key: cord-0289002-pq0t6x88
authors: Sims, Joshua J.; Lian, Sharon; Meggersee, Rosemary L.; Kasimsetty, Aradhana; Wilson, James M.
title: High activity of an affinity-matured ACE2 decoy against Omicron SARS-CoV-2 and pre-emergent coronaviruses
date: 2022-05-19
journal: bioRxiv
DOI: 10.1101/2022.01.17.476672
sha: aeeeb02fe6eb1d18500a7bf1fb94e7064c57e54b
doc_id: 289002
cord_uid: pq0t6x88

The viral genome of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), particularly its cell-binding spike protein gene, has undergone rapid evolution during the coronavirus disease 2019 (COVID-19) pandemic. Variants including Omicron BA.1 and Omicron BA.2 now seriously threaten the efficacy of therapeutic monoclonal antibodies and vaccines that target the spike protein. Viral evolution over a much longer timescale has generated a wide range of genetically distinct sarbecoviruses in animal populations, including the pandemic viruses SARS-CoV-2 and SARS-CoV-1. The genetic diversity and widespread zoonotic potential of this group complicates current attempts to develop drugs in preparation for the next sarbecovirus pandemic. Receptor-based decoy inhibitors can target a wide range of viral strains with a common receptor and may have intrinsic resistance to escape mutant generation and antigenic drift. We previously generated an affinity-matured decoy inhibitor based on the receptor target of the SARS-CoV-2 spike protein, angiotensin-converting enzyme 2 (ACE2), and deployed it in a recombinant adeno-associated virus vector (rAAV) for intranasal delivery and passive prophylaxis against COVID-19. Here, we demonstrate the exceptional binding and neutralizing potency of this ACE2 decoy against SARS-CoV-2 variants including Omicron BA.1 and Omicron BA.2. Tight decoy binding tracks with human ACE2 binding of viral spike receptor-binding domains across diverse clades of coronaviruses. Furthermore, in a coronavirus that cannot bind human ACE2, a variant that acquired human ACE2 binding was bound by the decoy with nanomolar affinity. Considering these results, we discuss a strategy of decoy-based treatment and passive protection to mitigate the ongoing COVID-19 pandemic and future airway virus threats. Author Summary Viral sequences can change dramatically during pandemics lasting multiple years. Likewise, evolution over centuries has generated genetically diverse virus families posing similar threats to humans. This variation presents a challenge to drug development, in both the breadth of achievable protection against related groups of viruses and the durability of therapeutic agents or vaccines during extended outbreaks. This phenomenon has played out dramatically during the coronavirus disease 2019 (COVID-19) pandemic. The highly divergent Omicron variants of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) have upended previous gains won by vaccine and monoclonal antibody development. Moreover, ecological surveys have increasingly revealed a broad class of SARS-CoV-2-like viruses in animals, each poised to cause a future human pandemic. Here, we evaluate an alternative to antibody-based protection and prevention—a decoy molecule based on the SARS-CoV-2 receptor. Our engineered decoy has proven resistant to SARS-CoV-2 evolution during the ongoing COVID-19 pandemic and can neutralize all variants of concern, including Omicron BA.1 and Omicron BA.2. Furthermore, the decoy binds tightly to a broad class of sarbecoviruses related to pandemic SARS-CoV-2 and SARS-CoV-1, indicating that receptor decoys offer advantages over monoclonal antibodies and may be deployed during the COVID-19 pandemic and future coronavirus outbreaks to prevent and treat severe illness.

The viral genome of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), particularly 21 its cell-binding spike protein gene, has undergone rapid evolution during the coronavirus disease Several groups have identified several sites present in the functional binding epitope of the RBD 82 spike protein that have undergone mutations to evade all currently available classes of 83 monoclonal antibodies (9-11). The most significant escape mutants identified are K417 for class 84 1 antibodies, L452R and E484 for class 2 antibodies, and R346, K444, and G446-450 sites for 85 class 3 antibodies (9, 11). It is concerning that many of these mutations are present in emergent 86 CoV-2 variants, which also show reduced susceptibility to monoclonal antibodies (9, 12, 13).

