key: cord-0001763-6c6cw80p
authors: Chen, Jhih-Si; Li, Hui-Chun; Lin, Shu-I; Yang, Chee-Hing; Chien, Wan-Yu; Syu, Ciao-Ling; Lo, Shih-Yen
title: Cleavage of Dicer Protein by I7 Protease during Vaccinia Virus Infection
date: 2015-03-27
journal: PLoS One
DOI: 10.1371/journal.pone.0120390
sha: 3faebf3f78e4b42abd134372119fde0ed298fa4b
doc_id: 1763
cord_uid: 6c6cw80p

Dicer is the key component in the miRNA pathway. Degradation of Dicer protein is facilitated during vaccinia virus (VV) infection. A C-terminal cleaved product of Dicer protein was detected in the presence of MG132 during VV infection. Thus, it is possible that Dicer protein is cleaved by a viral protease followed by proteasome degradation of the cleaved product. There is a potential I7 protease cleavage site in the C-terminus of Dicer protein. Indeed, reduction of Dicer protein was detected when Dicer was co-expressed with I7 protease but not with an I7 protease mutant protein lack of the protease activity. Mutation of the potential I7 cleavage site in the C-terminus of Dicer protein resisted its degradation during VV infection. Furthermore, Dicer protein was reduced dramatically by recombinant VV vI7Li after the induction of I7 protease. If VV could facilitate the degradation of Dicer protein, the process of miRNA should be affected by VV infection. Indeed, accumulation of precursor miR122 was detected after VV infection or I7 protease expression. Reduction of miR122 would result in the suppression of HCV sub-genomic RNA replication, and, in turn, the amount of viral proteins. As expected, significant reduction of HCVNS5A protein was detected after VV infection and I7 protease expression. Therefore, our results suggest that VV could cleave Dicer protein through I7 protease to facilitate Dicer degradation, and in turn, suppress the processing of miRNAs. Effect of Dicer protein on VV replication was also studied. Exogenous expression of Dicer protein suppresses VV replication slightly while knockdown of Dicer protein does not affect VV replication significantly.

MicroRNAs (miRNAs) are a group of small noncoding RNAs about 22 nt in length that downregulate gene expression by either of the two posttranscriptional mechanisms: mRNA cleavage or translational repression [1] . miRNAs have been implicated in a vast array of cellular processes including cell differentiation, proliferation and apoptosis [2] . Links between miRNAs and To clone the plasmid expressing pre-miR122, cDNA library derived from HuH7 cells was used as template and forward and reverse PCR primers (5'GGAATTCGGAGTGTGA CAATGGTGTTTG 3' and 5'GCTCTAGATTTAGTGTGATAATGGCGTTTG 3') were used to amplify the gene fragment. After PCR, the DNA fragment was digested by restriction enzymes (EcoRI/XbaI) and cloned into the expression vector pcDNA3 (linearized by EcoRI/XbaI).

All of the expression plasmids were verified by sequencing.

Vaccinia virus WR strain [28] was used to infect HeLa and HuH 7 cells in this study, following previously published procedures for virus amplification and plaque assay [22, 29] . Cytosine arabosinide (ara C), where used, was added to the cells at a concentration of 40 μg/ml. Recomninant virus vI7Li, a gift kindly provided by Dr. Bernard Moss, was also used to infect HeLa cells following previously published procedures [30] . Influenza A virus WSN33 was used to infect MDCK cells following previously published procedures for virus amplification and plaque assay [31] .

Our previous procedures were followed for WB analysis [23, 26, 32] . The primary antibodies used for the analyses in this study were mouse monoclonal antibodies against the C-terminus (a.a. 1813-1912) of Dicer (M01, clone 2F12, Abnova, Taiwan), against the a.a. 378-385 of Dicer (clone 5D12.2, Millipore, USA), against T7 tag (Novagen, USA), against HCV NS5A protein (Biodesign, USA), against V5 tag (Serotec, USA) and rabbit polyclonal antibodies against ERK-2 protein (Santa Cruz Biotechnology, USA), against NPT protein (Upstate, USA), against β -actin (GeneTex, CA, USA) and against I7 protein (a gift kindly provided by Dr. Bernard Moss). Usually, 200 ug protein is enough for the WB analysis. However, due to the insensitivity of the antibodies against the C-terminus of Dicer, 800 ug protein is needed to detect the endogenous Dicer protein. When this antibody was used to detect exogenous T7-Dicer protein from expressing plasmid, the endogenous Dicer protein could not be detected.

