key: cord-0304748-5g373aav authors: Zhong, Gang; Luo, Yixuan; Zhao, Jianping; Wang, Meng; Yang, Fan; Huang, Jian; Zou, Lijin; Zou, Xuenong; Wang, Qingqing; Chen, Fei; Wang, Gang; Yu, Yin title: Highly efficient healing of critical sized articular cartilage defect in situ using a chemically nucleoside-modified mRNA-enhanced cell therapy date: 2022-05-06 journal: bioRxiv DOI: 10.1101/2022.05.06.490932 sha: 827e7c8dd96270ec67ac00ac5a6c5266d5ea474e doc_id: 304748 cord_uid: 5g373aav Critical sized cartilage defects heal poorly and MSC-based therapies holds promise functional cartilage regeneration either used alone or in combination with growth factors. However, Recombinant protein growth factors were proven to have minimal benefits while to have adverse side effects and high cost. Nonviral mRNA delivery provides a promising, alternative approach to delivering therapeutic proteins within defect lesion for an extended period of time. Despite successful therapeutic outcome in bone and other vascularized tissues, the therapeutic application of mRNA in poorly vascularized tissues such as cartilage is still facing many challenges and rarely studied. We report here using chemically modified messenger RNA encoding TGF-β3(TGF-β3 cmRNA) to enhance the therapeutic efficacy of BMSCs to efficient repair of cartilage defect. Local administration of TGF-β3 cmRNA enhanced BMSCs therapy restored critical-sized cartilage defects in situ in a rat model within 6 weeks with structural and molecular markers similar to its nature counterparts. In addition, the development of osteoarthritis caused by cartilage damage was prevented by this mRNA-enhanced BMSCs therapy evidenced by minimal late-stage OA pharmacological presentations. This novel mRNA enhanced-MSC technology extend the development of new therapeutic approaches for treating functional cartilage repair. Articular cartilage is an important component of synovial joint, cushioning the vibrations and shocks of connected bones during walking, jumping, and other movements[1], which makes it prone to mechanical injury in rigorous athletic and recreational activities [2, 3] . As an avascular tissue, which lacks blood and nutrient supply, articular cartilage once damaged can hardly regenerate by itself, which eventually leads to osteoarthritis (OA) [4] , which is the most common chronic joint ailments worldwide, with estimates showing that it will affect 78 millions people by 2040 [5, 6] . High incidence and limited self-healing pose challenges for the treatment of cartilage defects in both young atheletic population and elderly individuals. Traditional treatments, including nonsteroidal drugs, physiotherapy and surgical transplantation (autograft or allograft), are hindered by their shortcomings such as inefficiency, longterm treatment, side effects and immune rejection [7, 8] . Stem cell therapy has recently received extensive attention for musculoskeletal regeneration due to its multilineage differentiation potential which has demonstrated enormous tissue repair effects in numerous attempts [9] . However, the multilineage potential of stem cells is a double-edged sword, conferring the therapeutic efficacy of stem cell therapy in a variety of tissues, while retaining the risk of teratoma and carcinogenesis, which brings huge potential safety concerns to stem cell therapy [10, 11] . Several researchers have described the role of MSCs transplantation in tumor formation. Tolar and colleagues transplanted MSCs into nude mice and observed tumor formation, and the formed tumors exhibited characteristics typical of osteosarcoma, including sarcoma morphology, typical osteoid formation, and the prevalence of lung metastases [12] . Mohseny et al continuously cultured freshly obtained BMSCs in vitro and injected them into mice subcutaneously. As a result, osteosarcoma-like changes were observed in the back of the mice. Further mechanistic analysis revealed that the continuous loss of the Cdkn2 gene in MSCs appeared to be a key event in the carcinogenesis of MSCs during in vitro culture [13] . To sum up, the unguided and unfettered implementation of stem cell therapy may carry enormous risks and lead to serious consequences. Controlled stem cells differentiation involves many aspects, especially growth factors, which serves as an outstanding candidate to guide stem cell therapy by mediating directed differentiation in a targeted lineage, and some of them have been utilized in clinic, showing great efficacy [14] . Despite the proven success, this therapeutic strategy was shelved in clinical scenarios, largely blaming its short half-life when contacted with body fluids and tissues [15, 16] as well as growing tendency of immune reactions overtime. Long term superphysiological dosage of protein growth factors have shown evident side effects [17] . Gene therapy provides a promising alternative to supply therapeutic proteins in a moderate yet sustainable manner. As an initial attempt with limitations, pDNA is integrated into the genome of target cells with the help of vectors to achieve continuous translation of therapeutic proteins [18] . However, the low transfection efficiencies due to the need for nuclear entry and safety concerns are potential barriers for their clinical translation [19] . Messenger RNA (mRNA) has recently been shown to be an attractive alternative to pDNA. Unlike the case with DNA therapeutics, its effector site is in the cytoplasm and the encoded therapeutic protein is