While comprehensive structural analysis suggests potential improvements for targeting 88 monoclonal antibodies and other biologics to the spike protein for inhibition (14-17), the fact 89 remains that SARS-CoV-2 evolution during the course of the pandemic has generated variants 90 which have evaded essentially the whole spectrum of clinical monoclonal candidates to date (5, 91 18). Furthermore, evidence suggests that application of single monoclonal antibody types in a 92 therapeutic setting can rapidly give rise to escape mutants (19) (20) (21) (22) . Together, these findings call 93 into question the ability of the antibody platform to keep pace with the course of the COVID-19 94 pandemic, or to be of use in future pandemics caused by other coronaviruses.

Receptor decoys may represent a mode of viral neutralization that is more resistant to continued 97 viral evolution and escape-mutant generation (23). SARS-CoV-2 evolution has occurred in a 98 way that retains tight binding to its primary cell entry receptor, angiotensin-converting enzyme 2 99 (ACE2) (24). We and others have developed affinity-matured, soluble ACE2 decoy molecules 100 that potently neutralize SARS-CoV-2 (23, 25-30). Our soluble Fc-fused decoy, CDY14HL-Fc4, 101 contains six amino acid substitutions that improve the neutralization of CoV-2 variants by 300-102 fold versus un-engineered ACE2 and an active site mutation that ablates its endogenous 103 angiotensin-cleaving activity. Furthermore, CDY14HL maintains tight binding or neutralizing 104 activity for the distantly related betacoronaviruses (sarbecoviruses) WIV1-CoV, and SARS-105 CoV-1 despite being engineered for improved activity against SARS-CoV-2 (25). This property 106 suggests that this decoy may be a useful tool to combat future pandemics from currently pre-107 emergent, ACE2-dependent coronaviruses.

Here, we evaluate the binding and neutralization activity of CDY14HL against a wide range of 110 emerging SARS-CoV-2 variants, including Omicron BA.1 and Omicron BA.2, and a wide range 111 of pre-emergent coronaviruses with similarity to SARS-CoV-1 and SARS-CoV-2. These studies 112 suggest the broad utility of decoy-based viral entry inhibitors in combating current and future 113 coronavirus pandemics. 117 We set out to evaluate the ability of our engineered ACE2 decoy to neutralize emerging SARS-

CoV-2 strains. We previously assessed binding between the decoy and CoV RBDs by first 119 expressing and purifying the RBDs and subjecting these to binding analysis using surface 120 plasmon resonance (25). We sought an RBD binding assay that would allow us to assess a broad 121 range of viral sequences for decoy compatibility quickly, without the need to express and purify 122 unique viral proteins. As a first step, we assessed binding to variant RBDs using a yeast display 123 system (31) ( Figure 1A) . We generated budding yeast displaying viral RBDs as fusion proteins 124 to the cell-surface-tethered yeast protein Aga2. We then incubated the RBD yeast with RBD with an apparent affinity of 0.14 nM ( Figure 1B and Table 1 ). This result is in good 128 agreement with the 0.21 nM affinity obtained for the interaction using an orthogonal technique, 129 bio-layer interferometry (BLI, Figure S1 ), as well as with the picomolar binding affinity we 130 previously measured for CDY14HL-Fc4:RBD interaction using surface plasmon resonance (25).

Since our first description of CDY14HL (25), several SARS-CoV-2 variants of concern (VoCs) 133 have emerged, some with greater transmissibility and clinical sequelae than the original Wuhan 134 strain (13, 32, 33); most of the RBD evolution has occurred at the ACE2 interface ( Figures 1C   135 and 1D) and could impact decoy affinity. We used the yeast display system to evaluate decoy 136 binding to RBDs from five of these VoCs (Iota, Delta, Delta Plus, Lambda, and Mu). CDY14HL 137 maintained sub-nanomolar binding affinity for all VoC RBDs ( Figure 1B and Table 1 ). This sub-nanomolar affinity as measured by the RBD yeast display assay ( Figure 1B and Table 1) . 150 The decoy bound yeast-displayed Omicron RBDs at least four-fold more tightly than the 151 ancestral RBD (0.03 nM and 0.02 nM for the BA.1 and BA.2 strains, respectively, Table 1 ).

