key: cord-0063087-oafttz7n
authors: BEDOTTO, Marielle; FOURNIER, Pierre-Edouard; HOUHAMDI, Linda; COLSON, Philippe; RAOULT, Didier
title: Implementation of an in-house real-time reverse transcription-PCR assay to detect the emerging SARS-CoV-2 N501Y variants
date: 2021-05-14
journal: J Clin Virol
DOI: 10.1016/j.jcv.2021.104868
sha: 22d9896c6223f37d42ad4aeda8f221181ef8a370
doc_id: 63087
cord_uid: oafttz7n

nan

N501Y substitution within the spike receptor binding domain. Indeed, they have become predominant in England (20I/501Y.V1) [1] and were detected in South Africa (20H/501Y.V2) [2] and Brazil (20J/501Y.V3) [3] . The 20I/501Y.V1 variant has started to spread worldwide including in France [4] . It has been reported as 50-74% more transmissible than preexisting strains, suspected to evade anti-spike antibodies [1] , and it caused a reinfection [5] . Its realtime detection is critical to manage patients appropriately, monitor and assess its epidemiological and clinical features, and survey cases of immune escape post-infection or vaccination. Sequencing is a detection strategy that is difficult to implement exhaustively considering the very large number of SARS-CoV-2 cases.

We implemented an in-house one-step real-time reverse transcription-PCR (qPCR) assay that specifically detects SARS-CoV-2 N501Y variants by targeting nucleotide position 23,063 within S gene where A>U leads to N501Y. SARS-CoV-2 genomes from the GISAID database with or without N501Y were used to design primers and a hydrolysis probe (Table   1 ). Ten cDNA samples, one for each of the 10 Marseille variants [6, 7] , including Nextclades 20A.EU2 and 20E, identified in our institute by genome next-generation sequencing, and three nasopharyngeal samples of the Marseille-4 variant/Nextclade 20A.EU2 that predominated locally [8] tested negative. Then we tested SARS-CoV-2 positive nasopharyngeal samples (cycle threshold value of qPCR diagnosis test= 10.2-32.9) collected in January 2021 from 161 patients and for which the viral genotype was determined by nextgeneration sequencing, as previously described [8] . Marseille-4/Nextclade 20A.EU2 (n= 1)) tested negative with our N501Y-specific qPCR.

Our in-house qPCR system was found reliable to detect the N501Y substitution. It allowed estimating the 20I/501Y.V1 variant prevalence among SARS-CoV-2 diagnoses to be 18.0% overall between January 1 st and February 28 th , 2021, and to increase from 3.4% (57/1,683) during the two first weeks of January 2021 to 47.3% (745/1,572) during the two last weeks of February 2021. A commercialized RT-PCR diagnosis assay (TaqPath RT-QPCR test) allows the indirect identification of the 20I/501Y.V1 variant by detecting its ORF1a and N genes but not its S gene due to a deletion at positions 21,766-21,772 [4] . However this deletion is also present in strains devoid of the N501Y substitution and was reported in 0.6% of recent SARS-CoV-2 diagnoses in France [4] . Moreover, it is absent from the 20H/501Y.V2 and 20J/501Y.V3 N501Y variants, which prevents their identification. Finally, our in-house qPCR test can be widely and easily deployed in laboratories as it can potentially run on any open qPCR microplate platform, does not require technical workers' training, and is as cheap as other in-house qPCR assays. Such approach should allow adapting continuously diagnosis strategies for new SARS-CoV-2 variants.

Conceived and designed the study: PC, DR. Contributed materials/analysis tools: MB, PEF, LH, PC. Analyzed the data: all authors. Wrote the paper: PC, DR. 

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding sources had no role in the design and conduct of the study; collection, management, analysis, and interpretation of the data; and preparation, review, or approval of the manuscript.

This study has been approved by our institution's ethics committee (N°2020-029).

Early transmissibility assessment of the N501Y mutant strains of SARS-CoV-2 in the United Kingdom

Emergence of a SARS-CoV-2 variant of concern with mutations in spike glycoprotein

Genomic characterisation of an emergent SARS-CoV-2 lineage in Manaus: preliminary findings

Two-step strategy for the identification of SARS-CoV-2 variant of concern 202012/01 and other variants with spike deletion H69-V70

Confirmed reinfection with SARS-CoV-2 variant VOC-202012/01

Dramatic increase in the SARS-CoV-2 mutation rate and low mortality rate during the second epidemic in summer in Marseille

Genome sequence analysis enabled deciphering the atypical evolution of COVID-19 epidemics in

Emergence and outcome of the SARS-CoV-2 "Marseille-4" variant

Table 1. Primers, probe and qPCR conditions Name Sequence (5'-3') Positions * Primers: Pri_IHU_N501Y_F1 ATCAGGCCGGTAGCACAC

Probe (6FAM-labelled): Pro_IHU_C_GB_1_MBP CCACTTATGGTGTTGGTTACCAA 23

μL of probe (10 pmol/µL), and 8.6 μL of water. PCR conditions are as follows: reverse transcription at 50°C for 10 min

40 cycles comprising a step at 95°C for 15 sec and a step at 60°C for 60 sec