Real-time reverse transcriptase-polymerase chain reaction (real-time RT-PCR) Total RNAs extracted from HeLa or HuH7 cells (mock or vaccinia virus infection) were converted into cDNAs using oligo-dT as the primer. Our previous procedures were followed for real-time RT-PCR [22, 33] . Specific primers identical to those used in the Takamizawa's report were used to detect precursor miRNA122 and U6 RNA [34] . Primers (5' TGGAGACGCCAA TAGCAATA 3' and 5' TGCTGCTGCAGTGAATTCTT 3') were used to detect Dicer mRNA while primers (5'CGCTGGTCAGTTCGTGATTA 3' and 5'AACTCAGGCCCATTTCCTTT 3') were used to detect TFRC mRNA as a control.

Experiments were performed three times. Data were analyzed using student t test. P<0.05 was considered statistically significant (p<0.05, Ã ; p<0.01, ÃÃ ; p<0.001, ÃÃÃ ).

The amount of endogenous Dicer protein was reduced after VV infection in HeLa cells as detected by antibodies against its extreme C-terminus (lanes 1 and 2, Fig. 1A ). This reduction could be recovered after AraC, an inhibitor of VV DNA replication, was added after virus infection (lane 3, Fig. 1A ). Unlike the TFRC mRNA decreased after VV infection in a dose dependent manner, the Dicer mRNA level, though decreased, was not specifically reduced after VV infection ( Figure SIA in S1 File). Exogenously expressed Dicer protein with a T7 tag at its N-terminus was also reduced after VV but not influenza A virus infection in HeLa cells as detected by antibodies against its extreme C-terminus (Fig. 1B) . A smaller protein with tiny amount was detected using antibodies against T7 tag at the N-terminus of this fusion protein (lane 3, left panel of Fig. 1C ). This smaller protein was also detected after addition of MG132, an inhibitor of proteasome degradation, after virus infection (lane 7, right panel of Fig. 1C ).

The amount of endogenous Dicer protein was also reduced after VV infection in HuH7 cells (Fig. 1D) . Again, unlike the TFRC mRNA, the mRNA level of Dicer, though reduced, was not specifically reduced after VV infection in these cells ( Figure SIB in S1 File). Similar results were found in HCV replicon cells (data not shown, also see below), which are derived from HuH7 cells with HCV subgenomic RNAs [25] .

It is possible that during VV infection Dicer protein is cleaved by a viral protease at the Cterminus and the cleaved products are then degraded by proteasome degradation pathway. VV G1 protein, a predicted metalloprotease, is essential for the morphogenesis of infectious virions but not for the cleavage of major core proteins [35] . In addition, I7 protease is responsible for processing most or all viral core and membrane proteins in the late stage of VV life cycle [30, 36, 37] . These proteolytic events are involved in the transformation of immature virions into mature virions. There are five predicted cleavage sites for I7 protease (AG/X) in Dicer protein sequence. Therefore, I7 protease may involve in the cleavage of Dicer protein. To address this issue, I7 protease gene was cloned and expressed (Figure SII in S1 File). When co-expressed with I7 protease, exogenously expressed Dicer protein was reduced as detected using antibodies against the extreme C-terminus of Dicer protein ( Fig. 2A, lanes 2 and 3) . When MG132 was added, full-length Dicer protein was increased in the absence of I7 protease ( Fig. 2A , lanes 2 and 4) while it was further reduced in the presence of I7 protease ( Fig. 2A , lanes 3-5) as detected using antibodies against the extreme C-terminus of Dicer protein. The same samples were analyzed using antibodies recognizing the N-terminal T7 tag of Dicer protein. A band with smaller size was detected in the presence of MG132 when Dicer and I7 proteins were coexpressed (Fig. 2B, lanes 2 and 3) . Expression of I7 protease could only be detected by Western blotting analysis in the presence of MG132 to stabilize this labile protein (lane 5, Fig. 2A) . The plasmid expressing a mutant I7 protease lack of the protease activity was constructed by replacing amino acid residue 328 from Cys to Ala [30] . Reduction of Dicer protein was not detected when it was co-expressed with this mutant I7 protein (Fig. 2C) .

