key: cord-0001697-pxymyqoy authors: Ducatez, Mariette F.; Pelletier, Claire; Meyer, Gilles title: Influenza D Virus in Cattle, France, 2011–2014 date: 2015-02-03 journal: Emerg Infect Dis DOI: 10.3201/eid2102.141449 sha: 57e6620ed5a7142981da23d408a094c2e01bed35 doc_id: 1697 cord_uid: pxymyqoy A new influenza virus, genus D, isolated in US pigs and cattle, has also been circulating in cattle in France. It was first identified there in 2011, and an increase was detected in 2014. The virus genome in France is 94%–99% identical to its US counterpart, which suggests intercontinental spillover. R ecent studies in the United States have identified a new genus within the family Orthomyxoviridae, tentatively named Influenzavirus D (1) . The new pathogen, C/swine/ Oklahoma/1334/2011 (C/OK), was first identified in pigs with influenza-like illness and was only moderately related to previously characterized influenza C viruses (≈50% overall homology between C/OK virus sequence and its closest related sequences). Like human influenza C virus, C/OK harbored 7 genomic segments, whereas influenza A and B viruses have 8. C/OK virus genome was more distant from influenza C virus genomes than influenza A genomes are from influenza B virus genomes. In hemagglutination inhibition assays, cross-reactivity between antibodies against C/ OK virus and human influenza C virus was lacking, which again suggests a new genus in the family Orthomyxoviridae (2) . C/OK-like viruses were also isolated from cattle in the United States in 2013 (1) and China in 2014 (2). C/OK was shown to replicate in ferrets, the animal model of choice for studying influenza virus in humans, suggesting that humans could be infected with C/OK-like viruses. Thus, the host range and geographic distribution of C/OK-like viruses (influenza D virus) needs to be investigated. Because cattle have been suggested as the reservoir for this novel influenza virus (1), we screened bovine samples in France for influenza D virus and characterized the virus from positive specimens. Bovine lung fragments, deep nasal swab specimens, and trans-tracheal aspiration liquids were submitted to the Laboratoire Départemental d'Analyses de Saône (Table 1 , http:// wwwnc.cdc.gov/EID/article/21/2/14-1449-T1.htm). Coinfections were detected with Pasteurella multocida, Mannheimia haemolytica, Histophilus somni, bovine respiratory syncytial virus, and/or bovine herpesvirus 1 in 4 of the influenza D-positive specimens. Two samples (nos. 5831 and 5920, collected in 2014) were negative for all tested respiratory pathogens, despite reports of clinical signs in the animals ( Table 1) . The specimen with the lowest C t value, D/bovine/ France/2986/2012 (C t 15) was selected for further molecular characterization, and its full genome was amplified by PCR (primers in Table 2 ) and sequenced on a 3130XL Applied Biosystems capillary sequencer (Applied Biosystems, Foster City, CA, USA). The sequences were submitted to EMBL (LN559120-LN559126). The 7 gene segments of D/bovine/France/2986/2012 clearly clustered with US influenza D strains from pigs and cattle (C/OK, C/bovine/Minnesota/628/2013, C/bovine/ Minnesota/729/2013, and C/bovine/Oklahoma/660/2013) (Figure) , which suggests a common origin of these new influenza viruses. We found no evidence of reassortment between influenza C and D (C/OK-like) viruses. In addition, the splicing pattern of the matrix gene segment and the reduced 5-N-acetyl binding pocket in the hemagglutinin-esterase (HE) protein of D/bovine/France/2986/2012 was similar to that of C/OK and different from that of human influenza C virus, confirming the similarity of D/ bovine/France/2956/2012 and the newly described swine and bovine US influenza D virus strains. The estimated ranges of evolutionary distances (in number of substitutions per site using the maximum composite likelihood model) between D/bovine/France/2986/2012 and the 4 US influenza D viruses ranged from 0.8 to 5.7% and were as follows: 1.9%-2.1%, 0.8%-0.9%, 2.1%-2.5%, 2.3%-2.7%, 1.8%-3.8%, 3.6%-4.2%, and 5.1%-5.7% for polymerase basic (PB) 2, PB1, polymerase 3/polymerase acidic, nucleoprotein, matrix, nonstructural protein, and HE gene segments, respectively. We also identified unique features in D/bovine/ France/2956/2012 genome. Forty unique amino acid substitutions were identified throughout the genome, but the limited available data on influenza D genomes make a functional interpretation of the substitutions difficult to determine. In addition, although the HE proteins of human influenza C and C/OK viruses contain 7 and 6 potential glycosylation sites, respectively, D/bovine/ France/2986/2012 has just 5: at positions 28, 54, 146, 346, and 613 (ATG numbering), identical to 5 of the 6 identified for C/OK virus. For influenza A viruses, modifications of N-linked glycosylation sites in the globular head of the hemagglutinin protein have been linked to changes in virulence, antigenicity, receptor-binding preference, fusion