key: cord-0002161-r7e8ecnx
authors: Lv, Shuang; Xu, Qing-Yuan; Sun, En-Cheng; Zhang, Ji-Kai; Wu, Dong-Lai
title: Dissection and integration of the autophagy signaling network initiated by bluetongue virus infection: crucial candidates ERK1/2, Akt and AMPK
date: 2016-03-15
journal: Sci Rep
DOI: 10.1038/srep23130
sha: 08741b63c08d63c1a86dd3ef3ce3d1bfd39e560b
doc_id: 2161
cord_uid: r7e8ecnx

Bluetongue virus (BTV), a complex double-stranded segmented RNA virus, has been found to initiate cellular autophagy for its own benefit. Here, with a view to understanding the underlying mechanisms, we first systematically dissected the exact signaling network in BTV-induced autophagy. We found that the activity of mTOR, a crucial pivot, was inhibited by BTV1 infection, subsequently leading to downstream p70S6K suppression and autophagy initiation. We then explored the upstream regulators of mTOR and analyzed their activities via a series of assays. We found BTV1-induced autophagy to be independent of the ERK1/2 signaling pathway. However, the BTV1-induced inhibition of PI3K/Akt was found to be partially responsible for mTOR inactivation and subsequent autophagy initiation. Furthermore, we found unexpectedly that AMPK seemed to play a more important role in BTV1-induced autophagy. Elevated [Ca(2+)](cyto)-mediated activation of CaMKKβ exactly managed the activation of AMPK, which then positively regulated autophagy through suppressing mTOR. We must emphasize that TSC2 is a fatal mediator between upstream Akt or AMPK and downstream mTOR through its phosphorylation. Taken together, our data suggested that the BTV1-induced inhibition of the Akt-TSC2-mTOR pathway and the upregulation of the AMPK-TSC2-mTOR pathway both contributed to autophagy initiation and further favored virus replication.

Bluetongue virus (BTV), a double-stranded RNA (dsRNA) virus, is a member of the genus Orbivirus within the family Reoviridae. As an arthropod-borne virus, it is responsible for a hemorrhagic disease affecting domestic animals, primarily sheep and cattle, as well as some wild ruminants 1,2 . The impact of bluetongue disease was relatively low before the 1990s; however, several seasonal incursions of distinct BTV serotypes/strains have occurred virtually every year since 1998, causing massive economic losses to animal husbandry [3] [4] [5] . Due to its economic significance, BTV has been studied extensively from perspectives of molecular virology and structural biology, and great progress has been made [6] [7] [8] . However, research on the interactions between the virus and host remains relatively weak, highlighting the need for in-depth understanding of BTV pathogenicity in the host.

As obligate intracellular parasites, viruses have limited coding capacity, and their survival is extremely reliant on host cells. To understand the pathogenicity of a virus, one of the key questions in virology is how viruses gain temporary or long-term control over their hosts. Viruses must evolve strategies that utilize or usurp cellular processes to facilitate their own propagation. Macroautophagy (hereafter referred to as autophagy) is a conserved cellular catabolic process that mediates the removal of damaged organelles and long-lived cytoplasmic macromolecules via a lysosomal degradative pathway 9 . Recently, a multitude of studies have reported that viral infections have complex interconnections with the autophagic process 10 . Autophagy has intracellular antimicrobial properties and plays a role in immune responses to viral infections. However, many viruses, including a number of RNA viruses, have been shown to evade or subvert this process to benefit their replication [11] [12] [13] . A similar phenomenon was also observed in our previous study, which revealed that BTV infection can activate autophagy and utilize it

Our previous studies demonstrated that BTV1 infection triggered autophagy for its own benefit 14 . To probe the underlying mechanism by which BTV1 induced autophagy, we analyzed the mTOR pathway in BSR cells because mTOR is the major hub of the whole regulatory network of autophagy 18 . Rapamycin, an mTOR inhibitor, was used as a positive control. As shown in Fig. 1a , compared with mock cells, BTV1 infection and rapamycin treatment both caused significant decreases in the levels of phospho-mTOR, while the total mTOR remained nearly unchanged. The ratio of LC3-II to β -actin, a marker of autophagy, clearly increased, indicating that mTOR signaling is involved in BTV1-induced autophagy in BSR cells.