Five potential viral I7 protease cleavage sites in Dicer protein are after a.a. 13, 323, 465, 1079 and 1817. It is possible that Dicer protein was cleaved by I7 protease after a.a. 1817, and the cleaved protein (about 199 kDa) was further degraded through proteasome ubiquitin degradation pathway (Fig. 2D ). To this end, a plasmid expressing the Dicer protein with mutation in a.a. 1816 and 1817 was constructed. Compared with the wild-type Dicer protein, the protein amount of mutated Dicer protein was no longer reduced after VV infection (Fig. 2E ).

To further demonstrate the reduction of Dicer protein by VV infection was through I7 protease, a recombinant VV vI7Li expressing I7 protease protein under IPTG regulation was used [30] . Indeed, Dicer protein was reduced dramatically by recombinant VV vI7Li after but not before the induction of I7 protease (Fig. 3) .

Pre-miRNAs transited by exportin-5 to the cytoplasm were cleaved by Dicer protein to generate miRNAs. Thus, the degradation of Dicer protein should block the formation of miRNAs and results in the accumulation of pre-miRNAs during VV infection. miRNA repertoires are highly cell type specific and change markedly during development or upon cell activation [14] . miR122 is abundant in HuH7 cells [38] . To determine the effect of VV infection on the miRNA processing, the endogenous pre-miR122 level was analyzed in HuH7 cells after VV infection. As expected, the endogenous pre-miR122 level was increased after VV infection in a dose dependent manner (Fig. 4A) . Similar results were found in HCV replicon cells after VV infection (data not shown, also see below). miR122 is scarce in HeLa cells. The plasmid expressing pre-miR122 was constructed and transfected into HeLa cells. The exogenous pre-miR122 level was analyzed in HeLa cells after VV infection. Again, the exogenous pre-miR122 level was increased after VV infection in a dose dependent manner (Fig. 4B) while the Dicer mRNA level was not affected significantly ( Figure SIA in S1 File). The exogenous pre-miR122 level was also analyzed in HeLa cells cotransfected with the plasmids expressing pre-miR122 and I7 protease. The exogenous pre-miR122 level was also increased in the presence of I7 protease in a dose dependent manner (Fig. 4C) while the Dicer mRNA level was not affected by I7 protease (Figure SIC in S1 File).

It has been previously reported that miRNA122 could facilitate HCV replication [38, 39] . Degradation of Dicer protein would reduce the production of miRNA122 and, in turn, should repress the HCV RNA replication. Thus, the replication of HCV subgenomic RNA, and in turn the amount of proteins encoded from this RNA, should be reduced in HCV replicon cells after VV infection [33] . Indeed, the HCV NS5A and core-NPT protein levels were suppressed, accompanying with the reduction of Dicer protein in HCV replicon cells after VV infection in a dose dependent manner (Fig. 5A) . The plasmid expressing I7 protease was also transfected into the HCV replicon cells. As expected, accompanying with the reduction of Dicer protein, the HCV NS5A and core-NPT protein levels were suppressed in a dose dependent manner (Fig. 5B) . Again, expression of I7 protease could only be detected by Western blotting analysis in the presence of MG132 to stabilize this labile protein (lane 6, Fig. 5B ).

