key: cord-0001952-a1t74jsm
authors: Eshoo, Mark W.; Carolan, Heather E.; Massire, Christian; Chou, Danny M.; Crowder, Chris D.; Rounds, Megan A.; Phillipson, Curtis A.; Schutzer, Steven E.; Ecker, David J.
title: Survey of Ixodes pacificus Ticks in California Reveals a Diversity of Microorganisms and a Novel and Widespread Anaplasmataceae Species
date: 2015-09-16
journal: PLoS One
DOI: 10.1371/journal.pone.0135828
sha: e658837e4d77ef0bccdd849648e2db595f5ec65b
doc_id: 1952
cord_uid: a1t74jsm

Ixodes pacificus ticks can harbor a wide range of human and animal pathogens. To survey the prevalence of tick-borne known and putative pathogens, we tested 982 individual adult and nymphal I. pacificus ticks collected throughout California between 2007 and 2009 using a broad-range PCR and electrospray ionization mass spectrometry (PCR/ESI-MS) assay designed to detect a wide range of tick-borne microorganisms. Overall, 1.4% of the ticks were found to be infected with Borrelia burgdorferi, 2.0% were infected with Borrelia miyamotoi and 0.3% were infected with Anaplasma phagocytophilum. In addition, 3.0% were infected with Babesia odocoilei. About 1.2% of the ticks were co-infected with more than one pathogen or putative pathogen. In addition, we identified a novel Anaplasmataceae species that we characterized by sequencing of its 16S rRNA, groEL, gltA, and rpoB genes. Sequence analysis indicated that this organism is phylogenetically distinct from known Anaplasma species with its closest genetic near neighbors coming from Asia. The prevalence of this novel Anaplasmataceae species was as high as 21% at one site, and it was detected in 4.9% of ticks tested statewide. Based upon this genetic characterization we propose that this organism be called ‘Candidatus Cryptoplasma californiense’. Knowledge of this novel microbe will provide awareness for the community about the breadth of the I. pacificus microbiome, the concept that this bacterium could be more widely spread; and an opportunity to explore whether this bacterium also contributes to human or animal disease burden.

In the western United States Ixodes pacificus ticks are the vector of Borrelia burgdorferi, the causative agent of Lyme disease [1, 2] . I. pacificus ticks are also vectors for several other vectorborne pathogens including Borrelia miyamotoi and Anaplasma phagocytophilum. In addition, I. pacificus ticks have been shown to carry Spiroplasma ixodetis [3] , a microorganism that has no known role in human disease. Broad-range PCR and electrospray ionization mass spectrometry (PCR/ESI-MS) can detect multiple pathogens in a single test including tick-borne pathogens [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] . PCR/ESI-MS can also detect novel and uncharacterized organisms [10, 12, [15] [16] [17] [18] [19] . We have previously used PCR/ESI-MS to characterize a large collection of ticks, including I. pacificus ticks from California, for the prevalence of B. miyamotoi [6] . Most studies of I. pacificus ticks have employed tests designed to detect single pathogens and not co-infections. In this study we used PCR/ESI-MS to characterize the breadth of microorganisms carried by I. pacificus collected from throughout the state of California. In the ticks analyzed, we detected several previously described endemic zoonotic pathogens as well as Babesia odocoilei, a protozoan not previously known to be carried by I. pacificus. Many of the microbes carried by ticks are obligate intracellular microbes and have not been cultured but have been identified and characterized genetically such as 'Candidatus Rickettsia andeanae', 'Candidatus Rickettsia vini' and 'Candidatus Neoehrlichia mikurensis' [20] [21] [22] [23] . In our study we identified and genetically characterized a novel and widespread Anaplasmataceae species which is genetically most closely related to isolates from Asia.

Broad-range PCR employs PCR primers designed to generate an amplicon from a wide range of microbes. Depending upon the organism(s) present in the sample the resulting amplicons will be comprised of differing composition of bases (the number of A's, G's, C's and T's aka base count). When these amplicons are analyzed by electrospray ionization mass spectrometry the base count of the amplicons can be determined and compared to a database to identify the organism(s) present. Nucleic acid extracts from ticks were screened for tick-borne microorganisms with three variations of a broad-range PCR/ESI-MS assay ( Table 1) . Primer set A includes 16 primer pairs designed to detect and identify a wide and diverse range of bacterial species. Primer set B includes two primer pairs designed to detect all Babesia species [5] . Primer set C consists of nine primer pairs designed to detect a wide range of bacterial and protozoan tickborne pathogens that were previously described [5] . PCR amplicons were analyzed by electrospray ionization followed by time of flight mass spectrometry system (Abbott Laboratories, Des Plaines IL) as previously described [10, 13, 14, [24] [25] [26] [27] .

