key: cord-0254383-tbkzg4aw
authors: Kuraoka, Masayuki; Yeh, Chen-Hao; Bajic, Goran; Kotaki, Ryutaro; Song, Shengli; Harrison, Stephen C.; Kelsoe, Garnett
title: Recall of B cell memory depends on relative locations of prime and boost
date: 2021-12-20
journal: bioRxiv
DOI: 10.1101/2021.12.17.472609
sha: e9bddcf1b703a34b59ac75f5ae6e51b66701f30a
doc_id: 254383
cord_uid: tbkzg4aw

Re-entry of memory B cells to recall germinal centers (GCs) is essential for updating their B-cell antigen receptors (BCRs). Using single B-cell culture and fate-mapping, we have characterized BCR repertoires in recall GCs following boost immunizations at sites local or distal to the priming. Local boosts with homologous antigen recruit to recall GCs progeny of primary GC B cells more efficiently than do distal boosts. Recall GCs following local boosts contain significantly more B cells with elevated levels of Ig mutations and higher avidity BCRs. This local preference is unaffected by blockade of CD40:CD154 interaction that terminate active, primary GC responses. Local boosts with heterologous antigens elicit secondary GCs with B-cell populations enriched for cross-reactivity to the priming and boosting antigens; in contrast, cross-reactive GC B cells are rare following distal boosts. Our findings indicate the importance of locality in humoral immunity and inform serial vaccination strategies for evolving viruses. One Sentence Summary The participation of memory B cells in recall germinal centers depends on whether the boost is local or distal to the priming site.

Vaccinations or microbial infections activate the adaptive immune system and establish, predominantly through germinal center (GC) responses, long-lasting protective immunity. This durable immunity comprises long-lived plasma cells and memory B (Bmem) cells. The former maintain circulating antibody (Ab) to provide a first line of defense against reinfection. The latter exhibit multiple fates on re-encountering antigen; Bmem cells either proliferate and differentiate into short-lived plasmablasts/-cytes (PBs/PCs) or (re)enter GCs in which they undergo new rounds of antigen-driven selection and Ig somatic hypermutation (SHM) to "update" their B-cell receptors (BCRs). Rapid Bmem differentiation into PBs/PCs contributes to prompt, high affinity Ab responses and protective activity, the Bmem cells that re-enter GCs and emerge with updated BCRs play critical roles in combatting evolving viruses (e.g., HIV-1, influenza, SARS-CoV-2).

Viruses that accumulate fitness-enhancing mutations in response to immune pressure (in individuals or populations) can generate escape variants to which pre-existing Bmem BCRs and circulating Abs bind weakly or not at all.

Studies in mice and humans have provided substantial evidence for the recruitment of Bmem cells into recall GCs (1-4) and for the updating of Bmem BCRs (3, (5) (6) (7) . Nonetheless, questions have arisen concerning participation of Bmem cells in recall GC responses (8) (9) (10) , and recent studies have suggested that recruitment of Bmem cells to secondary GCs is not an efficient process. (11) . Fate-mapping experiments have shown that the marked, progeny of primary GC B cells account for a small subset (≤5%) of secondary GC B cells and that newlyactivated, mature B cells dominate the recall GC responses (11, 12) . In addition to this overall inefficiency, recruitment of high affinity Bmem cells into recall GCs may be further reduced as higher affinity Bmem cells appear to be biased for PBs/PCs differentiation rather than GC reentry (13) (14) (15) (16) (17) (18) .

That immunization or microbial infection establishes humoral memory that is local as well as systemic is now recognized. For example, pulmonary infection of mice with influenza viruses establishes resident Bmem cells in the lung, and these local Bmem cells exhibit distinct BCR specificities and contribute to early local plasmacytic responses that provide stronger protection against influenza challenge than do systemic Bmem cells (19, 20) . This property of local humoral memory may be general. Early studies report that antigen-retention in local LNs 3 has significant roles in the migration and retention of specific Bmem cells and that LNs linked to primary immunization sites produce more Ab-secreting cells than do distal LNs after secondary challenge (21) (22) (23) (24) .

