doi:10.1086/302687


1785

Letters to the Editor

Am. J. Hum. Genet. 65:1785, 1999

Elevated Frequency and Allelic Heterogeneity of
Congenital Nephrotic Syndrome, Finnish Type, in the
Old Order Mennonites

To the Editor:
Congenital nephrotic syndrome is a clinically and ge-
netically heterogeneous disorder of the glomerular fil-
tration barrier, characterized by massive proteinuria at
or shortly after birth. Although nephrotic syndromes
encompass a heterogeneous group of disorders, congen-
ital nephrotic syndrome of the Finnish type (NPHS1
[MIM 256300]) is a distinct clinical entity. NPHS1 has
an autosomal recessive mode of inheritance and is gen-
erally rare—except in Finland, where the incidence is
∼1/10,000 live births (Norio 1966). Nephrin, a putative
transmembrane protein belonging to the immunoglob-
ulin family of cell-adhesion molecules, has been identi-
fied as the gene mutated in NPHS1, with loss-of-function
deletion and missense mutations identified in Finnish
and other white patients with NPHS1 (Kestilä et al.
1998; Lenkkeri et al. 1999). Several cases of NPHS1
have also been observed in other populations, with or
without direct evidence of Finnish ancestry (Fuchshuber
et al. 1996). On the basis of limited haplotype analysis,
it has been argued that some cases of non-Finnish
NPHS1 may have a common origin in Finland (Män-
nikkö et al. 1996).

We observed a high incidence of NPHS1 among the
Old Order Mennonites in Lancaster County, Pennsyl-
vania. In particular, we identified 26 cases of NPHS1,
dating from the 1950s, in a very large inbred Mennonite
kindred (population). Interestingly, all but one of the
cases of NPHS1 in Mennonites occurred in a subgroup
known as the “Groffdale Conference” Mennonites. The
Groffdale Conference Mennonites formed as a result of
a schism in the Weaverland Conference Mennonites of
Lancaster County in 1927. The separation between the
two groups was based on differing views regarding ac-
culturation to American thought and society. The more
conservative group formed the Groffdale Conference,
whereas the more progressive members continued in the
Weaverland Conference. At present, the populations and

birth rates of the two conferences are approximately
equal.

We estimated the incidence of NPHS1 among the
Groffdale Conference to be .002 or 1/500 live births, on
the basis of the complete ascertainment of eight cases
among 4,062 births during the period 1985–94. This
incidence is 20 times greater than that observed in Fin-
land and predicts that ∼8% of Groffdale Mennonites
are carriers of the NPHS1-causing allele. The ancestors
of this Old Order group immigrated from Switzerland
to Lancaster County during the early 18th century, and
no explicit Finnish ancestry is known. In this study, we
(1) confirm the role of nephrin in NPHS1, (2) show that
a major mutation is shared by families with NPHS1 that
are in the Groffdale Conference, and (3) show that this
mutation is most likely of recent origin—uncovered by
inbreeding and amplified by genetic drift. Our data also
suggest that the major Mennonite mutation most like-
ly predated the Weaverland-Groffdale split, since one
Weaverland NPHS1 proband is a double heterozygote
with one copy of the major nephrin mutation as well as
a second novel mutation, possibly contributed through
a non-Mennonite lineage.

We initially ascertained four families, in each case
through a proband with NPHS1. The four families had
8 obligate carrier parents and 11 unaffected offspring.
Only one of the probands from these four families was
alive during the study. Subsequent to our analysis of
these four families, one additional family—which in-
cluded a second surviving proband, parents, and pa-
ternal grandparents—was ascertained. After our muta-
tion-detection studies were completed, three additional
families with NPHS1 agreed to participate.