To confirm whether mTOR is repressed by BTV1 in a replication stage-dependent manner, we performed an immunoblotting assay using samples collected at various infection times. The results showed that mTOR phosphorylation activity displayed a reduced trend with the replication of the virus. Consistently, the phosphorylation of ribosomal protein S6 kinase-1(p70S6K), a hallmark substrate of mTORC1, was also found to be diminished with increasing infection time (Fig. 1b) . The ratios of p-mTOR/mTOR and p-p70S6K/p70S6K were notably decreased by approximately 3.5 times and 4.5 times, respectively, at 36 hpi. (Fig. 1c , Upper and middle panels, P < 0.01). As expected, the increase in LC3-II was monitored at the indicated times after BTV1 infection relative to mock-infected cells (Fig. 1b) . Similarly, the indicator ratio of LC3-II to β -actin was significantly increased by approximately 3 times at 24 hpi and 4 times at 36 hpi (Fig. 1c , Lower panel, P < 0.01). Meanwhile, monoclonal antibodies that specifically recognize the BTV1 VP2 and NS3 proteins were used to track the progression of infection. Collectively, these observations indicate that BTV1 induces autophagy by inhibiting mTOR signaling, and the process is dependent on viral replication. Autophagy initiated by BTV1 is not dependent on the ERK1/2-mTOR pathway. To investigate the upstream regulators targeting mTOR, a systematic screening strategy was formulated. Because the ERK1/2 pathway is reported to play a key role in the inhibition of mTOR and thus the positive regulation of autophagy 35 , we first examined whether ERK1/2 participates in autophagy induction in BTV1 infected cells. Because the autophagy phenomenon and mTOR activity are more obvious during the middle-late stage of virus replication, the following tests all used two timepoints: 24 and 36 hpi. Figure 2a shows that the bands of phospho-ERK1/2 hardly changed in BTV1-infected cells relative to the uninfected group, which implied that phospho-ERK1/2 was not involved in BTV1-induced autophagy. Further confirmation assays were conducted by the inhibition of ERK1/2 phosphorylation with the specific inhibitor U0126. The results showed that the p-ERK1/2 band reduced significantly with U0126 treatment, meaning the inhibitory effect of the drug was obvious. However, the inhibition of p-ERK1/2 by U0126 hardly affect the trends of mTOR phosphorylation and LC3 conversion caused by BTV1 infection (Fig. 2b , Lane 2 and 4), which suggested that ERK1/2 was not the functional upstream regulator of mTOR-LC3 pathway in BTV1 infection (Fig. 2b) . Additionally, immunofluorescence analysis was used to quantify the LC3 punctae, another marker of autophagy. After transfection with pEGFP-LC3, the addition of U0126 did not obviously alter the number of EGFP-LC3 punctae relative to the DMSO group with or without BTV1 infection in BSR cells (Fig. 2c ,d, P > 0.05). Thus, we conclude that ERK1/2 signaling is not involved in BTV1-induced autophagy. Our findings of viral titer determination are consistent with previous observations of VP2 in western blotting, indicating that U0126 treatment did not affect virus replication (Fig. 2e ). All the above results suggest that BTV1-induced autophagy initiation is not dependent on the ERK1/2-mTOR pathway.

shown that mTOR is directly linked to Akt, a downstream product of PI3K 36 , and the PI3K/Akt/mTOR signaling pathway plays an important role in cell autophagy. Therefore, we examined Akt activity to investigate whether autophagy induced by BTV1 infection was involved in this mTOR-dependent pathway. We found that BTV1 induced a marked reduction in Akt and mTOR activity as well as a great increase in LC3-II, especially at 36 hpi (Fig. 3a) , implying that Akt positively regulates mTOR. Next, to further obtain evidence for the interconnection between decreased Akt signaling and mTOR-dependent autophagy, activator insulin was exposed to BSR cells with or without BTV1 infection. Figure 3b showed that after insulin treatment, the decreases in Akt and mTOR phosphorylation were restored in BTV1-infected or mock-treated cells, which led to reduced autophagy (Fig. 3b) . Similar findings were seen in the confocal image of BTV1 plus insulin, showing fewer accumulated GFP-LC3 punctae in Fig. 3c ,d. As expected, autophagy suppression led to decreased extracellular and intracellular virus yields with insulin treatment, especially at 36 hpi (Fig. 3e) , indicating that Akt links to autophagy and BTV replication at a late stage of infection. Moreover, we constructed mutant plasmids to examine the effects of dominant-negative (DN) and constitutively active (myr) Akt variants on autophagy and virus replication. We found that the abundance levels of LC3-II and NS3 protein were partially recovered by the presence of DN-Akt and partially degraded by myr-Akt compared with the vector group or WT-Akt group (Fig. 3f) . Taken together, our data show that the Akt-mTOR pathway contributes to the regulation of autophagy and naturally affects BTV1 (c) Bar graphs showed the relative abundances of phosphorylated mTOR (p-mTOR), p-p70S6K and LC3-II protein (normalized to corresponding total protein or β -actin). A mock infection of 12 h was set at 1.0. The values represent the mean ± SD from three repeats. Statistical significances were analyzed using Student's t-test (**P < 0.01).

Scientific RepoRts | 6:23130 | DOI: 10.1038/srep23130 infection. However, the effect of this signaling is not strongly influential on BTV1-conferred autophagy and virus replication, suggesting that other mechanisms may exist.