Does a distinct population of local Bmem cells in peripheral LNs support secondary GC responses that are distinct from those at distal sites? Is the importance of location in humoral immunity relevant only to non-lymphoid tissues, e.g., lung, or does it extend to secondary lymphoid tissues? To address these questions, we compared secondary GC responses to boost immunizations given in the same (ipsilateral) or opposite (contralateral) leg of primed mice. The magnitude of secondary GC and serum Ab responses to homologous boosts were similar for both ipsilateral and contralateral boosts. We found, however, that the quality of these responses differed. Ipsilateral boosts elicited GCs with higher numbers of cells that were the progeny of the primary GC response than did contralateral boosts. Consequently, secondary GCs elicited by ipsilateral boosting contained higher numbers of B cells with elevated Ig mutation frequencies and higher avidity for antigen. Disruption of active, primary GC responses by injecting anti-CD154 Ab did not reduce this local recall bias for previously mutated, higher affinity cells. In response to boosts with heterologous antigens, ipsilateral boosts were more effective in producing secondary GC B cells that bound both the primary and boost antigens than did contralateral boosts. Our findings suggest that local B-cell memory is retained in the form of GC B cells and/or GC-phenotype B cells. The results have implications for strategies of vaccination against evolving pathogens, for which updating BCRs is essential for durable protection. 4 

To compare Ab responses following boost immunizations at local and distal sites, we immunized B6 mice with influenza hemagglutinin (HA) H1 SI-06 in the right footpad, and then boosted these animals 1-3 month(s) later with homologous HAs either in the right hock (ipsilateral boosts) or in the left hock (contralateral boosts). Eight days after boosting, we quantified HAspecific IgG Abs in sera by a Luminex multiplex bead assay, and enumerated PBs/PCs in the draining LNs by flow cytometry (Fig. 1A) . Boost immunizations raised the concentrations of HA-specific serum IgG Abs by ~12-fold (p < 0.001; ipsilateral boosts, 14-fold; contralateral boosts, 10-fold; Figs. 1B and 1C), but there were no significant differences in H1 HA-specific serum IgGs between ipsilateral and contralateral boosts (p > 0.99; Figs. 1B and 1C).

Consistent with robust serum IgG responses, the number of B220 lo CD138 hi PBs/PCs in the draining LNs were higher after boosting, ~15-fold (p = 0.001) and ~8-fold (p = 0.038) following ipsilateral and contralateral boosts, respectively than in no-boost controls (Figs. 1D and 1E). Between boost regimens there were no significant differences in the number of PBs/PCs in the draining LNs (p > 0.99; Fig. 1E ). We sorted these samples into three groups by intervals between the priming and boosting (i.e., 4-5 week, 8-10 week, and 12-14 week intervals, respectively) and found across all intervals that ipsilateral boosts and contralateral boosts elicited comparably robust serum IgG responses and plasmacytic responses in the draining LNs (Fig.   S1 ).

We characterized secondary GC responses in the draining LNs following ipsilateral or contralateral boosts by enumerating the number of B220 + CD138 -GL-7 + CD38 lo IgD -GC B cells and by determining their BCR reactivity and avidity. Flow cytometric analysis showed that GC responses elicited by the primary immunization had waned largely, but not completely, by the time of the boosts ( Fig. 2A and 2B) . We recovered ~6 times as many GC phenotype B cells from the draining LNs of no-boost controls (geometric mean = 1,700) than from naïve controls 5 (geometric mean = 270). Although this difference was not statistically significant (p = 0.72), ~85% (11 out of 13) of LN samples from no-boost controls contained more than 1,000 GC B cells, while only one third (4 out of 12) of LN samples from naïve mice did (Fig. 2B ).