One of the two living Mennonite probands with
NPHS1 (6986) was less-severely affected than the other
patients. This patient underwent nephrectomy at age 18
mo, followed by nightly peritoneal dialysis and a renal
transplant at age 3.5 years. Prior to nephrectomy, this
child had an array of life-threatening problems, includ-
ing recurrent renal-vein thrombosis, severe hypertension,
encephalitis, hypothyroidism, refractory anemia, hyper-
cholesterolemia, edema, ascites, and malnutrition. The
second surviving Mennonite child was 30 mo of age at
the time of our study. She had minimal medical inter-
ventions until age 2 years, at which time she was started
on the Finnish protocol of enalapril, thyroid replace-



1786 Letters to the Editor

Table 1

Oligonucleotide Primers for Amplification of NPHS1 Exons

Exon(s) Primer Sequences

Annealing
Temperature

(oC)

Product
Size
(bp)

1, 2 Forward: AGACGCAAGGTGGCTGGCAGCG 60 474
Reverse: TTCCGCTGGTGGCTGAGGGTC

3, 4 Forward: AGCGGAGCTGCGGCCCTGACT 63 520
Reverse: CCTTCCCACTCCAGAGGCTTCA

5 Forward: TCGCACCCACCCTGAGGACTTC 60 252
Reverse: ATGCTTGCATCCCTGGGGTCTG

6 Forward: CCCCACCTCTTCTCCCTGACT 60 246
Reverse: ATCCCCCCACACCCCCCAGTG

7, 8 Forward: GGAAAGAGTGGATGGGCTACT 60 486
Reverse: CTCTGAGGCACAGACCGACAG

9 Forward: TCTGGGCTGGTCTGTGAGAAA 55 264
Reverse: TCAGCCCCCTCCATGCTCAGA

10, 11 Forward: GTGCTGCAGTCCCCACGTCTG
Reverse: CATTCCTGGCCACCCCCATAG

60 435

12 Forward: TGCTGATGAGAGTGCTTCTCC 60 467
Reverse: CACCCCAGGCTCCGCCCAGTC

13 Forward: CTGGGCGGAGCCTGGGGTGCA 60 308
Reverse: CAGAGGCTGGAGAGGCACTAG

14 Forward: ATCCCTCCCCTCTCTGGTCTG 60 356
Reverse: AAGGTAAGACCCAAGGAGTAG

15, 16 Forward: AACCTTAAACCCCGTCGTGAC 60 543
Reverse: CAATGAGGAGACTCCACAATG

17 Forward: AACCTTCCTGGAACCCCTAAG 57 300
Reverse: CACTCCCAAGGAACTCACAGT

18, 19 Forward: GTGATGGATCTGGGGCTAGAC 59 558
Reverse: AGGGACTCAGGGAGGGGAAGT

20 Forward: GATAGATAGGCAGACGGTTAC 55 382
Reverse: AACTCCATCCTCACACATACA

21, 22 Forward: TCTTCTGGAATTCTTTTGTAT 55a 474
Reverse: TACACATCCTCTGAGGAATAC

23 Forward: ACCAGTTCCCATGAATCTAATA 55 262
Reverse: GTCGTTAAGCAGCTGTGACTAC

24–26 Forward: CAGCCTGTTGTCTGGGATTC 60 610
Reverse: GCTTCAGTCGCCGTCGGTGC

27, 28 Forward: TCCGGGCACAGTGGGGTCAGAG 59 454
Reverse: GCAGCTAGCTGGCCCTAACTAA

29 Forward: TCCATGGTTCTAACTCACTT 60 580
Reverse: GCACTTAGGGACCCTCAGAATAG

a Requires 10% DMSO.

ment, vitamin D, and erythropoetin (Guez et al. 1998).
Within 4 wk of the start of enalapril therapy, her serum
albumin increased from 0.6 to 2.1 g/dl and her gener-
alized edema resolved. If she survives until she obtains
a weight of 10–12 kg, renal transplantation will be
reconsidered.

