body from the male urethra. other than a holmium laser, there are currently no other endoscopic tools that can cut a fish- hook in a male urethra, as we did in this case. we recommend that holmium lasers be considered in endoscopic extraction of foreign bodies from the male urethra. conflicts of interest statement the authors declare that they have no financial or non-financial conflicts of interest related to the subject matter or materials dis- cussed in the manuscript. source of funding mennonite christian hospital, hualien, taiwan. references . forde jc, casey rg, grainger r. an unusual penpal: case report and literature review of posterior urethral injuries secondary to foreign body insertion. can j urol ; : e . . mitterberger m, peschel r, frauscher f, pinggera gm. allen key completely in male urethra: a case report. cases j ; : . . stravodimos kg, koritsiadis g, koutalellis g. electrical wire as a foreign body in a male urethra: a case report. j med case reports ; : . . gokce g, topsakal k, ayan s, kilicarslan h, gokce sf, gultekin ey. case report: nonobstructive giant urethral stone with two safety pins. int urol nephrol ; : e . . frenkl tl, rackley rr, vasavada sp, goldman hb. management of iatrogenic foreign bodies of the bladder and urethra following pelvic floor surgery. neu- rourol urodyn ; : e . . wyatt j, hammontree ln. use of holmium:yag laser to facilitate removal of intravesical foreign bodies. j endourol ; : e . . bedke j, kruck s, schilling d, matter a, horstmann m, sievert kd, et al. laser fragmentation of foreign bodies in the urinary tract: an in vitro study and clinical application. world j urol ; : e . . spore ss, teichman jm, corbin ns, champion pc, williamson ea, glickman rd. holmium:yag lithotripsy: optimal power settings. j endourol ; : e . holmium laser-assisted endoscopic extraction of a fishhook from the male urethra . introduction . case report . discussion conflicts of interest statement source of funding references health and environment project in benin field actions science reports the journal of field actions vol. | vol. health and environment project in benin raphaël edou electronic version url: http://journals.openedition.org/factsreports/ issn: - publisher institut veolia electronic reference raphaël edou, « health and environment project in benin », field actions science reports [online], vol. | , online since february , connection on april . url : http:// journals.openedition.org/factsreports/ creative commons attribution . license http://journals.openedition.org http://journals.openedition.org http://journals.openedition.org/factsreports/ field actions science report www.factsreports.org © author(s) . this work is distributed under the creative commons attribution . license. health and environment project in benin r. edou ong bethesda web : www.bethesdabenin.org abstract. in , the republic of benin was facing great social and economic upheavals. in , the canadian and american mennonite missionaries created the bethesda health care centre. in , assessment of the hospital activities showed that many people were coming back to the centre repeatedly with the same illnesses linked to sani- tation aspects and living conditions. the community development and environmental protection department (dcam) was thus established to face this great challenge. it quickly helped the community and the local authorities to establish a waste management system. the programme for sanitation and protection of the environment (prape) was designed and funded by the french embassy and evangelische entwicklungsdienst v.e (eed), a german christian organization. households then began to subscribe for the collection of their wastes. bethesda began to assist other communities to put in place waste management systems. today, it is working throughout the country with many municipalities. while the programme was being implemented, we discovered that the community need- ed to be supported in their revenue generating activities. we set up in , a solidarity-based microinance system. the savings of some people were used to grant credit to others. this community bank has developed into a large bank today. in , a system of mutual insurance was put in place. a complete integrated system to address the basic needs of the community was thus set up. keywords. mennonites, religion, integrated vision, environment, health, microinance, economics, non-government organization. introduction in , the republic of benin was facing a great social and economical crisis. civil servants of all the sectors in public administration were on strike. people did not know where to go for their health care. salaries were not paid for more than six months and life for the general population was very dif- icult. the country was about to degenerate into civil war as a result of the civil unrest in the country. thanks to the assistance from the french, and canadian and american mennonite missionaries, the bethesda health centre was started in with us$ , granted by theses partners. today, the health centre of bethesda has expanded and has become a large hospital in cotonou. it hosts each year about , patients and has developed the depart- ment of paediatrics, ophthalmology, stomatology, cardiology, obstetrical gynaecology, x-rays, etc. the hospital has also put in place an aids service which has been promoted by the government to the status of an aids treatment centre. in an integrated vision, bethesda has established other de- partments. in , the sanitation department was estab- lished to implement sanitation and environmentally-friendly projects aimed at reducing the high incidence of some dis- eases frequently treated at the hospital. in , the decision correspondence to: raphaël edou (bethesda@bethesdabenin.org) was made to establish a micro-inance department called pebco. this initiative, which currently has , clients, uses community savings to promote income-generating ac- tivities. since many women were obliged to use the loans for family needs (health care, children schooling, etc.), they were unable to reimburse them as planned. hence the bethesda non-government organization (ngo) recently began an ini- tiative to provide a community-based health insurance option for the population in . there are now , members. this paper focuses on the presentation of benin and the pro- gram, but also describes how the project could be better im- proved and what were its beneits and impacts. the purpose of the project . presentation of benin benin is a west african country of nearly seven million in- habitants and has a high proportion of young people. about per cent of the people live in urban areas, and this is nearly ten per cent higher than the level of urbanization in sub-saha- ran africa as a whole. politically, benin has been stable for about years and is governed under a democratic system where individual freedom is respected. the government has been following a policy of decentralization for about the past years. since then, the population has been content to build r. edou: health and environment project in benin field actions science report its future, and peace has made the country a dynamic region. this has contributed to a considerable increase in the rate of urbanization in recent years. as a result, urban issues have increased in prominence in the policy and practice arenas. . presentation of the program in early s, benin was trying to overcome political, eco- nomic and social crisis. fortunately bloodshed was avoided and a democratic government was adopted for the country after the national conference in . this crisis severely limited the level of services that the city authority of cotonou could pro- vide to its citizens. the public hospital was not functioning properly and the few private health care options were very ex- pensive. the poor could not afford private care. thanks to the assistance from the french, canadian and american mennonite missionaries, the beninese evangelical churches founded the bethesda health centre in . when the bethesda health centre started operating in sainte rita in , many people, estimated as high as % of the population, were experiencing illnesses, particularly gastroenteritis, malaria, and bronchial pneumonia. during the irst few years, the number of cases treated by the centre doubled each year. many people were re- turning to the centre repeatedly with the same illnesses. the casual dumping of waste was undoubtedly a contributing factor to the high levels of illness. this was a problem that needed to be addressed urgently. in general, the living conditions of many people in the area were the cause of their bad health. at that time the city’s waste management department had only three working trucks that it could use to collect rubbish from the city with approximately , residents. the dumping of rubbish was a big problem in cotonou. rubbish was dumped in the streets, where it accumulated in large holes that had been worn away in the surface, on open ground, near to houses, in the canals and the marine lagoon surround- ing the north side of the city. the mere establishment of a clinic in the community where there were very poor sanita- tion conditions did not accurately address the health issues of vulnerable people. to raise awareness among the community about the links between poor health and lack of proper waste management and inadequate sanitation, the health centre cre- ated a unit for community development and environmental protection (dcam). this was successful at making contact with communities and in promoting the need for environmen- tal action to improve health. the community had then be- come a willing partner for seeing that action would be taken. the environmental programme started then around the clinic in the district of sainte rita, one of the local author- ity districts that make up the city of cotonou. this district has a population of approximately , and occupies three square kilometres. about half of this site is low ground that experiences yearly looding. . how the project was implemented . . planning, preparation and piloting in dcam bethesda undertook the initiative to bring together representatives of the community, government and the local authorities with a view to taking action to alleviate the chronic problem of rubbish dumping. some members of the local authority were initially skeptical and did not believe that it would be possible to convince people from the local communities to contribute towards clearing away the rubbish. dcam also met numerous times with groups and organizations, such as women’s and youth groups, old- er people, church organizations, market traders and school and parent representatives, from the community, as well as with the service providers themselves. gradually a consen- sus was established on the needs, objectives and priorities for action and what each of the stakeholders could contrib- ute or offer. it was decided that the priority would be to develop a sustainable waste management system for the neighbor- hoods of sainte rita. sustainability would be endorsed through building the management capacities of local orga- nizations and training of and support to local people to de- velop jobs in waste collection and processing. it would also be important to bring in the local authorities and relevant government departments into the partnership so that they could share the responsibilities for waste management and contribute in their areas of management capacity, support and expertise. the communities were keen to start clearing rubbish from the streets almost from the outset of the discussions about the programme and also began to ill in some of the holes in the roads where the rubbish was being dumped. however, these efforts were very limited compared with the scale of the dumping in the whole area. over a period of months, dcam entered into pains- taking discussions with affected stakeholders to formulate a plan for dealing with the waste disposal issue throughout the whole of sainte rita. the main hurdles to overcome were to obtain and equip a suitable site to act as a waste collection and recycling centre, obtaining real commitment rather than tacit support for the project from the municipal- ity in cotonou and the environmental ministry, negotiating a formalized agreement with communities specifying how contributions to the undertaking would be shared, and se- curing funding for a preparatory programme geared to- wards full long-term sustainability. dcam was able to use a site about km away for its processing centre and secured funds of us$ , from the french embassy fund for development (caisse française de développement) to initiate waste management activities in a more systematic way. additional funding was provided by evangelische entwicklungsdienst v.e (eed), a german christian organization. this project support was endorsed by the ofice of the united nations development programme (undp) in benin and the minister of finance of benin as an opportunity for more environmentally-sustainable practices in waste management in the country. by january everything was in place for the programme for sanitation and protection of the environment (prape) to be formally inaugurated. the launch was attended by com- munity representatives, staff of dcam bethesda, representa- tives of the french embassy, and the minister for the environment as well as other relevant stakeholders. r. edou: health and environment project in benin www.factsreports.org . . strengthening the capacity when prape started the project, the staff realized that it would require a great effort and commitment of all the stake- holders to succeed in disseminating community-based waste management in a systematic way to the majority of house- holds in sainte rita. in the few areas where residents had al- ready taken the lead and organized their own campaigns, the organizers were likely to have been highly motivated. it could not be assumed that all the residents throughout sainte rita would be as motivated. dcam intended to continue with the promotion of envi- ronmentally-focused waste management; but at a more in- tense level and more extensively in the settlement. this would highlight how residents would beneit and their sur- roundings would be improved. other aspects of the campaign would be important too and the whole process would be more effective if these were utilized strategically and in an inte- grated way. thus, dcam needed to ind out about what products the different types of waste generated could be re- cycled into or reused as, what existing or potential markets could be penetrated for these products, what processing tech- nologies were available and which of these would be the most suitable, what equipment and other material assets would be required and how all of these could be utilized by local people to obtain sustainable jobs and equipment. dcam then would have to take the leading role in disseminating this know-how to a large number of people in sainte rita. building local people’s conidence was a priority in the ini- tial stages of the programme. people needed to be convinced that dcam had the right ideas for dealing with the waste management issues and that the programme had a long-term and deeply-rooted commitment to seeing the process through to a conclusion. they also needed to know that all the waste would be taken away or reused at a cost that would be afford- able to the majority of them. dcam then would have to en- courage local people to realize that the future and sustainability of the programme lay in their hands and that they had the in- nate skills that merely needed to be awakened and extended so that the communities could make an effective contribution. the small-scale waste removal activities carried out dur- ing the preliminary stages of the programme had proved to be valuable learning experiences for the larger-scale effort. in practical terms, the focus of the activities had moved onto training of community groups so that they could have a key role in putting into place sustainable mechanisms for waste management; and organization of neighborhood committees to provide the local management capacity. the technical as- pects of waste recycling and reprocessing that would be suitable for community application were developed by dcam. research was undertaken to ind out how waste re- cycling was being managed in germany, the netherlands, egypt and elsewhere in west africa, amongst other coun- tries and regions. during this phase, the opportunity was also taken to raise awareness among many more people in sainte rita about the links between their illnesses and health problems and the rub- bish that was being dumped in their vicinity and the inade- quate sanitation that they had access to. many of the facilitators for these sessions were women, to encourage more women from the community to attend. the aim was that later the people taking part in these workshops would commit themselves as householders who make their waste available to the programme or as members of groups or enterprises that collect, reprocess or recycle the waste. the waste management department of the city of cotonou and the ministry of the environment in benin were key insti- tutional partners of the programme. these organizations knew about the problems caused by indiscriminate waste dumping. they had had little impact in alleviating this prob- lem themselves, especially in the lower income areas; but still needed to be convinced that an alternative, community- focused approach would be more effective. however, they were willing to support, co-operate with and learn from the programme, even to the extent that the minister for environment attended a number of seminal events organized by dcam. eventually these institutions, together with ngos, contributed to spreading the message about dcam to other municipalities in benin through organizing workshops and meetings and production and dissemination of publica- tions. working with dcam municipalities, they would learn what aspects of waste management they can focus on most effectively and which ones would best be taken care of by communities that have had their capacities raised. . . the scaling-up experience achieving scaling-up was not a high priority during the early stages of the programme. most importantly the intention was to demonstrate that a signiicant proportion of the waste gen- erated in the municipality of sainte rita could be dealt with by local people, thereby creating local jobs and incomes and contributing to environmental sustainability through recy- cling and re-use wherever possible. a number of factors contributed to successful scaling-up in sainte rita. these included: – dcam bethesda already had extensive contacts and a good knowledge about local communities through the operation of healthcare services. the team was able to organize meetings and training with community mem- bers without signiicant problems. – dcam-bethesda placed high emphasis on preventive healthcare rather than just treating patients with illness- es. they had therefore already acquired communica- tion skills and the use of appropriate media for communicating with local people. – local people and the municipality recognized that waste dumping in the area was a problem that needed urgent attention and were willing to support any initia- tive that appeared to show promising results. many community members were motivated to sort their waste at home. – dcam was successful in convincing many local peo- ple that many of their health problems were caused by inadequate sanitation and indiscriminate waste dump- ing. apart from the physical discomfort of illness that r. edou: health and environment project in benin field actions science report people wanted to avoid, illnesses also often prevented people from working, and to treat them people had to attend the health centre and pay for the services. – communities, through their neighborhood committees, had a high level of input into determining the direction of the programme. – the training that was undertaken, focusing on youths, was effective in helping them to set up business as waste collectors and recyclers. – waste was collected from households at regular inter- vals, so that the levels of waste did not build up and residents had conidence in the collection service. – the household collection service was initially subsi- dized and residents charged a low rate of about us$ . per month to encourage uptake. by house- holds were being charged a more economically realistic rate of about us$ per month; but residents were still willing to pay this as they appreciated the improve- ments in the settlements that had been achieved. – a loans programme that was set up was successful at helping entrepreneurs setting up and acquiring tools and equipment. – it is relatively low in cost to set up a business as waste collectors. for an outlay of about us$ , two people can start a business. this cost is affordable for many com- munity members and they are further assisted in meeting these costs by the loans that are made available. – dcam was successful at linking entrepreneurs to markets. – much of the day to day operation of waste collection and promotion of waste sorting by households is over- seen by neighborhood committees. dcam does not generally become involved in this and could thus de- vote much of its effort to dissemination, publicity and building the capacities of communities that were at the beginning of managing their own waste products. since the launch of prape in in sainte rita, the pro- gramme has extended to much of the rest of the city of cotonou, which now has a population of nearly one million, and several other cities and larger towns in benin. some dif- ferent factors were important for this more extensive scaling- up than in sainte rita, though other factors were the same. these different factors included the following: – the work in sainte rita had proved to be an effective demonstration model with other organizations in cotonou and benin wanting to replicate and adapt the successful outcomes of the programme in their own areas. – the department of environment in benin was a key stakeholder in the programme in sainte rita and took an even more proactive role in the wider dissemination. the ministry donated carts, containers and trucks to help activities so new areas could get started. – the development of a network of ngos and waste pro- cessors was instrumental in the dissemination process. the network irst extended throughout cotonou, incor- porating organizations, but more recently network- ing activities have been organized throughout benin. – dcam was involved in the scaling-up process by pro- viding a consultancy and advisory service to other groups and organizations wanting to set up community- based waste management. this has helped to ensure that these new operations are well run and managed. – the loans service that was initially set up to assist waste collectors in sainte rita start their businesses has be- come a fully-ledged community bank that still focuses on loans for waste collection and processing but can also offer loans for other needs. the bank now operates in the three largest cities in benin. the bank also offers training in business management skills so that their businesses are more likely to become successful. – dcam has been relatively successful at leading the ngo network and help oxfam (quebec) to implement their project of capacity building of the network of ngos and waste processors in cotonou. the world bank and the government of benin are supporting a community development and infrastructure programme, managed by dcam, operating throughout the country. – dcam has employed students and interns. some of them, as well as some former employees of dcam, have themselves helped to set up local waste manage- ment services in other areas. – dcam has had good cooperation with numerous other organizations in benin and internationally to extend the programme. these organizations have included univer- sities, research centres, municipalities, ngos and the government ministries. – waste issues were a priority that needed attention in many places in benin, so communities, municipalities and ngos were interested in adopting the processes that were demonstrated in sainte rita. they could also see that the majority of households had signed up for the waste collection service and that the service could be run as an economically viable operation. in addition to scaling-up geographically and in reaching large numbers of people, the programme has also scaled-up in terms of broadening the scope of its work. this aspect of scaling-up has been undertaken through: – recycling or land illing of suitable waste from the health centre. eventually the programme was handling waste from health centres throughout cotonou. – the community bank that was set up to promote wom- en’s savings now also support the creation of other small businesses, apart from those based on waste, many of them operated by women. most of these busi- nesses have been in food processing. r. edou: health and environment project in benin www.factsreports.org – assisting the government-coordinating agency (serhau) in promoting community participation and community-based development. this programme, set up by the government and the world bank, is being implemented in the three largest cities of benin. for three years prape has been helping to: – establish neighborhood association committees, – develop the objectives and plan for each of them, – build capacity on managerial skills of the committees, – assist in community infrastructure building (schools, health centres, youth centres, markets, and public latrines) and prepare the community to manage them effectively. – build the equipment for water supply in the community. . . participants in the process one of the successes of dcam was the level to which the programme has been able to integrate the activities of many stakeholders into a dynamic that has had signiicant impact throughout benin in environmental and health improvement, income generation, poverty reduction and community devel- opment. stakeholders involved in the programme have in- cluded ngos, community groups and organizations, municipalities, government, donors, private sector compa- nies, researchers and consultants. the driving force behind dcam was the bethesda health centre (dcam bethesda) which was set up in sainte rita in by mennonite missionaries from the united states, canada, and france, together with benin’s churches. bethesda established dcam in to initially address the problems caused by uncontrolled waste disposal throughout sainte rita. communities were the other vital partner. without coop- eration of community groups, the waste would not have been cleared away and would have continued being dumped. however many residents in the eight neighborhoods of sainte rita were responsive to the awareness raising meetings orga- nized by dcam. neighborhood associations already existed, and as the programme developed they became more involved. dcam also encouraged the formation of neighborhood com- mittees that would organize the local management of waste collection and collaborated with the neighborhood associa- tions to select participants for the committee. dcam would then enter into a dialogue and train the committee members on waste management issues. scaling-up would have been dificult without institutional support and cooperation. dcam was able to obtain support at the start of the programme from the french embassy and the ministry of the environment in benin. many discussions took place between dcam bethesda and these two institu- tions on programme formulation, and the minister of the environment and representatives from the french embassy attended the launch of dcam and other important events during the programme. dcam also had discussions with mu- nicipal representatives in cotonou, and the support to the programme of the ministry was a key factor in obtaining mu- nicipal support for the programme in cotonou and, later on, in other towns and cities. the ministry of environment also provided practical support by donating carts, trucks, waste containers and gloves for the programme. dcam was initially a health and environmental ngo that largely operated within sainte rita. however, for scaling-up of the programme in other areas of cotonou and in other cit- ies and towns, the cooperation and support of other ngos that worked closely with their respective