CaMKKβ-AMPK axis may be involved in BTV1-induced autophagy. In addition to Akt, another key mediator of mTOR is AMPK, which has been demonstrated to negatively regulate mTOR activity 37, 38 . We sought to determine whether BTV-induced mTOR inactivation in BSR cells involves AMPK. First, BSR cells were infected with BTV1 or treated with AICAR (an AMPK activator) 39 for 36 h to assess the AMPK activity. Figure 4a shows that BTV1 infection led to increased AMPK activity in BSR cells, as evidenced by the heightened expression level of phospho-AMPK. Then, we further analyzed the links of AMPK activation and mTOR inhibition with BTV1 infection. Figure 4b shows that BTV1-infection significantly increased the phosphorylation of AMPK at 24 and 36 hpi, while the levels of p-mTOR steadily decreased, which accordingly resulted in an increase in LC3-II. Thus, it is reasonable to speculate that AMPK might relate to the mTOR signaling pathways. Previous reports proposed that AMPK could be activated via Ca 2+ /calmodulin-dependent protein kinase kinase (CaMKKβ ) and subsequently inhibited mTOR 40 . So the level of CaMKKβ was also examined and found elevated in BTV1-infected cells at 24 and 36 hpi compared with mock cells (Fig. 4c ). This observation is consistent with the result for AMPK. Accordingly, it is reasonable to speculate that the CaMKKβ -AMPK-mTOR signaling pathwaymay be involved in BTV1-induced autophagy.

AMPK is authentically an upstream regulator of mTOR, and CaMKKβ is responsible for the AMPK-mTOR axis. Based on the aforementioned speculation, we further collected evidence to support this viewpoint. First, the role of AMPK in BTV1-reduced autophagy was verified.

Because AMPK is activated with BTV1 infection, Compound C, an agent known to inhibit AMPK 41 , was used to assess the alteration of p-mTOR and CaMKKβ corresponding to AMPK inhibition. Figure 5a shows that in BTV1-infected cells, AMPK inhibition partly restored the phosphorylation of mTOR, and the restoration of mTOR activity subsequently inhibited BTV1-induced autophagy, whereas the inhibition of AMPK by Compound C did not inhibit CaMKKβ activation in response to BTV1 infection, suggesting that AMPK is a negative regulator of mTOR and occurs downstream of CaMKKβ . The puncta formation of GFP-LC3 was further examined. Compared with uninfected cells, significant puncta formation was found in BTV-infected cells but was dramatically reduced with the application of Compound C (Fig. 5b,c) , so we concluded that AMPK could positively regulate autophagy. Additionally, in our previous study, we found that autophagy affected the state of BTV infection. Here, we found that the inhibition of autophagy with Compound C via AMPK not only downregulated the expression of VP2 and NS3 in BTV1-infected cells at 36 hpi ( Fig. 5a) but also decreased the yields of BTV progeny both inside and outside the infected cells at 24 and 36 hpi (Fig. 5d ). Our findings are consistent with previous observations.

To exclude any non-specific effects of the pharmacological experiment, RNA interference was used to suppress the expression of AMPK. Two pairs of siRNAs targeting AMPK were designed, and the silencing effect was tested (Fig. 5e) . The effective mixture of those siRNAs targeting AMPK were used. As shown in Fig. 5f , compared with negative control siRNA (siNC)-transfected cells, BSR cells transfected with AMPK-targeting siRNAs exhibited a notable increase in p-mTOR protein but no obvious change in CaMKKβ . LC3-II formation was also greatly reduced by the suppression of AMPK expression, accompanied by significantly reduced viral protein synthesis. Meanwhile, the extracellular and intracellular virus particle yields also showed obvious reductions at 24 and 36 hpi (Fig. 5g) . These results were consistent with the pharmacological studies. Taken together, our data suggest that AMPK is authentically an upstream regulator of mTOR and is required for the effective replication of BTV.

Next, the role of CaMKKβ in the AMPK-mTOR axis was checked. BSR cells were infected with BTV1, as previously performed, in the absence or presence of STO-609, a specific CaMKKβ inhibitor 42 . Lysed samples were used to evaluate the activity of AMPK and mTOR. As expected, STO-609 treatment not only significantly inhibited the BTV-induced increase in the phosphorylation of AMPK but also restored the BTV-induced decrease in the phosphorylation of mTOR, implying that CaMKKβ is an upstream regulator of the AMPK-mTOR axis (Fig. 6a) . A large number of GFP-LC3 puncta were observed in BTV1-infected cells, an indicator of autophagy activation, whereas these puncta were reduced dramatically upon STO-609 treatment, suggesting that activated autophagy was inhibited (Fig. 6b,c) . Thus, we concluded that CaMKKβ could positively regulate autophagy. The significant reduction in extracellular viral load and intracellular virus titer when exposed to STO-609 reflected that CaMKKβ is required for BTV1 replication (Fig. 6d) . As before, siRNAs targeting CaMKKβ were used to confirm the results of the drug tests (Fig. 6e) . As shown in Fig. 6f , compared with the negative control group, BSR cells transfected with CaMKKβ -targeting siRNAs exhibited a similar phenomenon with STO-609 treatment: AMPK expression and LC3-II level were suppressed, and p-mTOR protein was regained. The depressed extracellular and intracellular viral loads (Fig. 6g) and reduced viral proteins synthesis (Fig. 6f) indicated that autophagy inhibition via CaMKKβ inhibition also disturbed BTV1 replication. In brief, our data suggest that CaMKKβ is responsible for the AMPK-mTOR axis and BTV1 infection. In an attempt to elucidate further the mechanism, upstream inducer was progressively explored.