For genetic analysis, we obtained, with informed con-
sent, either peripheral blood samples or buccal swabs
from members of the eight families. Genomic DNA was
extracted according to standard procedures. No pa-
thology samples were available from the deceased af-
fected individuals, to perform additional analyses. Mi-
crosatellite-marker alleles were amplified and genotyped
via standard PCR methods (Puffenberger et al. 1994).
Allele sizes for all markers (except D19S608, D19S609,

and D19S610) were determined in comparison with
CEPH individual 1347-02; allele numbers for D19S608,
D19S609, and D19S610 were assigned arbitrarily. To
determine the genomic structure of nephrin, we used the
“BLAST 2-sequences” option of the program BLAST
(Tatusova et al. 1999), to align nephrin cDNA sequence
and overlapping genomic sequence from cosmid R33502
(GenBank AFO35835 and AC002133). The gene con-
sists of 29 exons and spans ∼26 kb; primer sequences,
from the program Oligo, version 4.0, were designed for
PCR amplification of all 29 exons in 19 reactions (table
1). For mutation analysis, nephrin exons were PCR am-
plified from one patient (3898), the patient’s father
(3833), and a CEPH control DNA. After PCR amplifi-
cation, products were sequenced on an ABI377 se-



Letters to the Editor 1787

Figure 1 Haplotype analysis of four Mennonite nuclear families with NPHS1. Chromosome 19q13 haplotypes, of the markers shown in
table 2, of NPHS1-transmitting parents and homozygosity for a haplotype in proband 3898 are shown. None of the 11 unaffected siblings
from the four families were homozygous for the identified haplotype (data not shown). The common mutation, 1481delC, segregates with the
haplotype designated in boldface.

quencer (PE Biosystems), with the use of standard dye-
terminator chemistry.

We expected that any NPHS1 candidate locus will
have a unique haplotype in Mennonites, which is ho-
mozygous in affected individuals, heterozygous in the 8
obligate heterozygote parents, and not homozygous in
the 11 unaffected siblings (fig. 1 shows all individuals
but the unaffected siblings). Using 10 microsatellite
markers, Männikkö et al. (1995) mapped NPHS1 to
chromosome 19q13.1 by linkage and linkage-disequi-
librium analysis in Finnish patients. We genotyped these
same markers in the 20 available individuals and iden-
tified a common haplotype (table 2) for five markers in
the 3.5-cM interval D19S609–D19S220, satisfying the
above criteria and implicating nephrin in Mennonite
NPHS1. It is unclear whether any of the Finnish NPHS1
haplotypes are in common with Mennonite NPHS1 hap-
lotypes, since Kestilä et al. (1998) have not published
actual allele sizes at the marker loci studied.

Nucleotide sequencing of all nephrin exons (table 1)
from one proband revealed the deletion of one nucleo-
tide within exon 12 (1481delC), which segregated with
the NPHS1 haplotypes identified. In addition to the fam-
ilies shown in figure 1, six parents from three additional
Mennonite sibships with NPHS1 were genotyped for the

1481delC mutation; all were heterozygous. This deletion
mutation is novel (Kestilä et al. 1998) and leads to a
frameshift and premature truncation of the protein, to
547 residues. Nephrin is a 1,241-residue protein pre-
dicted to be a cell-adhesion receptor and/or a signaling
protein. Its predicted structure includes eight Ig-like do-
mains and one fibronectin-like domain, adjacent to a
transmembrane region. The truncation caused by the
Mennonite mutation occurs well before the putative
transmembrane domain (residues 1059–1068); there-
fore, it follows that 1481delC is very likely a null allele
and that homozygotes have no functional protein.

Subsequent to the identification of 1481delC, we as-
certained the only other living Mennonite proband
(6986 [fig. 2]) and his immediate family. Interestingly,
this patient was found to be heterozygous for 1481delC
and inherited the allele maternally. After nephrin se-
quence analysis of this patient and his father, we detected
a second frameshift mutation, 3250delG, for which both
were heterozygous. Genealogical analysis revealed that
proband 6986 has a partially non-Mennonite lineage;
his maternal great-grandmother married into the Men-
nonite kindred (fig. 2). We were able to trace the second
mutation, 3250delG, to the patient’s paternal grandfa-
ther by DNA analysis. Since the proband’s non-Men-