To determine the effect of Dicer protein on VV replication, the gain-of-function (overexpression of Dicer) and loss-of-function (knockdown of Dicer) assays were performed. Exogenously expressed Dicer protein suppressed viral protein amount (e.g., A type inclusion protein) inside the cells slightly (Fig. 6A) and also reduced the number of the secreted viral particles in the medium to around 60% (Fig. 6B) . The number of secreted viral particles was further reduced when the Dicer protein with mutations in a.a. 1816 and 1817 was exogenously expressed 5, and 10) . Twenty-four hrs after infection, mRNAs were extracted and converted into cDNA. Then, real-time PCR assay was performed to detect the amount of miR122 using U6 mRNA as the internal control for normalization. (C) HeLa cells were mock-transfected or cotransfected with the plasmids expressing pre-miR122 and I7 protease with the indicated amount. Forty-eight hrs after transfection, mRNAs were extracted and converted into cDNA. Then, real-time PCR assay was performed to detect the amount of miR122 using U6 mRNA as the internal control for normalization. (p<0.05, *; p<0.01, **; p<0.001, ***). 

Our results in this study showed that Dicer protein was reduced in VV-infected cells (Fig. 1) , and in turn, the processing and the function of miR122 were blocked (Figs. 4 and 5) . Reduction of Dicer protein should affect the processing of universal miRNAs. Indeed, a recent report indicated that Dicer protein was suppressed in VV-infected cells that was associated with a universal reduction of host miRNAs expression [20] . miRNAs have been implicated in a vast array of cellular processes including cell proliferation and apoptosis [2] . Thus, reduction of Dicer protein during VV infection is probably one of the many factors responsible for the viral pathogenesis.

Reduction of Dicer protein in VV-infected cells (Fig. 1 ) may be caused by several different mechanisms. One possible mechanism is due to mRNA reduction (Figures SIA and SIB in S1 File), which is also reported previously [20] . VV is known to enhance the degradation of host mRNAs by two decapping enzymes encoded by the virus, D9 and D10 [40, 41] . There are still other possible mechanisms. The reduction of Dicer protein during VV infection could be recovered by adding araC to inhibit the VV DNA replication (Fig. 1) . Therefore, in addition to the reduction of Dicer mRNA, a viral protease expressed after VV DNA synthesis is also probably responsible for the reduction of Dicer protein. I7 protease is required for AG/X-specific cleavages of viral membrane and core proteins during VV assembly [30] . Our results further demonstrated that Dicer protein was first cleaved by I7 protease after a.a. 1817 and the cleaved product was then degraded by the proteasome-ubiquitin degradation pathway during VV infection (Figs. 1-3) . Comparing with the I7 protease encoded by VV infection (Fig. 3) , I7 protease derived from expressing plasmid is much more labile because it could only be detected by Western blotting analysis in the presence of MG132 ( Figs. 2A and 5B ). This also indicated that tiny amount of I7 protease should be sufficient for the cleavage of Dicer protein (Figs. 2A and 5B). However, Dicer protein was reduced after the induction of I7 protease protein in the presence of more than 50 uM IPTG but not in less than 50 uM IPTG (Fig. 3) , indicating that not only the tiny amount of I7 protease but also other factors (e.g., whether I7 protease interacts with Dicer protein or not) are important to cleave Dicer protein and facilitate its degradation.

There are many different ways of interactions between viruses and miRNAs. Firstly, host miRNAs could suppress or facilitate viral replication [5, 6, 38] . Secondly, many DNA viruses, including herpesviruses, adenovirus, polyomaviruses and papillomavirus, have evolved to encode viral miRNAs to potentially control various phases of the viral life cycle, such as latency, reactivation, replication, etc. [42] [43] [44] [45] [46] . We do not expect VV would encode its viral miRNAs, similar to those typical cellular miRNAs, because this virus is replicated in the cytoplasm. Thirdly, both our present study and Dr. Grinberg's report [20] showed that a suppression of host miRNA expression was followed by the reduction of Dicer protein during VV infection. Other DNA viruses may not suppress Dicer protein since this would affect the processing of their own viral miRNAs. Therefore, it is not surprising that VV, different from the other DNA viruses, uses a novel way to interact with miRNAs.

RNAi could serve as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway [17] . Several mammalian viruses contain viral proteins with RSS activity, that usually involved two mechanisms: Dicer binding and siRNA binding [16] . The results of this study indicated that I7 protease of VV could cleave Dicer protein to facilitate Dicer degradation. Thus, VV I7 protease possesses RSS activity with a novel mechanism.