It is now well established that intracellular Ca 2+ is one of the regulators of autophagy and plays a dual role 43 . Some reports indicated a stimulatory role for Ca 2+ towards autophagy, that is to say, elevated cytosolic Ca 2+ concentration ([Ca 2+ ] cyto ) would promote the autophagic process 40, 44 . More importantly, a previous study indicated that the elevated [Ca 2+ ] cyto -mediated induction of autophagy is proposed to occur through the activation of CaMKKβ , which phosphorylates and activates AMPK 40 . Thus, we next explored the status of [Ca 2+ ] cyto , a possible upstream regulator of CaMKKβ and AMPK, in BTV1-infected cells.

The BSR cells infected with BTV1 at the indicated times were incubated with Fluo-3 AM, and intracellular Ca 2+ was monitored using a flow cytometer. We observed that the fluorescence intensity of the peaks shifted rightward with the infection, meaning that [Ca 2+ ] cyto levels increased progressively with increasing infection time (Fig. 7a) . Further, to determine whether the BTV-induced increase in [Ca 2+ ] cyto actually performs signaling through CaMKKβ and AMPK for autophagy induction, we first applied ionomycin as a positive control to perform our assay. Ionomycin (Iono), a Ca 2+ ionophore that serves as a mobile Ca 2+ carrier, allows Ca 2+ fluxes from both the extracelluar space and the ER causing a rapid burst in cytosolic calcium levels and CaMKKβ and AMPK activation 45 . As shown in Fig. 7b ,c, compared with mock cells, BSR cells treated with BTV1 or ionomycin exhibited similar change trends in [Ca 2+ ] cyto and related moleculars, suggesting that BTV-induced Ca 2+ signaling may lead to autophagy stimulation by the same way. Based on these findings, we reasoned that if chelation of calcium resulted in contrary effects. 1,2-Bis(2-aminophenoxy)ethane-N,N,N′ ,N′-tetraacetic acid tetrakis(acetoxymethyl ester) (BAPTA-AM) is a well-established chelator of intracellular calcium ions 40 . As expected, the fluorescence intensity of the peak shifted leftward with BAPTA-AM treatment, indicating that BAPTA-AM treatment indeed obviously reduced [Ca 2+ ] cyto level (Fig. 7d) . Accordingly, the addition of BAPTA-AM to the cells significantly abolished the activities of CaMKKβ and AMPK. In addition, the remarkable decrease of LC3 expression with BAPTA-AM was accompanied by an obvious reduction in viral proteins synthesis (Fig. 7e ). All these reflected that Ca 2+ is required for functional autophagy in a CaMKKβ -and AMPK-dependent manner during BTV infection.

It is clear that the activity of mTORC1 is negatively regulated by the tuberous sclerosis 1/2 (TSC1/TSC2) complex, and TSC2 can be positively regulated by AMPK or negatively regulated by Akt 28, 46 . Based on our existing data, we then planned to focus our attention on TSC2. To address whether TSC2 is an essential intermediate in both the Akt-mTOR and AMPK-mTOR signaling pathways, TSC2 gene knockdown was first performed using TSC2-specific siRNAs to predict related molecules. Some pairs of siRNAs targeting TSC2 (Mesocricetus auratus/mau, GI:524963743) and TSC2 (Cricetulus griseus/cgr, GI:625196261) were designed and screened, and we chose siTSC2 (mau2#) for further use because it exhibited the most significant effect (Fig. 8a) . Nontarget siRNA was used as a negative control (siNC). We found that BTV1 infection induced the activation of TSC2 and reduced mTOR activity. The suppression of TSC2 by siRNA recovered mTOR phosphorylation and then downregulated LC3-II (Fig. 8b) , suggesting that TSC2 regulated autophagy via mTOR. Furthermore, Akt inhibition and AMPK activation caused by BTV1 infection were not markedly altered in BSR cells treated with TSC2-specific siRNA compared to cells treated with control siRNA (Fig. 8b) , implying that Akt and AMPK might be upstream regulators of TSC2 in BTV1-mediated autophagy. To thoroughly confirm this conclusion, we transfected BSR cells with Akt mutant plasmids and siR-NAs against AMPK, respectively, then infected the cells with BTV1 for 36 h, and the protein lysates were analyzed. We found that the activation of Akt with plasmid myr-Akt repressed p-TSC2, and the inhibition of Akt with DN-Akt recovered TSC2 activity (Fig. 8c) . The inhibition of AMPK also suppressed TSC2 activation (Fig. 8d ). All these results indicated that TSC2 is a crucial downstream effector of Akt and AMPK. In addition, LC3 aggregation was markedly decreased in infected cells treated with TSC2-specific siRNA compared to cells treated with control siRNA (Fig. 8e,f) , which suggested that TSC2 was required for the BTV1-induced autophagic response. TSC2 interference ultimately led to impaired replication of BTV through the disturbance of autophagy (Fig. 8g) . These results imply that TSC2 is a pivotal intermediate of the Akt-mTOR and AMPK-mTOR signaling pathways, ultimately contributing to BTV1-induced autophagy. Figure 8h shows a hypothetical model depicting the signaling mechanisms of BTV1-induced autophagy in BSR cells.