Both ipsilateral and contralateral boosts elicited strong secondary GC responses; numbers of GC B cells were ~17-fold (p < 0.001) and ~13-fold (p = 0.011) higher following ipsilateral and contralateral boosts, respectively, than in no-boost controls ( Figs. 2A and 2B ). Ipsilateral and contralateral boosts elicited secondary GC responses of comparable magnitudes (p > 0.99; Fig. 2A and 2B ). This relationship held when we boosted mice at 4-5 weeks, 8-10 weeks or 12-14 weeks after priming (Fig. S2A-S2C ).

To determine the specificity and affinity of B cells in secondary GCs, we sorted individual GC B cells from the draining LNs of boosted animals into single-cell Nojima cultures (Kuraoka et al., 2016) . After culture, we screened clonal IgG Abs in culture supernatants by a Luminex multiplex assay for binding to HA H1 SI-06 (Fig. 2C) To compare the distribution of BCR affinities for HA H1 SI-06, we determined the avidity index (AvIn) for each clonal IgG Ab (25) . The median AvIn for the GC B cells following ipsilateral boosts was 8  10 -4 , which was moderately but significantly different from median AvIn value for their contralateral boost counterparts (median AvIn = 5  10 -4 ; p = 0.019; Fig.   2C ). In addition, ipsilateral secondary GCs contained more high avidity (AvIn > 0.1) B cells.

High avidity B cells constituted 14% (14%) of HA-specific GC B cells elicited by ipsilateral boosts, about 4-fold above that of contralateral boost GC B cells (p = 0.035; Fig. 2D ). Secondary GCs after local boosts were similar in size to those induced at distal sites but contained more high affinity B-cell clones. 6 To examine somatic genetics of secondary GC B cells, we determined VDJ gene sequences for subsets of Nojima culture samples (ipsilateral boosts, n = 837; contralateral boosts, n = 376). We amplified VDJ rearrangements from cDNA prepared and sequenced from the cell pellets of individual IgG + cultures (25) . Secondary GC B cells following ipsilateral boosts and contralateral boosts carried on average 2.7 and 2.0 VH mutations, respectively (Fig. 3A ), corresponding to VH mutation frequencies (number of nucleotide substitutions per base pairs sequenced) of 1.0% and 0.7%, respectively (p = 0.73; Fig. 3A ). These mutation frequencies were significantly (p < 0.001) higher than those in day 8 primary GC B cells (average 0.5%, Fig. 3A and (25) Tamoxifen injections can induce YFP expression not only in AID-expressing cells that are activated by primary immunizations but also in those that are irrelevant to the priming (e.g., Peyer's patch GC B cells constitutively present in the gut). To ensure that YFP + cells that engage in secondary responses originated from cells specifically generated by the priming, we compared frequencies of YFP + cells following "boost" immunizations with or without prior immunization.

In the absence of priming, "boost" immunizations following tamoxifen injections recruited little or no YFP + cells into PBs/PCs and GC B-cell compartments while YFP + cells were readily detectable in these B-cell compartments in mice that had been primed previously ( 

To examine the BCR repertoire of YFP + secondary GC B cells, we sorted them following ipsilateral boosts, performed single-cell Nojima cultures and determined binding specificity and avidity of the clonal IgG Abs by a Luminex multiplex assay. Of the 514 clonal IgG Abs we recovered from the YFP + secondary GC B cells, 109 (21%) bound to HA H1 SI-06 (Table 1) .

These HA-reactive clonal IgG Abs had a broad range of BCR affinities for the HA immunogen. This avidity distribution was no different from that of overall secondary GC B cells (compare Before boosting, sera from H1-primed animals contained H3-binding serum IgG Abs at 17 ng/ml (geometric mean), ~70-fold lower than the concentration of H1-bindig IgG Abs (1,300 ng/ml; Fig. 5B ). Following boosts, concentrations of H3-specific serum IgG Abs increased by 10-fold (from 13 ng/ml to 130 ng/ml, ipsilateral boosts) and 3-fold (from 27 ng/ml to 79 ng/ml, contralateral boosts; Fig. 5C and 5D). In contrast to H3-binding IgG responses, ipsilateral, but not contralateral, boosts with H3 HAs increased concentrations of H1-specific serum IgG Abs by 2-fold (from 1.1 g/ml to 2.1 g/ml, p < 0.05; Fig. 5D ), implying that ipsilateral boosts with HA H3 X31 re-activated H1/H3 cross-reactive cells that had been established by priming with HA H1 SI-06 more efficiently than did contralateral boosts.