Another group working on their own decoy recently tested CDY14HL-Fc1 using a similar 153 binding strategy, using HEK293 cells expressing Omicron BA.1 and BA.2 spike glycoprotein 154 instead of yeast. Their results corroborate our data and highlighted that our decoy bound 155 Omicron BA.1 and BA.2 at low nanomolar concentrations (18). We have also confirmed sub-156 nanomolar decoy affinity for the Omicron strain RBDs using BLI, though the two distinct assay 157 formats produced different rank-orders of variant affinities ( Figure S1 ). 160 We next investigated whether the broad decoy affinity for SARS-CoV-2 variants observed using 161 the yeast display binding assay would translate to potent viral neutralization. We used 

Given the broad activity towards SARS-CoV-2 variants with diverse spike sequences, we next 176 evaluated the ability of CDY14HL to bind RBDs from a diverse set of coronaviruses with 177 pandemic potential. Aside from SARS-CoV-1 and SARS-CoV-2, we identified 23 178 sarbecoviruses isolated from bats across Asia, Africa, and Europe (24, 41-53), many of which 179 are thought to use ACE2 as a receptor ( Figure 3A ). We cloned synthetic RBD genes into the 180 yeast display format for binding analysis ( Table 2) . Additionally, we included the RBD from the 181 human coronavirus NL63, an alpha-CoV with a genetically distinct RBD that has been shown to 182 use ACE2 for cell entry (54). We determined the binding affinities of yeast-displayed RBD to Except for Khosta-2 (56), sarbecoviruses from clades 2 and 3 (isolated in Asia and 194 Europe/Africa, respectively) did not bind CDY14HL-Fc1. Based on a recent survey of 195 RBD:ACE2 usage (56), we suspected these clade 2 and 3 RBDs were not capable of human 196 ACE2 binding, which we confirmed in the yeast display system using a soluble wild-type human 197 ACE2-Fc1 fusion protein at 100 nM ( Figure 3B) . Interestingly, Bloom and colleagues recently 198 discovered that a K493Y/T498W double mutation to the RBD of the clade 3 CoV BtKY72 199 confers human ACE2 binding (56). We found that our decoy bound BtKY72 K493Y/T498W 200 RBD with sub-nanomolar affinity, though it could not bind wt-BtKY72 (Table 2, Figure 3C) . 201 This suggests that if distant CoVs acquire mutations that confer the potential for zoonotic spread, 202 CDY14HL would retain potent inhibitory potential.

These binding data are in broad agreement with our previous work demonstrating tight decoy 205 binding to RBDs from SARS-CoV-1 and WIV1-CoV (25); indeed, we confirm SARS-CoV-1 206 and WIV1-CoV binding here using the yeast display assay ( Table 2) . However, we reasoned that 207 viral neutralization comes about not only due to the decoy affinity for the viral target, but also 208 from the ability of the decoy to compete for viral binding with the endogenous ACE2 receptor.

To assess this possibility, we employed a competitive binding assay between the decoy and 210 ACE2 receptor in the yeast system. We incubated RBD yeast with a low concentration of decoy

(1 nM of CDY14HL-hFc1; 95 ng/ml) along with a 100-fold molar excess of wt-ACE2 (100 nM 212 of wt-ACE2-mFc, with a mouse Fc fusion to distinguish it from the decoy). We assessed the 213 level of decoy binding retained in the presence of receptor competition by flow cytometry and 214 compared these values across the set of RBDs ( Figure 3D ).

The positive control, the RBD from the well-neutralized ancestral SARS-CoV-2 strain, retained 217 34% of decoy binding in the presence of 100-fold molar excess of wt-ACE2-mFc ( Figure 3E) . 218 Similar to SARS-CoV-2, all clade 1a and 1b sarbecovirus RBDs tested retained at least 24% 219 binding in the competition assay. Khosta-2, a clade 3 RBD with weak decoy binding ( Table 2) , 220 retained 79% percent decoy binding in the presence of 100-fold excess wt-ACE2. Similarly, the 221 relatively weak-binding RBD from RaTG13 also retained almost complete decoy binding under 222 competition. These examples highlight that decoy affinity alone may be a poor determinant of 223 the ability to compete with endogenous ACE2 as an inhibitor ( Figure S2) . The lone alpha-CoV 224 in our study, NL63, retained the lowest fraction of decoy binding in the competition assay (21%, 225 Figure 3E ). Further study is needed to determine whether this result indicates a lower 226 neutralizing potency of the decoy for the genetically distinct ACE2-dependent alpha-CoVs.