Suppression of VV replication slightly was demonstrated by exogenous expression of Dicer protein ( Fig. 6A and 6B) . However, knockdown of Dicer protein did not facilitate VV replication significantly (Fig. 6C and 6D ). This may be simply due to the efficient cleavage of Dicer protein during VV infection (Figs. 1 and 2) .

In conclusion, results in this study indicate that, during VV infection, the cleavage of Dicer protein by I7 protease facilitates Dicer degradation, and in turn, suppresses the processing of miRNAs. 

Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight?

MicroRNAs: genomics, biogenesis, mechanism, and function

microRNA functions

The role of RNAi and microRNAs in animal virus replication and antiviral immunity

RNAi and cellular miRNAs in infections by mammalian viruses

Dicing with viruses: microRNAs as antiviral factors

Processing of primary microRNAs by the Microprocessor complex

Nuclear export of microRNA precursors. Science

Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs

Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans

A role for the RNase III enzyme DCR-1 in RNA interference and germ line development in Caenorhabditis elegans

A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA

Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing

Origins and Mechanisms of miRNAs and siRNAs

RNAi in the regulation of mammalian viral infections

Viral RNA silencing suppressors (RSS): novel strategy of viruses to ablate the host RNA interference (RNAi) defense system

RNAi suppressors encoded by pathogenic human viruses

Role of RNA interference (RNAi) in dengue virus replication and identification of NS4B as an RNAi suppressor

Poxviridae: The Viruses and Their Replication

Vaccinia virus infection suppresses the cell microRNA machinery. Arch Virol

Degradation of host microRNAs by poxvirus poly(A) polymerase reveals terminal RNA methylation as a protective antiviral mechanism

Increased ATP generation in the host cell is required for efficient vaccinia virus production

Characterization of the cleavage of signal peptide at the C-terminus of hepatitis C virus core protein by signal peptide peptidase

Hepatitis C virus non-structural protein 3 interacts with cytosolic 5'(3')-deoxyribonucleotidase and partially inhibits its activity

Reactive oxygen species suppress hepatitis C virus RNA replication in human hepatoma cells

Enterovirus type 71 2A protease functions as a transcriptional activator in yeast

Role for a bidentate ribonuclease in the initiation step of RNA interference

Vaccinia virus 4c (A26L) protein on intracellular mature virus binds to the extracellular cellular matrix laminin

Comparison of methods for detection of vaccinia virus in patient specimens

Role of the I7 protein in proteolytic processing of vaccinia virus membrane and core components

Rescue of influenza A virus from recombinant DNA

SARS-CoV nucleocapsid protein interacts with cellular pyruvate kinase protein and inhibits its activity

Visualization of the structures of the hepatitis C virus replication complex

Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res

Vaccinia virus G1 protein, a predicted metalloprotease, is essential for morphogenesis of infectious virions but not for cleavage of major core proteins

The vaccinia virus I7L gene product is the core protein proteinase

Molecular dissection of the vaccinia virus I7L core protein proteinase

Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA

Liver-specific microRNA miR-122 enhances the replication of hepatitis C virus in nonhepatic cells

Characterization of a second vaccinia virus mRNA-decapping enzyme conserved in poxviruses

Vaccinia virus D10 protein has mRNA decapping activity, providing a mechanism for control of host and viral gene expression

Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells

Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed

The functions of herpesvirus-encoded microRNAs

Identification of virus-encoded micro-RNAs

Identification and function of human cytomegalovirus microRNAs

We thank Dr. Wen Chang for providing vaccinia virus WR strain, Dr. G.J. Hannon for providing the plasmid expressing T7-Dicer, Dr. George G. Brownlee for providing 12 plasmids to generate influenza A virus, Dr. J.-H. Ou for providing the HCV replicon cells and Dr. Bernard Moss for providing recombinant vI7Li and antibodies to I7 protein.

Conceived and designed the experiments: HCL SYL. Performed the experiments: JSC SIL CHY WYC CLS. Analyzed the data: SYL. Wrote the paper: HCL SYL.