immediately translated in the ribosome with no need to translocate to the nucleus of the cell, which significantly decreases the risk of insertional mutagenesis [20] . Remarkably, mRNA might be capable of enhancing cell therapy. For instance, a single leukapheresis derived peripheral blood lymphocytes are transfected with anti human mesothelin mRNA CAR and are stored as multiple cell aliquots for repeat transfusion [21] . Currently, mRNA enhanced cell therapy(CAR-T) have progressed into clinical trials [22] . Together, recent advances in mRNA technology, led by molecular backbone modifications and mRNA enhanced cell therapy such as the new CAT-T therapy [23] [24] [25] have sparked very strong interests in the use of mRNA in regenerative medicine as a novel, safe and effective way for tissue regeneration. Given that transforming growth factor-β3 (TGF-β3) plays a key role in cartilage regeneration, capable of inducing chondrogenic differentiation of MSCs and promoting cartilage-like matrix deposition [26] , it was selected as targeted protein of which gene encoded for in this project. Here, we have evaluated the ability of a chemically modified mRNA encoding TGF-β3 (TGF-β3 cmRNA) to repair the cartilage defects in a rat articular cartilage defect model by comparing with BMSCs-only treatment strategies. The data demonstrate TGF-β3 cmRNA-enhanced cell therapy effectively healed a critical-sized defect in the rat articular cartilage in situ . The work summarized here illustrates the efficacy and safety of an affordable mRNA-enhanced cell therapy for cartilage regeneration in situ and also hold implication for other low vascularized tissue repair. Briefly, Bone marrow was collected from the femoral cavity of 7-day-old SD rats by flushing of medium using a 22-gauge needle and cultured in complete growth medium (alpha-modified eagle's medium (αMEM, GIBCO, USA), 10% fetal bovine serum (Sigma, USA), 100 U/mL penicillin and 100 mg/mL streptomycin) at 37 °C and 5.0% CO2 in a humidified incubator. The culture medium was replaced every 3 days. All experiments were performed with BMSCs at passage 3. For 3D pellet culture of BMSCs, 1.5×10 6 cells were aggregated into cell pellets by centrifugation at 1000 rpm for 5 minutes and the supernatant was carefully replaced with 10 mL of fresh medium. Chondrogenesis assays were induced by the complete chondrogenic medium, consisting of DMEM high-glucose, 10 ng/mL TGF-β3, 100 nM dexamethasone, 50 μg/mL ascorbic acid 2-phosphate, 1% ITS+ supplement, 10% FBS and 1% P/S. In mRNA treated groups, 10 ng/mL TGF-β3 protein was replacement with TGF-β3 mRNA. It was replaced with three-quarters of the medium every three days until day 21 in culture before taken for other assays. We choose EGFP cmRNA as a reporter to demonstrate the transfection efficiency in HEK 293T cells and BMSCs. HEK 293T cells and BMSCs were seeded at 1×10 5 cells per well in 12-well plate, left to recover for overnight then transfected by EGFP cmRNA at N/P=0, 4, 6, 8, 10, and 12 respectively. 24h after the transfection, cells were captured by fluorescence microscope for imaging, and the fluorescence indensity of each image was quantified by ImageJ to determine the appropriate N/P ratio of transfection. Subsequently, the cell cytotoxicity detection was carried out followed by the above processes using CCK-8 assay (Beyotime Biotechnology, China). Briefly, the cells were treated by CCK-8 reagent solution at 10:1 ratio per well. 1h after incubating in incubator, the absorbance was determined spectrophotometrically at 450 nm using a SpectraMax iD3 (Molecular Devices, USA). Luciferase cmRNA only and Luciferase cmRNA/PEI compounds were injected into both leg joint of rats(n = 6 per group). The compounds were first assembled by mixing PEI and Luciferase cmRNA at N/P=8(Luciferase cmRNA: 20-200μg). Bioluminescence imaging of rats was proceeded using an IVIS Spectrum system (PerkinElmer, USA) at 24h and 96h after the injection. Firstly, rats were anesthetized with isoflurane, and the fur of inspection area was shaved to avoid the luminescent signal interference from the white fur. Rats were placed supine in the IVIS chamber. Superposition of bright field and dark field photos can intuitively show the location and intensity of specific bioluminescence signal in rats. GAGs content was determined by 1,9-dimethylmethyleneblue (DMMB) dye-binding assay. Briefly, serially diluted samples were prepared and the DMMB solution was added. The absorbance was measured at 530 nm using the VMax Kinetic ELISA microplate reader (Molecular Devices, Inc., Sunnyvale, CA). GAGs content was normalized to DNA content in each specimen and presented as GAGs per cell. 3D pellet samples were fixed in 4% paraformaldehyde (12h), frozen and sectioned prior to histological evaluation. H&E (hematoxylin-eosin), Safranin-O, Alcian Blue staining were performed strictly as previously described. For immunohistochemical analysis, 10μm slices were incubated for 30 minutes in blocking solution to prevent nonspecific binding and were then incubated with primary antibodies overnight at room temperature. Rabbit anti-human polyclonal antibodies against collagen type II and Aggrecan (Developmental Studies Hybridoma Bank, Iowa City, IA) were used in this study. A goat anti-mouse secondary antibody (Vector Laboratories Inc., Burlingame, CA) was used for detection. The reaction products were visualized by the Vectastain ABC kit and the DAM Peroxidase Substrate Kit (Vector laboratories