Tick collection and DNA extraction I. pacificus ticks were collected from 2007 to 2009 in thirteen counties throughout the state of California by flagging (S1 Fig). All ticks tested were adults with the exception of 126 nymphal ticks collected in Sonoma County. All ticks were visually pre-identified as I. pacificus, and the species was confirmed in 96.9% of the ticks tested by the detection of the Rickettsia endosymbiont of I. pacificus [10] . No ethical clearance was required to conduct research on invertebrate ectoparasites. All samples were submitted by private collectors or collected by county vector control agencies from locations that did not require specific permission. These studies did not involve endangered or protected species. Ticks were either alive, frozen, or ETOH preserved prior to DNA extraction using a modified Qiagen column-based protocol described previously [28] with the substitution of the Qiagen DNAeasy columns (Qiagen, Valencia, CA) for the Qiagen Virus MinElute columns (Qiagen, Valencia, CA). A negative extraction control consisting of lysis buffer was included with each set of extractions and carried through the analysis to monitor for potential contamination.

Nucleic acid extracts from three ticks (collected from different California counties) that showed the novel PCR/ESI-MS microorganism signature were selected for further sequence analysis. The 16S rRNA, groEL, gltA, and rpoB genes were sequenced by single molecule real-time DNA sequencing using the RS II DNA sequencer (Pacific Biosciences, Menlo Park CA). In addition, a tick positive for A. phagocytophilum from Placer County, CA was also selected for sequence analysis. The previously published primer pair 27F/1492R was used to amplify a 1,459-bp region of the 16S rRNA gene [29] . The groEL gene was amplified using a primer pair targeting an 851-bp region of the groEL gene present in Anaplasma, 'Candidatus Neoehrlichia', and Ehrlichia species (F-groEL: ATCTCTAAAGCTAAAGCTGCTGG and R-groEL: ACACC AACCTTAAGTACAGCAAC). The gltA gene was amplified using a primer pair derived from the published F4b-R1b primer pair [30] (F-gltA: ACCGGGTTTTATGTCTACTGC and R-gltA: CACGATGACCAAAACCCAT). The rpoB gene was amplified using primers designed to amplify a 600-650-bp region across Rickettsiales (F-rpoB: ATCGTTCCTGTTGAAGATAT GCC and R-rpoB: GCAATGCCCAGCATTCCAT). PCR amplification of the target genes was performed in a 50-μL reaction with 1 unit of Platinum Taq DNA Polymerase High Fidelity, 1x High Fidelity PCR Buffer, 2 mM MgSO 4 , 0.2 mM dNTP mix, and 250 nM of each primer (Life Technologies, Carlsbad, CA). All PCR amplification reactions were performed on the MJ Dyad thermocycler (Bio-Rad Inc., Hercules, CA). The following PCR conditions were used to amplify the 16S rRNA gene locus: 94°C for 2 min, followed by 40 cycles of 94°C for 15 s, annealing at 47°C for 30 s, and 68°C for 2 min for cycle extension. The cycle ended with a final extension of 4 min at 68°C. Amplification of the groEL and gltA loci was performed using the same conditions with the exceptions of a 50°C annealing temperature and a 1.5-min cycle extension time. PCR amplification of the rpoB locus was performed as described for the groEL and gltA loci except that a 1-min extension time was used. PCR products from each sample were purified using the Qiagen MinElute PCR Purification Kit. After purification, libraries were prepared using 500 ng of amplicons and a modified version of Pacific Biosciences library preparation protocol that consisted of end-repair, adapter ligation, and exonuclease treatment of the PCR amplicons. The final sequencing library was purified using the Qiagen MinElute PCR purification kit. One SMRT cell was used to sequence each amplicon library following diffusion loading. Sequencing data were analyzed using Pacific Bioscience's RS_Long_Amplico-n_Analysis.1 protocol in the SMRT Analysis v2.2.0 software package to cluster, error correct, filter out chimeras, and build consensus sequences. Sequences were deposited in GenBank under accession numbers KP276585 to KP276611.