We determined the number and frequency of secondary GC B cells by flow cytometry. Like secondary GC responses to homologous HA boosts ( Fig. 2A) , boosts with heterologous HAs elicited robust GC responses in the draining LNs following both ipsilateral and contralateral boosts (Fig. 6A, 6B) . To determine the reactivity profile of secondary GC B cells after boosting with heterologous HA antigens, we isolated GC B cells from the draining LNs of boosted animals and established single-cell Nojima cultures (25) . On average, antigen-specific B cells (i.e., clonal IgGs that bound HAs of H1 SI-06 or H3 X31 or both) accounted for 16% (9.4%) and 18% (8.2%) of clonal IgGs recovered from secondary GC B cells following ipsilateral and contralateral boosts, respectively (Fig. S6A ). For both boost regimens, most (90% and 97%, ipsilateral and contralateral boosts, respectively) HA reactive B cells bound HA H3 X31 (i.e., the boosting antigen; Fig. 6C ). Despite these similarities, the distribution of HA reactivity of secondary GC B cells was different between boost regimens. The frequency of H1/H3 crossreactive cells among HA-specific secondary GC B cells was significantly higher after ipsilateral boosts than after contralateral boosts (Fig. 6C, 6D ). On average, H1/H3 cross-reactive B cells constituted 12% (11%) and 0.9% (1.5%) of HA-reactive GC B cells after ipsilateral and contralateral boosts, respectively. We recovered H1/H3 cross-reactive B cells from 8 out of 10 mice given an ipsilateral boost and 2 out of 6 mice after a contralateral boost (Fig. 6D ).

The participation of cross-reactive GC B cells that bound both priming antigens and boosting antigens was much lower when we boosted H1 SI-06 primed mice with an irrelevant antigen, rPA. Antigen-specific B cells (i.e., clonal IgGs that bound H1 SI-06 or rPA or both antigens) accounted for 28% (10%) and 18% (3.3%) of clonal IgGs recovered from secondary GC B cells following ipsilateral boosts and contralateral boosts, respectively (Fig. S6B) . 

We have shown an important role of locality in secondary GC responses. Using a combined approach of single B-cell cultures with a fate-mapping mouse model, we found that in response to homologous HA antigens, ipsilateral boosts recruited to secondary GCs progeny of the primary GC B cells more efficiently than did contralateral boosts (Fig. 4) . Consequently, secondary GCs following ipsilateral boosts comprised B cells with elevated IgH SHM and with high avidity to immunogens at higher frequencies than did their contralateral counterparts (Figs.   2-4) . In response to heterologous HA antigens, ipsilateral boosts increased serum IgG that bound the priming HAs along with those that bound boosting HAs, while contralateral boosts increased only serum IgG components that bound boosting HAs (Fig. 5) . Ipsilateral boosts recruited to 12 secondary GCs cross-reactive B cells that bound both the priming and boosting HAs more efficiently than did contralateral boosts (Fig. 6 ).

Which factors contribute to an efficient engagement of the progeny of primary GC B cells in secondary GCs following ipsilateral boosts? Local antigens that are retained on FDCs (32) have significant roles in retaining "primed B cells" within the draining LNs without further differentiation into PBs/PCs and thereby contribute to long-lasting, local B-cell memory (22) (23) (24) .

We propose that local B-cell memory is retained in the primed LNs in the form of classical . S3) . What would be an outcome of the recall GC responses? That is, who will win the Darwinian selection that would be operated in recall GCs? While activated, naïve B cells that are overrepresented in early recall GCs (11, 12) (Fig. 4) may eventually outnumber the rarer, recalled "primed B cells" over the course of the GC reactions, a relative population size in early GCs does not necessarily predict an outcome of the B-cell selection. For example, a subset of recalled Bmem cells may have a "head start" and outcompete the naïve counterparts as they express high avidity BCRs that are infrequent in the naïve counterparts (Figs. 2-4) . It is also possible that secondary GCs, like primary GCs, are permissive environments and overall BCR affinity maturation could operate without losing BCR diversity (25) . In this model, both the rarer recalled "primed B cells" and more frequent, activated naïve B cells could co-exist throughout the recall GC responses and produce their respective progenies.