local communities was valuable. dcam has been actively involving these ngos through a network that comprises ngos in cotonou. together these ngos employ nine hundred work- ers and have a budget of about us$ , per year. a na- tional network of ngos involved in waste management is being developed to cover the other cities and towns where community-based waste management has been set up. the other important stakeholders in the process are the cus- tomers for the reprocessed products from the waste. these include farmers and gardeners who make use of the compost made from the organic wastes, and residents who use the bri- quettes made from paper and sawdust. particularly important was a company called agriplas that takes about three tonnes per month of recovered plastic that has been granulated to make electrical cable, among other applications. altogether the recycling centre that serves cotonou produces about tonnes of recycled granulated plastic waste per year. other private companies make use of this material for a range of plastic products. the plastic waste stream is particularly valuable for the project as it is the highest value product from the waste and contributes a lot of the revenue to the operation that goes towards reduction of the amount that households are charged. . . dissemination and communications issues a strength of the programme was that the dissemination of the programme took place largely by word of mouth, and dcam encouraged neighborhood committees and ngos to keep residents informed and seek their views about the pro- gramme in this way. meetings, awareness raising workshops, and training events were used to raise community awareness about the programme and issues around health, environment and waste management; and to interest residents to take part in the programme. once a number of residents in an area had agreed to be part of the programme, either as waste collectors or as providers of waste that had been pre-sorted, prape organized speciic training and demonstrations. neighborhood committees act- ed as intermediaries between residents, collectors and prape and maintained ongoing informal contact with these stake- holders. more formal meetings were organized once a month between prape and neighborhood committees. these pro- vided community groups with an effective way of highlight- ing any problems or issues that needed to be resolved or any new developments that needed to be considered. meetings were also organized with donors, the ministries of environment and health, and representatives from the mu- nicipality of cotonou initially to obtain ideas on the scope of r. edou: health and environment project in benin field actions science report the programme and how these particular institutions would be involved. other ngos were not initially important stake- holders as the programme was focused on sainte rita, where many people knew about dcam bethesda. however, they became key stakeholders in the wider dissemination in the rest of cotonou and more widely in benin. as well as dcam, the ministry of environment had a leading role in the dissemination process for scaling up the programme beyond sainte rita. together they organized workshops and seminars and produced about different documents and broadcasts about the programme. these, to- gether with ngo networking, were the principal ways for dissemination of the programme in order to scale-up to the rest of cotonou and more widely in benin. other dissemination pathways also contributed to wider dissemination of the programme. these included the actions of former interns, students and employees who worked with dcam and then set up similar operations in their own areas; awards and competitions, for example, for young people who had made the largest contributions to environmental im- provement; and the consultancy service that dcam has pro- vided on community and infrastructure development. a particularly visible initiative of dcam was green planting along main roads and around prominent buildings in cotonou. the compost used in the planters was produced from organic waste through the programme. what were the beneits/ impacts of the project? bethesda has grown remarkably in only years of existence from quite a modest operation in based in the eight neighborhoods in the area of sainte rita in cotonou, to a pro- gramme covering environmental improvement, livelihood and income strengthening, and services and infrastructure provision in many cities and larger towns throughout cotonou. a particular strength of the programme was the way in which dcam was able to combine various sources of revenue to produce a process that now covers all of its costs, but is still affordable to many of the residents and can support waste col- lectors and the workers and operations at the recycling centre. more than per cent of the households in two neighbor- hoods in sainte rita are pre-sorting their waste and having it collected through the operation. donor and government fund- ing is now only being used to further develop and extend the programme and not to cover existing operations. through the efforts of dcam, the ministry of environment, ngos and other stakeholders, locally-organized waste management is now being carried out in parts of the cities and towns of porto- novo, parakou, kandi, come and aplahoue. in addition, prape has assisted other organizations elsewhere in benin and in togo and congo to set up similar operations. the most successful examples have been in cotonou and kandi. in cotonou, the recycling centre miles from the city has been set up and extended with donor support. it handles waste from neighborhoods in the city. the waste collection operation in cotonou receives revenues of about us$ , annually from households. to reduce costs of the operation, residents have been informed about reducing the amount of unsuitable waste they send for recycling or landill. the operation in kandi has been particularly successful, where a recy- cling centre has been set up close to the town and only per cent of the waste from participating households is sent for land illing. a loans and savings operation that was started in a modest way in to support small-scale entrepreneurs in waste activities has grown very impressively. this has become a community bank with an annual turnover of about us$ million and makes over us$ million of loans to about , recipients per year. it operates in the three big- gest cities in benin. the bank operates without subsidy. dcam has initiated a process in community-based waste management that has been scaled-up successfully throughout the city of cotonou, other towns and cities in benin and in a small number of other countries in africa: – the establishment and providing of low cost health cares (in all specialties) for poor people through the bethesda hospital in cotonou. the government has recognized bethesda as an aids treatment centre. – the development of a self-funded waste collection pro- gram in the city of cotonou and in fourteen other cities creating jobs in the country. – creation of a credit and savings organization called “programme d’epargne crédit à base communautaire (pebco)” that reaches , people with a loan port- folio valued at us$ million and a repayment rate of %. the turnover amounts of us$ million. – establishment of the cotonou-based agriplas centers and to recycle plastic and paper for buyers from nigeria. – the economic and inancial development of this social enterprise from a yearly budget of us$ , in , to a current budget of us$ , , . – assisting the government-coordinating agency (serhau) in promoting community participation and community-based development. this programme, set up by the government and the world bank, is being implemented in the three largest cities of benin. for three years prape has been helping to: – establish neighborhood association committees, – develop the objectives and plan for each of them, – build capacity on managerial skills of the committees, – assist in community infrastructure building (schools, health centres, youth centres, markets, and public latrines) and prepare the community to manage them effectively. – the community health insurance in cotonou is again an evidence of the skill of bethesda to obtain results at community level. – bethesda has a training program for community health providers in order to help people in hard areas to r. edou: health and environment project in benin www.factsreports.org administer the basic care for people with malaria and other diseases. – bethesda has implemented health care at the commu- nity level with advanced strategy which consists of vaccination door to door within the community. – bethesda has been implementing a decentralized and waste management project in eight municipalities in benin by building their capacity to develop a good pro- gram for sanitation issues in their area. the work of bethesda is beginning to be widely recog- nized. in , the programme made the shortlist for the dubai international award for best practices - best practices and local leadership programme. in the program won the dubai international award for best practice. bethesda has also won other international awards: – the japanese award for most innovative development in january by the global development network; – the best ngo in africa award in by the african social award. in addition, bethesda: – has hosted the international community with visits by the american ambassador to benin in , the german ambassador to benin in , a member of the board of directors of the world bank in september , and the vice president of the world bank for africa in october . – is directed to public beneit organization by the govern- ment of benin by presidential decree - in may . how could the project be better improved? even if the project has been very successful, it is also impor- tant to note some weaknesses that need to be addressed. the vision at the beginning was to take action in order to solve problems within the communities because people were fac- ing hard situations. the study or research that will help to follow up the impact regarding basic data on the communities was absent. the research work is less developed and the pro- gram did not have the tool that would help to make it feasible to publish results from the work. many indings were not pointed out through research actions; this explains why few publications have resulted from the work at bethesda. another challenge is communication, which is still very poor so many donors that may know bethesda’s experience are not aware about the proved capacities of bethesda to al- leviate poverty with its integrated approach. bethesda is able to help in other countries because the experience itself is very strong and can help to reduce poverty. conclusions the integrated health care program in benin progressed over the years as community needs appeared and is based on a participatory problem-solving model. therefore, the design has been a dynamic system that integrates new possibilities to empower the community to face problems and improve its welfare. the initiative, which began in with a commu- nity-based approach, led us to the conclusion that to address the health problems in developing countries such as benin, we have to look at the health care system as a whole in response to the needs of the community. the four-component program approach is the one that bethesda is now carrying out to address the needs of the community. the methods include: . work on real problems which touch many people in the community and help them to think together about them; . do the work progressively with respect to the different problems by making each step sustainable and basing everything on a participatory approach; . develop a good partnership among the stakeholders; mainly the state, the local government, the population and the civil society; . be aware that there are inancial resources in the com- munity despite its poverty. these resources, put together, could raise a mountain; . build conidence among the different stakeholders. for the future, bethesda needs to develop a good partner- ship with a research program in order to better assess the im- pacts of its integrated approach and communicate them to a wider outside community. a .. short report genomic structure of the gene for the sh and pleckstrin homology domain-containing protein grb and evaluation of its role in hirschsprung disease misha angrist , stacey bolk , kimberly bentley , sudha nallasamy , marc k halushka and aravinda chakravarti , department of genetics and center for human genetics, case western reserve university and university hospitals of cleveland, cleveland, ohio, - , usa hirschsprung disease (hscr), or congenital aganglionic megacolon, is the most frequent cause of congenital bowel obstruction. germline mutations in the ret receptor tyrosine kinase have been shown to cause hscr. mice that carry null alleles for ret or for its ligand, glial cell line-derived neurotrophic factor (gdnf), both exhibit complete intestinal aganglionosis and renal defects. recently, the src homology (sh ) domain-containing protein grb has been shown to interact with ret in vitro and in vivo, early in development. we have con®rmed the map location of grb on human chromosome , isolated human bacs containing the gene, elucidated its genomic structure, isolated a highly polymorphic microsatellite marker adjacent to exon and scanned the gene for mutations in a large panel of hscr patients. no evidence of linkage was detected in hscr kindreds and no mutations were found in patients. these data suggest that while grb may be important for signal transduction in developing embryos, it does not play an obvious role in hscr. keywords: hirschsprung disease; grb ; grb-ir; ret receptor tyrosine kinase; mutation detection; genomic structure; mapping congenital aganglionic megacolon, commonly known as hirschsprung disease (hscr), is associated with a lack of intrinsic ganglion cells in the myenteric and submucosal plexuses along variable lengths of the gastrointestinal tract (holschneider, ). enteric ganglion cells are derived primarily from the vagal neural crest. thus, hscr, like other disorders whose a�ected tissues are of neural crest origin, is best characterized as a neurocristopathy, albeit one that frequently co-occurs with additional phenotypes a�ecting neural crest-derived tissues (bolande, ; martucciello, ). hscr is relatively common, with an incidence of approximately in live births (spouge and baird, ). evidence that hscr susceptibility has a large genetic component has come from pedigrees segregat- ing hscr as an incompletely penetrant autosomal dominant trait and formal segregation analysis supporting the hypothesis of dominant inheritance in at least % of cases, with the remainder of cases explainable by recessive or multigenic inheritance (badner et al., ; bodian and carter, ). subsequently, genetic mapping of hscr to the pericentromeric region of chromosome in a subset of families (angrist et al., ; lyonnet et al., , and to chromosome q in a large mennonite kindred (pu�enberger et al., a) was reported. in , mutations in hscr patients were described in several genes, most notably in the ret receptor tyrosine kinase (edrey et al., ; romeo et al., ) and in the g-protein coupled endothelin-b receptor (ednrb; pu�enberger et al., a). mutations have since been reported in ednrb's physiological ligand, endothelin (hofstra et al., ; kusafuka et al., , . mouse knockout phenotypes for these genes, and for ret's ligand gdnf, support roles for them in the development of the enteric nervous system (jing et al., ; moore et al., ; sanchez et al., ; schuchardt et al., ), as mice carrying null alleles in each case exhibit intestinal aganglionosis. however, given the high likelihood that mutations in ret and the endothelins account for no more than % of all cases of hscr (attie et al., ; chakravarti, ; seri et al., ), substantial additional genetic factors remain to be discovered. the importance of ret in the development of neural crest derivatives, and hscr in particular, suggested that downstream components of the ret signal transduction pathway might also predispose to hscr susceptibility. recently, the sh domain- containing protein grb (ooi et al., ) was found to be a constituent of this pathway. using mouse ret as bait in a yeast two-hybrid assay, pandey et al. ( ) isolated grb as prey from an embryonic day . expression library. in vitro binding studies and co- immunoprecipitation experiments con®rmed these results. among other prey, grb was also obtained in a ret two-hybrid screen by another group (durick et al., ). using the cytoplasmic domain of human ret as bait, we conducted another two-hybrid screen of a mouse embryonic day cdna library. among the positives selected for signal strength in the b-galactosidase assay was a mouse cdna correspond- ing to the sh and pleckstrin homology domains of grb (angrist, ). thus, in several independent two-hybrid screens of early embryonic libraries, the sh domain of grb was found to interact with the intracellular domain of ret. correspondence: a chakravarti received april ; revised june ; accepted june oncogene ( ) , ± ã stockton press all rights reserved ± / $ . http://www.stockton-press.co.uk/onc grb was also viewed by us as a candidate for hscr susceptibility for reasons other than its association with ret. its expression in the early embryo is consistent with a role in enteric nervous system development (angrist, ; okamoto and ueta, ; pandey et al., ; webster, ). in addition to an sh domain at its carboxy terminus, grb also contains a pleckstrin homology (ph) domain of * amino acids (margolis, ; ooi et al., ). ph domains have been implicated in cellular signaling and cytoskeletal organization, especially in those molecules associated with cell membranes (shaw, ). the sequence that codes for the ph domain that is present in the so-called hgrb-irb/grb and hgrb /ir-sv isoforms of grb (frantz et al., ; o'neill et al., ) is part of a larger region in the coding sequence that bears striking identity to the c. elegans cosmid f e . and the gene it contains, mig- . mig- is critical for migration of several groups of neurons. what these neurons have in common is that, like presumptive enteric neurons in the mammal, they all undergo long-range migrations along the antero-posterior axis. additionally, mutant mig- animals all have shortened posterior excretory canals. manser and wood (manser et al., ; manser and wood, ) have suggested that the pleiotropic nature of this mutation may arise as the result of a defect in a component of the basal lamina that is critical for both canal outgrowth and neuronal migration. thus, given the failure of excretory cell migration and the presence of non-cell autonomous defects, pleiotropy, incomplete penetrance as well as the potential involvement of the extracellular matrix, it is clear that mig- mutant and hscr phenotypes share several salient genetic features. in order to assess grb 's role in hscr and further characterize the gene, we have con®rmed its map location, isolated bacterial arti®cial chromosomes (bacs) containing human genomic grb sequence, determined its intron-exon boundaries, and identi®ed a highly polymorphic microsatellite in intron . we have also screened a panel of hscr patients and families for linkage to chromosome p by genotyping microsatellite polymorphisms and for mutations in grb by nucleotide sequencing. no evidence of linkage was observed and no mutations were detected in hscr patients. initially, grb was mapped to human chromo- some by somatic cell hybrid mapping. using unique primers from the grb -derived expressed sequence tag (est) c- kf (genbank accession no. z ), a bp product was pcr-ampli®ed essentially as described (angrist et al., a; annealing temperature). primers used were: c kf .f: '-gagaggtgcttggaagaccat- ' and cik- f .r: '-agaactcgtattttgcgtaat- '. chro- mosomal mapping was accomplished by pcr genotyp- ing against the national institute of general medical sciences (nigms) human rodent somatic cell hybrid mapping panel (coriell institute for medical research, camden, nj, usa. regional chromosomal localization was performed using the stanford g radiation hybrid mapping panel as dna template, as previously described (angrist et al., b). both somatic cell hybrid and radiation hybrid mapping experiments yielded a single, unambiguous band. data were submitted to the stanford rh web server (http:// www-shgc.stanford.edu/rhserver /rhserver_form.html) for map analysis. rh mapping re®ned the gene's position to within . centirays (& kb) of d s and . centirays (& kb) of d s by radiation hybrid mapping. the best location is depicted in figure . based on a recent integrated physical and genetic map of human chromosome (bou�ard et al., ), the cytogenetic location of grb can be deduced to be p . ± p . this map placement is in close agreement with other recently reported ¯uorescence in situ hybridization and radia- tion hybrid mapping data from two independent groups (dong et al., ; jerome et al., ). genomic dna containing grb was obtained by screening a bac library with a fragment derived from the cdna clone obtained in an earlier two-hybrid screen (angrist, ) and that most closely resembled the sequence of human grb-ir (liu and roth, ). a bp spei fragment (nucleotides ± ) derived from this clone was excised from a two-hybrid system prey vector (pgad , a gift from dr stanley fields, university of washington, seattle, wa), cleaned using the wizard dna clean-up system (promega, madison, wi, usa) and used to probe the research genetics (huntsville, al) bacterial arti®cial chromosome (bac) library ®lters. hybridi- zations, isolation of bac dna and manual sequen- cing were performed as described (angrist et al. ). the gene was found to contain at least exons (figure , table ). exon and approximate intron sizes are listed in table . the genomic boundaries of human grb are estimated to encompass at least kb. a potentially polymorphic dinucleotide repeat ([tg] taa[ga] g[tg] ) was detected bp up- stream of the ' end of exon . we ampli®ed this sequence using radioactively end-labeled primer in ceph control individuals and hscr patients and their families. primers used were: grbircar.f : '- gtcttggt-gcttgcctggtgtg- ' and grbir- car.r : '-ggctgtcacggaggagaaaaag- '. ampli®cation conditions were as described (puffen- berger et al., b), except the annealing temperature was c and the mg + concentration was . mm. allele sizes and frequencies of the microsatellite marker, designated grb -can, are listed in table , with a heterozygosity of . determined empirically in ceph control individuals. when this marker was tested for linkage in hscr families and sib pairs, no evidence of linkage or increased allele sharing among a�ected individuals was detected. in order to assess allele sharing among a�ecteds, we utilized the nonparametric linkage (npl) test, as implemented in the program genehunter (kruglyak et al., ). this analysis yielded npl z scores of . (p= . ) for nine large kindreds, . (p= . ) for sib pairs, and . (p= . ) for all families segregating hscr combined. additionally, we obtained maximum two-point parametric lod scores for hscr versus grb -can of . for nine large families, . for sib pairs, and . for the combined family data. parametric analyses assumed a rare autosomal dominant gene (p= . ) and sex-dependent reduced penetrance in males ( %) and females ( %), as described in angrist et al. ( ). grb structure and analysis in hirschsprung disease m angrist et al after obtaining informed consent, a panel of + biopsy-proven hscr patients was screened for mutations in grb . patients were chosen without regard to segment length or accompanying pheno- types; the panel used here closely resembled that used in our previous non-mennonite hscr studies (angrist a, ) and represented the broad spectrum of segment length and associated manifesta- tions of neural crest disorders. using the intron-exon boundary information obtained from direct bac figure (top) genetic map of human chromosome p . -p . horizontal bar indicates most likely location of grb based on radiation hybrid mapping; marker locations are from dib et al. ( ). (bottom) schematic representation of grb exons. the relative size of each exon is indicated by the size of its box; intronic sequence is not represented. below the exons, the corresponding protein domains are depicted. `exon a' is presumed to exist ' of exon based on reports of another grb /grb-ir/hgrb g isoform (frantz et al., ; o'neill et al., ). the top and bottom portions of the ®gure are not drawn to the same scale table human grb genomic structure exon size (bp) position in cdna a (nt) intron size (kb) splice acceptor splice donor a b ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± * . * . * . * . * . * . * . . * . * . * . * . * . * . * . ± ' utr ttttttttaggacaaggtg ttctgtgcagaggatgatg tgccttccaggcgccttca tgtgttgcaggatgttaaa gcccctgcagagagaggtg attttcttagaatttcttc tcttcaacagaattttctg gttgtcacaggaacccaga cctcctgtagccaaacaaa tcctctccagtatggaatg tccttttcaggccagtgtc tcttttgcagaagcgaagc ccccccacagtgattcaca ccttccccaggctttttct gtctctccagtgcgaggac tactaccaggtatgggcga atcaccagcgtaaggaatg cgctgtcaggtaggtccag gcaaagcaggtgagtgtgc taggattaggtagggaacc aatcccatggtgagtctta cttttgcaggtactgggcc acttcaaaggtgagcttta tgcataaaggtacccacga ctcctcaaggtatgtgaca acgccagtggtaagtaaag ccctggagggtaaggcccc taagtacaggtaaacaggg cgtggatgggtaaggaacc atcttacctgtaagtattg ' utr a cdna sequence from liu and roth ( ). b position based on additional grb splice variants reported by others (frantz et al., ). grb structure and analysis in hirschsprung disease m angrist et al sequencing, primers were designed to pcr amplify the exons of human grb (table ). pcr ampli®cation and sequencing were carried out as described (angrist et al., ). beyond the micro- satellite marker, several sequence variants were found in grb in patients (table ). all were silent changes, none of which are expected to disrupt splicing or otherwise interfere with proper grb function, although this cannot be demonstrated conclusively in the absence of functional studies. interestingly, two of the three intronic variants altered two closely positioned but non-consecutive nucleotides (table ), suggesting that grb might be undergoing gene conversion. we consider this to be a reasonable hypothesis, given that these sequence changes reside outside canonical motifs necessary for proper splicing (senapathy et al., ) and that there are at least three other extant genes in the genome closely related to grb (daly et al., ; margolis, ). as reported here, grb was found to span a genomic region of * kb and to include at least exons (figure ). these exons encompass all published grb splice variants and include both the unique n- terminus of hgrb-ir and the full-length ph domain of hgrb-irb (also called grb-irph and hgrb /ir- sv ; frantz et al., ; liu and roth, , ; o'neill et al., ) each intron-exon boundary listed table allele sizes and frequencies for microsatellite marker grb -can in unrelated individuals allele size (bp) frequency . . . . . . . . . . . table primers used for genomic ampli®cation of human grb exons exon exon size (bp) product size (bp) annealing temperature ( f) forward primer ( '® ') distance to ' end of exon (bp) reverse primer ( '® ') distance from ' end of exon (bp) a +dmso +dmso ggcttggcttctcacagtctg ttctgctgcggtcctgttttt cctgatcaccaagatgtaca gtgtaaggctgggtcat tttcttgaaagcccgaagtt taccatgaatttcccacctgt ctttgqagctaaccttttacg gctgataacatgtctgcttta ttgcctttgctgtgcttgag ttctgactccctgtgtgaaca tgctgtggcgtttgtcac ctgcggcctttccttttc gtctgctgtcctcggtgctaa ggccagagtgcaccacacaaag acttaaatgccaaagcactgc cgttctgttccctgaggtggc to atg atctatggctggtggcgacat caagctagaactgggagtgt gaggcctggacctacctg acttcccgcccttcttcc aggtgccaatcctgttctga tgatactatgaaaacccaagt caagaggatttctattctgaa attagggctggtggtggtagc agtctcctgtgggctgctgag ctgccagaatagacatcaagt tgaagctgaaaaggcact ggctaccaccttgagggt ggggtgctgtttgattttctt ccccagcacaataaaaccttag gaatgaaaccagaaaacaaac ctccggttcttgttcctaagc to tga table polymorphisms detected in human grb grb intron/ nucleotide amino acid enzyme site hscr patients controls exon change change domain change +/+ +/ ± ± / ± +/+ +/± ± / ± w (p) intron ata?gtc bp ' of exon unique to grb-ir taii . ( . ) exon ccg?cca p p unique to gbr-ir avai styi . ( . ) exon tac?tat y y gm ± . ( . ) exon ccc?cca p p gm styi . ( . ) intron g?a bp ' of exon gm hphi plei, hinfi . ( . ) intron gtggg? atgga bp ' of exon gm ± . ( . ) gm=grb and mig (see text). `+' refers to previously published alleles in grb cdna (frantz et al., ; liu and roth, ; o'neill et al., ), `±' refers to alleles not previously described grb structure and analysis in hirschsprung disease m angrist et al is described in table and contains the gt-ag consensus sequences for eukaryotic donor and acceptor splice sites (senapathy et al., ). several factors might explain why grb was not found to predispose to hscr in our study. first, although there is little doubt that grb and ret interact in the mouse, this may not be the case in the human. also, it is not clear that this interaction is essential in vivo; in the absence of targeted grb mutations in mice, it is di�cult to gauge whether grb is truly unique in its function, or is merely a redundant member of a large family of sh adapter proteins. closely-related family members grb and grb also contain proline-rich, gm, ph and sh domains. moreover, ret appears to be one of several signaling molecules that exhibits high a�nity for grb . both the insulin receptor (ir) and the type i insulin-like growth factor receptor (igf-ir) have been shown to interact directly with grb (reviewed in (morrione et al., ). also, recent reports have shown that human grb isoforms are di�erentially expressed in insulin target cells such as skeletal muscle, liver and adipocytes (dong et al., ). thus, grb may be more important in mediating insulin signaling than in enteric neurogenesis. lastly, although we were able to screen all of the grb /grb-ir exons in patients and controls, we did not screen the introns or the upstream and downstream untranslated sequences. in addition, given that exon a was found to reside in intron , it is not unlikely that additional exons may exist within other introns. indeed, there are now four known isoforms in the human (dong et al., ). nevertheless, linkage analysis of hscr families using a highly polymorphic microsatellite marker within the gene suggests that grb mutations cannot account for a substantial fraction of familial hscr. to date, all reported hscr susceptibility genes are members of the ret signaling pathway (ret, gdnf), the g protein-coupled receptor (gpcr) endothelin-b pathway (ednrb, edn ), or the sry-like hmg-box family of transcription factors (sox ; pingault et al., ; southard-smith et al., ). we believe that the presence of both sh and ph domains in the grb family of proteins suggest a possible model for uniting the ret and gpcr pathways. there is now evidence that human grb is a common target for kinases existing in both the map kinase and phosphatidylinositol - kinase signal transduction pathways (dong et al., ). these data, as well as the importance of sh domains in rtk signaling and ph domains' possible role in g protein-coupled receptor-mediated signaling, suggest that grb family members might serve as a conduit for transducing extracellular neuroenteric signals to the nucleus and perhaps, sox or other related transcription factors therein. acknowledgements we are extremely grateful to the families who make all of our studies possible, to dr akhilesh pandey for reagents and helpful discussion, and to nydia bringht-twumasi for expert technical assistance. this research was partially supported by a grant from the national institutes of child health and development, national institutes of health (hd- ). references angrist m. ( ). identi®cation of hirschsprung disease susceptibility genes. doctoral dissertation. case western reserve university, cleveland, ohio. angrist m, kau�man e, slaugenhaupt sa, matise tc, pu�enberger eg, bolk s, washington ss, lipson a, cass dt, rayna t, weeks de, sieber w and chakravarti a. ( ). nature genet., , ± . angrist m, bolk s, thiel b, pu�enberger eg, hofstra rm, buys chcm, cass dt and chakravarti a. ( a). hum. mol. genet., , ± . angrist m, wells de, chakravarti a and pandey a. ( b). genomics, , ± . angrist m, bolk s, halushka m, lapchak pl and chakravarti a. ( ). nature genet., , ± . angrist m, jing s, bolk s, bentley k, nallasamy s, halushka m, fox gm and chakravarti a. ( ). genomics, , ± . attie t, pelet a, edery p, eng c, mulligan lm, amiel j, boutrand l, beldjord c, nihoul fekete c, munnich a, ponder baj and lyonnet s. ( ). hum. mol. genet., , ± . badner ja, sieber wk, garver kl and chakravarti a. ( ). am. j. hum. genet., , ± . bodian m and carter co. ( ). ann. hum. genet., , ± . bolande rp. ( ). pediatr. pathol. lab. med., , ± . bou�ard gg, idol jr, braden vv, iyer lm, cunningham af, weintraub la, touchman jw, mohr-tidwell rm, peluso dc, fulton rs, ueltzen ms, weissenbach j, magness cl and green ed. ( ). genome res., , ± . chakravarti a. ( ). hum. mol. genet., , ± . daly rj, sanderson gm, james pw and sutherland rl. ( ). j. biol. chem., , ± . dib c, faure s, fizames c, samson d, drouot n, vignal a, millasseau p, marc s, hazan j, seboun e, lathrop m, gyapay g, morissette j and weissenbach j. ( ). nature, , ± . dong lq, du h, porter sg, kolakowski lf, lee av, mandarino j, fan j, yee d and liu f. ( ). j. biol. chem., , ± . durick k, wu r-y, gill gn and taylor ss. ( ). j. biol. chem., , ± . edery p, lyonnet s, mulligan lm, pelet a, dow e, abel l, holder s, nohoul fekete c, ponder ba and munnich a. ( ). nature, , ± . frantz jd, giorgetti-peraldi s, ottinger ea and shoelson se. ( ). j. biol. chem., , ± . hofstra rmw, osinga j, tan-sindhunata g, wu y, kamsteeg e-j, stulp rp, van ravenswaaij-arts c, majoor-krakauer d, angrist m, chakravarti a, meijers c and buys chcm. ( ). nature genetics, , ± . holschneider am. (ed). ( ). hirschsprung's disease. thieme-stratton: new york. jerome ca, scherer sw, tsui lc, gietz rd and triggs- raine b. ( ). genomics, , ± . jing s, wen d, yu y, holst pl, luo y, fang m, tamir r, antonio l, hu z, cupples r, louis jc, hu s, altrock bw and fox gm. ( ). cell, , ± . kruglyak l, daly mj, reeve-daly mp and lander es. ( ). am. j. hum. genet., , ± . kusafuka t, wang y and puri p. ( ). hum. mol. genet., , ± . grb structure and analysis in hirschsprung disease m angrist et al kusafuka t, wang y and puri p. ( ). journal of pediatric surgery, , ± . liu f and roth ra. ( ). proc. natl. acad. sci. usa, , ± . liu f and roth ra. ( ). mol. cell. biochem., , ± . lyonnet s, bolino a, pelet a, abel l, nihoul-fekete c, briard ml, mok siu v, kaariainen h, martucciello g, lerone m, puliti a, luo y, weissenbach j, devoto m, munnich a and romeo g. ( ). nature genet., , ± . manser j, roonprapunt c and margolis b. ( ). dev. biol., , ± . manser j and wood wb. ( ). dev. genet., , ± . margolis b. ( ). prog. biophys. mol. biol., , ± . martucciello g. ( ). pediatr. surg. int., , ± . moore mw, klein rd, farias i, sauer h, armanini m, phillips h, reichardt lf, ryan am, carver-moore k and rosenthal a. ( ). nature, , ± . morrione a, valentinis b, resnico� m, xu s and baserga r. ( ). j. biol. chem., , ± . o'neill tj, rose dw, pillay ts, hotta k, olefsky jm and gustafson tm. ( ). j. biol. chem., , ± . okamoto e and ueta t. ( ). j. ped. surg., , ± . ooi j, yajnik y, immanuel d, gordon m, moskow jj, buchberg am and margolis b. ( ). oncogene, , ± . pandey a, duan h, difiore pp and dixit vm. ( ). j. biol. chem., , ± . pingault v, bondurand n, kuhlbrodt k, goerich de, prehu m-o, puliti a, herbarth b, hermans-borgmeyer i, leguis e, matthijs g, amiel j, lyonnet s, ceccherini i, romeo g, clayton smith j, read ap, wegner m and goossens m. ( ). nature genet., , ± . pu�enberger eg, hosoda k, washington ss, nakao k, dewitt d, yanagisawa m and chakravarti a. ( a). cell, , ± . pu�enberger eg, kau�man er, bolk s, matise tc, washington ss, angrist m, weissenbach j, garver kl, mascari m, ladda r, slaugenhaupt sa and chakravarti a. ( b). hum. mol. genet., , ± . romeo g, ronchetto p, luo y, barone v, seri m, ceccherini i, pasini b, bocciardi r, lerone m, kaarianen h and martucciello g. ( ). nature, , ± . sanchez m, silos-santiago i, frisen j, he b, lira s and barbacid m. ( ). nature, , ± . schuchardt a, d'agati v, larsson blomberg l, costantini f and pachnis v. ( ). nature, , ± . senapathy p, shapiro mb and harris nl. ( ). methods enzymol., , ± . seri m, yin l, barone v, bolino a, celli i, bocciardi r, pasini b, ceccherini i, lerone m, kristo�ersson u, larsson lt, casasa jm, cass dt, abramowicz mj, vanderwinden jm, kravcenkiene i, baric i, silengo m, martucciello g and romeo g. ( ). hum. mutation, , ± . shaw g. ( ). bioessays, , ± . southard-smith em, kos l and pavan wj. ( ). nature genet., , ± . spouge d and baird pa. ( ). teratology, , ± . webster w. ( ). j. embyol. exp. morphol., , ± . grb structure and analysis in hirschsprung disease m angrist et al genomic structure of the gene for the sh and pleckstrin homology
domain-containing protein grb and evaluation of its role in
hirschsprung disease acknowledgements references wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ american archivist / vol. , no. / summer the international scene ronald j. plavchan, editor we are indebted to the following correspondents: australia: r.g. neale; austria: josef riegler; bahamas/caribbean: d. gail saunders; brazil: maria amelia gomes leite; china: sun fangjiu; federal republic of germany: wolfram werner; finland: eljas orrman; france: michel duchein; german democratic republic: horst schetelich; england & wales: bruce jackson; india/swarbica: n.h. kulkarnee; israel: haya wolovsky; italy: donato tamble; malawi/east and central africa: steve m. mwiyeriwa; malaysia/sarbica: zakiah hanum nor; mexico: juan claudio mayer guala; netherlands: t.p. huijs; new zealand: judith s. hor- nabrook; nigeria/west africa: j.c. enwere; organization of american states: celso rodriguez; peru/ala: cesar gutierrez munoz; poland: jerzy szczepanski; scotland: andrew m. jackson; senegal/west africa: m. saliou mbaye; solomon island/oceania: r.g.a. chesterman; south africa: maryna fraser; spain: margarita vazquez de parga; vatican city: claudio de dominicis; and zimbabwe: r.g.s. douglas. argentina head of national archives becomes new ala president. cesar a. garcia belsunce, director general of the ar- chivo general de la nacion, was elected on november by the general assembly of the asociacion latino- americana de archivos (ala) to suc- ceed guillermo durand florez, director of the archivo general de la nacion (peru), who has served as president of ala since . under ala bylaws, the presidency is a three-year term with no reelection. with the ascension of an argentinean to the presidency, the ala executive secretariat has moved from lima, peru to buenos aires, argentina. miguel angel cannone of the archivo general de la nacion is the new executive secretary, succeeding cesar gutierrez munoz, who has returned to an archival position at the universidad catolica in lima. publication of nota informativa, the information newsletter started by gutierrez munoz in august and issued periodically by the executive secretariat, has been suspended and no decision has yet been made about con- tinuing the program. the new address of the ala executive secretariat is ar- chivo general de la nacion, leandro n. alem , buenos aires, argen- tina. d ow nloaded from http://m eridian.allenpress.com /doi/pdf/ . /aarc. . .w m by c arnegie m ellon u niversity user on a pril american archivist / summer bolivia proceedings of the second meeting of bolivian archivists published. the cen- tro pedagogico y cultural de portales, cochabamba, has published the pro- ceedings of the second meeting on boli- vian archives that was held on - july in cochabamba. it includes the program; a list of participants; the in- augural address of gunnar mendoza, director of the archivo nacional de bolivia; the various proposals presented; and the final resolutions. canada third anniversary of the maison des archives. three years ago, on june , the maison des archives officially opened in the pavilion casault of laval university at sainte-foy, a suburb of quebec city. it not only became the new home of the archives nationales du quebec (anq) but proved the feasibility of converting older existing buildings in- to modern archival repositories. the story of the conversion process is in- teresting and filled with valuable lessons for archivists and government officials who seek additional archives space but are hampered by limited financial re- sources. from both an architectural and archival standpoint, the maison des ar- chives is a marvel. the building, constructed in and called the grand seminaire, was originally designed by ernest cormier to serve as a seminary for the catholic diocese of quebec. it served in this capacity for the next twenty years, although by the building was no longer being used for the training of young men to the priesthood, as enroll- ment had declined. in laval university acquired the property and renamed the building the pavilion casault. at about the same time the anq moved to the campus, and the decision was made to transform the ma- jor portion of the university chapel into an archives. the major challenge was how to transform the existing structure into the specialized needs of a modern archival repository without sacrificing the aesthetic and impressive architec- tural character (modern gothic) of the original structure and within reasonable cost estimates. to accomplish this, it was necessary to undertake major in- terior alterations but yet not destroy the significant interior architectural ele- ments of the former seminary chapel. within the former chapel area, an eight-story structure was built to house the various archives services. four levels serve as storage areas for documents and microfilm, two levels contain research rooms and a library, one level is a recep- tion area for researchers and exhibi- coupe longitudinale, apres intervention. la section occupee par la maison des archives est indiquee en gris. pavilion casault niveau: coupe apres les travaux maison des archives . magasins . hall . accueil . salle d'exposition unlversite laval a. salle de cours b. ecole de musique . administration . salle des chercheurs et bibliotheque . cartes et plans et audio-visuel c. £cole des arts visuets d. futur centre museographique . tri et classement . atelier de restauration et de reliure i. ascenseur public e. studio d'essais f. geodesie ii. ascenseur personnel et archives g. mecanique d ow nloaded from http://m eridian.allenpress.com /doi/pdf/ . /aarc. . .w m by c arnegie m ellon u niversity user on a pril the international scene tions, and one level houses administra- tive offices and a preservation/restora- tion laboratory. the unique construc- tion quadrupled the amount of floor space available for archival use. total cost of the conversion project was $ million, or half the estimated cost to construct a new facility of the same dimensions. for the province's tax- payers, it was a bargain. another resulting benefit has been the preserva- tion of a building with considerable ar- chitectural appeal that might otherwise have been destroyed with the demise of its original function. the maison des archives is indeed a tribute to the in- genuity and practicality of university of- ficials and members of the provincial government's ministry of public works and supplies. other portions of the former grand seminaire are used by the university to house its schools of music, visual arts, and journalism; department of geodesy; museographic center; and classrooms and special testing facilities. for further information about the con- version or anq, write to archives na- tionales du quebec, cp , sainte- foy, quebec g v n canada. mennonidsche rundschau microfilmed. the oldest mennonite periodical pub- lished continuously under one name, mennonitische rundschau ( - ), is now available on microfilm through university microfilms of ann arbor, michigan. the coordination of the proj- ect, which required almost two years, has been under ken reddig, archivist at the center for mennonite brethren studies in winnipeg, manitoba. the principal part of the project, which also proved to be the most difficult, was to locate and collate all existing copies of the rundschau. the collection is in- complete, because reddig has been unable to locate copies of twenty-seven separate issues, as well as the entire year of , even though he made every ef- fort to locate the missing copies in both north america and europe. it was decided to proceed with the microfilm- ing project with the understanding that, if additional copies eventually are located, these will be added to the microfilm collection. mhso genealogy committee formed. the genealogy committee of the men- nonite historical society of ontario (mhso) held its first meeting at conrad grebel college, waterloo, on november . the aim of the commit- tee is to record information found on tombstones, set up a filing system, pro- mote the collecting of family photo- graphs, and assist those individuals who are working on their own family histories. federal republic of germany tenth international congress on ar- chives preparations. planning for the tenth international congress on ar- chives scheduled to be held in bonn - september is well under way. the beethovenhalle has been chosen as the site of the congress, and other ica bodies will hold meetings at nearby bonn university. the theme for the international meeting of archivists is "the challenge to archives: growing r e s p o n s i b i l i t i e s and limited resources." a special session is also planned for the exchange of archival materials through reprography. in addi- tion to the regular schedule of meetings and sessions, there will be planned ex- cursions to aachen, cologne, and trier. on september, delegates to the con- gress will have the opportunity to tour the new construction of the bundes- archiv in koblenz. saa is planning to sponsor a study tour to western europe that will include the congress. further information about d ow nloaded from http://m eridian.allenpress.com /doi/pdf/ . /aarc. . .w m by c arnegie m ellon u niversity user on a pril american archivist / summer the study tour will appear in forthcom- ing issues of the saa newsletter. for more information about the congress or accommodations, write to klaus olden- hage, ica secretariat, postfach , d- koblenz , federal republic of germany. france new look announced for unisist newsletter. c. coudert-schklowski, editor of the unisist newsletter, has announced (vol. , no. , ) a major change in the content for subsequent issues of the newsletter. one of the stated aims for the change is to make the newsletter complementary with the unesco journal of information, science, librarianship and archives ad- ministration. consequently, articles in the newsletter will deal solely with the activities of the general information programme (pgi) division and of other unesco sectors in the information field. a c c o r d i n g to c o u d e r t - schklowski, the change will also mean that the newsletter will only be published at irregular intervals—whenever material is available. the resulting ad- vantage to its readers will be that they will receive current information. the april-june issue of the unesco journal is dedicated to ar- chives. it contains articles by frank b. evans (unesco), g.p.s.h. de silva (national archives of sri lanka), ber- nard faye (unesco), y.p. kathpalia (national archives of india), oleg a. mihailov (soviet research center for technical documentation), michael roper (british public record office), and michael cook (university of liver- pool). the journal is also available in spanish. israel major israeli institution receives ein- stein's private papers. the private papers of albert einstein ( - ) recently arrived at the jewish national and university library in jerusalem. the famous german-born physicist had bequeathed these materials to the hebrew university, j e r u s a l e m . einstein's private papers, comprising about , pages, include his writings, unpublished drafts, notes, notebooks, lecture notes, personal and scientific correspondence, touring diaries, family papers, photographs, and a variety of items suitable for exhibition. new building for central zionist ar- chives planned. in its report to the th zionist congress, , the central zionist archives revealed that the zionist executive has taken steps to im- plement its decision to construct an archives building. political events and economic problems have been responsi- ble in the past for the project's delay; but space problems have reached a critical point, affecting storage, acquisitions, and reference service. the planned new archives will be erected near binyenei ha-oomah in jerusalem. detailed archi- tectural plans have been drawn up and submitted for approval by the town planning committee. in the th zionist congress defined the status of the central zionist archives as the historical archives of the world zionist organization and the jewish agency. mexico computerized finding aids for notarial records. in august , the university computing center at the university of massachusetts, amherst, published the guide to the notarial records of the ar- chivo general de notarias of mexico city for the year . the -page finding aid was compiled by robert a. potash of the university of massachu- setts in collaboration with jan bazant and josefina z. vasquez of el colegio d ow nloaded from http://m eridian.allenpress.com /doi/pdf/ . /aarc. . .w m by c arnegie m ellon u niversity user on a pril the international scene persona nohbrada abreu abreu l u i s aba l u i s aba luis aba luis luis juan gaspa jose jose jose manue franc mar lor en: refug teres k . g . a i benit' f r . j o s jose jose juan juan katia •i a mo iako i a no iano ' i a no • i e arca rca a a b o l a f i a a a b o l a f i a abren y narin abreu eu y rodriguez eu y rodriguez burto icevedo : acevedo : y •on acosta a r i a acosta ,rdo acosta iosta clasificacion nacionrlidad protesta de libranza fiahza ehpleo fianza curador testamento testahento testahento espanol cohpravehta casa poder general subrogacion arrendam protesta oe letra cohpraventa parte hda protesta de letra protesta de letba recibo de dote arrendaniento negocio eeuu poder general declabacion testah poder especial pleitos testamento poder adhinistrar subrogacion h poteca testahento fechft hot / / / / - / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / • c i c ' sample from the guide for , general index to persons. de mexico. the significance of this volume was that it demonstrated that computers can be used to prepare com- prehensive indexes for notarial records —a first for latin america. under the pilot project, begun in , there will be three such computerized indexes for the selected years: , , and . the second guide was published in no- vember , and the third is scheduled for publication in september . prior to this project, notarial archives presented a special challenge to scholars who wished to use them in their studies on latin america. although these rec- ords contain a wealth of useful informa- tion, the nature of the records' internal arrangement and the absence of compre- hensive name and subject indexes greatly limited their use by scholars. in a group of scholars met in mexico city to discuss the problems and possible use of computers to provide a comprehensive index. from this meeting emerged the pilot project. the tinker foundation of new york provided the initial funds; and subsequent funding has been sup- plied by the organization of american states, centro de estudios historicos of el colegio de mexico, and the universi- ty of massachusetts. a team of archival assistants under the supervision of ba- zant and vasquez recorded the necessary data on specially designed forms at the archivo general de notarias and then forwarded the data to potash at amherst for processing on the universi- ty's computers. when the project is completed—upon publication of the third volume—the university will undertake to train one of the team's members at the computer center and to transfer to mexico all of the software and other documentation associated with the pilot project. it is in- tended that el colegio de mexico, ar- chivo general de notarias, or some other mexican institution will assume responsibility for continuing with the project. furthermore, it is hoped that mexico will be able thus to provide assistance to other archives in latin america in the use of computers to pre- pare finding aids of their archival hold- ings. copies of the guide may be purchased from the university computing center bookstore, a- graduate research center, university of massachusetts, amherst, ma . spain first ala general conference. at the invitation of spanish archival officials and the government, the asociacion d ow nloaded from http://m eridian.allenpress.com /doi/pdf/ . /aarc. . .w m by c arnegie m ellon u niversity user on a pril american archivist / summer latinoamericana de archivos (ala) held its first general conference in madrid on - november . this event also marked the first time ala has held such a general meeting outside of latin america. in addition to the election of a new president and govern- ing board, the general assembly ap- proved an increase in annual member- ship dues as well as a very ambitious five-year plan (plan de mediano plazo) for archival development in latin america. some of the elements of the plan for the - period envision fulfillment of the resolutions passed at the rio de janeiro meeting that related to the training of archivists, establishment of committees to prepare for the th anniversary of columbus' discovery of america, solicitation of na- tional archives to conduct nationwide celebrations of archives week begin- ning in , and the identification of nonarchival organizations in setting up archival programs. other aspects of the plan include drafting guidelines for the profession; compiling current archival legislation in latin america; establish- ing guidelines for the organization of municipal archives; expressing support for cid (centro de information docu- mental de archivos, madrid, spain), cida (centro interamericano de desar- rollo de archivos, cordoba, argentina), and centromidca (centro taller regional de restauracion y microfilm- acion de documentos para el caribe y centroamerica, santo domingo, do- minican republic); and conducting a survey of the technical facilities and budget allocations in the region. in the area of preservation, ala intends to survey the general conditions of docu- ments in latin american respositories and to ask cid to prepare preservation/ conservation standards for the region. under the five-year plan some efforts will be made to encourage the use of audiovisual materials by sponsoring a seminar on audiovisual archives and by providing adequate training for persons who work with such materials. united kingdom university establishes literary manu- scripts register. after three years of planning and fund-raising, reading uni- versity library reports that it is setting up a computerized location register to trace manuscripts and letters of british and irish writers, especially those of the th century. david sutton, formerly of warwick university library, has been appointed the senior research officer to supervise the project, which is estimated to cost over £ , . fund- ing for the project is being provided by the leverhulme trust, the british library board, the strachey trust, the arts council, the british council, the british academy, the longman group, national westminster bank, lloyds bank, barclays bank, and hewlett packard ltd. as a result of this financial backing, maintenance of the location register in the university library is assured until . in addition to the financial support, international com- puters, ltd. has promised to assist in computerizing the register. the concept of the register arose in july during a debate at a two-day sconul (standing conference of na- tional and university libraries) seminar in london on the manuscripts and let- ters of modern writers. shortly after- ward a sconul working group was formed to examine more closely the idea of a location register. between may and november a pilot project, financed by the strachey trust, was carried out by james edwards, keeper of archives and manuscripts at reading university, to determine potential problems. by march the decision was made to proceed with the establishment of a full location register at reading. for further d ow nloaded from http://m eridian.allenpress.com /doi/pdf/ . /aarc. . .w m by c arnegie m ellon u niversity user on a pril the international scene information about the register, write to h.e. bell, senior assistant