whether pharmacological treatments and siRNA transfection affected cell viability, which would ultimately affect the proliferation of the virus in host cells, we used the WST-1 (updated substitution of MTT) assay to analyze their effects on cell viability. Based on the results, we conclude that chemical application and siRNA transfection exhibited almost no significant effects on cell viability (See supplementary Fig. S1 ).

Autophagy is a tightly regulated and evolutionarily conserved cellular process in which cells destroy and recycle their own components in lysosomes. Accumulating lines of evidence have suggested that many virus-induced autophagies play important roles in the viral life cycles and pathogenesis 47 . Several viruses have been shown to evade, subvert, or exploit autophagy, seemingly to insure their own replication or survival advantages, including rotavirus, poliovirus, enterovirus 71, coronavirus, Epstein-Barr virus (EBV), hepatitis C virus (HCV), and hepatitis B virus (HBV) 10 . In our previous work, we found that BTV, a complex dsRNA virus belonging to the Reoviridae family, also triggered autophagy for its own benefit in host cells 14 . However, the exact mechanism activated by BTV to initiate the autophagy process remains largely unknown. In this study, we broadly describe a signaling cascade network induced by BTV1, involving ERK1/2, Akt and AMPK, integrated by mTOR, resulting in the autophagy response to provide a favorable cellular environment for the viral needs (Fig. 8h) .

Many signaling cascades have been implicated in regulating autophagy, in response to different intra-or extracellular stimuli. Similarly to yeast, the classical pathway involves the well-known serine/threonine kinase mTOR, a master regulator. Various pathways and small molecules regulate autophagy via mTOR or mTOR-independent mechanisms, which have been identified in recent years 17 . The mTOR pathway involves two functional complexes: the rapamycin-sensitive mTOR complex 1 (mTORC1), which regulates autophagy, and mTOR complex 2 (mTORC2), which is not a direct autophagy regulator. The activity of mTOR is controlled by many upstream signals, e.g., PI3K/Akt, AMPK and p53, which subsequently regulate related down-stream molecules and initiate the autophagy process. We present our current knowledge regarding the possible key genes composing the autophagy machinery induced by BTV infection.

The mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) pathway, which is commonly activated in cancers, regulates autophagy 15 . ERK1/2 has recently been shown to inhibit mTOR via activating TSC2, thus enhancing Beclin1-mediated autophagy 48 . ERK1/2 signaling has been observed in porcine circovirus type 2 and avian reovirus, which both regulate autophagy 33, 34 . However, in our observations, ERK1/2 is not involved in the autophagy induced by BTV1 infection (Fig. 2) .

A major signaling cascade controlling mTORC1 is the PI3K pathway. Akt has been shown to modulate the autophagic activity regulated by the PI3K pathway. The different classes of PI3K exert distinct effects on autophagy 49 . Increases in the class I PI3K product, PIP3, inhibit autophagy by inducing Akt activation. In other words, class I PI3K/Akt is a negatively regulated pathway of autophagy. In contrast, increasing the levels of the class III Scientific RepoRts | 6:23130 | DOI: 10.1038/srep23130 PI3K product, PI-3-P, stimulates autophagy. For BTV1, our results suggest that the down-regulation of p-mTOR can be partly attributed to Akt inactivation after BTV1 infection, which leads to autophagy activation (Fig. 3) . Mutations causing Akt activation or inactivation cause the suppression and induction of autophagy, respectively. These results are consistent with a previous report 50 . Similarly to BTV, with slight differences, avian reovirus protein p17-mediated Tpr suppression negatively regulates PI3K/Akt/mTOR signaling for its own replication, and HCV infection induces ER stress, which inhibits the Akt-TSC-mTORC1 pathway, thus inhibiting ULK1, and subsequently upregulates autophagy 34, 51 . Thus, we deduce that different viruses utilize the PI3K/Akt/mTOR pathway to promote autophagy through various stimulatory molecules. In addition, it is worth mentioning that the functions of the PI3K/Akt pathway are not limited to autophagy induction. The PI3K/Akt signaling pathway is involved in multi-cellular processes such as glucose metabolism, protein synthesis, and proliferation. It also appears to be associated with the host cell immune response to counteract viral infection 52 . Moreover, previous investigations have suggested that many viruses rely on the activation of this pathway for their replication 53, 54 . Hence, we conclude that the PI3K/Akt pathway is a complex and crucial pathway that is distinctively manipulated by various viruses, depending on the virus type or stage of viral replication.