Alignments of the full-length 16S rRNA, gltA, groEL, and rpoB were constructed from representative Anaplasmataceae sequences using data from complete genomes or type strains. Sequences GU075704 and JN715833 were identified by preliminary BLAST searches as the closest relatives of the novel Anaplasmataceae species and were included in the ribosomal alignment. Sequence alignments were generated using ClustalW and were manually curated using secondary structure pairing constraints with Bioedit software [31] (S1, S2, S3 and S4 Alignments) to yield, after exclusion of the primer sequences and non-conserved indels, ungapped alignments for 16S rRNA (1,347 bp, N = 26 sequences), groEL (804 bp, N = 23), gltA (720 bp, N = 23) and rpoB (555 bp, N = 19) (S1, S2, S3 and S4 Text). Identity score matrices were generated with Bioedit from the curated alignments (S1, S2, S3 and S4 Data). Phylogenetic analyses were performed using the online program suite at www.Phylogeny.fr using the "A la Carte" menu [32] on the curated alignments. Maximum-likelihood trees were constructed as described [33, 34] and edited using TreeDyn [35] .

A total of 982 individual ticks were tested by broad-range PCR/ESI-MS for the presence of tick-borne pathogens and other microorganisms. All ticks tested were adults except for 126 nymphal ticks collected at a single site in Sonoma County. The summary of the non-endosymbiont microorganism detections is reported in Table 2 . The Rickettsia endosymbiont of I. pacificus [10] was detected in 96.9% (952/982) of the ticks tested (Table 3) , confirming the tick Alameda Lake Temescal regional recreation area species assignments. In addition to the endosymbiont, at least one tick-borne microorganism was detected in 14.9% of the ticks surveyed (146/982), with co-infections detected in 1.2% of the ticks ( Table 2) . Though our Babesia primers are able to detect a wide range of Babesia species, the only species detected in California ticks was B. odocoilei, found in 3% (18) of the 574 ticks tested for Babesia. Not all of the specimens were tested due to limited nucleic acid extracts. This organism is known to be transmitted by Ixodes scapularis but has not previously been detected in I. pacificus ticks. Borrelia miyamotoi was found in 2% of the ticks tested, which we have previously reported [6] . Borrelia burgdorferi was found in 1.4% of the ticks, consistent with infection rates that have been reported by others [36] . In this study, Anaplasma phagocytophilum was detected in only 3 of the 982 ticks tested. Two of the A. phagocytophilum-positive ticks came from the same site in Placer County and the third detection was in a B. burgdorferi co-infected tick from Marin County. Spiroplasma ixodetis was found in 2% (16/770) of the ticks tested using the primer set that detects this organism. In addition to the Rickettsia endosymbiont of I. pacificus, 37 ticks tested yielded a PCR/ESI-MS base count signature similar, but not identical, to that of a spotted fever group Rickettsia species ( Table 3) . Though these signatures are highly consistent with one or more Rickettsia species, further analysis is needed to confirm the identity.

The most prevalent non-endosymbiont was a novel bacteria found in 4.9% (48/982) of the ticks tested. Ticks from China Camp State Park in Marin County had the highest observed infection rate of 22% (7/33) for this organism. The bacterium was detected in ticks collected throughout the state with detections in ticks collected in Aliso & Wood Canyons Wilderness Park in Orange County and at Patrick Creek in Del Norte County in the far northern part of the state. The PCR/ESI-MS signature of this novel bacterium was similar to that of A. phagocytophilum ( Table 3) . Given the breadth of coverage provided by the primer pairs used in the PCR/ESI-MS assay, this signature is consistent with the detection of a novel Anaplasmataceae species. Three representative tick samples containing this signature (samples CP-1, MR-9, and CC-14 from Napa, Placer, and Marin Counties, respectively) were selected for DNA sequence analysis. We also selected for sequencing one of the three ticks positive for A. phagocytophilum (sample MR-23 from Placer County) for sequencing. The four loci sequenced, the 16S rRNA gene, gltA, groEL and rpoB, were chosen to clarify the relationship of the novel species with named Anaplasma, Ehrlichia and 'Candidatus Neoehrlichia' species.