Together with the observed sub-nanomolar decoy binding affinity, these competitive binding 228 data predict broad and potent neutralization of beta-CoVs that can bind human ACE2. As many 229 factors including subtle shifts in co-receptor usage and cell entry mechanism can define the 230 potency of an inhibitor (57), further studies with diverse CoVs in pseudotyped and live-virus 231 systems will be required to confirm this finding. particularly sarbecoviruses that can bind human ACE2, or that whose viral spike proteins only 277 need a small number of mutations to acquire human ACE2 binding. We were delighted to find 278 that the decoy retained very high binding activity against spike proteins from every pre-emergent 279 strain studied that also had the ability to bind human ACE2, suggesting the broad utility of the 280 decoy in the current and future coronavirus pandemics. holds the promise of significantly restricting viral escape, as any mutation that diminishes decoy 287 binding will likely also diminish receptor binding and thus viral fitness. We are quickly moving 288 this ACE2 decoy into the clinic in the AAV platform as well as a protein therapeutic as a 289 possible solution to COVID-19 variants and to prepare for future coronavirus outbreaks. 

To generate wt-ACE2-mFc for competitive binding assays, we cloned human ACE2 (1-615) 338 fused to a C-terminal mouse IgG2a Fc into pcDNA3.1. We transfected the plasmid into Expi293 purification. We previously characterized a decoy fusion to human IgG4 Fc (25), but found that 346 Fc1 and Fc4 decoy fusions behave similarly with respect to binding and neutralization (e.g., the 347 IC50 values against Wuhan-Hu1 pseudotypes were 37 ng/ml and 35 ng/ml for CDY14HL-Fc4 348 and CDY14HL-Fc1, respectively). The RBD sequences of the CoVs were taken from spike protein coding sequences ( Table 2) 352 downloaded from the National Center for Biotechnology Information (NCBI). Using MEGA X 353 (66), we aligned the amino acid sequences in ClustalW and constructed a phylogenic tree using 354 maximum likelihood analysis and bootstrapping with 100 replicates. Table 2 .We cloned the RBDs into a plasmid between an 359 upstream yeast Aga2 gene and a downstream hemagglutinin (HA) epitope tag with flexible GSG 360 linkers. The plasmid has a low-copy centromeric origin similar to that of pTCON2 (67).

Plasmids were transformed into EBY100 using the Frozen-EZ Yeast Transformation II Kit 362 (Zymo). We grew colonies in SD-Trp media before induction in log phase for 24 hr at 30˚C in purification in support of these studies. We thank Alex Martino for assistance with BLI studies. 400 We thank Nathan Denton for assistance with manuscript preparation and graphics. Table 2 and Figure 3E to evaluate the relationship between decoy affinity and the amount of decoy retained in a competitive binding assay.

For the determination of binding affinity, biolayer interferometry measurements were taken on the Octet HTX (Sartorius Corporation). Purified CDY14HL-Fc1 was immobilized on an antihuman IgG Fc sensor (AHC sensor, Sartorius Corporation). Decoy loaded tips were dipped into wells containing purified His-tagged SARS-CoV-2 Spike RBD proteins (R&D Biotechne Corporation). RBD concentrations of 50, 25, 12.5, 6,25, 3.125 and 1.56 nM were used to determine the KDs. The diluent and running buffer for all experiments was 1x Kinetics Buffer (FortéBio, PBS+ 0.02% Tween20, 0.1% BSA, 0.05% sodium azide). KD fits were determined by 1:1 binding model global grouped fits on the Octet Data Analysis HT Version 12.0.2.59 (FortéBio). All measurements were conducted in triplicate.