HA-binding IgGs accounted for only ~20% of all clonal IgGs recovered from secondary GC B cells (Table 1) . This frequency did not change when we focused our analysis on fatemapped cells (Table 1) . In other words, most (80%) of the progeny of primary GC B cells participate in secondary GC responses without measurable affinity to immunogens. One possible explanation would be that these HA non-binding B cells had lost affinity to HAs by new rounds of SHM during secondary GC responses. Indeed, without strong selection, any stochastic mutational process has a much greater likelihood of lowering BCR affinity than of increasing it.

It is also possible that these HA non-binding YFP + cells represent progeny of the antigen nonbinding B cells found among primary GC B-cell populations (25, 33) and/or among the contemporaneously generated Bmem pool (12). Recovery of HA non-binding, YFP + secondary GC B cells that carried no IgH SHM or only silent (no amino acid change) IgH SHM (Fig. S5) strongly suggests that they were activated by both the primary and secondary immunizations without measurable BCR affinities (as IgG) and yet participated in secondary GC responses.

Although the nature of these antigen non-binding secondary GC B cells still needs to be elucidated, secondary GCs, like primary GCs, are permissive environments, at least for the entry and early phase of the reaction, and support B cell clones with a broad range of BCR affinities, including those with undetectable affinities for the native form of the immunogen. H1/H3 cross-reactive B cells participated in secondary GCs following ipsilateral boosts with H3 HAs, and to a lesser extent, following contralateral boosts in H1-primed mice (Fig. 6 ).

This advanced engagement of H1/H3 cross-reactive B cells in local, secondary GCs accompanied an increase, following ipsilateral boosts, in binding of serum IgG Abs to H1 HAs as well as of those binding to H3 HAs (Fig. 5) . Our observations suggest that local boosts with H3 HAs effectively activate H1/H3 cross-reactive B cells that are retained within the persistent pool of "primed B cells" we described above. Participation of H1/H3 cross-reactive B cells in secondary GCs would give them an opportunity to update their BCRs to fit with newlyintroduced antigens (i.e., H3 HAs). A further question is how these cross-reactive B cells compete with other B cells (e.g., H1-specific or H3-specific) and how they evolve in recall GCs.

with a series of designed immunogens to activate the targeted, naïve precursor B cells and their descendants to direct B-cell lineage progression toward a desired goal that would not be reached otherwise (e.g., broadly neutralizing Abs to HIV-1 or influenza) (34) . As AID expression and SHM are largely limited in GC B cells (35, 36) , one of the key steps is engagement of Bmem cells in recall GC responses in which they undergo new rounds of SHM, clonal selection and affinity maturation to newly-introduced antigens. Our observations suggest that activation of local B-cell memory populations by repeated immunizations at the same sites might be required to ensure efficient participation of "primed B cells" in recall GC responses, and thus might be necessary for a successful, B-cell-lineage immunogen design vaccine strategy.

Female, C57BL/6 mice were obtained from the Jackson Laboratory. Aicda Cre-ERT2 x Rosa26 loxP-EYFP (AID-Cre-EYFP) mice (1, 26) and S1pr2-ERT2cre-tdTomato mice (17) were analyzed. Sera were collected before boosts (one day before or same day as boosts) and after boosts (8 days after boosts). All experiments involving animals were approved by the Duke University Institutional Animal Care and Use Committee.

HAs for the full-length, soluble ectodomains of H1 A/Solomon Islands/03/2006 (H1 SI-06) and H3 A/Aichi/2/1968 (H3 X31) were cloned, expressed, and purified as previously described (25, (37) (38) (39) .