registrar, university of reading, whiteknights, reading rg ah england. golden jubilee of british library's newspaper library. in the fall of the british library's newspaper library, located on colindale avenue in london, celebrated its fiftieth anniversary. over the years this library has become one of the major newspaper archives in the world increasingly committed to micro- film. the present building opened in and contained thirteen miles of shelving to accommodate , volumes. its designers boasted that there was sufficient records storage space to last fifty years before the building need- ed expansion, but this prognosis was shortsighted. since the opening the library has been expanded twice and of- ficials have introduced a microfilm pro- gram to store the current holdings of , printed volumes and , reels of microfilm. microfilming began in with the opening of a microfilm annex and has accelerated since its in- troduction. preservation and space re- quirements have not been the only reasons for pursuing a microfilm pro- gram. officials point to the benefits in the area of reference service. by microfilming the collections the library can provide microfilm duplicates or elec- trostatic copies to both local and foreign researchers. the library reports that it sends about , reels of microfilm duplicates each year to other libraries, principally those located outside of the united kingdom. draft data standard for archives list- ing. the specialist repositories group (srg) working party on methods of listing has compiled a draft data stan- dard for the manual and computerized listing of archives. participants at the cambridge in-service training course held - july practiced listing documents from their repositories ac- cording to the data standard. one major problem was the definition of prove- nance, and the working party intends to discuss this in depth at its next meeting. although srg started the working par- ty, it has hoped to attract as many members as possible from various ar- chival insititutions to ensure that the data standard is suitable for use with any type of record. the museums documen- tation association (mda) has been assisting in the preparation of the draft data standard with the aim that it would be capable of use with any computer system and compatible with interna- tional standards. copies of the draft data standard may be obtained from ruth f. vyse, assistant archivist, ox- ford university archives, bodleian library, broad street, oxford ox bg england. cambridge university conservation project. in may a conservation project was established at cambridge university library under the director- ship of f.w. ratcliff. the british library is funding the project. one of the objectives of the conservation proj- ect is to describe existing facilities for the training of people in paper conserva- tion and craft bookbinding and to assess precisely what educational or training opportunities exist at all levels in order to compile a comprehensive list of con- servation and related courses available in the united kingdom. questionnaires are being sent out to every training course known or brought to the atten- tion of the project's staff. guide to archives resources available. globe book services ltd., a member company of macmillan publishers ltd., has announced publication of british archives: a guide to archive resources in the united kingdom. this general guide to british archives has been com- d ow nloaded from http://m eridian.allenpress.com /doi/pdf/ . /aarc. . .w m by c arnegie m ellon u niversity user on a pril american archivist / summer piled by janet foster, archivist with the city of london and hackney health district, and julia sheppard, archivist in the contemporary medical archives centre at the wellcome institute. it is being publicized as more comprehensive than previous guides and is fully indexed by name of institution, country and town, subject, and named collections. each of the entries provides infor- mation about major holdings, access conditions, acquisitions policy, publica- tions, historical background, finding aids, facilities, and the name, address, and telephone number of the person to contact for fuller information. for fur- ther information about this guide, write to the publisher, canada road, byfleet, surrey kt jl england. over a century of business history for your reference collection . . . annual reports major american corporations if "the business of america is business," then one way to understand the history of america is to study the history of american business. a unique and invaluable reference aid to this study is available from the micro- publishing subsidiary of pergamon press, microforms international marketing corporation (mimc). through an agreement with the baker library at harvard university, mimc has converted to microfilm more than years of american business and finan- cial history in the annual reports of major american companies. using the fortune double directory for , the baker library assembled the annual reports of the "fortune " industrials, plus those of companies from each of the "fortune " lists of top commercial banks, life insurance and diversified financial firms, and retail, transportation, and utility companies. the file has been kept up to date and is complete through . microforms are also available for the reports of individual companies or any groups of companies for complete price information and contents of the collection, write or call: p e r g a m o n p r e s s , i n c . attn: dr. edward gray fairview park, elmsford, ny / - /g/ d ow nloaded from http://m eridian.allenpress.com /doi/pdf/ . /aarc. . .w m by c arnegie m ellon u niversity user on a pril book reeews harvey l. dyck, editor,tlze paczjist ii?zpt~lse in historical perspective (toronto: university of toronto press, ). cloth, pp. $ . harvey dyck is to be congratulated for making available of the papers presented at an international conference on "the pacifist impulse in historical perspective" convened at the university of toronto in iviay of i , a date coinciding with the release of peter brock's comprehensive three-volume history of pacifism to (university of toronto press). given the intellectual stature, reputation and longevity o f peter brock, one is hard pressed t o imagine a morc aptly dedicated festschrift on this subject; the list of contributors constitutes a veritable "who's who" in peace studies. following the editor's eloquent tribute to tlie prolonged and synergistic role played by peter brock in the scholarly discipline of peace history, tlie essays are subsumed under f o ~ ~ r broad categories: "approaches t o peace history," "christian traditions of pacifism and non-resistance,'' "gandhi and the indian tradition of non-violence," and "pacifism and peace movements in the modern world, - ." a precis provided at the beginning of each section attempts, in an unforced and generally l i e l p f ~ ~ l manner, to fit the widely 'divcrgcnt essays and approaches within each givcn subdivision into a coherent, overarcliing framework. while each of the essays was in its own way highly stimulating and often book reliens enlightening, i did have my favorites. of the three contributions subsumed under "approaches to peace history," tlie most illuminating for this reviewer was martin ceadel's "ten distinctions for peace historians." ceadel, a lecturer in politics at oxford university, demonstrates that the terms and concepts at the lieart of the peace-studies lexicon are imbued with meanings contingent upon time, place, circumstance and ideology, and are therefore understood in such varied and at times contradictory ways as to mal * > ^ i ^ family > s . < ^ & . tsbpis s family n • , • family i s r r ^ family v family ^rro * > r family * m s t family < > ^ family i ~ © family family family s family x" ~ family o d \ female, male, deceased c ) c unconfirmed glioma <$> no. of sibs, children # • confirmed glioma © ^ other neuroectodermal tumor = identical twins figure i —abbreviated pedigrees of families with glioma (arrow indicates proband). https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core table . pathological diagnosis of confirmed cases by family family pathology glioblastoma (p) anaplastic astrocytoma anaplastic astrocytoma (p) astrocytoma anaplastic astrocytoma (p) glioblastoma glioblastoma (p) anaplastic astrocytoma astrocytoma (p) mixed glioma (second cousin) family anaplastic astrocytoma (nephew) glioblastoma (distant cousin) glioblastoma (p) glioblastoma astrocytoma (p) glioblastoma anaplastic astrocytoma anaplastic astrocytoma (p) anaplastic astrocytoma glioblastoma (p) anaplastic astrocytoma pathology mixed glioma (p) astrocytoma glioblastoma (p) glioblastoma glioblastoma (p) glioblastoma glioblastoma (p) glioblastoma (aunt's son) astrocytoma (uncle's son) anaplastic astrocytoma (p) glioblastoma glioblastoma (p) glioblastoma glioblastoma (p) oligodendroglioma glioblastoma (p) anaplastic mixed glioma glioblastoma (p) glioblastoma astrocytoma (p) anaplastic astrocytoma (p)= proband - - - - - - - * age (years) g h low grade gliomas f o anaplastic gliomas h glioblastomas figure — bar graph demonstrating number of cases, age at diagno- sis and pathology for confirmed cases. the probability of observing at least two affected persons in a family, given at least one affected person, can be estimated. for example, assuming an incidence for glioma of / , popu- lation/year (i.e., the published age-adjusted incidence rate), persons/family and risk years/person, the probability of observing at least two glioma cases, given at least one, is %. this generous estimate of chance occurrence in families is still smaller than the observed rate which may be as high as - %. we too think gliomas occur in families more frequently than predicted by chance, but are not certain. to clarify this issue we are now using spouses as case controls. furthermore, family members often share a common environment and as such may share exposure to potential carcinogens. no environmental risk le journal canadien des sciences neurologiques table . comparison by family of age at diagnosis and pathology among affected individuals from different generations family number average age earlier generation age (p) (p) (p) (p) . pathology gbm gbm aa a gbm gbm aa gbm gbm gbm gbm gbm gbm gbm later generation age months (p) (p) (p) (p) (p) (p) (p) (p) (p) . pathology aa aa gbm aa mg gbm aa aa gbm gbm aa gbm amg gbm (p) = proband gbm = glioblastoma aa = anaplastic astrocytoma a = astrocytoma mg = mixed glioma amg = anaplastic mixed glioma factors for glioma were identified in these families but our anal- ysis was not exhaustive in this respect. g l i o m a s , as they appeared in these families, were not remarkably different from "sporadic" cases in terms of male to female ratio, age at diagnosis, or distribution of tumor types. of note, in families where affected persons were members of differ- ent generations, those from recent generations were invariably younger at diagnosis. younger age at diagnosis in patients from volume , no. — november https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core the canadian journal of neurological sciences table . comparison by family of age at diagnosis and among affected individuals from identical generations family number age (p) pathology aa (earlier generation) (p) (later genera (p) (p) (p) (p) (p) (p) (p) = proband a = astrocytoma a ion) aa a a mg gbm gbm aa = gbm mg = mixed glioma = ol table . cancers cancer type bladder breast* colorectal leukemia* melanoma myeloma neuroblastoma age pathology age a — gbm — mg — gbm aa — a — gbm — anaplastic astrocytoma = glioblastoma igodendroglioma in the families with glioma number of cases cancer type osteosarcoma* ovarian pancreas prostate "stomach" "cancer" pathology pathology — — — aa — — a — number of cases "cancers associated with the li-fraumeni syndrome. recent generations is commonly observed in hereditary condi- tions and, in most instances, can be ascribed to earlier diagnosis or biased ascertainment of cases. earlier diagnosis may result from anticipation by family members or their physicians, or improved diagnostic methods, or both. the cohort of family members at risk in a recent generation is younger-on-average than a similar cohort from an earlier generation; it follows that affected persons from a recent generation will also be younger- on-average. presumably these factors explain the -year age difference in this study, although it is conceivable that genetic mechanisms also contribute to younger age at diagnosis in affected persons from later generations. if gliomas in these families are evidence of a heritable genet- ic abnormality causing brain tumors, what might it be? we can only speculate. three important features of these families emerge from an analysis of figure : first, males and females are affected; second, most family members are unaffected; third, there is no predictable pattern of inheritance. a dominant sus- ceptibility gene of low penetrance might explain the patterns in families , - , , , - , and but the clustering of tumors in children of unaffected parents in families , , and suggests a recessive gene. while it is conceivable that a heri- table cancer might be transmitted between generations by a dominant mutation of variable penetrance, there is no convinc- ing experimental evidence that this occurs in humans. on the other hand, there is considerable evidence that recessive muta- tions of growth suppressing genes lead to the heritable passage of cancer predisposition, as revealed by the retinoblastoma (rb) paradigm. in this pediatric eye tumor for which both sporadic (unilateral) and familial (bilateral) cases exist, germ line het- erozygosity for the mutant rb allele is reduced to homozygosity by somatic mutation in the retina. because somatic mutation occurs frequently in heterozygotes virtually all carriers develop retinoblastoma. the same appears to be true for the p gene and the li-fraumeni syndrome. - unlike retinoblastoma and the li-fraumeni syndrome, most individuals "at risk" in families with glioma remain unaffected. any analogy between families with glioma and these inherited cancer syndromes must come to terms with this discrepancy. recently, sakai et al. have reported that naturally occurring point mutations in recognition sequences of the rb gene promo- tor cause an hereditary low-penetrance retinoblastoma syndrome characterized by frequent asymptomatic or unilaterally affected carriers. perhaps a similar mechanism involving another gene or multiple genes can be invoked to explain infrequent gliomas in families. searching for gliomas in families has taught us that a posi- tive history is not always apparent initially, that a family mem- ber other than the patient is usually the best historian, and that most families are eager to cooperate. we continue to search for families with glioma, collecting blood and tumor wherever pos- sible, believing that analysis of their dna will one day facilitate the identification of genes important for glioma induction. acknowledgements the authors thank the victoria hospital research development fund, the cancer research society inc. and dr. v. bramwell for invalu- able support, dr. g. ebers for advice and encouragement, c. wong for statistical help, j. berry and p. payson for technical assistance and p. gray for preparing the manuscript. references . bakshi r, ducatman am, hochberg fh. glioblastomas in new england opthalmologists (letter). n eng j med ; : - . . hochberg f, toniolo p, cole p. head trauma and seizures as risk factors of glioblastoma. neurology ; : - . . lossignol d, grossman sa, sheidler vr, griffin ca, piantadosi s. familial clustering of malignant astrocytomas. j neuro-oncol ; : - . . duhaime ac, bunin g, sutton l, rorke lb, packer rj. simultaneous presentation of glioblastoma multiforme in sib- lings two and five years old: case report. neurosurgery ; : - . . heuch i, blom gp. glioblastoma multiforme in three family mem- bers, including a case of true multicentricity. j neurol ; : - . . maroun fb, jacob jc, heneghan wd, managan ma, russell na, et al. familial intracranial gliomas. surg neurol ; : - . . tijssen cc, hairpin mr, endtz lj. familial brain tumors. in: martinus nijhoff, ed. developments in oncology. boston: ; - . . von motz id, bots g, endtz lj. astrocytoma in three sisters. neurology ; : - . . isamat f, miranda am, bartumeus f, prat j. genetic implications of familial brain tumors. j neurosurg ; : - . . kaufman hh, brisman r. familial gliomas: report of four cases. j neurosurg ; : - . . armstrong rm, hanson cw. familial gliomas. neurology ; : - . https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core le journal canadien des sciences neurologiques . kjellin k, muller r, astrom ke. the occurrence of brain tumors in several members of a family. j neuropathol exp neurol ; : - . . munslow ra, hill ah. multiple occurrences of gliomas in a family. j neurosurg ; : - . . parkinson d, hall cw. oligodendrogliomas. simultaneous appear- ance in frontal lobes of siblings. j neurosurg ; : - . . joughin jl. coincident tumor of the brain in twins. arch neurol psychiatr ; : - . . fairburn b, urich h. malignant gliomas occurring in identical twins. j neurol neurosurg psychiatry ; : - . . turcot j, despres jp, st. pierre f. malignant tumors of the central nervous system associated with familial polyposis of the colon. report of two cases. dis colon rectum ; : - . . mastronardi l, ferrante l, lunardi p, et al. association between neuroepithelial tumor and multiple intestinal polyposis (turcot's syndrome): report of a case and critical analysis of the literature. neurosurgery ; : - . . li fp, fraumeni jf, mulvihill jj, blattner wa, dreyfus mg, et al. a cancer family syndrome in twenty-four kindreds. cancer res ; : - . . malkin d, li fp, strong lc, et al. germ line p mutations in a familial syndrome of breast cancer, sarcomas and other neo- plasms. science ; : - . . srivastav s, zou z, pirollo k, blattner w, chang eh. germ-line transmission of a mutated p gene in a cancer-prone family with li-fraumeni syndrome. nature ; : - . . fearon er, vogelstein b. a genetic model for colorectal tumori- genesis. cell ; : - . . mikkelson t, cairncross jg, cavenee wk. genetics of the malig- nant progression of astrocytoma. j cell biochem ; : - . . hochberg f, toniolo p, cole p. nonoccupational risk indicators of glioblastoma in adults. j neuro-oncol ; : - . . martin gm, schellenberg gd, wijsman em. bird td. dominant susceptibility genes. nature ; : . . lee w-h, bookstein r, lee ey-hp. studies on the human retinoblastoma susceptibility gene. j cell biol ; : - . . sakai t, ohtani n, mcgee tl, robbins pd, dryja tp. oncogenic germ-line mutations in spl and atf sites in the human retinoblastoma gene. nature ; : - . volume , no. — november https://www.cambridge.org/core/terms. https://doi.org/ . /s x downloaded from https://www.cambridge.org/core. carnegie mellon university, on apr at : : , subject to the cambridge core terms of use, available at https://www.cambridge.org/core/terms https://doi.org/ . /s x https://www.cambridge.org/core biomed centralbmc genomics ss open accemethodology article identification of disease causing loci using an array-based genotyping approach on pooled dna david w craig† , matthew j huentelman† , diane hu-lince , victoria l zismann , michael c kruer , anne m lee , erik g puffenberger , john m pearson and dietrich a stephan* address: neurogenomics division, translational genomics research institute (tgen) phoenix, arizona , usa and clinic for special children, strasburg, pa , usa email: david w craig - dcraig@tgen.org; matthew j huentelman - mhuentelman@tgen.org; diane hu-lince - dhlince@tgen.org; victoria l zismann - vzismann@tgen.org; michael c kruer - mkruer@tgen.org; anne m lee - alee@tgen.org; erik g puffenberger - epuffenberger@clinicforspecialchildren.org; john m pearson - jpearson@tgen.org; dietrich a stephan* - dstephan@tgen.org * corresponding author †equal contributors abstract background: pooling genomic dna samples within clinical classes of disease followed by genotyping on whole-genome snp microarrays, allows for rapid and inexpensive genome-wide association studies. key to the success of these studies is the accuracy of the allelic frequency calculations, the ability to identify false-positives arising from assay variability and the ability to better resolve association signals through analysis of neighbouring snps. results: we report the accuracy of allelic frequency measurements on pooled genomic dna samples by comparing these measurements to the known allelic frequencies as determined by individual genotyping. we describe modifications to the calculation of k-correction factors from relative allele signal (ras) values that remove biases and result in more accurate allelic frequency predictions. our results show that the least accurate snps, those most likely to give false-positives in an association study, are identifiable by comparing their frequencies to both those from a known database of individual genotypes and those of the pooled replicates. in a disease with a previously identified genetic mutation, we demonstrate that one can identify the disease locus through the comparison of the predicted allelic frequencies in case and control pools. furthermore, we demonstrate improved resolution of association signals using the mean of individual test-statistics for consecutive snps windowed across the genome. a database of k-correction factors for predicting allelic frequencies for each snp, derived from several thousand individually genotyped samples, is provided. lastly, a perl script for calculating ras values for the affymetrix platform is provided. conclusion: our results illustrate that pooling of dna samples is an effective initial strategy to identify a genetic locus. however, it is important to eliminate inaccurate snps prior to analysis by comparing them to a database of individually genotyped samples as well as by comparing them to replicates of the pool. lastly, detection of association signals can be improved by incorporating data from neighbouring snps. published: september bmc genomics , : doi: . / - - - received: may accepted: september this article is available from: http://www.biomedcentral.com/ - / / © craig et al; licensee biomed central ltd. this is an open access article distributed under the terms of the creative commons attribution license (http://creativecommons.org/licenses/by/ . ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. page of (page number not for citation purposes) http://www.biomedcentral.com/ - / / http://creativecommons.org/licenses/by/ . http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.biomedcentral.com/ http://www.biomedcentral.com/info/about/charter/ bmc genomics , : http://www.biomedcentral.com/ - / / introduction the ability to genotype hundreds of thousands of single nucleotide polymorphisms (snps) across the genome and to perform association analysis between cases and controls provides, for the first time, a discovery-based approach for determining the underpinnings of complex human genetic disorders. technologies from affymetrix (microarray-based genechip® mapping arrays), illumina (beadarray™), and sequenom (massarray™) are now available with sufficient density to detect linkage disequi- librium between informative snps and nearby disease- causing nucleotide variants through non-hypothesis based whole-genome association scans for certain popula- tions [ - ]. several practical issues make whole-genome association studies by utilizing individual genotyping difficult to implement [ ]. power estimates predict that somewhere on the order of a thousand cases and control subjects must be genotyped to detect allelic differences of < % between the cohorts, as well as to detect rare alleles which may be causative in only a subset of the cohort [ ]. addi- tionally, population stratification and allelic imbalance may identify snps that have statistically significant allelic frequency differences yet have no relation to the disease [ , , ]. whole-genome association studies are now tech- nologically possible, though the cost is several million dollars if samples are individually genotyped. here we describe the validation of pooling genomic dna samples as a rapid pre-screening to detect disease-causing loci for a few thousand dollars on snp genotyping microarrays. it is possible to identify snps that have significant differ- ences in allelic frequencies between two populations while saving a significant amount in resources by pooling genomic dna and then snp genotyping on a single microarray, or preferably on a series of replicated arrays. indeed, a limited number of studies have been conducted that demonstrate the possibility to predict accurately the allelic frequencies of a snp from a pooled sample on a microarray, and, in fact identify quantitative trait loci [ - ]. typically, these studies have validated the pooled allelic frequencies by later individually genotyping between ten to a few hundred snps. the most elegant val- idations of pooling have used indirect approaches, such as spiking a single individual of known genotype into a pooled group with unkown genotypes [ ]. one cannot realistically expect all probes on a microarray to function equally, especially considering that the objec- tive of these platforms is to identify allelic differences of %, %, and %. indeed, as platforms move to , + snps, the ability to select preferentially the best performing snps, such as was done in the design of the affymetrix k genechip®, will likely be compromised. as a result, our prediction is that many snps will be unre- liable for pooling, and thus may be more likely to lead to false positives. in a pooling study, limiting false positives that are a result of the assay, rather than the underlying population, will be a major factor in being able to realis- tically identify snps that can predict disease status. in this study, we investigated the reliability of snp allelic fre- quency measurements as determined from pooling genomic dna samples on snp mapping arrays. we fur- ther demonstrate our ability to identify poorly predictive snps prior to analysis. results we compared the predicted allelic frequencies from pools of genomic dna to the known allelic frequencies deter- mined by individual genotyping in order to establish the accuracy of pooling. the goal was to compare allelic fre- quencies for all the snps on a microarray, since not all snps will be equally accurate for the prediction of fre- quencies. inaccurate snps are expected to be problematic as microarrays progress to probe hundreds of thousands of snps, whereby snps are chosen primarily for their physical position in the genome and not for their repro- ducibility. indeed, in order to identify , snps for the affymetrix k genechip® mapping array nearly , snps were screened by affymetrix for reliability in the assay [ ]. individual genotyping of snps for samples allelic frequencies for , snps on samples were determined by individually genotyping on the k gene- chip®. these samples were genotyped over a one-year period; therefore, some samples were genotyped on ver- sion . of this platform and others on version . . only snps genotyped on both platforms were utilized for this study. accuracy of snp calls was approximately . %, as determined by inheritance errors in family pedigrees, in line with the accuracy reported by affymetrix ( . %) [ ]. we found no significant decrease in accuracy between the two versions of the k genechip®. the aver- age percentage of snps called across all samples was . %. only individuals with a call rate above % were included in the present study. for example, , snps were called for all individuals and , snps were called for > % of individuals. in our experience using this plat- form on over , samples we determined that the call rate is highly dependent on dna quality and that high quality genomic dna yields a call rate of – %. the samples used in this study have been collected over sev- eral years with variable dna quality. it is to be expected expect that large-scale whole-genome association studies will also be forced to utilize dna of less than optimal quality since hundreds to thousands of individuals are needed. thus the genomic dna used in this study will likely be representative of what could be expected in a page of (page number not for citation purposes) bmc genomics , : http://www.biomedcentral.com/ - / / whole-genome