Nucleotide sequence of CDY14HL-Fc1: TGTTCTATCAAAGTTCACTTGCTgCTTGGAATTATAACACCAATATTACTGAAGAGAA  TGTCCAAAACATGAATAAcGCTGGGGACAAATGGTCTGCCTTTTTAAAGGAACAGTC  CACAtTTGCCCAAATGTATCCACTACAAGAAATTCAGAATCcCACAGTCAAGCTTCAG  CTGCAGGCTCTTCAGCAAAATGGGTCTTCAGTGCTCTCAGAAGACAAGAGCAAACG  GTTGAACACAATTCTAAATACAATGAGCACCATCTACAGTACTGGAAAAGTTTGTAA  CCCgGATAATCCACAAGAATGCTTATTACTTGAACCAGGTTTGAATGAAATAATGGC  AAACAGTTTAGACTACAATGAGAGGCTCTGGGCTTGGGAAAGCTGGAGATCTGAGG  TCGGCAAGCAGCTGAGGCCATTATATGAAGAGTATGTGGTCTTGAAAAATGAGATG  GCgAGAGCAAAcCATTATGAGGACTATGGGGATTATTGGAGAGGAGACTATGAAGT  AAATGGGGTAGATGGCTATGACTACAGCCGCGGCCAGTTGATTGAAGATGTGGAAC  ATACCTTTGAAGAGATTAAACCATTATATGAACATCTTCATGCCTATGTGAGGGCAA  AGTTGATGAATGCCTATCCTTCCTATATCAGTCCAATTGGATGCCTCCCTGCTCATTT  GCTTGGTGATATGTGGGGTAGATTTTGGACAAATCTGTACTCTTTGACAGTTCCCTTc  GGACAGAAACCAAACATAGATGTTACTGATGCAATGGTGGACCAGGCCTGGGATGC  ACAGAGAATATTCAAGGAGGCCGAGAAGTTCTTTGTATCTGTTGGTCTTCCTAATAT  GACTCAAGGATTCTGGGAAtATTCCATGCTAACGGACCCAGGAAATGTTCAGAAAGC  AGTCTGCCtTCCCACAGCTTGGGACCTGGGGAAGGGCGACTTCAGGATCCTTATGTG  CACAAAGGTGACAATGGACGACTTCCTGACAGCTCATCATGAGATGGGGCATATCC  AGTATGATATGGCATATGCTGCACAACCTTTTCTGCTAAGAAATGGAGCTAATGAAG  GATTCCATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACACCTAAGCATT  TAAAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAAGACAATGAAACAGAAATAA  ACTTCCTGCTCAAACAAGCACTCACGATTGTTGGGACTCTGCCATTTACTTACATGTT  AGAGAAGTGGAGGTGGATGGTCTTTAAAGGGGAAATTCCCAAAGACCAGTGGATGA  AAAAGTGGTGGGAGATGAAGCGAGAGATAGTTGGGGTGGTGGAACCTGTGCCCCAT  GATGAAACATACTGTGACCCCGCATCTCTGTTCCATGTTTCTAATGATTACTCATTCA  TTCGATATTACACAAGGACCCTTTACCAATTCCAGTTTCAAGAAGCACTTTGTCAAG  AAATAAACTTCCTGCTCAAACAAGCACTCACGATTGTTGGGACTCTGCCATTTACTT  ACATGTTAGAGAAGTGGAGGTGGATGGTCTTTAAAGGGGAAATTCCCAAAGACCAG  TGGATGAAAAAGTGGTGGGAGATGAAGCGAGAGATAGTTGGGGTGGTGGAACCTGT  GCCCCATGATGAAACATACTGTGACCCCGCATCTCTGTTCCATGTTTCTAATGATTAC  TCATTCATTCGATATTACACAAGGACCCTTTACCAATTCCAGTTTCAAGAAGCACTTT  GTCAAGCAGCTAAACATGAAGGCCCTCTGCACAAATGTGACATCTCAAACTCTACA  GAAGCTGGACAGAAACTGTTCAATATGCTGAGGCTTGGAAAATCAGAACCCTGGAC  CCTAGCATTGGAAAATGTTGTAGGAGCAAAGAACATGAATGTAAGGCCACTGCTCA  ACTACTTTGAGCCCTTATTTACCTGGCTGAAAGACCAGAACAAGAATTCTTTTGTGG  GATGGAGTACCGACTGGAGTCCATATGCAGACCCCAGAGGGCCCACAATCAAGCCC  TGTCCTCCATGCAAATGCCCAGCACCTAACCTCTTGGGTGGACCATCCGTCTTCATCT  TCCCTCCAAAGATCAAGGATGTACTCATGATCTCCCTGAGCCCCATAGTCACATGTG  TGGTGGTGGATGTGAGCGAGGATGACCCAGATGTCCAGATCAGCTGGTTTGTGAAC  AACGTGGAAGTACACACAGCTCAGACACAAACCCATAGAGAGGATTACAACAGTAC  TCTCCGGGTGGTCAGTGCCCTCCCCATCCAGCACCAGGACTGGATGAGTGGCAAGG  AGTTCAAATGCAAGGTCAACAACAAAGACCTCCCAGCGCCCATCGAGAGAACCATC  TCAAAACCCAAAGGGTCAGTAAGAGCTCCACAGGTATATGTCTTGCCTCCACCAGA  AGAAGAGATGACTAAGAAACAGGTCACTCTGACCTGCATGGTCACAGACTTCATGC  CTGAAGACATTTACGTGGAGTGGACCAACAACGGGAAAACAGAGCTAAACTACAAG  AACACTGAACCAGTCCTGGACTCTGATGGTTCTTACTTCATGTACAGCAAGCTGAGA GTGGAAAAGAAGAACTGGGTGGAAAGAAATAGCTACTCCTGTTCAGTGGTCCACGA GGGTCTGCACAATCACCACACGACTAAGAGCTTCTCCCGGACTCCGGGTAAATGA