GC B cells (GL-7 + B220 hi CD38 lo IgD -CD138 -) and plasmablasts/-cytes (B220 lo CD138 hi ) in the draining LNs were identified as described (25, 40, 41) . Labeled cells were analyzed/sorted in a FACS Canto (BD Bioscience) or a FACS LSRII (BD Biosciences) or a FACS Vantage with DIVA option (BD Bioscience). Flow cytometric data were analyzed with FlowJo software (Treestar Inc.). Doublets were excluded by FSC-A/FSC-H gating strategy. Cells that take up propidium iodide were excluded from our analyses.

GC B cells were expanded in single cell cultures (25) . Briefly, NB-21.2D9 cells feeder cells were seeded into 96-well plates at 2,000 cells/well in B cell media (BCM); RPMI-1640 (Invitrogen) supplemented with 10% HyClone FBS (Thermo scientific), 5.5  10 -5 M 2-mercaptoethanol, 10 mM HEPES, 1 mM sodium pyruvate, 100 units/ml penicillin, 100 g/ml streptomycin, and 16 MEM nonessential amino acid (all Invitrogen). Next day, recombinant mouse IL-4 (Peprotech; 2 ng/ml) was added to the cultures, and then single B cells were directly sorted into each well of 96-well plates using a FACS Vantage. Two days after culture, 50% (vol.) of culture media were removed from cultures and 100% (vol.) of fresh BCM were added to the cultures. Two-thirds of the culture media were replaced with fresh BCM every day from day 4 to day 8. On day 10, culture supernatants were harvested for ELISA determinations and culture plates were stored at -80C for V(D)J amplifications.

Presence of total and antigen-specific IgG in serum samples and in culture supernatants were determined by ELISA and Luminex multiplex assay (25) . Diluted culture supernatants (1:10 in PBS containing 0.5% BSA and 0.1% Tween-20) were screened for the presence of IgGs by standard ELISA (25) . IgG + samples were then screened for binding to immunogen antigens (HA H1 SI-06, HA H3 X31, and rPA) by Luminex assay (25) . Briefly, serum samples or culture supernatants were diluted (initial dilutions of 1: 100, and then 3-fold, 11 serial dilutions for serum samples; 1: 10 or 1: 100 for culture supernatants) in 1×PBS containing 1% BSA, 0.05% NaN3 and 0.05% Tween20 (assay buffer) with 1% milk and incubated for 2 hours with the mixture of antigen-coupled microsphere beads in 96-well filter bottom plates (Millipore). After washing with assay buffer, these beads were incubated for 1 hour with PE-conjugated goat antimouse IgG Abs (Southern Biotech). After three washes, the beads were re-suspended in assay buffer and the plates were read on a Bio-Plex 3D Suspension Array System (Bio-Rad). The Table S1 ) and 1 M of 5' SMART templateswitching oligo that contained plate-associated barcodes (Table S1 ) at 50C for 50 min followed by 85C for 5 min. cDNA was then subjected to two rounds of PCR using Herculase II fusion DNA polymerase with combinations of forward primers and reverse primers that contained wellassociated barcodes ( 

Popliteal LNs from immunized AID-Cre/EYFP mice were fixed with 1% paraformaldehyde in PBS for overnight at 4C, and then placed in PBS containing 10-30% sucrose at 4 C (10% for 2 hours, 20% for 2 hours, and then 30% for overnight). Tissues were then embedded in Tissue-Tek O.C.T. compound (Sakura Finetek) and snap-frozen in 2-methylbutane cooled with liquid nitrogen. Frozen tissues were stored at -80 C until use. Serial 5-m-thick cryosections were cut on a CM1850 cryostat (Leica) and thaw-mounted onto glass slides and stored at -. After air drying, sections were rehydrated in a washing buffer (PBS with 0.5% BSA and 0.1% Tween-20) 18 for 30 minutes at room temperature, and then blocked with rat anti-mouse CD16/32 (2.4G2) and

rat IgG (Sigma-Aldrich) for 15 minutes at room temperature. Sections were labeled with AlexaFluor488-conjugated anti-GFP Ab (FM264G, BioLegend), BV510-conjugated anti-IgD (11- 26c.2a, BioLegend) , and AlexaFluor647-conjugated anti-CD21/35 (7E9, BioLegend) in a humidified chamber for 3 hours at room temperature in the dark. After washing, labeled sections were mounted in Fluoremount-G (SouthernBiotech) and imaged with SP8 upright confocal microscope (Leica). The images were processed with ImageJ software (Fiji package, NIH).