association study on a disease where sev- eral-thousand individuals are needed. construction of pools pools were created in triplicate from the individually gen- otyped samples. the individuals were from the old order amish and old order mennonite populations of south- eastern pennsylvania [ ]. pool consisted of individ- uals, pool consisted of a different individuals, and pool consisted of patients who died of a form of sud- den infant death syndrome known as siddt and had a known region of identity-by-descent (shared a pre- defined allele on all six chromosomes across the case cohort) [ ]. this region was defined on the k microar- ray by consecutive autozygous snps, of which were informative. all dna was quantitated using picogreen reagent (molecular probes, eugene, oregon) to ensure equal amounts were contributed to the pool from each individual. these three pools were then genotyped in rep- licates of three on the k genechip®. in all, microar- rays were used for the pooled genotyping compared to microarrays for the individual genotyping. calculation of allelic frequencies from pooled samples the predicted allelic frequencies from pooled genotype samples were calculated for each snp using a k-correction factor based on their derivation from over , individ- uals genotyped on the k genechip®. the training set consisted of , individuals that were genotyped in our lab within the past year. all had call rates above % with an average call rate of %. none of the , individuals used for calculation of k-correction factors were included in the pooled genomic dna. the purpose of the k-correction factor is to allow for cal- culation of a predicted allelic frequency from peak heights, or in this case fluorescence signal, whereby p = a/ (a+kb) [ ]. k-correction factors have recently become well established and have been used successfully in primer extension assays whereby measurements in snp allelic frequencies on pooled genomic dna have been taken by hplc, mass spec, and by fluorescence in taq- man assays [ - ]. for the k mapping array assay, p is the predicted allelic frequency of the a allele, a is the flu- orescent signal intensity measure of the a allele, and b is the fluorescent signal intensity measure of the b allele. the k-correction factor can be calculated for a given snp using a heterozygote who is ab, effectively % a and % b. conveniently, output of the affymetrix genechip software for the affymetrix k mapping array includes relative allele signal (ras) values which have been previ- ously used to determine k-correction values (see figure ) [ ]. generally, ras = a/(a+b). here, a refers to the median match/mismatched differences of the major allele and b for the minor allele (affymetrix technical manual). example of ras statistics for three snps based on genotyp-ing of individuals with an average call rate of all snps greater than %figure example of ras statistics for three snps based on genotyp- ing of individuals with an average call rate of all snps greater than %. these example snps illustrate how snp call reliability can vary both between snps and within the same snp, as measured by ras and ras values. blue spheres are bb individuals, orange triangles are aa individu- als, and green squares are ab individuals, grey stars are "not called". page of (page number not for citation purposes) bmc genomics , : http://www.biomedcentral.com/ - / / there are two ras values, ras (sense) and ras (anti- sense) since both sense and antisense directions are probed. whereas k-correction factors based on the affymetrix k genechip® mapping array have been previously calcu- lated directly using only heterozygous ras values [ ], we suggest that this can be improved upon since the ras val- ues are generally not or for homozygotes (see figure ). indeed, we observed significant deviation for many snps, which could potentially add significant bias (see discussion) [ ]. thus for each snp, we normalized ras values, referred to as nras, using the individuals from the training set that were aa (normalized to ) and bb (nor- malized to zero). without this normalization, predicted frequencies will be systematically biased as the pooled samples approach homozygosity. thus nrasx = (rasx- aaave)/(bbave) where aaave is the average rasx score for individuals aa in the training set, and bbave is the rasx score for individuals bb in the training set. the value of x refers to whether the calculation is for ras or ras , and nras values are calculated for both ras and ras . thus, two predictions of allelic frequency are obtained: one from ras and one from ras . each ras variable has dis- tinct variability, and as shown in figure (b), ras may be very precise with low variance, while ras may exhibit high variance, and vice versa. averaging the two ras val- ues will mask the ras value with lower variance. because of this independent variability, we do not recommend averaging ras and ras for all snps as was suggested in other pooling studies [ , , ]. rather, we recommend treating the two ras values as separate experiments, and preferably removing ras values with the greatest variance prior to analysis. values making up each of the ras and ras mean values are provided for homozygous aa, homozygous bb, and heterozygous individuals on a website based on our , person database which is being made available to the pub- lic as part of this publication. these k-correction factors derived from ras and ras values using this training dataset are available at [ ] and as supplementary material. comparison of allelic frequencies: pooling vs. individual genotyping for the , snps on the affymetrix k genechip® we found a median difference in allelic frequency between individually genotyped samples and pooled samples of . %, a mean difference of . %, and a standard devia- tion of . %. figure shows a histogram for all the snps and their difference between the predicted frequency from the pools and the individual genotypes data. other stud- ies have reported slightly lower differences between pooled and individually genotyped methods for determining allelic frequencies ( – %) [ , , ]. many reasons are likely for this difference: we used dna that was collected over ten years and was of varying quality; we also compared all the snps on the microarray rather than selecting only a few snps for comparison. realistically, the greater difference seen in this study may be more rep- resentative of large association studies, in which thou- sands of genomic samples of varying quality are pooled. (a) allele frequency differences between individual and pooled genotypesfigure (a) allele frequency differences between individual and pooled genotypes. histogram representing the total number of snps at each allele frequency difference between individ- ual and pooled samples. (b) accuracy of predicted snp fre- quencies increases for those snps that perform well on mapping k individual assays and decreases for poorly per- forming snps. the mean and median absolute difference between the predicted allelic frequency and individually gen- otyped allelic frequencies are shown vs. the binned perform- ance of snps on individual assays. performance is ranked by the frequency of calls in a set of , individually genotyped samples. page of (page number not for citation purposes) bmc genomics , : http://www.biomedcentral.com/ - / / identification of assay false positives while the differences in frequencies between pooled and individual genotyped samples show that calculating fre- quencies from pooled samples is highly accurate, it is per- haps of greater importance that we are able to predict those snps that are unreliable and largely inaccurate. assays genotyping , snps will likely not have the ability to be as selective and thus are likely to provide a large number of snps that do not reliably quantitate allelic frequencies from pooled genomic samples. as shown in table , we found that the snps most likely to give a "nocall" in individual genotyped samples more often gave unreliable predictions of allelic frequencies in pooled samples. furthermore, as shown in figure b, those snps that are the worst % (in terms of % called for individual genotypes) also gave rise to higher allelic frequency differences. we found that rarely called snps are also likely to be called inaccurately (table and figure c). in this case, constructing k-correction factors and predicting allelic fre- quencies will be unreliable for these snps, even if pooled replicates show low variability. snps with the highest var- iance in pool replicates were also unreliable. as a practical measure, we found that applying both filters for too many "nocalls" in a training set and having a high variance in pooled replicates was more effective than either measure alone. we could identify / rd of the worst performing snps (greater than % difference), by removing the worst performing % of snps based on variance in pool replicates and removing the worst performing % of snps based on excessive "no calls" when individually geno- typed. consequentially, the removal of those snps that are either poorly called in a training set of individually genotyped samples or highly variable across pooled repli- cates significantly decreases the number of false positives. the number of snps removed should maintain a balance between retaining dense snp coverage and excluding those snps more likely to give false positives. ultimately, removing potential false positives will be a compromise between the coverage of the snp microarray and the genetic diversity of the population. it is of interest to note that allelic frequencies calculations were more accurate as snps approached homozygosity. for example, for those snps with allelic frequencies from % to % and from % to % the mean difference was . % vs. a mean difference of . % for snps with allelic frequencies between % and %. this finding may be due to inaccuracies in the assays as snps approach %, since the variance for heterozygotes is higher than the variance measured for homozygotes. identification of a disease locus from genotyping of pooled samples in order to assess whether it is feasible to use pooled gen- otyping to identify the genetic locus for a disease, we created case and control pools for the disease sudden infant death with dysgenesis of the testes (siddt) and a pool of amish control individuals. a test for proportions was employed to detect statistical differences between cases and controls. this test-statistic is more often used in pooled studies since frequency data are generally not whole-integers [ ]. shown in equation is the calculation for the test statistic (t) where fcase is the allele frequency for the case group and fcontrol is the allele frequency for the control group. table : inaccurate snps with the largest difference between snp allele frequencies when genotyped individually vs. calculated from pooled dna can be partially predicted. nearly % of the snps found to be the most inaccurate snps were also either (a) one the worst performing snps in individual genotyping or (b) had the largest variability between replicates in the pool. all snps (a) worst performing snps criteria: nocalls on person database (b) worst performing snps criteria: pool variability from replicates snps found in (a) or (b) inaccuracy (predicted vs. genotyped) most inaccurate snps (individual genotyped vs. pooled) . % . % . % . % most inaccurate snps (individual genotyped vs. pooled) . % . % . % . % remaining snps . % . % . % . % t f f f f f f case control case control case case = − + = var( ) var( ) , var( ) ( − ( )f n case case ) page of (page number not for citation purposes) bmc genomics , : http://www.biomedcentral.com/ - / / the distribution follows an approximate χ distribution with one degree of freedom. the snp with the highest sig- nificance, rs , had a p-value of . and was in the siddt locus at chromosome q . however, it is expected that the snp with the lowest p-value will not always be at the correct disease locus. even strong single snp association signals will likely be obscured in the noise when , + snps are probed. thus we employed a moving window whereby the mean test-statis- tic of several consecutive snps was calculated at each snp position across the genome. the objective of the moving window was to leverage the fact that neighbouring snps will likely be in linkage disequilibrium, whereby one snp is at least partially predictive of the neighbouring snp. the number of snps contained in the moving window was varied between and . shown in table is the rank of the q region for varying window sizes. it is of inter- est to assess sensitivity of this windowing approach to snps within the region. thus, we consecutively removed the top three snps contributing to the overall association signal. removing the first two snps has little effect on detecting the association signal. the q region remains the most significant for window sizes of four and greater even when these top two snps are removed. in compari- son, all three top snps has a marginal effect, lowering the rank of the region from highest to within the top ten. to compute the statistical significance of averaged test-sta- tistics, we used a permutation test. with this approach the consecutive order of snps was randomized in four hun- dred separate bootstrapped datasets. p-value statistics were calculated from the distribution of these datasets. shown in table , the siddt locus ( q . -q . ) was generally revealed as the most significant region of associ- ation for window sizes between and snps. it will not always be the case that snps are in linkage dis- equilibrium and a windowing-based approach will be effective. the permutation statistics can be used to test this scenario in order to see if the frequency of a given mean window test-statistic is indeed significant. the old order amish and mennonite populations used in this study identification of the siddt locus from pooled genomic dna by calculating the mean test-statistic for a rolling window of con-secutive snpsfigure identification of the siddt locus from pooled genomic dna by calculating the mean test-statistic for a rolling window of con- secutive snps. the moving window was determined across the genome and the p-value was calculated from a distribution of bootstraps of the original dataset. mean window sizes of , , , , , and are shown and the siddt locus is high- lighted in yellow. the siddt disease locus is the top region for window sizes of , , , , and . page of (page number not for citation purposes) bmc genomics , : http://www.biomedcentral.com/ - / / arise from a population founded in approximately the six- teenth century with expectedly larger regions of identity by descent. the amish and mennonites are not one large isolated population. it is more accurate to say that both these populations derive from the swiss anabaptists (circa ). these groups are socially and genetically unique even though both came from the same geographical region. thus undoubtedly some stratification exists between our two cohorts and it is encouraging that the correct region was easily identifiable despite any stratifica- tion [ ]. based on previous research in this population, the k mapping array was anticipated to be of sufficient density whereby many of the snps would be in relative linkage disequilibrium throughout this regional population. indeed, the permutation statistics of moving windows support this notion as the q region shows a p-value of < e- for window sizes of snps and greater, far lower than would be expected with ~ , snp measure- ments. other methods have been developed that reduce noise using haplotype data from snps in linkage disequi- librium [ ]. in the absence of this haplotype data, which may often be the case, it is encouraging that the very straightforward statistical approach described here is effective at identifying the correct locus. discussion our results show that ( ) pooling genomic samples is highly accurate; ( ) unreliable snps most likely to give false-positives can be largely identified and removed prior to association analysis; and ( ) a moving window of aver- aged test-statistics can be used to detect association sig- nals. additionally, we have described modifications as to how allelic frequencies are calculated from ras values of pooled samples that remove systematic biases. pioneering work on pooling studies by other research groups has shown that the average relative allele signal (rasave) can be effectively used to derive k-correction fac- tors by k = rasave/( -(rasave), and as such, can be used to accurately predict allelic frequencies [ , , ]. pooling studies are intended to be screening approaches. ras val- ues are highly convenient since they are generated by the affymetrix gdas software on the k platform and fairly intuitive to understand. we suggest significant improve- ments to this innovative approach that will remove biases; allow for continued use of ras values; and result in more accurate predictions. these improvements focus on lower- ing the number of false positives due to added variance or systematic biases, since the utility of pooling-based approaches will be based on how one can detect associa- tion signals given a high number of false positives. first, ras and ras should not be averaged since they are separate probe sets with distinct variances. one may unnecessarily propagate unwanted variance by averaging. for example in figure b, it is clearly visible that ras is highly predictable of the particular snp allele whereas ras is highly inaccurate. in this case, averaging ras and ras will produce a rasave value that is less accurate than ras alone. we suggest instead that these values be treated as separate measures, each with their distinct vari- ance. in the case of ras values with a large variance, these values should not be used due to the increased chance of a false positive. table : identification of disease locus using a moving window. snps were ranked by test statistics and sorted by physical position. the average was calculated for a moving window of consecutive snps across the genome. the region q . was already known to contain the mutation leading to the siddt. the rank of region q . for a various window sizes in shown in the second column. in the rd, th, and th columns, the top , , and snps were removed from the q . regions to probe sensitivity of window size. # snps averaged in moving window q . rank region (all snps) q . region rank (exclude top snp in region) q . region rank (exclude top snps in region) q . region rank (exclude top snps in region) page of (page number not for citation purposes) bmc genomics , : http://www.biomedcentral.com/ - / / second, we highly recommend that ras values for each snp be normalized prior to calculation of allelic frequencies. when these values are not normalized prior to calculating a predicted allelic frequency a significant bias is introduced since the ras values, as produced by the affymetrix gdas software, generally are not . or . for homozygous bb and aa respective alleles. indeed, on a training set of individuals we found that % of snps who were called aa had a ras value less than . and % of snps called bb had a ras value greater than . . this bias can be seen in an example calculation using k-correction factors derived from a typical ras value directly obtained from the gdas software. for example, the average ras for a given snp of an aa individual may be . , the average ras for a heterozygous individual may be . , and the average ras for a bb individual may be . . when one uses the approach outlined by butcher, et al, the k-correction factor is . , whereby the ras value of the average heterozygote is divided by one minus this value [ ]. in a pooled sample, the same snp is expected to have a ras value of . if it is completely homozygous for aa. however, using the k-correction approach on non- normalized ras values, one would predict an allelic fre- quency of %, whereas the actual frequency is %, a bias of %. these biases would be most pronounced as pools approach dominance by one allele type, as would often be the case for a snp highly associated to a disease. while ras values are readily obtainable from the affyme- trix software for the k genechip® arrays, they are not provided for the k or k. this is partly due to the fact that ras values are no longer used to make a snp call. we have developed a simple perl script which generates ras values, still useful in pooling, for the k and k affymetrix genechip® platform from chp files. this tool is available on our website [ ]. while one may use these ras values to find obvious differences in cases and con- trols, for many snps allelic frequencies are not linearly dependent on the ras values; thus, one should calculate allelic frequencies when possible to reduce uneven biases between different snps. additionally, we are making public on the same site both normalized and non-normalized k-correction factors derived from over , genotyped individuals for the k version . snp genotyping platform. other research groups have created central repositories for k-corrections using non-normalized ras values and we will work with these teams to contribute these values to this valuable cen- tralized resource [ ]. conclusion prior to the investment of large resources into individual genotyping thousands of individuals, one may first con- sider pooling samples at a low cost to rapidly ascertain gross population stratification concerns and potentially identify the regions of the genome with the strongest asso- ciation to the trait. the sheer number of snps interrogated will lead to a high number of false positives, due to both actual variation in genotype frequencies of the underlying groups and to technical variance. we demonstrate that technical variance can be detected a priori for each snp using training sets from large numbers of individual microarrays or by replicates of pooled samples. we further show that despite the issues of population stratification, admixture, and subgroups that are difficult to detect when pooling, the cost savings make pooling a first step that we suggest should logically precede the investment of mil- lions of dollars. we describe here a method by which k and k affymetrix snp array data can be parsed into ras scores and pooled inbalances accurately assessed in an outbred population. methods k genechip® mapping array genotyping k snp genotyping was performed as detailed by affymetrix on the k genechip® mapping . and . arrays [ ]. in short, ng of genomic dna was digested with units of xba i (new england biolabs, beverly, ma) for hours at °c. adaptor xba (p/n , affymetrix, santa clara, ca) was then ligated onto the digested ends with t dna ligase for hours at °c. after dilution with water, samples were subjected to pcr using primers specific to the adaptor sequence (p/n , affymetrix) with the following amplification parameters: °c for minutes initial denaturation, °c seconds, °c seconds, °c seconds for a total of cycles, followed by °c for minutes final extension. pcr products were then purified and frag- mented using . units of dnase i at °c for min- utes. the fragmented dna was then end-labeled with biotin using units of terminal deoxynucleotidyl trans- ferase at °c for hours. labeled dna was then hybrid- ized onto the k mapping array at °c for – hours at rpm. the hybridized array was washed, stained, and scanned according to the manufacturer's instructions. the chp_ _ras.pl script processes one or more chp text files from affymetrix k and k snp chips, calculates ras and ras scores and outputs them in an excel spreadsheet. testing shows that for k chips, chp_ _ras.pl produces the same scores as those produced by affymetrix' gdas software. chp_ _ras.pl is distributed as part of tgen-array, a collection of perl scripts and mod- ules that provide parsing and object-oriented interfaces to common microarray files. the script can be downloaded at the tgen bioinformatics website [ ]. page of (page number not for citation purposes) bmc genomics , : http://www.biomedcentral.com/ - / / authors' contributions dwc and mjh performed snp genotyping, participated in the concept of the paper, and drafted the manuscript. dhl, vlz, mjh, and aml conducted pooling and snp genotyping. dwc and jmp performed statistical analysis of the snp data. das participated in study design, coordi- nation, and manuscript drafting. all of the authors have read and approved the final manuscript. additional material acknowledgements we thank the old order amish families who participated in the research and the old order amish community for their willingness to participate in research studies. references . matsuzaki h, dong s, loi h, di x, liu g, hubbell e, law j, berntsen t, chadha m, hui h, yang g, kennedy gc, webster ta, cawley s, walsh e, jones kw, fodor sp, mei r: genotyping over , snps on a pair of olignucleotide arrays. nature methods , : - . . fan jb, oliphant a, shen r, kermani bg, garcia f, gunderson kl, hansen m, steemers f, butler sl, deloukas p, galver l, hunt s, mcbride c, bibikova m, rubano t, chen j, wickham e, doucet d, chang w, campbell d, zhang b, kruglyak s, bentley d, haas j, rigault p, zhou l, stuelpnagel j, chee ms: highly parallel snp genotyping. cold spring harb symp quant biol , : - . . marnellos g: high-throughput snp analysis for genetic associ- ation studies. curr opin drug discov devel , : - . . cardon lr, bell ji: association study designs for complex diseases. nat rev genet , : - . . risch n, teng j: the relative power of family-based and case- control designs for linkage disequilibrium studies of complex human diseases i. dna pooling. genome res , : - . . hirschhorn jn, daly mj: genome-wide association studies for common diseases and complex traits. nat rev genet , : - . . carlson cs, eberle ma, kruglyak l, nickerson da: mapping com- plex disease loci in whole-genome association studies. nature , : - . . butcher lm, meaburn e, knight j, sham pc, schalkwyk lc, craig iw, plomin r: snps, microarrays and pooled dna: identification of four loci associated with mild mental impairment in a sample of children. hum mol genet , : - . . meaburn e, butcher lm, liu l, fernandes c, hansen v, al-chalabi a, plomin r, craig i, schalkwyk lc: genotyping dna pools on microarrays: tackling the qtl problem of large samples and large numbers of snps. bmc genomics , : . . butcher lm, meaburn e, liu l, fernandes c, hill l, al-chalabi a, plo- min r, schalkwyk l, craig iw: genotyping pooled dna on microarrays: a systematic genome screen of thousands of snps in large samples to detect qtls for complex traits. behav genet , : - . . simpson cl, knight j, butcher lm, hansen vk, meaburn e, schalkwyk lc, craig iw, powell jf, sham pc, al-chalabi a: a central resource for accurate allele frequency estimation from pooled dna genotyped on dna microarrays. nucleic acids res , :e . . butcher lm, meaburn e, dale ps, sham p, schalkwyk lc, craig iw, plomin r: association analysis of mild mental impairment using dna pooling to screen brain-expressed single- nucleotide polymorphisms. mol psychiatry , : - . . matsuzaki h, loi h, dong s, tsai yy, fang j, law j, di x, liu wm, yang g, liu g, huang j, kennedy gc, ryder tb, marcus ga, walsh ps, shriver md, puck jm, jones kw, mei r: parallel genotyping of over , snps using a one-primer assay on a high-density oligonucleotide array. genome res , : - . . puffenberger eg, hu-lince d, parod jm, craig dw, dobrin se, con- way ar, donarum ea, strauss ka, dunckley t, cardenas jf, melmed kr, wright ca, liang w, stafford p, flynn cr, morton dh, stephan da: mapping of sudden infant death with dysgenesis of the testes syndrome (siddt) by a snp genome scan and identi- fication of tspyl loss of function. proc natl acad sci u s a , : - . . hoogendoorn b, norton n, kirov g, williams n, hamshere ml, spurlock g, austin j, stephens mk, buckland pr, owen mj, o'dono- van mc: cheap, accurate and rapid allele frequency estima- tion of single nucleotide polymorphisms by primer extension and dhplc in dna pools. hum genet , : - . . le hellard s, ballereau sj, visscher pm, torrance hs, pinson j, morris sw, thomson ml, semple ca, muir wj, blackwood dh, porteous dj, evans kl: snp genotyping on pooled dnas: comparison of genotyping technologies and a semi automated method for data storage and analysis. nucleic acids res , :e . . norton n, williams nm, williams hj, spurlock g, kirov g, morris dw, hoogendoorn b, owen mj, o'donovan mc: universal, robust, highly quantitative snp allele frequency measure- ment in dna pools. hum genet , : - . . giordano m, mellai m, hoogendoorn b, momigliano-richiardi p: determination of snp allele frequencies in pooled dnas by primer extension genotyping and denaturing high-perform- ance liquid chromatography. j biochem biophys methods , : - . . moskvina v, norton n, williams n, holmans p, owen m, o'donovan m: streamlined analysis of pooled genotype data in snp- based association studies. genet epidemiol , : - . . website: . [http://www.tgen.org/neurogenomics/data]. . puffenberger eg: genetic heritage of the old order mennon- ites of southeastern pennsylvania. am j med genet c semin med genet , : - . . hinds da, seymour ab, durham lk, banerjee p, ballinger dg, milos pm, cox dr, thompson jf, frazer ka: application of pooled gen- otyping to scan candidate regions for association with hdl cholesterol levels. hum genomics , : - . . website : . [http://bioinformatics.tgen.org/software/tgen-array/]. additional file calculated k-correction factors for pooling on affymetrix k genechip mapping array based on , person database. click here for file [http://www.biomedcentral.com/content/supplementary/ - - - -s .zip] additional file the chp_ _ras.pl script processes one or more chp text files from affyme- trix k, k, and k ea snp chips, calculates ras and ras scores and outputs them in an excel spreadsheet. testing shows that for k chips, chp_ _ras.pl produces the same scores as those produced by affymetrix' gdas software. gdas does not calculate ras values for k chips. it should be noted that snps on k chips do not necessarily contain even numbers of sense and antisense probes and in fact only about % have sense and antisense probes. the remaining snps have a – or – probe bias towards either sense or antisense. this is important because part of the ras calculation involves taking the median of the "successful" probes and median may not be the best approach if only probes exist in one direction and some may have failed and been dis- carded. chp_ _ras.pl is distributed as part of tgen-array, a collection of perl scripts and modules that provide parsing and object-oriented inter- faces to common microarray files. the tgen-array site contains online documentation for all modules and scripts in the distribution including pages that show the source code so the code and algorithms may be inspected. click here for file [http://www.biomedcentral.com/content/supplementary/ - - - -s .xls] page of (page number not for citation purposes) http://www.biomedcentral.com/content/supplementary/ - - - -s .zip http://www.biomedcentral.com/content/supplementary/ - - - -s .xls http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.tgen.org/neurogenomics/data http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://bioinformatics.tgen.org/software/tgen-array/ abstract background results conclusion introduction results individual genotyping of snps for samples construction of pools calculation of allelic frequencies from pooled samples comparison of allelic frequencies: pooling vs. individual genotyping table identification of assay false positives identification of a disease locus from genotyping of pooled samples table discussion conclusion methods k genechip® mapping array genotyping authors' contributions additional material acknowledgements references challenges to effective cultural property policy on the ground in latin america copy international journal of cultural property ( ) : – . printed in the usa. copyright © international cultural property society doi: . /s reality and practicality: challenges to effective cultural property policy on the ground in latin america donna yates * abstract: although on-the-ground preservation and policing is a major component of our international efforts to prevent the looting and trafficking of antiquities, the expectation placed on source countries may be beyond their capacity. this dependence on developing world infrastructure and policing may challenge our ability to effectively regulate this illicit trade. using case studies generated from fieldwork in belize and bolivia, this paper discusses a number of these challenges to effective policy and offers some suggestions for future regulatory development. it is exceedingly difficult to develop high-level policy that reflects the diversity of situations in both antiquities source and market countries. there exits an inherent challenge between the globalized and the localized; between high-level regulatory schemes that must apply to all and the needs and capabilities of the locations in which it is applied. assumptions that must be made about developing states’ internal capabilities during the crafting of high-level policy may not produce action- able interventions on the ground. as a result, there are aspects of our international antiquities policy regime that are consistently challenged by the realities of pro- tection and law enforcement in parts of the developing world. yet, as it stands, antiquities source countries are considered to be our first line of defense against theft and trafficking. in many sensitive developing world situations, our existing qa * trafficking culture project , scottish centre for crime and justice research , university of glasgow , scotland . email: donna.yates@glasgow.ac.uk acknowledgments: this work was supported by the european research council under the european union’s seventh framework programme (fp / – )/erc grant agreement n° gtico, the leverhulme trust, and the fulbright program. the author would like to thank all of the individuals in belize and bolivia who agreed to be interviewed for this project. donna yates international system of cultural property regulation does little to protect heritage sites in situ or to break up the criminal trafficking networks. if we are to continue to consider source-end protection as a lynchpin of the global combating of the illicit antiquities trade, we need to address these issues directly. we also must consider a greater shift in focus from source-end protection to real and effective market reduction. in this article i will discuss the on-the-ground experience of cultural property protection in two developing latin american countries with rich archaeological heritage consisting in part of antiquities and other cultural objects with market appeal: bolivia and belize. although drastically different in size, both countries face similar internal pressures related to violence, insecurity, the continued effect of narcotics production and trafficking economies, and the need to improve the lives of a largely poor citizenry. both countries have a strong interest in protecting their cultural heritage from an economic standpoint in the form of cultural tourism but also as a component of the maintenance of national identity. based on information gathered from interviews conducted with heritage profes- sionals and interested stakeholders during targeted fieldwork in belize ( ) and bolivia ( ), i will provide a sketch of the various challenges to the effective protec- tion of heritage and prevention of antiquities trafficking in each context. using these examples as case studies, i will discuss three points of perceived disconnect between the realities of cultural property protection in certain developing world contexts and the aspirational international system that these practitioners are working within: . the burden placed on local law enforcement for site protection and criminal investigation vs. the realities of underfunding, institutional failure, remoteness of sites, and access to training and technology; . a regulatory system that focuses on devel- opment and maintenance of international partnerships even when such partner- ships neither reflect the geographical orientation of the illicit trade, nor the realities of geopolitical schisms; . the tendency for regulatory development at all levels to focus on cultural property trafficking in isolation rather than as part of a web of interrelated illicit economies that might be best regulated or policed together. i close with policy suggestions which may help to address the realities of antiquities trafficking and heritage protection in many parts of the developing world. the goal of this paper is not to critique the construction or the intent of specific regulatory tools, but rather to discuss how certain aspects of our existing system of international antiquities regulation play out on the ground and how they are per- ceived and experienced by those on the front line in two developing world contexts. bolivia background bolivia is a landlocked south american state that straddles the high andean plateau and the western amazon. about percent of its population of . million people xxx live in urban areas and the rest are spread out over bolivia’s vast rural and often poorly accessible tracts. bolivia has a remarkably low population density, esti- mated at about . people per square kilometer. ethnicity is a decisive political and social issue and is a major component of bolivian identity. the country has a large indigenous population, with estimates ranging from about percent to over percent of the population, depending on how the question is asked, and the majority of bolivians who do not identify as indigenous, identify as mestizo (as do many people who identify as indigenous). although white bolivians com- prise a small minority of the population, political power was historically concen- trated in this group; bolivia has been considered one of the most racially stratified countries in the americas. this began to change in the s when modifications to the law allowed for more indigenous participation in public life. in late , after a period of popular protest and the resignation of two presidents, evo morales became the country’s th presi- dent, the first to self-identify as indigenous. his leftist government, which remains in power at the time of writing, has instituted significant changes within nearly all sectors of bolivian governance, culminating in the passing, in , of an entirely new constitution which refounded the republic bolivia as the plurinational state of bolivia. long-considered to be the poorest country in south america, since morales’ election bolivia has tripled per capita income in the country and its real gdp growth has been projected at . percent, the highest it has been in years. this, coupled with aggressive wealth distribution policies from the morales government, has led to small but noticeable poverty reduction successes in the country, although morales’ regime is not without considerable external and internal criticism. the protection of the remains of bolivia’s spectacular ancient and colonial past is set against this backdrop. bolivia was the heartland of the tiwanaku culture, a major player during the andean middle horizon, and the eponymous archaeolog- ical zone is both a unesco world heritage site and a core component of national identity. the material remains of this culture, as well as those of the subsequent inka and aymara cultures, have historically been in demand on the international antiquities market (although less so than objects from neighboring peru). bolivia is also home to numerous colonial-era churches, many located in very remote or even abandoned villages. these churches often contain art objects: paintings, icons, and silver, the latter being the result of the massive silver mines at potosí. in recent decades, international demand for sacred colonial andean art has grown. since it has been illegal to excavate bolivian archaeological objects without a government license and illegal to remove them from the country. objects of colonial and republican art were subsequently added to this ban and, as it stands, it is illegal to buy, sell, and export these objects in all circumstances. all of these objects, be they undiscovered in the ground or hanging in a colonial church, are considered cultural property of the bolivian state. thus, almost every ancient or colonial bolivian cultural object on the international art market left bolivia in violation of the law. aq donna yates record keeping looking specifically at the maintenance of records concerning aspects of cultural property we can see how quickly such action as a mandate can fail in the developing world. in bolivia, all known cultural property of the nation has required govern- ment registration since . this is a two pronged process: individuals or groups who possess cultural objects that fall under the law are required to notify the ministry of cultures so that the objects may be registered and the ministry of cultures is meant to maintain an office tasked with seeking out registerable objects, for example in remote historic churches. furthermore all dealers in antiquities are meant to be formally registered with the government and their premises are meant to be regularly inspected. all of this fits well into the framework set out by the unesco convention on the means of prohibiting and preventing the illicit import, export and transfer of ownership of cultural property ( unesco convention) (indeed, many of these laws are post-unesco), and were certainly an aspect of bolivia successfully obtaining a bilateral agreement concerning cultural property import restrictions with the united states. yet while this registry system exists on paper, the system is aspirational: it rep- resents a mandate that an under-funded ministerial department in a poor country is unable to meet. few people voluntarily register cultural property in their pos- session, a complete dealer list has not been compiled in years, and archaeological store rooms, even at major sites, have not been inventoried. an exception is the register of cultural property within museums and churches. the files concerning objects in these known heritage structures are extensive which has helped in the recovery of stolen objects in a number of cases. that said, as is often the case, the success of this registry appears to be associated with the devotion and the con- tinued institutional presence over several decades (remarkable in bolivia) of an individual who has dedicated himself to this particular task. as of mid- , these commendable records only existed on paper and the dedicated individual hoped that they would be digitized someday but was not expecting funding anytime soon. in other words, while these records exist, police, customs agents, and others cannot easily access them. policing and institutions in bolivia police protection and state-level justice remains unavailable to most cit- izens. in , nearly half of bolivia’s municipalities did not have a judge, percent did not have a prosecutor, and percent did not have a public defender. bolivian confidence in the police is one of the lowest in latin america: only . percent express confidence in their police force, on par with mexico ( . percent), a coun- try whose police force has one of the worst reputations in the world. furthermore, . percent of bolivians reported that they felt insecure: on par with famously- insecure haiti at . percent. xxx this feeling of general insecurity in bolivia results in conflict between commu- nities and the state-level police and justice systems. to use one extreme example, there exists in bolivia a concept called justicia comunitaria (community justice), which is informally defined as a pre-conquest indigenous system of values, judg- ment, and consequence that exists alongside the regular state-level justice system. a version of justicia comunitaria was enshrined in the constitution as the right for communities to police themselves according to their own indigenous belief system. however , justicia comunitaria in bolivia (especially when that particular term is used) is nearly always linked to fatal or near fatal lynching of accused crim- inals. these lynchings usually happen in poor communities where petty theft has a devastating effect and where the police are seen as either not present or as crim- inals themselves. incidentally, these poor communities, especially rural ones, are also the primary targets for cultural property theft. the majority of recent thefts of conquest and colonial artworks from bolivian churches, some thefts from to , have occurred in small, poor, rural, indigenous villages that are, by many accounts, outside of the reach of the state-level authorities. many recent accounts of cultural property thefts in these areas include complaints from villagers that it took multiple days for the government to send anyone to investigate the crimes, and lamentations from cultural property investigators that the villages in question are very difficult for them to access. recently a limited number of communities have been turning to justicia comu- nitaria to deal with cultural property theft, sometimes with fatal consequences. in early march , two men were lynched in the village of quila quila after they were allegedly caught robbing colonial-era paintings from the local church. they were collectively ‘tried’, beaten, strangled, and buried behind the church they were said to have robbed. what followed was a multi-day standoff between the com- munity and the police, leading to an assurance that the community would face no charges if they handed over the alleged thieves’ bodies. bolivian communities believe that their authorities are not competent and are entirely unable to protect their heritage sites. crime reporting although the looting and trafficking of antiquities is considered a distinct crime under bolivian law, and a form of aggravated theft under the penal code, bolivia has neither a cultural property/heritage police task force, nor a dedicated point person that coordinates cultural property theft and looting cases between the var- ious government and security agencies that have a stake in the matter. the recent introduction of new heritage law in the country focused more on archaeology and contained no new provisions for crime prevention and policing. as it stands in bolivia, when there is a reported case of cultural property theft (usually from a historic church), a warning is issued to interpol and to bolivian customs from the relevant body within the bolivian ministry of cultures. this notice donna yates usually contains details of the theft as well as photos and descriptions of the items that were stolen. that such photos are available is a testament to the dedication of bolivia’s cultural heritage documentation group: most countries are unable to issue such reports. that said, it is unclear to what degree customs agents are made aware of these reports. as of the time of writing there is no database of stolen cul- tural property that is available to anyone outside of the ministry of cultures. when archaeological objects are stolen from the ground, or evidence of looting at an archae- ological site is detected, no warning is issued. it is unclear if any central records of incidents of archaeological looting are kept. archaeologists are often unaware of the scale, scope, and focus of cultural property crime within the country. as is the case in many developing countries, smuggling is part of bolivian reality, a fact rarely discussed during international debate over cultural property regulation. a sizable amount of the goods available on the bolivian market have been smug- gled or are illicit to some degree. in recent years anti-corruption measures have been put in place and border agents are better monitored for corruption. however, fake electronics, copied software and dvds, photocopied books, and any number of other items for which duty has not been paid make their way to bolivian con- sumers. la paz, for example, has a massive maze-like market district referred to as el mercado negro (the black market), which is indicated on quite a few maps. every consumer good imaginable is available in the stalls of this part of the city. in the past, it has been reported that some illicit antiquities have been bought and sold there. due to financial constraints, it is unlikely that any of this will change any time soon. because the idea of a certain interpretation of ancient bolivia has become the core of a bolivian identity and is supported by the current government, completely reinventing the regulation of bolivian cultural property seems unlikely. yet it is possible that, internally, the illicit trafficking of bolivian cultural objects can be policed alongside other illicit goods. indeed, this is the situation that already exists, but formalization of the linkage may prove effective. international relations and antiquities since early when leftist evo morales became president of the country, rela- tions between bolivia and some antiquities market nations, notably the u.s., have been strained. this has had a direct effect on bolivia’s ability to recover stolen cultural objects. for example, in august of , i was informed that a number of looted bolivian church items had been found for sale on the internet via u.s.-based dealers. having checked my own records, i can document the items were available online from at least early december . the thefts of these items occurred in the late s and it is unclear when and how they were imported into the u.s. this, however, was not of specific concern: the objects had all been photographed and documented by bolivia’s ministry of cultures and bolivia could clearly prove that these objects were stolen; return should have been straightforward. xxx yet, u.s. and bolivian sources stated that extremely poor relations between the countries had caused complete stagnation. although everyone involved (except, perhaps, the antiquities dealer) knew where these stolen objects where and agreed that they should be seized and returned, the final paperwork needed to put this operation in motion was not able to go through. both the bolivians and ameri- cans working on this case had deep respect for their counterparts but felt that they were in a political bind. they were unable to advance bilateral cooperation with a country that their government does not wish to cooperate with. all involved care passionately about bolivian cultural property and are doing good work under the circumstances, but the circumstances are not good. as of june , over two years later, at least some of these stolen cultural items were still available online. theft of cultural property has a profound destabilizing effect on bolivian communities. perhaps no case demonstrates that better than that of the famous coroma textiles, the theft of which inspired the first unesco convention-based restrictions on the import of bolivian cultural objects into the u.s. this bilateral agreement, sought by the indigenous community members of coroma who per- sonally petitioned the u.s. government for intervention, has been hailed as a triumph. the textiles were returned, there were convictions in three countries, and a community’s sacred heritage was restored. yet, despite this bilateral success, the heritage of coroma is not truly protected by the u.s./bolivia agreement: the cul- tural objects mentioned in the previous paragraph, still for sale on the internet and the subject of official stagnation, were stolen from coroma’s conquest-era church in the late s. coroma’s church was also looted in and in . belize background belize is a small central american state on the eastern side of the yucatan peninsula. formerly british honduras until independence in , the country is sparsely populated: , people in about , square kilometers for a population density of about . people per square kilometer. despite its small population, belize is one of the most ethnically diverse countries in the world, with most belizeans considering themselves to be multiracial. about percent of the population is of mixed maya and european descent, percent are kriol, meaning mixed african and (largely) british descent, and both of those groups are racially mixed with other latin americans, west indians, afro-amerindians (garifuna), and increasingly chinese, east indians, and low german-speaking mennonites. most belizeans are multi-lingual, speaking english as well as kriol and, more often than not, spanish and one or more maya languages. belize’s archaeological past is spectacular. it houses numerous major and minor maya archaeological sites, from small sacred caves to large metropolises. belizeans encounter archaeological objects and sites in their day-to-day lives and donna yates archaeological themes appear on everything from the currency and on belize’s most popular brand of beer. the sites are spread throughout the country, but there are major concentrations of sites along belize’s borders with guatemala and mexico, making cross-border trafficking a serious concern. tourism is a large component of belize’s economy. as the country is located only a short flight from the u.s., is english-speaking, has a currency that is pegged : to the u.s. dollar, and is filled with exotic natural and archaeological sites, it has positioned itself as an easy adventure holiday for u.s. travelers. because of this, threats to nature and to archaeology are considered to be threats to the country’s economy. belize was heavily hit by the various waves of archaeological looting in central america, particularly for carved stone stela in the s, and elaborately painted polychrome pottery up into recent years. the most comprehensive study of looting in belize was conducted in the early s and the most recent study was undertaken in . record keeping looking at record keeping in belize, which too is mandated by law, we can observe the typical developing world situation where a well-trained, credentialed, and devoted but very small archaeological body is stretched too thin to do everything that they would like to. the individual in charge of their library of records plans on digitizing them with the strong hope of making them publically available for free online. however, as of they lacked the appropriate scanning equipment and, more importantly, lacked the staff needed to accomplish the task. they stated that they would have to do the work themselves, but did not have the time. interviews with other government-employed professionals indicated that in presentations and internal documents, they were still using various looting, trafficking, arrest, and seizure numbers from as far back as the early s and that the last time such numbers were rounded up was . such records have not been specifically kept for no other reason than a lack of staff and a lack of time. that said, belize has made a big push to try to get citizens to voluntarily register archaeological objects in their possession as mandated by law. policing and institutions in , aldous huxley wrote, “if the world had any ends [belize] would certainly be one of them. it is not on the way from anywhere to anywhere else. it has no strategic value. it is all but uninhabited....” although harsh, this quote sums up the logistical issues of policing in belize. its vast, jungle-covered territory contains very few people, is difficult to monitor making it a haven for illicit activities. about percent of belize’s population is considered to be below the poverty line and the country has an unemployment rate of percent. gang violence is on the rise in the country, particularly in belize city. in recent years belize has had one of xxx the highest murder rates in the world, from th to rd highest, close in ranking to neighbors such as honduras, el salvador, and guatemala. rape, violent crime, and burglary rates are also extremely high in belize. the population has historically held the police in low regard due to increasing violence and a perceived failure of the police to respond to and investigate crimes. very few crime or justice studies have focused on belize and academic evalua- tion of policing in the country is limited. an exception is a pilot study conducted by hanson et al. in . at the time they found the belize police had a staffing shortfall of . percent as well as a budgetary shortfall. the police lacked basic resources: police station parking lots resembled salvage yards, vehicles were scarce and barely operational, and the maritime unit of this long-coasted caribbean country had only one functioning boat. poor infrastructure is an issue: a critical lack of roads (as well as the poor condition of existing roads) and some of the most expensive public utilities in the region discourage various types of monitoring and policing, as well as development. belize shares long jungle borders with both mexico and guatemala. because of the density and remoteness of the jungle as well