Broad 450 neutralization of SARS-related viruses by human monoclonal antibodies

Subcutaneous REGEN-COV Antibody Combination to Prevent 456 Covid-19. Reply

Prospective 458 mapping of viral mutations that escape antibodies used to treat COVID-19

Effects of 461 common mutations in the SARS-CoV-2 Spike RBD and its ligand, the human ACE2 receptor on binding 462 affinity and kinetics

In situ structural 464 analysis of SARS-CoV-2 spike reveals flexibility mediated by three hinges

SARS-CoV-2 spike protein: flexibility as a new target for fighting infection

CoV-2 Evolved to Variant Strains Escaping Neutralization of Convalescent Plasmas and RBD-Specific 470

Comprehensive 472 mapping of mutations in the SARS-CoV-2 receptor-binding domain that affect recognition by polyclonal 473 human plasma antibodies

Mapping mutations to 475 the SARS-CoV-2 RBD that escape binding by different classes of antibodies

Neutralization of SARS-CoV-2 Omicron BA.2 by 478 Therapeutic Monoclonal Antibodies. bioRxiv. 2022

Increased 480 transmissibility and global spread of SARS-CoV-2 variants of concern as at

Protein structure analysis of the interactions 483 between SARS-CoV-2 spike protein and the human ACE2 receptor: from conformational changes to 484 novel neutralizing antibodies

Structure, Function, and 488 Antigenicity of the SARS-CoV-2 Spike Glycoprotein

Cryo-EM structure of the 490 2019-nCoV spike in the prefusion conformation

An engineered ACE2 492 decoy receptor can be administered by inhalation and potently targets the BA.1 and BA.2 omicron 493 variants of SARS-CoV-2

Risk of rapid 495 evolutionary escape from biomedical interventions targeting SARS-CoV-2 spike protein

Emergence of 498 SARS-CoV-2 resistance mutations in a patient who received anti-SARS-COV2 spike protein monoclonal 499 antibodies: a case report

Emergence of the 501 E484K mutation in SARS-COV-2-infected immunocompromised patients treated

RESISTANCE 504 CONFERRING MUTATIONS IN SARS-CoV-2 DELTA FOLLOWING SOTROVIMAB INFUSION

Engineered ACE2 receptor 507 therapy overcomes mutational escape of SARS-CoV-2

Functional assessment of cell entry and receptor usage for SARS-509

CoV-2 and other lineage B betacoronaviruses

Intranasal gene therapy 511 to prevent infection by SARS-CoV-2 variants

An engineered decoy receptor for SARS-CoV-2 513 broadly binds protein S sequence variants

Engineered ACE2 receptor 515 traps potently neutralize SARS-CoV-2

Computationally Designed ACE2 Decoy 517 Receptor Binds SARS-CoV-2 Spike (S) Protein with Tight Nanomolar Affinity

ACE2-based decoy receptors for SARS coronavirus 2

Engineering human ACE2 to 522 optimize binding to the spike protein of SARS coronavirus 2