1788 Letters to the Editor

Table 2

Mennonite NPHS1 Mutant-Allele–Carrying
Haplotypes

Markera

Intermarker
Distance

(cM)b Haplotypec

D19S414 4.9 181 163 163 181
D19S416 .6 177 165 165 177
D19S425 1.0 252 260 260 252

D19S609 1 1 1 1
D19S610 3.0 1 1 1 1
D19S608 4 4 4 4
D19S224 .5 258 258 258 258
D19S220 2.2 283 283 283 283

D19S223 5.6 238 238 238 242

D19S574 184 184 190 198

a Markers in the segment common to all haplotypes
and that implicate nephrin in NPHS1 span a genetic
distance of �3.5 cM and are underlined.

b Between the marker shown and that immediately
below (except for “3.0,” which denotes the distance
spanned by the four markers underlined).

c The boxed portion indicates a common haplotype
segment shared by all parents of the affected individuals
whom we studied. The number of copies is four, two,
one, and one, respectively.

Figure 2 Genealogy of two nephrin-deletion mutations. The sin-
gle Mennonite proband who is doubly heterozygous and who inherited
the common Mennonite mutation and a second mutation from a non-
Mennonite ancestor is shown. The kinship coefficient of the ancestors
shown clarifies that this proband is closely related to other Mennonites
with NPHS1.

nonite great-grandmother is deceased, we could not
establish whether she contributed this mutation or
whether the occurrence of 3250delG is a new mutation
in the proband’s grandfather. Nonetheless, we identified
a second unique mutation, which also results in pre-
mature truncation of nephrin protein, resulting in a
1,141-residue protein. According to the predicted struc-
ture of the protein, it is likely that the 1,141-residue
protein inserts into the membrane but lacks the complete
cytosolic domain. Thus, some residual nephrin function
may exist and may explain the less-severe phenotype of
this patient.

Our results confirm the role of nephrin in NPHS1 and
allelic heterogeneity within the Mennonites. NPHS1 is
very rare throughout the world, and its low incidence
is likely under mutation-selection balance; for a recessive
lethal mutation, the incidence would equal its de novo
mutation rate per generation, which has a mean value
of ∼10�6 (Cavalli-Sforza and Bodmer 1971). The ∼1/
10,000 incidence in Finland is two orders of magnitude
larger and is likely to have increased by genetic drift and
founder effects during the past 100 generations (2,000
years) of Finnish history. Moreover, the occurrence of at
least three distinct mutations, each on a specific marker
haplotype with estimated frequencies of 0.78%, 0.16%,
and 0.06% (Kestilä et al. 1998), suggests that the age

of the more frequent mutation is not recent. This is cor-
roborated by the observation of linkage disequilibrium,
over a small distance (∼150 kb), for the major Finnish
NPHS1 mutation (Kestilä et al. 1998). As we have
shown here, these effects are further amplified in the Old
Order Mennonites, which have a much more recent his-
tory and a much smaller effective population size.

In this study, we have estimated the Mennonite
NPHS1 incidence at ∼1/500 live births, or an overall 20-
fold increase compared with the Finnish incidence. This
large increase is undoubtedly from genetic drift and
founder effects (Chakravarti and Chakraborty 1978),
consistent with the finding of a major common mutation
(1481delC) in a population with an estimated effective
number of ∼200 (A. Chakravarti and E. G. Puffenberger,
unpublished data). We argue that the 1481delC muta-
tion is likely of very recent origin. Table 1 shows that
the core NPHS1 haplotype, on which the 1481delC mu-
tation is found, is shared by all eight mutant chromo-
somes and is �3.5 cM; however, haplotypes 1 and 4
(five copies total) and haplotypes 2 and 3 (three copies
total) each share the longer D19S414–D19S220 hap-
lotype, of 10 cM. Therefore, the average time to origin
of the common mutation in the Mennonites is ∼1/0.1
morgans, or ∼10 generations. It is possible either that
this was a rare mutation in the European Mennonite
groups and that it expanded in the United States or that
the mutation is of recent U.S. origin.