AMPK is a critical regulator of the cellular metabolism and plays an important role in the autophagy process. Phosphorylated AMPK can either negatively regulate the mTOR complex (mTORC1) or directly phosphorylate ULK1, both of which can initiate the autophagy process 38 . Tracking back upstream from AMPK demonstrated that two signals were involved, Ca 2+ -mediated CaMKKβ and cellular energy. Calcium and CAMKKβ are involved in AMPK activation in hypothalamic neurons, T cells and endothelial cells, indicating that the calcium metabolism also plays a role in AMPK-mTOR-mediated autophagy regulation 40 . Recent research findings have shown that, in rotavirus-infected cells, CaMKKβ is stimulated by the increase in the intracellular Ca 2+ level and further activates AMPK, the latter potently inducing autophagy 55 . Rotavirus-encoded viroporin NSP4 plays a key role in this process. Because BTV and rotavirus all belong to the Reoviridae family, and the NS3 of BTV shares a similar structure with viroporin, this CaMKKβ signaling was verified in BTV1-induced autophagy. Quite predictably, BTV infection caused the elevation of [Ca 2+ ] cyto and Ca 2+ -mediated activation of CaMKKβ , leading to the phosphorylation of AMPK and the initiation of autophagy (Figs 4-7) . Although BTV1 infection indeed could elevate cytosolic calcium, the mechanisms by which this occurs are unclear. We speculated that BTV might encode one or more proteins to change the biomembrane permeability to calcium, causing the increased [Ca 2+ ] cyto originated from ER or Golgi [Ca 2+ ] stores, or extracellular environment. In our previous study, we have confirmed that ER stress response is involved in BTV-induced autophagy 56 , which remined us there might be some links between ER stress and elevated [Ca 2+ ] cyto . It's worth noting that many viruses, such as poliovirus, coxsackievirus, and hepatitis B virus, all could induce [Ca 2+ ] cyto increase as well as CaMKKβ activation 57, 58 , leading to the speculation that virus-mediated CaMKKβ activation through elevated [Ca 2+ ] cyto might be a common mechanism for the induction of autophagy. Moreover, we noted that the effects of AMPK inhibition on BTV1-induced autophagy are slightly greater than the effects of CaMKKβ inhibition, so we speculated that AMPK might be simultaneously activated by some other upstream signals, which are currently unclear. According to the literature reports, AMPK is a serine-threonine kinase that functions as a fuel gauge and maintains energy homeostasis during cellular stress 59 . AMPK is sensitive to the cytosolic AMP-to-ATP ratio, and metabolic stress activates autophagy through the suppression of mTOR signaling 24 . Thus, whether the decreased ATP level is triggered by BTV1 infection and participates in the activation of AMPK and the induction of autophagy needs to be further explored.

In conclusion, our findings suggest that BTV1-induced autophagy is initiated by repressing mTOR through Akt inhibition and AMPK activation and is independent of ERK1/2 signaling. All these autophagic pathways may be utilized to sustain and favor BTV1 replication. Clearly, our understanding of the molecular mechanisms remains insufficient, as several aspects of BTV-induced autophagy remain unclear. The crosstalk or linkage between these signaling pathways that act in controlling autophagy needs to be further explored, and detailed studies on potential new pathways should be conducted.

In summary, our data presented here identify a crucial step in driving the progress of interplay between BTV and autophagy. Our current knowledge on the signaling regulations of BTV-induced autophagy will provide new insights into the pathogenesis of BTV and contribute to potential antiviral drugs development.

in Dulbecco's modified Eagle's medium (DMEM, Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C in a 5% CO 2 humidified atmosphere. BTV1 strain SZ97/1 (GenBank accession numbers JN848759 to JN848768) was propagated in BSR cells.