Phylogenetic trees were constructed based on the four sequenced genes and publicly available sequences of representative Anaplasmataceae and more distantly related Rickettsiales ( Fig  1A-1D) . The four single gene trees are largely congruent and show previously established features like the monophyly of the genera Anaplasma, Ehrlichia, and 'Candidatus Neoehrlichia' [23, 37] . The split of Anaplasma species into two branches is also shown in the 16S rRNA, groEL and gltA trees, where all named Anaplasma species are represented [38] . Minor differences are observed within the exact branching order of species within the established clades, in particular for A. bovis [39] . Each tree firmly places the novel Anaplasmataceae microorganism on the branch leading to the Anaplasma clade [37] . The four gene sequences of the A. phagocytophilum isolate (MR-23) had 99.4% to 100% identity to the A. phagocytophilum genome sequence (GenBank NC_007797). The observed deviations from the reference genome sequence in the 16S rRNA gene (1 SNP) and gltA (2 SNPs) were shared with independent sequences of California isolates of A. phagocytophilum (AF172167, AF304137), suggesting that these differences are mostly likely unique to isolates from California.

The sequences of the genes from the three samples of the novel Anaplasmataceae shared 99.5% to 100% sequence identity, confirming the detection of a common species in the three samples. The closest 16S rRNA sequence found in GenBank (98.0% identity or 1320/1347 identical positions) came from an uncultured Anaplasma sp. isolated from Haemaphysalis longicornis ticks from Jeju Island, Korea (accession numbers GU075699 to GU075704) [40] and Beijing, China (JN715833) (Fig 1) . No groEL, gltA, or rpoB sequence is currently available for those isolates. The 16S rRNA sequence from our novel Anaplasmataceae bacterium shared 93.4% to 94.2% identity with characterized Anaplasma species and 91.1% to 91.6% identity with characterized Ehrlichia species (Fig 1A) . In comparison, previously characterized Anaplasma species share over 95.2% identity across the 16S rRNA gene and only 90.4% to 92.9% identity with Ehrlichia species. The groEL, gltA, and rpoB sequences from the novel microorganism had relatively low homology with other sequences in GenBank; the groEL sequences were slightly more similar to Ehrlichia than to Anaplasma sequences. Accordingly, the four gene trees place the novel California isolate (together with the related Chinese and Korean clones for 16S rRNA) on an intermediate branch that predates the radiation of all validated Anaplasma species (Fig 1A-1D) . Phylogenetic analysis of the Rickettsia endosymbiont of I. pacificus

In our next generation DNA sequencing of the four ticks with Anaplasma we also determined the sequences of the Rickettsia endosymbiont 16S rRNA (GI: KP276589, KP276590 and KP276591), gltA (GI: KP276596, KP276597, KP276598, and KP276599), and rpoB (GI: KP276608, KP276609, KP276610, and KP276611) loci from four ticks. The groEL locus was not sequenced as it was not amplified due to primer design. No sequence variation was detected in the four tick specimens sequenced, and the sequences of the I. pacificus endosymbiont shared 100% identity with the recently published genome sequence. (Fig 1A-1D ).

In this study of the microorganisms carried by I. pacificus ticks, we found B. burgdorferi and B. miyamotoi at frequencies consistent with those found by others [41] . Our broad-range PCR primers are capable of detecting and distinguishing a wide range of Borrelia species including B. americana, B. bissettii, and B. californiensis previously detected in I. pacificus ticks [42] [43] [44] . Only B. miyamotoi and B. burgdorferi were observed in this study. As the study was performed over the course of several years, we were able to improve the throughput of the assay by reducing the number of primers used from 16 to 8 without affecting sensitivity or breadth of coverage for tick-borne pathogens. This is the first observation of the protozoan parasite Babesia odocoilei in I. pacificus ticks. We detected this organism in 3.0% of the ticks tested from areas ranging from Humboldt County in the far northern part of California to San Bernardino County in Southern California, indicating that this pathogen is probably widespread among its known Cervidae and Bovidae hosts [45] in the state. B. odocoilei is known to be widely distributed in I. scapularis ticks throughout the eastern United States [45, 46] , where it is has been reported from as far north as Saskatchewan, Canada [47] to as far south as Tennessee [48] and is not known to cause human illness.

Approximately 4% of the ticks were infected with a microorganism with a base count signature consistent with a spotted fever group Rickettsia that was distinct from the characterized Rickettsia endosymbiont of I. pacificus. Further analysis is needed to determine whether this signature represents a novel spotted fever group Rickettsia or a genotypic variant of a known species.