as belize’s small population and small police and defense forces, these borders are relatively open. interviews with belize police indicate that police checkpoints are easily avoided “by simply walking through trails in the jungle.” this, coupled with its position between south america and the u.s., has increasingly led belize to become a strategic point in the international trafficking of all sorts of illicit goods, including narcotics and persons. reports indicate that many of the criminals operating on belize’s borders are former central american paramilitaries, hired into the cartel support infrastruc- ture and that they are “commonly found better armed than the police.” all existing studies on the looting and trafficking of cultural property in belize and my own fieldwork, document a clear trans-border element to this type of crime, both historically and into the present day. large maya sculptural pieces such as stela from machaquilá were looted from guatemala, carried across the belize border, and exported to the u.s., in that case via a boat to florida. ethnographic work has shown that looting gangs from both guatemala and mexico, them- selves from the peripheries of the periphery in their own countries, have been able to move freely between countries. belizean looters, too, certainly have operated on whatever side of the border was most advantageous. especially when it comes to transnational crime, this criminal activity occurs in belize precisely because it is so difficult to monitor the country’s remote borders. nested illicit economies central america has changed a lot in recent decades. shifts in the regional localities of the transnational trade in narcotics have inspired a movement southward into areas along mexico’s borders with guatemala and belize and down into el salvador and honduras. the specifics of these regional shifts are outside of the scope of donna yates this paper, but in belize this has led to a situation where the idea of an antiquities- specific focus of either organized or disorganized crime is highly unlikely. cultural property trafficking is neither profitable enough, nor can it be used to effectively “clean” or launder narcotics money. the cartels have more profitable activities to engage in. at this time antiquities looting and trafficking in belize appears to rests within a regionalized collection of illicit economies. although antiquities looting special- ists may have existed in the past, looting and trafficking in the present is far more opportunistic. individuals or groups are willing to commit a number of different illicit activities (e.g. animal poaching, smuggling consumer goods across the bor- der, land encroachment, illegal logging, laundering money for narcotics cartels, etc.) because they see them as viable alternatives to other activities and their environment supports such crimes. in other words people commit certain low-cost crimes if the opportunity to do so arises, especially when the physical and moral consequences of committing such crimes are minor and the crimes, themselves, are perceived as victimless. an interesting example of this can be seen within the mennonite communities along belize’s border with mexico. ideologically opposed to outside governance, belize’s mennonites have historically been implicated, often unfairly, in the nar- cotics trade, trans-border smuggling of a number of goods, illegal demolition of archaeological sites, and the looting and trafficking of antiquities: both in the form of actual looting/transport and in receiving money from looting groups for access to sites on mennonite land. clearly only a limited number belize’s mennonites are willing to engage in these illicit economies; however, some do see it as a viable alternative to other activities, see little consequence in their behavior, and live in an environment that both encourages financial gain and discourages compliance with external government. another example are the so-called “subsistence diggers,” recorded in paredes maury’s work in guatemala and matsuda’s work in belize. while matsuda’s “subsistence diggers” do seem to be primarily focused on archaeological looting, he does connect their activity directly to illegal migration into belize (and thus a lack of legal work option) as well as illicit overland transport of other goods. pare- des maury’s ethnographic work focused on looting conducted by poor chicle gum collectors in rural guatemala who would loot archaeological sites to add to their meager income, mostly because they were moving through the deep jungle any- way. looting was the focus of her work, but she notes that people in the region also supplement their income by poaching endangered animals, participating in illegal logging, and participate in the narcotics trade. discussion of antiquities looting as one of many opportunistic illicit activities is common in central america. a group of guatemalan archaeological workers i spoke with in stated that they had looted sites in the past and that they poached a jaguar for its pelt because the opportunity to do so was there. as i spoke to a former looter in belize , we drove a woman to a certain spot near the xxx border so she could carry undeclared meat to her shop in mexico, a service for which the driver was paid. former belizean forestry workers that i interviewed did not see much difference between people they caught looting and, say, people they caught trapping macaws, indicating that these were sometimes the same people. thinking internationally in the past and present many of the problems associated with regulating the illicit trade in maya antiq- uities via international partnership agreements stem from the fact that modern borders do not follow ancient borders. although the various ancient maya polities each had their own distinctive iconographic styles, even those styles cross mod- ern borders. maya polities also participated in complex trade with each other: just because an artifact is of one style does not mean it was not traded to another region in antiquity. even when a maya objects bears the name of a known site (the maya were, of course, a literate culture), this does not conclusively indicate a modern country of origin as it is clear that such objects were traded over great distances. it is almost impossible to conclusively determine which modern country a previously- unknown looted and trafficked maya artifact came from. until the s, looting at maya sites was focused on stone stela and carved architectural elements (lintels, staircases, etc.), massive pieces that were often cut, thinned, or otherwise mutilated for transport. in , clemency coggins published a short article which shone a light on the dark trade in looted stela and inspired public discussion about the pillage of maya sites. in , as a result of the profes- sional outcry that followed and an acknowledgment that the u.s. was the primary market for looted maya objects, the u.s. passed public law no. - u.s.c. § : “regulation of importation of pre-columbian monumental or architectural sculpture or murals.” it states: no pre-columbian monumental or architectural sculpture or mural which is exported (whether or not such exportation is to the united states) from the country of origin after the effective date of the regulation [...] may be imported into the united states unless the government of the country of origin of such sculpture or mural issues a certificate [...] which certifies that such exportation was not in violation of the laws of that country’. any piece of pre-columbian monumental sculpture must have ‘satisfactory evidence that such sculpture...was exported from the country of origin on or before the effective date of the regulation. in other words, unless a valid export permit could be produced, all pre-columbian murals, sculptures, or architectural pieces were prohibited from entering the u.s. it is important to note that this law is object-focused not country-focused. a maya stela stopped at a u.s. border cannot enter the country without a valid export permit and thus “fresh,” unprovenanced stela cannot enter the country at all. it does not matter what central american country that stela came from and it does not matter if the exact country of origin is unknown at the time the stela is detected. the u.s. does not need to determine where it is stolen from to establish donna yates that a stela is contraband, if it does not have the appropriate paperwork, it cannot enter the country. this law shares some characteristics with the contemporaneous convention on international trade in endangered species of wild fauna and flora (cites), which, among other things, creates an outright ban on the movement of certain plant and animal species no matter where they came from or where they were seized. the result of this law was the collapse of the u.s. market for maya stela and architectural pieces. no one could argue that a “new” stela that appeared on the market without an export permit was legal and no central american country would ever issue an export permit for an artifact on anything other than a temporary basis. an unforeseen consequence of the ban on sculpture and architecture was a shift in market demand. after , the u.s. market for maya stela largely disappeared, but the market for maya pottery exploded, seemingly because it was not covered by the law. it would seem that the appropriate response to this increase in trafficking of looted maya pottery should have resulted in an object-specific u.s. restriction on the importation of maya pottery, perhaps in the form of a permit requirement, however that did not happen. in the u.s. implemented the unesco convention via the conven- tion on cultural property implementation act (ccpia). ccpia gave the president of the u.s. the ability to impose import restrictions on certain cultural objects fol- lowing a request from another state that is party to the unesco convention and to negotiate and enter into bilateral agreements to this effect. these restrictions are bilateral and country specific. instead of, say, mandating valid export permits for all maya pottery no matter the country of origin, the u.s. restricts the import of all maya pottery from a particular country with which it has an agreement. the prob- lem with this should be clear: looted maya objects that, inherently, do not have a known modern country of origin can fall through the cracks. at the time of writing, the u.s. has cultural property agreements in place with all of the maya countries, although the treaty with mexico is slightly different and was developed before the u.s. implemented the unesco convention. the u.s. and belize only entered into a cultural property bilateral agreement in , meaning that in the years since the implementation of the unesco convention there was at least one maya heartland country with no u.s. import restrictions. this allowed for exploitable ambiguity in the import and sale of maya objects in the u.s. the destruction to maya sites associated with the looting of pottery and other small items not covered by the u.s. law of has devastated the region. although the looting of stela was destructive, these sculptures are usually stand-alone pieces. pottery and other smaller items are normally found within caches and tombs located deep within maya temples and other structures. the trickle-down effect of the switch in market demand towards these smaller objects was the wholesale destruc- tion of thousands of maya buildings. almost every known maya site has been com- promised by this wave of looting. xxx discussion . burden on developing countries’ institutions as it stands, most of the financial burden of the on-the-ground policing of the illicit traffic in cultural property rests on the source country in the form of physical pro- tection of archaeological and cultural sites. the existing system places emphasis on stemming the supply of looted antiquities at the source rather than discouraging demand. to a large degree, our current regulatory regime depends on extensive, competent, and well-funded internal protection over market-end disruption. this is reflected in the wording of articles and of the unesco convention, mandating that the states party to the convention set up national services with “qualified staff sufficient in number” to carry out documentation, protection, excava- tion, education, regulation, certification, customs, and policing duties within their territories. while subsequent articles of the unesco convention call for international collaboration, the internal duty to fund protection operations within source countries is emphasized. even if this wording is merely an ideal, it evidences a clear focus on disruption at the source and not disruption of either transnational trade or the market. yet as we have seen with both bolivia and belize, such source-end disruption may lay far outside of the logistical and financial capacities of developing countries. most major antiquities source countries, such as belize and bolivia, are located in the developing world where resources are limited. although these countries often enact tough anti-trafficking laws with stiff penalties, as is the case with both bolivia and belize, when faced with the logistical and financial difficulties inherent in the developing world, such laws prove nearly impossible to enforce. internal legal mandates to train, maintain, and heavily fund numerous different policing, documentation, and heritage preservation groups in an effort to fend off the inevi- table effects of international demand for illicit antiquities are left underfunded in the face of more pressing problems. such mandates are seen as insurmountable obstacles to both engaging in international discussions concerning antiquities traf- ficking regulation and to successfully negotiating cultural property agreements. furthermore, institutional failures in security-related sectors in the developing world are an impediment to the ideal functioning of existing international traf- ficking prevention measures. high-level international policy formation tends to assume, at least on paper, that there will be a competent police force on the ground, an adequate customs service to combat smuggling, and a functioning justice system to punish wrongdoers. yet in many developing countries, such functional and funded institutions are the exception, not the rule. as can be seen in bolivia, despite steady improvement in recent years, a sizable portion of the population is unable to access state-level institutions. police are seen as corrupt and insecurity is the norm. in belize, police suffer from inadequate equip- ment, short staffing, and remote jungle covered borders. although the law is clear donna yates and antiquities theft and trafficking penalties are steep in both countries, few criminals are ever apprehended. those that are may languish in judicial limbo for years or be let go simply because these justice systems are working with numbers far above their capacity. again a key element in our international system for antiq- uities trafficking prevention, security on the ground, depends on the financial and organizational stability of countries that are rarely financially and organizationally stable. bolivia and belize, like most developing countries face major threats related to internal and international crime. their ability to deal with those issues is seriously hampered by corruption, inaccessible territory, and limited financial resources. yet there is a perceived expectation internationally that local police and related institu- tions should be a key component of our international efforts to regulate the flow of looted antiquities onto the market. this expectation may prevent the apprehension and prosecution of individuals higher up on the antiquities trafficking chain and puts an unfair burden on the victims of antiquities theft. leaving these and other policing and protection efforts up to source countries does not adequately protect heritage sites, does not adequately protect communities, does not prevent illicit antiq- uities from entering the market, and does not disrupt the illicit trafficking chain. . focus on countries, not objects the development of international agreements between states, either within the framework of the unesco convention or outside of it, is at the core of our existing international regulatory regime to combat antiquities trafficking. there are a number of issues that arise when regulation of the illicit antiquities trade is reduced to relations between only two modern states. the most obvious is that the paths that looted cultural objects pass through on their way to the market often include third (or fourth or fifth) states which may or may not have cultural prop- erty agreements or favorable relations with the initial source and ultimate market countries. they may have no vested interest in spending scarce policing funds on what they might consider to be someone else’s problem. yet there are more subtle issues on the ground with heritage site protection based on international agreements. even when agreement is in place, poor relations between the two countries will stall recovery efforts. this is put in particularly sharp focus when considering the return of cultural property from the u.s. to bolivia. although relations between these two countries are unsteady, some sort of continued relationship and ongoing negotiations are required for stolen bolivian cultural objects either to be pre- vented from entering the u.s. or to be returned. thus international relations become the focus, not the objects themselves, and preservation hinges on these relations. this country-specific approach is quite different from an object-specific approach, which would require various proofs of ownership and permits for antiquities to cross borders or enter the market. in other words an object-specific approach requires less negotia- tion and can continue to function even when international relations sour. xxx furthermore, a country-specific focus can be completely ineffective when dealing with ancient cultures that spanned across several modern states. in the case of many forms of maya pottery, it is nearly impossible to determine which central american country a looted piece came from. when such pottery is seized outside of central america, it is usually unclear which modern state can or should claim it. even when a maya pot is intercepted leaving belize, the origin of the piece is not immediately obvious as it could have passed in that country from either mexico or guatemala. this ambiguity can and has been exploited by traffickers. however an object-specific regulatory approach, per- haps modeled after cites and requiring permits and ownership documentation for all maya pottery crossing any border, might serve to better control the market for such pieces. maya pottery without a clear country of origin and a clean export history would be prevented from entering the market country and the market itself. . cultural objects in isolation we tend to think of cultural objects as unique. they are the manifestation of the intangibilities of human identity, and it is easy to see why there is an urge to produce legislation that distinguishes cultural property theft from other crimes. while it may be correct to separate the theft and trafficking of such rare goods as antiquities from the mundane “normal” stolen goods, that does not mean that antiquities trafficking is unrelated to other crimes. the trafficking and illicit sale of antiquities may be one of a series of interrelated criminal activities which include the transport and sale of other objects. likewise, the looting of archaeological sites may be a response to eco- nomic instability caused by unrelated crime, such as the encroachment of displaced persons onto protected land due to the activities of drug cartel support economies. this certainly seems to be an issue in central america, where antiquities looting appears to be one of a number of illicit border economies that individuals engage in either when opportunity presents itself or out of need. these illicit activities are often conducted by the same people in the same space. using the example of belize, desig- nated archaeological sites are often in protected forest zones. these protected zones are also the site of illegal logging and rare wood taking, illicit palm cutting for the inter- national flower market, poaching of jaguars for pelts, taking of rare parrots, protected orchid theft and smuggling, and illegal farmsteading, as well as stopover points for planes involved in narcotics trafficking. to an extent, many of these crimes are policed together on the ground by forestry workers and tourism police, but administratively they are differentiated from antiquities trafficking and exist in a separate place within national law and our international regulatory regime. a reduction in illegal farming activities might reduce archaeological site looting; a crackdown on, specifically, parrot smuggling might result in individuals turning to artifact smuggling. siloing national and international policy for what can be seen as related crimes may prevent us from gaining an accurate understanding of the results of our interventions. to use the example of the village of quila quila in bolivia, we can see a potential outcome of viewing cultural property theft as separate from internal instability donna yates and insecurity. this community, out of a profound sense of insecurity and lack of confidence in the authorities, turned to fatal vigilantly justice to punish cultural property robbers. although this is an extreme, it illustrates what might be a lack of non-heritage-related development within our cultural property protection regime. perhaps we should make heritage protection a component of more general policy towards social improvement, not a stand-alone area in which capacity is built but no foundation exists for that capacity to rest on. some policy recommendations from the ground what, then can be done to improve international policy related to antiquities trafficking? that is not an easy question to answer; however beyond what i have previously discussed, this fieldwork in bolivia and belize points to two areas of potential improvement. first, object-focused import restrictions should be promoted. banning the import of all permit-less pre-columbian sculptural pieces, no matter their country of origin, nearly eliminated the market for such items in the u.s. this can and should be done on a global scale, perhaps using cites as a model. cites has its flaws, but by banning the free movement of certain animals and plants, no matter their country of origin, many of the exploitable aspects of other types of regulation are avoided. mandatory export and import permits will go a long way to eliminating traffickers’ ability to “clean” illicit antiquities for the more “respectable” market. there will be no “respectable” illicit antiquities and the reduction in demand will naturally reduce motivation to loot for supply. second, we should emphasize policing and punishment of traffickers and buyers rather than spend time and money on the return of a limited number of cultural objects. if we accept that most people in developing countries who engage in loot- ing are doing so because of a lack of viable alternatives and as part of any number of illicit and licit short-term economic activities, it is clear that focusing policing and punishment on them is useless. the more powerful end of the market will find other desperate people to commit those crimes. instead of policy focused on asset return, we need policy focused on reducing the market. this means real punishment for collectors and museums found to be buying looted goods and this means breaking up networks. any future international regulation should still mandate international cooperation, but that cooperation should be policing- and enforcement-focused. endnotes . in july and august of , i conducted fieldwork in the la paz department of bolivia. funded by the fulbright, this work was focused on cultural property trafficking out of bolivia, specifically looking at the on-the-ground effectiveness of certain national and international regulation. i also conducted archaeological fieldwork at tiwanaku, bolivia, in and in . . estado plurinacional de bolivia . xxx . carlos valdez, “bolivia's census omits ‘mestizo’ as category,” associated press, november , http://web.archive.org/web/ /http://bigstory.ap.org/article/bolivias-census-omits- mestizo-category ; estado plurinacional de bolivia . . particularly the law of popular participation, law , ( ) (bol). . bol. const. ( ). . imf . . law of oct. ( ) (bol.) . see yates and yates for complete analysis of bolivian cultural property legislation. . first via res. min. educació n ( ) (bol.), then formalized via bol. const. ( ) art. . see yates . . “no hay control en los anticuarios de la paz,” la razón, november , http://web.archive.org/ web/ /http://www.la-razon.com/index.php?_url=/suplementos/informe/control- anticuarios-paz_ _ .html . . adopted november , entered into force april . . fr – ( december ). . la razón . during interviews related to this work, i discovered that artefacts that i personally excavated in bolivia at a world heritage site in and have not been formally inventoried, although i submitted the paperwork and reports required by law. they have sat for ten years in an unsecured shed at the site. . e.g. paintings stolen from the church at san andrés de machaca, see yates b . . consejo de derechos humanos . . ciudadanía & lapop : . . see yates . . yates . . henry aria gutiérrez, “linchamientos en quila quila,” correo del sur , march , http://web.archive.org/web/ /http://www.infodecom.net/nacionales/chuquisaca/ item/ -linchamientos-en-quila-quila ; “turba linchó a dos supestos delincuentes en quila quila,” el diario , march . . dl no códifo penal art , art , art ( ) (bol). . i have not seen clear proof of this, however i was offered illicit fossils there in . fossils are protected by the same legislation as antiquities in bolivia and their sale and transnational transport is prohibited. . the specifics of this case have been omitted as the investigation is ongoing. . fr – march ; lobo ; yates b . . according to documentation supplied by informants. . “roban tres cuadros coloniales y escultura de iglesia en bolivia,” aci prensa, july , http://web.archive.org/web/ /https://www.aciprensa.com/noticias/roban-tres- cuadros-coloniales-y-escultura-de-iglesia-en-bolivia/ ; ronald barrancos, “bolivia: robaron piezas de platería del templo san francisco de población de coroma potosí,” blog of the brazilian ministry of culture, april , http://blogs.cultura.gov.br/mercosur/ / / /boliviarobaron- -piezas-de-plateria-del-templo-san-francisco-de-la-poblacion-de-coroma-potosi/ . in july of , i conducted preliminary fieldwork in belize. funded by the leverhulme trust, this work was focused on cross-border illicit trade between belize, guatemala, and mexico with an emphasis on cultural property trafficking. i also conducted archaeological fieldwork in belize and along the guatemalan side of the border in . . statistical institute of belize . . gutchen . . gilgan . . ibid.; gutchen . . gutchen . . gilgan . . ch ancient monuments and antiquities . ( ) (belize). aq aq aq aq aq donna yates . huxley . . unodc . . hanson et al. , . . ibid, . . ibid. . e.g. gilgan ; gutchen ; matsuda a , b ; pendergast ; pendergast and graham . . u.s. v. hollinshead , f. d , th cir. . paredes maury . . confidential interviews, belize . . steven dudley, “the zetas in guatemala,” insight crime report , september, : ; mcsweeney et al. , . . see yates . . this information is compiled from confidential interviews conducted in july . . as asserted in matsuda a and b . . e.g. ricardo flores, “belize, nueva ruta de narcos operan por tierra y aire,” la prensa grafica, june , http://web.archive.org/web/ /http://www.laprensagrafica.com/el- salvador/judicial/ -belice-nueva-ruta-de-narcosoperan-por-tierra-y-aire or http://perma.cc/ au -nfm ; i have seen alleged air strips in mennonite areas and several informants recounted such involvement. . confidential interviews, . . matsuda a , b ; paredes maury . . a spectacular example of this comes from the work of reents-budet on belize’s “buenavista vase” in schele et al. . . adopted march , entered into force july . . coggins , . . ibid. . gilgan . . treaty of cooperation providing for the recovery and return of stolen archaeological historical and cultural properties, u.s.