Plasmids, antibodies, and reagents. To construct pEGFP-LC3B, the LC3B gene was amplified from BSR cells with primers (LC3F:GTGAATTCTCCGTCCGAGAAGACCTTCAAG; LC3R:AAGTCGACTTACAC the average number of green punctae per cell in each treatment was counted. (g) The extracellular and intracellular BTV1 yields produced by siNC or siTSC2-transfected BSR cells were tested and shown as TCID 50 /mL at 24 hpi and 36 hpi. *P < 0.05, significantly different. (h) A hypothetical model signaling network involving ERK1/2, Akt and AMPK in BTV1-induced autophagy. BTV1 infection induces the suppression of Akt and upregulation of AMPK via [Ca 2+ ] cyto -mediated CaMKKβ activation, leading to the TSC2-mediated inhibition of mTOR and downstream p70S6K, ultimately leading to autophagy initiation. In addition, ERK1/2 is not involved in BTV1induced autophagy. The whole signaling network is utilized by BTV1 for its own benefit. and virus titers were calculated as TCID 50 /mL using the Reed-Muench method. All data are shown as the means of three independent experiments. Cell viability assay. The cell viability assay was performed using the WST-1 cell proliferation and cytotoxicity assay kit according to the manufacturer's protocol. In brief, BSR cells were seeded in a 96-well plate at a density of 5000 per well and incubated at 37 °C for 24 h. The cells were treated with the drugs mentioned above at optimal concentrations or transfected with siRNAs, and the plates were incubated for 36 h. Then, 10 μL of WST-1 was added to each well, and the cells were further incubated for 2 h. The optical density at 450 nm was measured. The viability of the treated cells was expressed as a percentage relative to the untreated cells.

Flow cytometry for intracellular calcium detection. The cytosolic free calcium was detected using Fluo-3 AM. Fluo-3 AM itself does not bind Ca 2+ , but it is readily hydrolyzed to fluo-3 once the dye is inside the cells, and fluo-3 will emit fluorescence only when it binds to Ca 2+ . The BSR cells infected with BTV1 or treated with ionomycin or BAPTA-AM for the indicated times were incubated with Fluo-3 AM at 37 °C for 1 h in darkness. After washing, the cells were resuspended in sterile phosphate buffered saline (PBS, pH 7.2), and the resulting fluorescence, as an indicator of intracellular Ca 2+ , was monitored using a flow cytometer (BD FACSAriaTM) at an excitation wavelength of 488 nm.

Statistical Analysis. Data were presented as the mean ± standard deviation (SD) from three independent experiments. All statistical tests were performed using GraphPad Prism 6 (GraphPad Software, Inc., La Jolla, CA, USA). Statistical comparisons were performed using Student's t test or ANOVA where appropriate. A P value of < 0.05 was considered statistically significant.

In addition to the wild type Akt, plasmids encoding dominant negative and constitutively active Akt variants were constructed by site-directed mutagenesis (T308A and S473A) or myr tag introduction (ATGGGGAGCAGCAAGAGCAAGCCCAAGTCTAGA)

AM, Ionomycin and WST-1 cell proliferation and cytotoxicity assay kits were purchased from Beyotime (Beijing, China)

Chemicals treatments and virus infection. Chemicals and their optimal concentrations used in this experiment included 100 nM rapamycin, 20 μM U0126, 100 μg/mL insulin, 330 μM AICAR, 5 μM Compound C, 50 μM STO-609, 4 μM ionomycin, and 25 μM BAPTA-AM

To evaluate the efficiency of the siRNAs, targeted siRNAs and a negative control siRNA (siNC) were transfected into BSR cells cultured in a 12-well plate using Lipofectamine 2000, according to the manufacturer's protocol. The knockdown effects were analyzed by Western blotting. After transfection with the most effective siRNAs, the cells were infected with BTV1 (MOI = 1) at 12 hpt and incubated for 24 h or 36 h before the samples were collected

5′-CGUCAUUGAUGAUGAGGCUTT-3′ (sense) and 5′-AGCCUCAUCAUCAAUGACGTT-3′ (antisense)

5′-GCCAUGGGUGUGACACUAUTT-3′ (sense) and 5′-AUAGUGUCACACCCAUGG CTT-3′ (antisense)

sense) and 5′ -UUAAUGAGCAGCACGAA GGTT-3′ (antisense); negative control siRNA: 5′-UUCUCCGAACGUGUCACGUTT-3′ (sense) and 5′-ACG UGACACGUUCGGAGAATT-3′ (antisense

The clarified lysates were harvested and subjected to 12% SDS-PAGE gel, and the proteins were then electrotransferred to NC membranes. After blocking with 5% BSA for 2 h, the membranes were incubated with appropriate primary antibodies overnight at 4 °C, followed by IRDye 800 CW goat anti-mouse IgG or goat anti-rabbit IgG as secondary antibodies. The blots were visualized and quantified using an Odyssey Infrared Imaging System

At 12-18 hpt, the cells were treated with drugs or BTV1 as described above, then fixed with 4% paraformaldehyde at 24-36 h post-treatment. After permeabilization with 0.1% Triton X-100, the cell nucleus was counterstained with 4′, 6′-diamidino-2-phenylindole (DAPI). The EGFP-LC3 fluorescence dots were observed using a Zeiss LSM-510 laser scanning fluorescence microscope

Bluetongue virus capsid assembly and maturation

Climate change and the recent emergence of bluetongue in Europe

Bluetongue in Europe: past, present and future

Turnover Rate of NS3 Proteins Modulates Bluetongue Virus Replication Kinetics in a Host-Specific Manner