Statistical significance (p < 0.05) was determined by Wilcoxon matched-pairs signed rank test, Kruskal-Walis test with Dunn's multiple comparisons, and Mann-Whitney's U test using GraphPad Prism software (version 9.2.0, GraphPad Software). Statistic test is indicated within each figure legend. Figure S4 . Tracing the fates of the progeny of primary GC B cells in S1pr2-ERT2cre-tdTomato mice Participation of the progeny of primary GC B cells was assessed in fate-mapping mouse models. S1pr2-ERT2cre-tdTomato mice or AID-Cre-EYFP mice were primed with H1 SI-06, injected with tamoxifen (d8-d12). (A) Representative flow diagrams of GL-7 and CD38 expressions on B220 + CD138 -cells (top panels) and of tdTomato (left) or EYFP (right) and IgD expressions on B220 + CD138 -GL-7 + CD38 lo GC B cells (d14 primary, bottom panels) in S1pr2-ERT2cre-tdTomato mice (left) and in AID-Cre-EYFP mice (right). (B and C) Ten weeks after the priming, S1pr2-ERT2cre-tdTomato mice were boosted with homologous HAs (H1 SI-06) ipsilaterally or contralaterally. Mice were analyzed 8 days after boosts (see also figure legend for Fig. 4) . Representative flow diagrams of GL-7 and CD38 expressions on B220 + CD138 -cells (top panels) and of tdTomato and IgD expressions on B220 + CD138 -GL-7 + CD38 lo GC B cells (B), and number of tdTomato + secondary GC B cells following ipsilateral or contralateral boosts (C). Each dot represents an individual mouse. Horizontal bars, geometric mean. Antigen-specific IgG  B Figure S6 . Frequency of antigen-specific IgGs among recall GC B cells B6 mice were primed with H1 SI-06, and then 8-10 weeks later boosted with either H3 X31 (A) or rPA (B) ipsilaterally or contralaterally. Eight days following boosts, Nojima cultures were established for secondary GC B cells. After culture, HA-reactivity was determined for each clonal IgG by Luminex assay. Frequency of HAspecific IgGs among all clonal IgGs was calculated for each mouse sample, which is represented by each dot. , p < 0.05; n.s., p > 0.05 by Mann-Whitney's U test. Combined data from 4 (for A) and 2 (for B) independent experiments are shown. TSO-P12 /5Biosg/CCAAGCTGGCTAGCACCATGACAGcatgcgtaCAGrGrGrG gene-specific reverse primers mIgG-RV1 GAGATGGTTYTCTCGATGGG gene-specific reverse primers mIgM-RV1 GGAATGGGCACATGCAGA gene-specific reverse primers mIgK-RV1 CTAACACTCATTCCTGTTGAAG gene-specific reverse primers mIgL23-RV1 AGACATTCTGCAGGAGACA gene-specific reverse primers mIgL145-RV1 AACASTCAGCACGGGACA

Multiple layers of B cell memory with different effector functions

Different B Cell Populations Mediate Early and Late Memory During an Endogenous Immune Response

Classswitched memory B cells remodel BCRs within secondary germinal centers

Human germinal centres engage memory and naive B cells after influenza vaccination

Rapid cloning of high-affinity human monoclonal antibodies against influenza virus

Both mutated and unmutated memory B cells accumulate mutations in the course of the secondary response and develop a new antibody repertoire optimally adapted to the secondary stimulus