As mentioned above, the distribution of NPHS1 is not
random within the Old Order Mennonite community
and is largely restricted to the Groffdale Conference. The
Groffdale and Weaverland Conferences share very recent
ancestry, yet the distribution and allelic spectrum of
NPHS1 mutations are not equal within these two
groups. At present, only 1 case of NPHS1 has been ob-



Letters to the Editor 1789

served in the Weaverland Mennonites, whereas 25 cases
have been identified in the Groffdale Mennonites since
the 1950s. We have found that the single Weaver-
land Conference patient with NPHS1 (6986) is a com-
pound heterozygote for the major Mennonite mutation,
1481delC (same core haplotype as in table 2), and a
second mutation, 3250delG. Our analysis shows that
1481delC is the only mutation segregating in seven nu-
clear families from the Groffdale Conference (fig. 2). It
is interesting that the origin of 3250delG is non-Men-
nonite, since it is inherited through the non-Mennonite
ancestors of proband 6986. These data emphasize the
rarity of NPHS1 mutations in most populations, iden-
tified here among non-Mennonites only when combined
with a common Mennonite mutation. Moreover, the
concentration of 1481delC in the Groffdale Mennonites
suggests that NPHS1 occurs at an incidence much higher
than 1/500. The incidence within each conference cannot
as yet be determined with any greater precision.

The accumulation of NPHS1 in the Groffdale Con-
ference and the rarity of 1481delC in the Weaverland
Conference can be explained in multiple ways. First, a
subfounder effect might explain the high incidence
within the Groffdale group. However, genealogical and
mutational analyses do not support this hypothesis, since
there is no common ancestor for all carriers of NPHS1
who were born after the 1927 schism and 1481delC is
present in the Weaverland Mennonite population. Sec-
ond, 1481delC may have arisen in the Groffdale Men-
nonites and may have been reintroduced into the Weav-
erland Conference. Since marriage between the groups
is extremely rare, it is unlikely, although not impossible,
that the mutation was contributed to the Weaverland
Conference after the 1927 split. An alternative and sim-
pler explanation is that 1481delC arose prior to the split
and that it has increased in frequency through genetic
drift. The formation of the Groffdale Conference by fam-
ily groups wishing to preserve a simpler lifestyle may
have led, by chance, to a relative increase in the mutant-
allele frequency in one conference compared with the
other.

It is surprising that a recent mutation has achieved
such a high frequency in a short time. This is likely a
result of the intense inbreeding that occurs within the
Old Order Mennonites in each generation—not from
high rates of social consanguinity but from the limited
ancestral pool and the sharing of multiple common an-
cestors between any two individuals. We have estab-
lished a genealogical database of 17,500 individuals
from the Old Order Mennonites that allows direct cal-
culation of kinship coefficients between any two indi-
viduals, equivalently the inbreeding coefficient for their
offspring. We studied 12 pairs of parents with com-
plete genealogies and with an offspring affected with
NPHS1; the average kinship coefficient was .020 (range

.010–.037), corresponding to a relationship between
first cousins once removed and second cousins. For the
four pairs of parents that we report here, the average
kinship coefficient was .017 (range .014–.019). These
rates are relevant for most individuals in the last several
generations. Consequently, any de novo mutation oc-
curring in the recent past has a high chance of becoming
homozygous, through inbreeding, in the Mennonites.
This is in contrast to outbred populations, in which, with
random mating, rare mutants become homozygous only
rarely.

Acknowledgments

We are very indebted to the members of the numerous fam-
ilies with nephrotic syndrome, for sharing information and
donating tissue samples; without these families this work
would have been impossible. We gratefully acknowledge the
superb assistance of Jennifer Scott, for family studies; Kimberly
Bentley, Andrew Wong, and Gilbert Wong, for DNA sequenc-
ing and technical assistance; and Carl Kashuk, for informatics.
This work was supported by National Institutes of Health
grant HD28088 to A.C.