Bluetongue virus proteins and particles and their role in virus entry, assembly, and release

The molecular biology of Bluetongue virus replication

Bluetongue virus: dissection of the polymerase complex

Development by self-digestion: molecular mechanisms and biological functions of autophagy

Viral interactions with macroautophagy: a double-edged sword

Autophagy in viral replication and pathogenesis

Viruses and the autophagy machinery

Subversion of cellular autophagosomal machinery by RNA viruses

Autophagy Activated by Bluetongue Virus Infection Plays a Positive Role in Its Replication

Regulation of mammalian autophagy in physiology and pathophysiology

Macroautophagy signaling and regulation

Regulation mechanisms and signaling pathways of autophagy

mTOR regulation of autophagy

ZNF32 inhibits autophagy through the mTOR pathway and protects MCF-7 cells from stimulus-induced cell death

The role of TOR in autophagy regulation from yeast to plants and mammals

Mammalian autophagy: core molecular machinery and signaling regulation

A direct linkage between the phosphoinositide 3-kinase-AKT signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed cells

Distinct classes of phosphatidylinositol 3′-kinases are involved in signaling pathways that control macroautophagy in HT-29 cells

AMPK: energy sensor and survival mechanism in the ischemic heart

Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy

AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1

The association of AMPK with ULK1 regulates autophagy

TSC2 mediates cellular energy response to control cell growth and survival

Control of the autophagy maturation step by the MAPK ERK and p38: lessons from environmental carcinogens

Connecting endoplasmic reticulum stress to autophagy by unfolded protein response and calcium

A dual role of p53 in the control of autophagy

Regulation of autophagy by NFkappaB transcription factor and reactives oxygen species

Porcine circovirus type 2 induces autophagy via the AMPK/ERK/TSC2/mTOR signaling pathway in PK-15 cells

Avian Reovirus Protein p17 Functions as a Nucleoporin Tpr Suppressor Leading to Activation of p53, p21 and PTEN and Inactivation of PI3K/AKT/mTOR and ERK Signaling Pathways

ERK and cell death: mechanisms of ERK-induced cell death--apoptosis, autophagy and senescence

The phosphatidylinositol 3-kinase/AKT/mammalian target of rapamycin signaling network and the control of normal myelopoiesis

Upstream and downstream of mTOR

AMPK and mTOR coordinate the regulation of Ulk1 and mammalian autophagy initiation

AMP-Activated Protein Kinase Plays an Important Evolutionary Conserved Role in the Regulation of Glucose Metabolism in Fish Skeletal Muscle Cells

Control of macroautophagy by calcium, calmodulin-dependent kinase kinase-beta, and Bcl-2

AMP-activated protein kinase and the regulation of autophagic proteolysis

STO-609, a specific inhibitor of the Ca(2+)/calmodulin-dependent protein kinase kinase

A dual role for Ca(2+) in autophagy regulation

Induction of macroautophagy by exogenously introduced calcium

Endoplasmic reticulum, Bcl-2 and Ca2+ handling in apoptosis

A complex interplay between Akt, TSC2 and the two mTOR complexes

Autophagy as a therapeutic target in cancer

A non-canonical MEK/ERK signaling pathway regulates autophagy via regulating Beclin 1

Signalling and autophagy regulation in health, aging and disease

Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery

Hepatitis C virus inhibits AKT-tuberous sclerosis complex (TSC), the mechanistic target of rapamycin (MTOR) pathway, through endoplasmic reticulum stress to induce autophagy

Make yourself at home: viral hijacking of the PI3K/Akt signaling pathway

The pivotal role of phosphatidylinositol 3-kinase-Akt signal transduction in virus survival

PI3K-Akt signaling and viral infection

Autophagy hijacked through viroporin-activated calcium/calmodulindependent kinase kinase-beta signaling is required for rotavirus replication

Endoplasmic reticulum stress-mediated autophagy contributes to bluetongue virus infection via the PERK-eIF2alpha pathway

Functional Analysis of Picornavirus 2B Proteins: Effects on Calcium Homeostasis and Intracellular Protein Trafficking

The Hepatitis B Virus X Protein Elevates Cytosolic Calcium Signals by Modulating Mitochondrial Calcium Uptake

The AMP-activated protein kinase--fuel gauge of the mammalian cell?

Methods in mammalian autophagy research

This study was supported by grants from the National Natural Science Foundation of China 

S.L. and D.L.W. conceived and designed the experiments. S.L. performed assays and wrote the paper. Q.Y.X. and E.C.S. kindly offered valuable suggestions and contributed materials and reagents. J.K.Z. provided some reagents and critically read the manuscript. All authors reviewed the manuscript.

Supplementary information accompanies this paper at http://www.nature.com/srep Competing financial interests: The authors declare no competing financial interests.