Other than the endosymbiont, the most prevalent organism we found in the ticks was a previously undescribed Anaplasmataceae species; the base count signature of this novel species was detected in 4.9% of ticks analyzed. Analyses of the 16S rRNA gene, groEL, gltA, and rpoB sequences from three samples concur to place this novel organism in the Anaplasma/Ehrlichia/ 'Candidatus Neoehrlichia' clade, in a position ancestral to all known Anaplasma species. The 16S rRNA sequence was found to share a maximum of 94.2% identify with any named Anaplasma species (Anaplasma platys isolate Okinawa, AY077619), well below the threshold of 97% conservatively associated with distinct species. Indeed, this less than 95% homology indicates a distinct genus may also be warranted [49] . As different bacterial clades may evolve at differing rates it is important to look at the clade of interest and determine the precedence for establishing new genera. In the examination of the family Anaplasmataceae the now wellestablished 'Candidatus Neoehrlichia' taxon was recognized as a genus distinct from the related Ehrlichia genus following analysis of the 16S rRNA gene and groEL sequences [50] . With the recognition of a second 'Candidatus Neoehrlichia' species and further sequencing of the gltA and rpoB genes, the 'Candidatus Neoehrlichia' and Ehrlichia genera share an average sequence identity of 93.4%, 88.2%, 59.5% and 86.4% across 16S rRNA, groEL, gltA and rpoB (S1, S2, S3 and S4 Data). In comparison, the average identity computed between the novel California isolate and the established Anaplasma species is 93.6%, 84.7%, 58.6% and 83.0% across the same loci. In other words, the divergence seen between the California isolate and all named Anaplasma species is greater than the divergence seen between the established genera Ehrlichia and 'Candidatus Neoehrlichia', therefore providing strong phylogenetic evidence for the recognition of a new taxon at the genus level.

A survey of available 16S rRNA gene sequences for uncharacterized Anaplasmataceae led to the identification of several 16S rRNA sequences that are closely related to our novel Anaplasmataceae species, suggesting that this new genus may be globally widespread. For example, isolates from Korea and China with near full-length 16S sequences were found to have the closest identity to our isolate at 97.9%. Several groups have reported finding "Anaplasma-like" partial 16S rRNA gene sequences in ticks and animals. Though these available 16S sequences are comparatively short (~200-274 nt), they show higher levels of homology to our novel Anaplasmataceae than to named Anaplasma species. For example, GenBank sequence GU734325, obtained from an extract from an Ixodes ricinus tick collected in the outskirts of Paris [50] , has 270/274 identity (98.6%) with the 16S sequence of our novel Anaplasmataceae. Moreover, this same sequence was also identified in a survey of tick populations in Tunisia and Morocco (GenBank AY672415, AY672420) [51] and in a survey of rodents from Slovakia (GenBank EF121953, EF121954) [52] . These studies hint at the dissemination in East Asia, Europe, and North Africa of at least two novel Anaplasmataceae species more closely related to the novel California species than to characterized Anaplasma species. In summary, the evidence presented indicates that the bacterium identified in the present study represents a lineage distinct from known Anaplasma species. In agreement with the guidelines for the provisional naming of partially characterized species [53] , we propose the name 'Candidatus Cryptoplasma californiense 'which should provide a clearer basis for future species recognition and naming. Further studies are needed to culture this organism and to determine its range of hosts. the California Department of Public Health Vector Borne Disease Section for collection of the California I. pacificus ticks. We would like to thank Jianmin Zhong at California State University Humboldt and Sylviane Schwarz for ticks from Humboldt County. We would also like to thank Anne Kjemtrup from the California Department of Public Health for comments and Stephen Dumler from the University of Maryland for useful comments and edits. We would also like to acknowledge Jacqueline Wyatt from J & L Scientific Editing for editing of this manuscript. This work was supported by National Institutes of Health grant number 2R44AI077156 and Abbott. 

Lyme disease in California: interrelationship of ixodid ticks (Acari), rodents, and Borrelia burgdorferi

The western black-legged tick, Ixodes pacificus: a vector of Borrelia burgdorferi

Spiroplasma ixodetis sp. nov., a new species from Ixodes pacificus ticks collected in Oregon

Xenodiagnosis to detect Borrelia burgdorferi infection: a first-in-human study

Broad-range survey of tick-borne pathogens in Southern Germany reveals a high prevalence of Babesia microti and a diversity of other tick-borne pathogens

Prevalence of Borrelia miyamotoi in Ixodes ticks in Europe and the United States

Achieving molecular diagnostics for Lyme disease

Identification and typing of Francisella tularensis with a highly automated genotyping assay