-mex., july , ust . . gilgan . bibliography ciudadanía & lapop . . “cultura política de la democracia en bolivia, : hacia la igualdad de oportunidades,” http://www.vanderbilt.edu/lapop/bolivia/bolivia- -report.pdf . coggins , clemency c . . “illicit traffic of pre-columbian antiquities.” art journal , no. : , , , . ——— . . “united stated cultural property legislation: observations of a combatant.” international journal of cultural property , no. : – . consejo de derechos humanos . . informe anual de la alta comisionada de las naciones unidas para los derechos humanos en bolivia . estado plurinacional de bolivia . . boletín informativo censo nacional de población y vivienda . n° . http://www.ine.gob.bo/pdf/boletin/np_ _ .pdf . ——— . . bolivia: characterísticas de población y vivienda. censo nacional de población y vivienda . instituto nacional de estadística . http://www.ine.gob.bo: /censo /pdf/ resultadoscpv .pdf or http://perma.cc/s b - gnp . aq aq aq aq aq aq xxx gilgan , elizabeth . . “archaeological heritage management in belize: a case study.” ma diss., department of archaeology, boston university . ——— . . “looting and the market for maya objects: a belizean perspective.” in trade in illicit antiquities: the destruction of the world's archaeological heritage , edited by neil brodie , jennifer doole and colin renfrew , – . cambridge : macdonald institute . gutchen , mark a . . “the destruction of archaeological resources in belize, central america.” journal of field archaeology : – . hanson , robert , greg warchol , and linda zupan . . “policing paradise: law and disorder in belize.” police practice and research , no. : – . huxley , aldous . . beyond the mexique bay . london : chatto and windus . imf . . “imf executive board concludes article iv consultation with bolivia.” website of the international monetary fund press release , http://web.archive.org/web/ /https:// www.imf.org/external/np/sec/pr/ /pr .htm . lobo , susan . . “the fabric of life: repatriating the sacred coroma textiles.” cultural survival quarterly , no. , http://web.archive.org/web/ /http://www.culturalsurvival.org/ publications/cultural-survival-quarterly/bolivia/fabric-life-repatriating-sacred-coroma-textiles . matsuda , david j . a. “the ethics of archaeology, subsistence digging, and artifact looting in latin america: point, muted counterpoint.” international journal of cultural property , no. : – . ——— . b. “subsistence digging in and around belize.” phd diss., union institute, cincinnati, oh . mcsweeney , kendra , erik a. nielsen , matthew j. taylor , david j. wrathall , zoe pearson , ophelia wang , and spencer t. plumb . . “drug policy as conservation policy: narco-deforestation.” science , no. : – . paredes maury , sofia . . “surviving in the rainforest: the realities of looting in the rural villages of el petén, guatemala.” famsi reports , http://web.archive.org/web/ /http://www. famsi.org/reports/ / paredesmaury .pdf . pendergast , david . . “and the loot goes on: winning some battles, but not the war.” journal of field archaeology , no. : – . pendergast , david , and elizabeth graham . . “fighting a looting battle: xunantunich belize.” archaeology , no. : – . reents-budet , dorie , linda schele , justin kerr , and michael mezzatesta . . painting the maya universe: royal ceramics of the classic period . durham, n.c .: duke university press . statistical institute of belize . . statistics of the nation , http://www.sib.org.bz/ . unodc . . global study on homicide . vienna: united nations publications, https://www. unodc.org/documents/gsh/pdfs/ _global_homicide_book_web.pdf . yates , donna . . “archaeology and autonomies: the legal framework of heritage management in a new bolivia.” international journal of cultural property , no. : – . ——— . a. “archaeological practice and political change: transitions and transformations in the use of the past in nationalist, neoliberal and indigenous bolivia.” phd diss., department of archaeology, university of cambridge . aq aq aq aq aq donna yates ——— . b. “coroma textiles.” trafficking culture website , http://web.archive.org/web/ /http://traffickingculture.org/encyclopedia/case-studies/coroma-textiles/ . ——— . . “church theft, insecurity, and community justice: the reality of source-end regulation of the market for illicit bolivian cultural objects.” european journal on criminal policy and research , no. : – . ——— . . “displacement, deforestation, and drugs: antiquities trafficking and the narcotics support economies of guatemala.” in cultural property crimes: an overview and analysis on contemporary perspectives and trends , edited by joris kila and marc balcells . brill : leiden . ——— . b. “san andrés de machaca church looting.” trafficking culture, http://web. archive.org/web/ /http://traffickingculture.org/encyclopedia/case-studies/ san-andres-de-machaca-church-looting/ . aq aq aq slavic review vites were in constant contact with a much wider variety of religions and denomi- nations than any other nation in europe. were reflections about the good and evil of tolerance alien to them? probably not. but they seldom were in the habit of writing down their reflections. the muscovites' world of ideas has to be distilled from the sources with much effort. nolte did not even attempt to learn about the intellectual disposition or indisposition of the muscovites toward tolerance in general; he sees tolerance as a legal and administrative problem. muscovite in- tellectual history is a rather risky affair, and it is understandable that nolte wanted to avoid the possible reproaches of overinterpreting the sources. but another omission can hardly be excused: nolte does not see that tolerance was also an eminently political problem. the treatment of catholics was determined by relations. with poland and by the treatment the orthodox were given by the poles; it was also determined by the union of . the decrees regulating the life of mohammedans in the muscovite state were deeply influenced by the restric- tions imposed on the orthodox living under ottoman rule. the muscovites were better informed about the living conditions of these orthodox than about any other group living outside their state. nolte refers frequently to ottoman-muscovite rela- tions (for example, pp. , , , , , ), but he fails to see their importance for his topic. for instance, he mentions that in muscovy muezzins were forbidden public performance (p. ) and the non-orthodox were not allowed to ring bells (p. ), overlooking that it was one of the standard complaints of the orthodox living in the ottoman empire that they were forbidden to ring church bells. the number of small mistakes and misspellings is above average. for example, the ukrainian historian golobuckij (correct russian form of his name p. ) is men- tioned on page once as golubickij and another time as gulobickij. nolte's book is a contribution to the administrative, legal, and partly to the economic aspects of the problem of religious tolerance in russia; the other aspects are still open to further research. walter leitsch university of vienna russian maps and atlases as historical sources. by leonid a. goldenberg. cariographica, monograph no. . translated by james r. gib- son. toronto: department of geography, york university, . iii, pp. subscription price, $ . for monographs. paper. this brief volume of cartographica originally appeared as "russian cartographic materials of the th and th centuries as an historical source and their classi-' fication," in problemy istochnikovedeniia, , no. , pp. - . the principal aim of the original version was to characterize the major kinds of seventeenth- and eighteenth-century cartographic documents and thereby bring to the historian's at- tention a wealth of relatively neglected materials important for research on the historical geography of russia. one must assume that this translation of golden- berg's work was designed to provide similar encouragement to historians and geographers outside the soviet union. in roughly forty pages of text, goldenberg deals with the evolution of russian cartographic materials, describes their content, and gives an indication of their usefulness as well as their present availability. at times the description seems dis- jointed and anecdotal. nonetheless, those unfamiliar with russian cartographic reviews materials will be impressed by their apparent richness and variety. the general survey, for example, with its associated "economic notes," provides coverage of thirty-four of the fifty-four provinces then in existence and contains detailed in- formation on land use, population, crafts, industries, and physical conditions in the late eighteenth and early nineteenth centuries. the central state archive of an- cient acts contains well over one million items related to the general survey, offer- ing the potential, when combined with other materials described by the author, to reconstruct much of the historical geography of russia. the translation itself is handsomely produced, but in size and concept this publication falls short of what one might expect in a separate issue of a monograph series. as an historical geographer, professor gibson could well have enhanced the volume by providing a substantial foreword and by using editorial comments to update the original version. unfortunately this was not done, and as a result the usefulness of the volume as a reference for historians and geographers is less than might have been expected. robert g. jensen syracuse university studies on the interior of russia. by august von haxthausen. translated by eleanore l. m. schmidt. introduction by *. frederick starr. chicago and london: university of chicago press, . xlv, pp. $ . . teachers and students of russian history will welcome this abbreviated one-volume english translation of august von haxthausen's celebrated three-volume german account of his travels in russia in . the only other english translation (also drastically shortened), that of , is now difficult to obtain. moreover, the present version is accompanied by an extensive scholarly apparatus, and it is attractively presented. the book opens with professor starr's lengthy and fasci- nating study of the author, which emphasizes not only the voyage itself but also haxthausen's continued active interest in russia, and even suggests that he, by means of a meeting and a memorandum, influenced alexander ii toward inau- gurating the emancipation of the serfs. (khomiakov's name, however, was alexis, not alexander, pp. xxiv, xxxi.) to squeeze three volumes into one "the frequent repetitions that encumber the german original have been deleted," always with appropriate markings. more important, numerous chapters and parts of chapters have been eliminated. to summarize what remains, in the scholars' own words: "the principle of selection applied throughout has been to translate those sections most closely connected with haxthausen's own deepest concerns and with those of contemporary social thought in western europe and russia. accordingly, the descriptions of village life in central russia and especially the extensive accounts of iaroslavl and nizhnii novgorod provinces are translated almost in full from volume . also included from volume is the excellent discussion of the sectarian communities, a theme followed up later in the chapter on the mennonites from volume . haxthausen's thoughtful analysis of colonization and national integration from volume is translated and abridged. finally the lengthy essays from volume on moscow, the nobility, the religiosity of russians, and the peasant commune are included. these passages, along with the analysis of colonization, present con- venient summary of haxthausen's investigations and form the basis for the author's concluding prognostications in 'the mission of russia'" (p. xliv). the translation reads well. the editor's notes are on the whole useful, although dnajc mutations in parkinson disease. | semantic scholar skip to search formskip to main content> semantic scholar's logo search sign increate free account you are currently offline. some features of the site may not work correctly. doi: . /hmg/ddt corpus id: dnajc mutations in parkinson disease. @article{vilariogell dnajc mi, title={dnajc mutations in parkinson disease.}, author={c. vilari{\~n}o-g{\"u}ell and a. rajput and a. milnerwood and brinda shah and chelsea szu-tu and j. trinh and irene yu and m. encarnacion and l. munsie and l. tapia and e. gustavsson and patrick chou and i. tatarnikov and d. evans and frederick t pishotta and m. volta and dayne beccano-kelly and c. thompson and m. k. lin and h. sherman and h. j. han and b. guenther and w. wasserman and virginie bernard and c. ross and silke appel-cresswell and a. stoessl and c. robinson and d. dickson and o. ross and z. wszolek and j. aasly and ruey‐meei wu and f. hentati and r. gibson and p. mcpherson and m. girard and m. rajput and m. farrer}, journal={human molecular genetics}, year={ }, volume={ }, pages={ - } } c. vilariño-güell, a. rajput, + authors m. farrer published biology, medicine human molecular genetics a saskatchewan multi-incident family was clinically characterized with parkinson disease (pd) and lewy body pathology. pd segregates as an autosomal-dominant trait, which could not be ascribed to any known mutation. dna from three affected members was subjected to exome sequencing. genome alignment, variant annotation and comparative analyses were used to identify shared coding mutations. sanger sequencing was performed within the extended family and ethnically matched controls. subsequent… expand view on pubmed europepmc.org save to library create alert cite launch research feed share this paper citationshighly influential citations background citations methods citations results citations view all figures, tables, and topics from this paper figure table figure figure figure view all figures & tables parkinsonian disorders lewy body disease vps gene apc gene whole exome sequencing secondary parkinson disease inclusion bodies haplotypes dnajc gene annotation numerous biopolymer sequencing citations citation type citation type all types cites results cites methods cites background has pdf publication type author more filters more filters filters sort by relevance sort by most influenced papers sort by citation count sort by recency dnajc mutation screening in patients with parkinson's disease from south italy. m. gagliardi, g. annesi, + authors a. quattrone medicine parkinsonism & related disorders save alert research feed the rab b p.g r mutation causes x-linked dominant parkinson’s disease i. f. mata, yongwoo jang, + authors c. p. zabetian biology, medicine molecular neurodegeneration pdf view excerpt save alert research feed evidence of mutations in ric acetylcholine receptor chaperone as a novel cause of autosomal-dominant parkinson's disease with non-motor phenotypes sumedha sudhaman, u. muthane, m. behari, s. t. govindappa, r. juyal, b. thelma biology, medicine journal of medical genetics save alert research feed chchd mutations in autosomal dominant late-onset parkinson's disease: a genome-wide linkage and sequencing study m. funayama, k. ohe, taku amo, n. furuya, n. hattori medicine the lancet neurology save alert research feed tmem variants in parkinson’s disease z. iqbal, m. toft biology, medicine nature genetics pdf save alert research feed vps and dnajc disease-causing variants in essential tremor a. rajput, j. p. ross, + authors c. vilariño-güell biology, medicine european journal of human genetics pdf save alert research feed title the rab b p . g r mutation causes x-linked dominant parkinson ' s disease permalink i. f. mata, yongwoo jang, + authors c. p. zabetian view excerpt save alert research feed lack of tmem mutations in patients with familial and sporadic parkinson's disease in a taiwanese population tian-sin fan, chin-hsien lin, hang-i lin, meng-ling chen, ruey‐meei wu medicine american journal of medical genetics. part b, neuropsychiatric genetics : the official publication of the international society of psychiatric genetics view excerpt, cites background save alert research feed a homozygous parkin p.g r mutation in a chinese family with autosomal recessive juvenile parkinsonism h. chen, xiangjun huang, lamei yuan, hong xia, h. deng biology, medicine neuroscience letters save alert research feed whole-exome sequencing in familial parkinson disease. janice l. farlow, laurie a robak, + authors t. foroud biology, medicine jama neurology pdf save alert research feed ... ... references showing - of references sort byrelevance most influenced papers recency vps mutations in parkinson disease. c. vilariño-güell, c. wider, + authors m. farrer biology, medicine american journal of human genetics pdf view excerpts, references methods and background save alert research feed mutations in lrrk cause autosomal-dominant parkinsonism with pleomorphic pathology a. zimprich, s. biskup, + authors t. gasser biology, medicine neuron , view excerpt, references background save alert research feed a mutation in vps , encoding a subunit of the retromer complex, causes late-onset parkinson disease. a. zimprich, a. benet-pagès, + authors t. strom biology, medicine american journal of human genetics view excerpt, references background save alert research feed characterization of dctn genetic variability in neurodegeneration c. vilariño-güell, c. wider, + authors m. farrer biology, medicine neurology view excerpt, references methods save alert research feed mutations in the parkin gene cause autosomal recessive juvenile parkinsonism t. kitada, s. asakawa, + authors n. shimizu biology, medicine nature , save alert research feed cloning of the gene containing mutations that cause park -linked parkinson's disease c. paisán-ruiz, s. jain, + authors a. singleton biology, medicine neuron , pdf view excerpt, references background save alert research feed genomewide association study for susceptibility genes contributing to familial parkinson disease n. pankratz, j. wilk, + authors coordinators and molecular genetic laboratories the psg—progeni and genepd investigators biology, medicine human genetics view excerpt, references background save alert research feed translation initiator eif g mutations in familial parkinson disease. marie-christine chartier-harlin, j. dachsel, + authors m. farrer biology, medicine american journal of human genetics pdf view excerpt, references methods save alert research feed the curious case of phenocopies in families with genetic parkinson's disease c. klein, r. chuang, c. marras, a. lang biology, medicine movement disorders : official journal of the movement disorder society view excerpt, references background save alert research feed mutation in the α-synuclein gene identified in families with parkinson's disease m. polymeropoulos, c. lavedan, + authors r. nussbaum biology , pdf save alert research feed ... ... related papers abstract figures, tables, and topics citations references related papers stay connected with semantic scholar sign up about semantic scholar semantic scholar is a free, ai-powered research tool for scientific literature, based at the allen institute for ai. learn more → resources datasetssupp.aiapiopen corpus organization about usresearchpublishing partnersdata partners faqcontact proudly built by ai with the help of our collaborators terms of service•privacy policy the allen institute for ai by clicking accept or continuing to use the site, you agree to the terms outlined in our privacy policy, terms of service, and dataset license accept & continue genes g c a t t a c g g c a t article pro ala ppar-γ and + t/c ppar-δ polymorphisms and association with metabolic traits in teenagers from northern mexico martín a. carrillo-venzor , nancy r. erives-anchondo , janette g. moreno-gonzález , verónica moreno-brito , angel licón-trillo , everardo gonzález-rodríguez , pilar del carmen hernández-rodríguez , sandra a. reza-lópez , verónica loera-castañeda and irene leal-berumen ,* faculty of medicine and biomedical sciences, autonomous university of chihuahua, circuito universitario, campus ii, chihuahua , mexico; a @uach.mx (m.a.c.-v.); smtp_gmail@uach.mx (n.r.e.-a.); jgmoreno@uach.mx (j.g.m.-g.); vmoreno@uach.mx (v.m.-b.); alicon@uach.mx (a.l.t.); evegonzal@uach.mx (e.g.-r.); sreza@uach.mx (s.a.r.-l.) faculty of chemical sciences, autonomous university of chihuahua, circuito universitario, campus ii, chihuahua , mexico; pilar_hernandez@inclar.com ciidir-ipn, durango , mexico; veronica.loera@gmail.com * correspondence: ileal@uach.mx received: may ; accepted: july ; published: july ���������� ������� abstract: peroxisome proliferator-activated receptors (ppars) play roles in glucose and lipid metabolism regulation. pro ala ppar-γ and + t/c ppar-δ have been associated with dyslipidemia, hyperglycemia and high body mass index (bmi). we compared metabolic traits and determined associations with pro ala ppar-γ or + t/c ppar-δ polymorphism among teenagers from different ethnicity. four hundred and twelve samples with previous biochemical and biometric measurements were used. genomic dna from peripheral blood was extracted and analyzed by end-point pcr for pro ala ppar-γ . the + t/c ppar-δ pcr product was also digested with bsl i. two genotype groups were formed: major allele homozygous and minor allele carriers. pro ala ppar-γ g minor allele frequencies were: % in mestizo- , % in mestizo- , % in tarahumara, % in mennonite, and % in the total studied population. the + t/c ppar-δ c minor allele frequencies were: % in mestizo- , % in mestizo- , % in tarahumara, % in mennonite, and % in the total studied population. teenagers with ppar-γ g allele showed a greater risk for either high waist/height ratio or low high-density lipoprotein; and, also had lower total cholesterol. whereas, ppar-γ g allele showed lower overweight/obesity phenotype (bmi z-score) frequency, ppar-δ c allele was a risk factor for it. metabolic traits were associated with both ppar polymorphisms. keywords: pro ala; + t/c; ppars polymorphisms; metabolic traits; allele frequencies; major/minor allele; genotypes . introduction the worldwide prevalence of obesity in was % in children and % in adults [ ]. according to the organization for economic co-operation and development (oecd) heavy burden of obesity , close to % of the population from the countries members of the oecd have overweight and nearly % have obesity. obesity and related diseases will reduce life expectancy . – . years in the future and million premature deaths are expected due to obesity-related diseases by [ ]. in the us, the obesity rate has increased from . to . % in – year-old teenagers between genes , , ; doi: . /genes www.mdpi.com/journal/genes http://www.mdpi.com/journal/genes http://www.mdpi.com https://orcid.org/ - - - https://orcid.org/ - - - https://orcid.org/ - - - https://orcid.org/ - - - http://dx.doi.org/ . /genes http://www.mdpi.com/journal/genes https://www.mdpi.com/ - / / / ?type=check_update&version= genes , , of and [ ]. obesity has also increased drastically in mexico. according to the encuesta nacional de salud y nutrición , the overweight/obesity prevalence in mexico was . % for – year-olds [ ]. ppars play roles in physiology, pathology, and whole-body energy regulation, lipid and glucose metabolism. pro ala ppar-γ and + t/c ppar-δ have been associated with dyslipidemia, hyperglycemia, and overweight/obesity. ppars are peroxisome proliferator-activated receptors and members of the nuclear hormone receptor superfamily, located in a wide variety of tissues and cells. they are ligand-activated nuclear transcription factors that interact with complex metabolic networks [ , ]. the ppar-γ gene is located on chromosome p (omim number ) and it encodes three proteins isoforms [ , ]. the ppar-γ isoform is expressed in most tissues; the γ is seen in macrophages, colon epithelium, and adipose tissue [ ]. however, the γ is specific for adipose tissue and it can be activated by fatty acids including prostanoids, thiazolidinediones, and other insulin-sensitizing antidiabetic agents [ , ]. the pro ala polymorphism is a missense coding variant (cca to gca) in γ , which results in a proline (major allele) to alanine (minor allele) substitution (rs ) [ ]. the presence of this single nucleotide polymorphism (snp) has been associated with type diabetes (t d) related traits, hypertension, abnormal lipid profile, insulin resistance, and greater body mass index (bmi) [ , ]. several meta-analysis studies have reported between – % increased risk of t d in adult population from europe, north america, and east asia with a pro allele [ , ]. however, different results have been reported regarding bmi and pro ala polymorphism in other ethnic groups [ – ]. the prevalence of the modified ala allele varies from about % in asian populations to % in caucasians [ ]. the ppar-δ gene is located in chromosome p . (omim number ) with exons [ ]. it has ubiquitous expression; however, its greatest expression occurs in tissues with high lipid metabolism, including the small intestine, heart, adipose tissue, and skeletal muscle [ ]. ppar-δ can be activated by polyunsaturated fatty acids and synthetic compound gw [ ]. the + t/c polymorphism (rs ) is also called − t/c or + c/t and is a t (major allele)–c (minor allele) base exchange in the ′-utr region of the gene [ , ]. the presence of this snp has been related to several metabolic traits. it is mostly associated with alterations in the blood levels of hdl, ldl, vldl, and triglycerides [ – ]. there is also an association between the c allele and bmi, glucose levels, height, and coronary heart disease (chd) [ , , , – ]. the prevalence of the c allele varies among different populations: . % to . % in chinese people, . % in germans, . % in french canadians and % in mexicans [ , , , , ]. a few studies in mexican teenagers have shown association with pro ala ppar-γ polymorphism with obesity-related traits. stryjecki et al. reported an association between this polymorphism with insulin resistance in mexican children [ ]. no studies about + t/c ppar δ polymorphism and metabolic traits in mexican children were found. the aim of this study is to determine the association between pro ala ppar-γ or + t/c ppar-δ polymorphisms with metabolic traits in mexican teenagers from different ethnic populations in chihuahua, mexico. we focused on teenagers to investigate whether polymorphisms and clinical metabolic traits relate, since the early detection of inherited polymorphisms, which cannot be modified, will allow us to promote preventive behaviors as eating healthy food, eating schedules, and physical activity. . materials and methods . . study population the facultad de medicina y ciencias biomédicas, ethical research committee board (protocol registration numbers fm-fm-a / and ci- - ) from the universidad autónoma de chihuahua approved the study protocol; written authorization was obtained from one of the parents or tutors. there were blood samples collected from unrelated adolescents aged – years. samples were collected from a previous scholar health care study in three different populations (mestizo, tarahumara, and mennonite) from chihuahua, mexico. however, two mestizo groups were considered (mestizo- genes , , of and mestizo- ), since they were from different geographic locations. moreover, we found significant differences when clinical metabolic traits were compared between them. on the other hand, a parallel study in our lab (same mestizos) showed significant differences in mitochondrial haplotype frequencies between these two groups (results not shown). recruitment was done in collaboration with public high schools not randomly selected. the data used to support the findings of this study are restricted by the ethics board “comité de Ética en investigación de la facultad de medicina y ciencias biomédicas de la universidad autónoma de chihuahua”, in order to protect participants’ confidentiality. data are available from irene leal-berumen, ileal@uach.mx, for the researchers who meet the criteria for access to confidential data. . . phenotyping all of the participants were weighed while using a digital scale (tanita bc- , ilinois, usa), and height was measured with a portable stadiometer (hm p, taichung, taiwan). the waist circumference (wc) was measured at the midpoint between the lowest rib and the iliac crest after a normal exhalation with students in the standing position, and percentile waist circumference was classified as