activity, and immune evasion (4). For example, an increase in glycosylation site numbers has been associated with early stages of influenza A(H1N1) virus evolution, and changes in the positional conversion of the glycosylation sites have been associated with later evolutionary stages of the virus (5). The missing potential glycosylation site in D/bovine/France/2986/2012 is located at position 513, probably likely in the F3 = HE2 fusion domain of the protein (6) and not in the globular head of the protein. Thus speculating on the putative time course of virus emergence between C/OK-like and D/bovine/ France/2986/2012-like strains is difficult. Further studies are needed to understand the phenotype(s) associated with aa substitutions in influenza D viruses. Webster et al. suggested the existence of a common ancestor for influenza A, B, and C viruses and a more recent common ancestor to influenza A and B viruses only considering the different genome organizations between influenza A/B and influenza C viruses (6). Sheng et al. recently estimated the time of divergence between influenza C and D virus gene segments at 334 years for PB1 to 1,299 years for HE (7) . The time of emergence and evolutionary rate of influenza D viruses need to be examined as more data become available. A puzzling question raised by our current study is the geographic origin of influenza D strains: were cattle in France contaminated by their North American counterparts or vice versa? Did co-evolution occur? Did the pathogen originate from a distinct location or from a distinct host? Retrospective studies with archived samples would help date the emergence of influenza D viruses and enable an understanding of their evolution. In addition, the geographic prevalence still needs to be investigated. The pathogen may have spread to swine and cattle in recent years only; efforts should be made to find the virus host range and its reservoir species and to evaluate the public health relevance of this new pathogen. Finally, surveillance projects with larger cohorts, as well as experimental infections, need to be conducted before 1) the causality between respiratory symptoms and influenza D virus infection in cattle can be established, 2) recommendations on samples to collect can be given, and 3) prevalence can be compared in different geographic areas. Although the causative agent(s) of some respiratory infections in the field remain(s) unknown (G. Meyer, pers. comm.) and although 2 of the positive specimens in our study originated from young cattle with respiratory symptoms but no identified respiratory pathogen, further studies are also warranted to provide an understanding of the pathobiology of influenza D virus in cattle and its putative role in complex bovine respiratory disease. AGCATAAGCAGGAGATTTTCAAAG FluD_HE-745R: GCACTACATGCTTGTTGC FluD_HE-667F: GTTTGTGGGACTGAGCAATC FluD_HE-1350R: CCCTGCTTGCGGTATTATC FluD_HE-1267F: CCCAAGTATGGCAGATG fluD_HE-2042R: GCAAGGAGATTTTTTCTAAGATT Matrix FluD-MP-8F: GCAGAGGATATTTTTGACGC FluD-MP-670R: CCCATATGCTATTCTTGCCAG FluD-MP-602F: AAAAAAGAGGCCCAGGCAC FluD-MP-1212R: GCAAGAGGATTTTTTCGCG Nucleoprotein FluD-NP-1F: GGCATAAGCAGGAGATTATTAAGC FluD-NP-949R: TAAAGGCTCTTACTCCAGAATA FluD-NP-849F: GCCTTGGTCAATGTGGCTG FluD-NP-1717R: GGGGACTGCAACAGAACCA Nonstructural protein FluD-NS-8F: GCAGGGGTGTACAATTTCAAT FluD-NS-804R: TCGAAACTGACTTGATTTCATCC Polymerase 3 GGCATAAGCAGGAGATTTA FluD-P3-759R: TTTTCTTCTAGATGTTCCAGTTTGA FluD-P3-677F: AAAAGAAATCAGGCTGAATGC FluD-P3-1467R: CCAAACAAACAGTCAGTTGA FluD-P3-1394F: CCCGGAAAGGTCAAGATAG FluD-P3-2184R: GGAGATTTTTAACATTACAAGGCC Polymerase basic 1 GGCATAAGCAGAGGATTTTAT FluD-PB1-736R: TTTTCCTCTTTCTCCGTC FluD-PB1-631F: AAAAATGAAGTCTCCAACATTG C/OK-Rev ) FluD-PB1-2317R: GATTTTTCTGTTATTAAACAACGC Polymerase basic 2 FluD-PB2-1F: GGCATAAGCAGAGGATGTC FluD-PB2-882R: CCCTTATCTTCTCTGCTGG FluD-PB2-796F: AAAAGAAGAGAGATGTTAGAGC FluD-PB2-1776R: TTTTACCCATTATCAAAGCAGG FluD-PB2-1724F: GAAAGAATAAACACTGATGATG FluD-PB2-2353R: GAGGATTTTTTCAATGTGCTTC Characterization of a novel influenza virus in cattle and swine: proposal for a new genus in the Orthomyxoviridae family Identification of a potential novel type of influenza virus in Bovine in China Isolation of a novel swine influenza virus from Oklahoma in 2011 which is distantly related to human influenza C viruses N-linked glycosylation in the hemagglutinin of influenza A viruses Glycosylation site alteration in the evolution of influenza A (H1N1) viruses Structure of the haemagglutinin-esterasefusion glycoprotein of influenza C virus Evolution and ecology of influenza A viruses Genomic and evolutionary characterization of a novel influenza-C-like virus from swine We thank the Plateau de Génomique GeT-Purpan, Unité Différenciation épidermique et auto-immunité rhumatoïde, Unité Mixte de Recherche 5165, Centre National de la Recherche Scientifique/Université Paul Sabatier, Centre Hospitalier Universitaire de Purpan, Toulouse (France) for the sequencing work.