Protein Engineering and 524 Selection Using Yeast Surface Display

Omicron variant (B.1.1.529) of SARS-CoV-2: Mutation, 526 infectivity, transmission, and vaccine resistance

transmissibility, and responses to current COVID-19 vaccines

Insights on the mutational landscape of the SARS-531 CoV-2 Omicron variant

Reduced Neutralization of 533 SARS-CoV-2 Omicron Variant by Vaccine Sera and Monoclonal Antibodies

Omicron escapes the majority of existing 536 SARS-CoV-2 neutralizing antibodies

Broadly neutralizing 538 antibodies overcome SARS-CoV-2 Omicron antigenic shift

Omicron-B.1.1.529 leads to 540 widespread escape from neutralizing antibody responses

Omicron virus escapes neutralization by therapeutic monoclonal antibodies. Res Sq

Reduced neutralisation of 544 SARS-CoV-2 omicron B.1.1.529 variant by post-immunisation serum

Spatial epidemiology 546 and genetic diversity of SARS-CoV-2 and related coronaviruses in domestic and wild animals

Bat 549 coronaviruses related to SARS-CoV-2 and infectious for human cells

Identification of diverse alphacoronaviruses 551 and genomic characterization of a novel severe acute respiratory syndrome-like coronavirus from bats in 552 China

Discovery of a rich gene pool of bat SARS-554 related coronaviruses provides new insights into the origin of SARS coronavirus

Isolation and characterization of a bat 557 SARS-like coronavirus that uses the ACE2 receptor

Novel Bat Coronavirus Closely Related to the Direct Progenitor of Severe Acute Respiratory Syndrome 560 Coronavirus

Addendum: A pneumonia outbreak 562 associated with a new coronavirus of probable bat origin

Complete Genome Sequence of a Severe Acute Respiratory Syndrome-Related 564 Coronavirus from Kenyan Bats

Genomic 566 characterization of severe acute respiratory syndrome-related coronavirus in European bats and 567 classification of coronaviruses based on partial RNA-dependent RNA polymerase gene sequences

Genomic characterization and infectivity of a novel 570 SARS-like coronavirus in Chinese bats

Complete genome analysis of a SARS-like bat 572 coronavirus identified in the Republic of Korea

Extensive diversity of coronaviruses 574 in bats from China

Coronaviruses in Horseshoe Bats (Rhinolophus spp

Human coronavirus NL63 578 employs the severe acute respiratory syndrome coronavirus receptor for cellular entry

Author Correction

CoV-2 and bat RaTG13 spike glycoprotein structures inform on virus evolution and furin-cleavage 582 effects

ACE2 binding is an 584 ancestral and evolvable trait of sarbecoviruses

A Single-Cell RNA Expression Map of Human Coronavirus Entry 586 Factors

An infectious 588 SARS-CoV-2 B.1.1.529 Omicron virus escapes neutralization by therapeutic monoclonal antibodies

Preparing for the Future -Nanobodies for Covid-19?

A potent SARS-CoV-2 neutralising 593 nanobody shows therapeutic efficacy in the Syrian golden hamster model of COVID-19

Structure-guided multivalent 596 nanobodies block SARS-CoV-2 infection and suppress mutational escape

Cross-neutralization of 598 SARS-CoV-2 by a human monoclonal SARS-CoV antibody

FDA updates Sotrovimab emergency use authorization

Ranking the risk of 603 animal-to-human spillover for newly discovered viruses

Versatile and multivalent nanobodies 605 efficiently neutralize SARS-CoV-2

Molecular Evolutionary Genetics Analysis 607 across Computing Platforms

Isolating and engineering 609 human antibodies using yeast surface display

Conformational dynamics of SARS-CoV-2 611 trimeric spike glycoprotein in complex with receptor ACE2 revealed by cryo-EM

Hu-1 RBD is shown with the positions mutated in Omicron BA.1 (E) and

2 (F) in red spheres.Error bars represent standard deviation of at least four replicate 633

Fig 2. CDY14HL maintains potent neutralization for diverse SARS-CoV-2 variants

Viral neutralization assay using lentiviruses pseudotyped with the ancestral

1, or Omicron BA.2 variant spike protein. Error bars represent standard deviation