Detection of Plasmodium vivax in a child returning from India by use of broad-range PCR and electrospray ionization mass spectrometry

Identification of endosymbionts in ticks by broad-range polymerase chain reaction and electrospray ionization mass spectrometry

Direct molecular detection and genotyping of Borrelia burgdorferi from whole blood of patients with early Lyme disease

Rapid identification of vector-borne flaviviruses by mass spectrometry

Detection and identification of Ehrlichia species in blood by use of PCR and electrospray ionization mass spectrometry

Genotypic variation and mixtures of Lyme Borrelia in Ixodes ticks from North America and Europe

Identification and characterization of Francisella species from natural warm springs in

Global surveillance of emerging Influenza virus genotypes by mass spectrometry

Rapid identification of emerging infectious agents using PCR and electrospray ionization mass spectrometry

Direct broad-range detection of alphaviruses in mosquito extracts

Rapid identification of emerging pathogens: coronavirus

Phylogenetic analysis of a novel molecular isolate of spotted fever group Rickettsiae from northern Peru: Candidatus Rickettsia andeanae

Genetic characterization of Candidatus Rickettsia vini

Molecular identification of Ehrlichia species and 'Candidatus Neoehrlichia mikurensis' from ticks and wild rodents in Shizuoka and Nagano Prefectures

Ultrastructure and phylogenetic analysis of 'Candidatus Neoehrlichia mikurensis' in the family Anaplasmataceae, isolated from wild rats and found in Ixodes ovatus ticks

Rapid identification and strain-typing of respiratory pathogens for epidemic surveillance

New technology for rapid molecular diagnosis of bloodstream infections

The Ibis T5000 universal biosensor: an automated platform for pathogen identification and strain typing

Detection of heartworm infection in dogs via PCR amplification and electrospray ionization mass spectrometry of nucleic acid extracts from whole blood samples

Extraction of total nucleic acids from ticks for the detection of bacterial and viral pathogens

16S ribosomal DNA amplification for phylogenetic study

Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia

BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT

Phylogeny.fr: robust phylogenetic analysis for the non-specialist

A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood

Approximate likelihood-ratio test for branches: A fast, accurate, and powerful alternative

TreeDyn: towards dynamic graphics and annotations for analyses of trees

Differences in prevalence of Borrelia burgdorferi and Anaplasma spp. infection among host-seeking Dermacentor occidentalis, Ixodes pacificus, and Ornithodoros coriaceus ticks in northwestern California

Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophila

Human infection with a novel tick-borne Anaplasma species in China: a surveillance study

The phylogenetic position of Anaplasma bovis and inferences on the phylogeny of the genus Anaplasma

Genetic Identification and Phylogenetic Analysis of Anaplasma and Ehrlichia Species in Haemaphysalis longicornis Collected from Jeju Island

Large Scale Spatial Risk and Comparative Prevalence of Borrelia miyamotoi and Borrelia burgdorferi Sensu Lato in Ixodes pacificus

Eco-epidemiological factors contributing to the low risk of human exposure to ixodid tick-borne borreliae in southern California, USA

Delineation of a new species of the Borrelia burgdorferi Sensu Lato Complex, Borrelia americana sp. nov

Multilocus sequence analysis of atypical Borrelia burgdorferi sensu lato isolates-description of Borrelia californiensis sp. nov., and genomospecies 1 and 2

New ruminant hosts and wider geographic range identified for Babesia odocoilei (Emerson and Wright

Detection of Anaplasma phagocytophilum and Babesia odocoilei DNA in Ixodes scapularis (Acari: Ixodidae) collected in Indiana

Babesia odocoilei infection in a Saskatchewan elk (Cervus elaphus canadensis) herd

Environmental investigation following the first human case of babesiosis in Tennessee

Notes on the characterization of prokaryote strains for taxonomic purposes

Questing ticks in suburban forest are infected by at least six tick-borne pathogens

Detection and identification of Ehrlichia spp. in ticks collected in Tunisia and Morocco

Serological and molecular detection of Borrelia burgdorferi sensu lato and Anaplasmataceae in rodents

Taxonomic note: implementation of the provisional status Candidatus for incompletely described procaryotes

We would like to thank Wakoli Wekesa, Robert Cummings, Paul Binding, David James, Ronald Keith, Angella Falco, Ann Donohue, Jamesina Scott, Stacy Berden, and Jack Cavier from