STACEY BOLK,1 ERIK G. PUFFENBERGER,2

JIM HUDSON,3 D. HOLMES MORTON,2 AND
ARAVINDA CHAKRAVARTI1

1Department of Genetics and Center for Human
Genetics, Case Western Reserve University School of
Medicine and University Hospitals of Cleveland,
Cleveland; 2Clinic for Special Children, Strasburg, PA;
and 3Research Genetics, Huntsville

Electronic-Database Information

Accession numbers and URLs for data in this article are as
follows:

BLAST, http://www.ncbi.nlm.nih.gov/BLAST (for alignment of
sequences)

GenBank, http://www.ncbi.nlm.nih.gov/Web/Search (for ne-
phrin cDNA [accession number AF035835] and for cosmid
R33502 [accession number AC002133])

Online Mendelian Inheritance in Man (OMIM), http://www
.ncbi.nlm.nih.gov/Omim (for NPHS1 [MIM 256300])

References

Cavalli-Sforza LL, Bodmer WF (1971) The genetics of human
populations. WH Freeman, San Francisco

Chakravarti A, Chakraborty R (1978) Elevated frequency of
Tay-Sachs disease among Ashkenazic Jews unlikely by ge-
netic drift alone. Am J Hum Genet 30:256–261

Fuchshuber A, Niaudet P, Gribouval O, Jean G, Gubler M,
Broyer M, Antignac C (1996) Congenital nephrotic syn-
drome of the Finnish type: linkage to the locus in a non-
Finnish population. Pediatr Nephrol 10:135–138

Guez S, Giani M, Melzi ML, Antignac C, Assael BM (1998)



1790 Letters to the Editor

Adequate clinical control of congenital nephrotic syndrome
by enalapril. Pediatr Nephrol 12:130–132

Kestilä M, Lenkkeri U, Männikkö M, Lamerdin J, McCready
P, Putaala H, Ruotsalainen V, et al (1998) Positionally cloned
gene for a novel glomerular protein—nephrin—is mutated
in congenital nephrotic syndrome. Mol Cell 1:575–582

Lenkkeri U, Männikkö M, McCready P, Lamerdin J, Gribou-
val O, Niaudet PM, Antignac C, et al (1999) Structure of
the gene for congenital nephrotic syndrome of the Finnish
type (NPHS1) and characterization of mutations. Am J Hum
Genet 64:51–61

Männikkö M, Kestilä M, Holmberg C, Norio R, Ryynänen
M, Olsen A, Peltonen L, et al (1995) Fine mapping and
haplotype analysis of the locus for congenital nephrotic syn-
drome on chromosome 19q13.1. Am J Hum Genet 57:
1377–1383

Männikkö M, Lenkkeri U, Kashtan CE, Kestilä M, Holmberg
C, Tryggvason K (1996) Haplotype analysis of congenital

nephrotic syndrome of the Finnish type in non-Finnish fam-
ilies. J Am Soc Nephrol 7:2700–2703

Norio R (1966) Heredity of the congenital nephrotic syn-
drome. Ann Paediatr Fenn 12 Suppl 27:1–94

Puffenberger EG, Kauffman ER, Bolk S, Matise TC, Wash-
ington SS, Angrist M, Weissenbach J, et al (1994) Identity-
by-descent and association mapping of a recessive gene for
Hirschsprung disease on human chromosome 13q22. Hum
Mol Genet 3:1217–1225

Tatusova TA, Madden TL (1999) Blast 2 sequences: a new
tool for comparing protein and nucleotide sequences. FEMS
Microbiol Lett 174:247–250

Address for correspondence and reprints: Dr. Aravinda Chakravarti, Depart-
ment of Genetics, BRB 721, Case Western Reserve University, 10900 Euclid
Avenue (for courier service: 2109 Adelbert Road), Cleveland, OH 44106. E-
mail: axc39@po.cwru.edu

� 1999 by The American Society of Human Genetics. All rights reserved.
0002-9297/1999/6506-0038$02.00