Immunogenic Stimulus for Germline Precursors of Antibodies that Engage the Influenza Hemagglutinin Receptor-Binding Site

Do Memory B Cells Form Secondary Germinal Centers? Yes and No

Do Memory B Cells Form Secondary Germinal Centers? Impact of Antibody Class and Quality of Memory T-Cell Help at Recall

Do Memory B Cells Form Secondary Germinal Centers? It Depends

Restricted Clonality and Limited Germinal Center Reentry Characterize Memory B Cell Reactivation by Boosting

The extent of affinity maturation differs between the memory and antibody-forming cell compartments in the primary immune response

Antigen recognition strength regulates the choice between extrafollicular plasma cell and germinal center B cell differentiation

High affinity germinal center B cells are actively selected into the plasma cell compartment

Apoptosis and antigen affinity limit effector cell differentiation of a single naive B cell

Regulated selection of germinal-center cells into the memory B cell compartment

Differentiation of germinal center B cells into plasma cells is initiated by high-affinity antigen and completed by Tfh cells

Distinct germinal center selection at local sites shapes memory B cell response to viral escape

The establishment of resident memory B cells in the lung requires local antigen encounter

Transfer of memory cells into antigen-pretreated hosts. I. Functional detection of migration sites for antigen-specific B cells

Transfer of memory cells into antigenpretreated hosts. II. Influence of localized antigen on the migration of specific memory B cells

Unilateral localization of hapten-specific B memory cells in lymph node draining a footpad injection of antigen

Induction and persistence of local B cell memory in mice

Complex Antigens Drive Permissive Clonal Selection in Germinal Centers

The AID-Cre-ERT2 Model: A Tool for Monitoring B Cell Immune Responses and Generating Selective Hybridomas

Programming the magnitude and persistence of antibody responses with innate immunity

Preferential localization of IgG memory B cells adjacent to contracted germinal centers

Cellular interaction in germinal centers. Roles of CD40 ligand and B7-2 in established germinal centers

In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. IV. Affinity-dependent, antigen-driven B cell apoptosis in germinal centers as a mechanism for maintaining self-tolerance

In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. V. Affinity maturation develops in two stages of clonal selection

Follicular dendritic cells: dynamic antigen libraries

Visualizing antibody affinity maturation in germinal centers

B-cell-lineage immunogen design in vaccine development with HIV-1 as a case study

Specific expression of activation-induced cytidine deaminase (AID), a novel member of the RNA-editing deaminase family in germinal center B cells

Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme

Broadly neutralizing human antibody that recognizes the receptor-binding pocket of influenza virus hemagglutinin

Viral receptor-binding site antibodies with diverse germline origins

Memory B Cells that Cross-React with Group 1 and Group 2 Influenza A Viruses Are Abundant in Adult Human Repertoires

Activation-induced cytidine deaminase mediates central tolerance in B cells

Natural IgM is produced by CD5-plasma cells that occupy a distinct survival niche in bone marrow

Structure of influenza virus haemagglutinin complexed with a neutralizing antibody

(C and E) Background-subtracted, normalized MFI values (Log10) for H1 SI-06 (x-axes) and H3 X31 (C, y-axes) or rPA (E, y-axes). Numbers in each quadrant represent frequencies of H1 or H3 or H1/H3 (C) reactive IgGs and H1 or rPA or H1/rPA reactive IgGs among antigen-specific clonal IgGs. Each dot represents an individual clonal IgG. (D and F) Frequencies of H1/H3 cross-reactive IgGs (D) and of H1/rPA cross-reactive IgGs (F) among all antigen-specific IgG.Each dot represents an individual mouse. , p < 0.05 by Mann-Whitney's U test. Combined data from 2 (rPA boosts) and 4 (H3 X31 boosts) independent experiments are shown. There are three riboguanosines (rGrGrG) at 3' end. b These primers contain plate-associated barcodes (0-12) that are indicated in lowercase letters. c These primers contain well-associated barcodes (1-12) that are indicated in lowercase letters. d These primers contain well-associated barcodes (A-H) that are indicated in lowercase letters.