Inc., Burlingame, CA), according to the manufacturers' instructions. All negative controls were done using the same staining without using primary antibodies. The experimental animal use protocol for this project was approved by the Institutional Animal Care and Use Committee (IACUC), Shenzhen Institute of Advanced Technology, Chinese Academy of Sciences (SIAT-IACUC-200403-HCS-YY-A1097-01). Seventy-five 6-month-old male SD rats were purchased from Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd, where they were housed and looked after in the experimental animal house. Two weeks later, they were anesthetized with 2% w/v pentobarbital sodium, the knee of SD rats was exposed and a chondral-only defect of 2 mm in diameter and 1.5 mm in depth was generated on the surface of patellar groove using electric drill (BOSCH, Garmany, GBM13). The rats were randomly divided into Collagen I (FibriCol®, Catalog:#5133, Advanced BioMatrix, USA) from bovine skin was prepared as previously described, and neutralized collagen I was diluted to 3 mg/ml using PBS, followed by BMSCs (10 7 cells/mL) and PEI-cmRNA (cmRNA-TGFβ3: 200 ug/mL) were homogenized in the collagen solution by physical stirring at 4 °C. The preparation and storage of the complex were carried out at 4 °C and used within 1 hour. Next, collagen loaded with cmRNA and/or BMSCs was injected into the defective area. 20 μg of cmRNA encoding TGF-β3 and 1×10 6 BMSCs were used for each cartilage defect. In vivo-jetPEI® (Polyplus-transfection® SA, Strasbourg, France) was used as a gene vector to deliver cmRNA-TGF-β3. According to the commercial instructions, PEI-cmRNA polyplexes at nitrogen to phosphate ratios (N/P) of 8 were formulated by mixing 50 μL of in vivo-jetPEI® solution to 100 µL 1.5mg/mL cmRNA encoding TGF-β3 for 15 min at room temperature. For in vivo testing, 20 μg of TGF-β3 cmRNA was used to prepare the polyplexes and then mixed into 100 µL collagen(PureCol ® , Advanced BioMatrix, USA) for each rat joint, prior to implantation. Rat knee was analyzed in µCT scanner (NEMO micro-CT, PINGSENG Healthcare, China) at 2, 4, and 6 weeks post-surgery. µCT scanning was performed with focus over the hindlimbs with a 90 kVP tube voltage and 65 μA current. 3D rendering and processing of CT images were performed by using a commercial image processing software (Avatar; PINGSENG Healthcare, Shanghai, China). Statistical comparisons were made using Student's T test between two samples, and one-way analysis of variance (ANOVA) was used to compare the means among different groups. Tukey's test was used in the post hoc multiple comparisons. All data are presented as the mean ± SD, and a "p" value of less than 0.05 was considered significant. "ns" stands for "not significant." Our study advances an efficient approach to non-vascularized articular cartilage tissue rengeneration by introduction of pro-regenerative factors(s) in situ to enhance BMSCs therapeutic benefits. We demonstrate that chemically nucleoside-modified mRNA enchanced cell therapy is an effective ,safe, and affordable approach to for potential clinical translation. The articular cartilage is an indispensable part of the joint and is vulnerable to wear and tear or physical trauma such as sports or military associated injuries. Unfortunately, research has shown that damage to the cartilage can not self-heal or heal independently, due to the tissue's low metabolic activity and avascularity. Without management, the damaged cartilage underwent progressive deterioration and posed negative effects on adjacent healthy tissue, ultimately landing to osteoarthritis (OA). Therefore there is neither cures nor disease-modifying manage for OA so far. Facing the challegnes of stem cell therapies regarding cartilage tissue regeneration, the application of growth factors offered a straight forward solution, yet their successful clinical translation was hindered by disadvantages from many aspects. Therefore,we In addition, whether the regenerated cartilage bear the biomechanical properties comparable to its nature counterparts also needs futher investigation performed in a relatively longer and larger study cohort. Lastly, the heterogeneity of BMSCs also needs to be considered while used side by side with cmRNA. Before planning clinical translation of our strategy, similar studies need to be carried out in a large animal models like porcine for further confirmation of its efficacy, safety and pharmacokinetics. With two modified mRNA-based COVID-19 vaccines currently approved for clinical use along with a big success [27, 28] , the safety and scalability of this technology has been established and modified mRNA technology has been applied in the treatment of various other diseases [29] . Tissue regeneration is a particularly suitable application for mRNA theraputics, because repetitive or systemic administration could be waived and the sustained regeneration of tissues could be achieved by effcient local growth factor expression in a timely and regional manner as illustrated by successful cases in liver, heart, skin and bone tissue [30] [31] [32] some of which has already advanced into clinical trials. These studies proved that mRNA can be used at a lower dose than its recombinant protein analog while obtaining successful therapeutic effects. Although systematical administration of nucleosides-modified mRNA could cause severe complications such as liver injury [33, 34] or heart problems [35] . Local injection in the context of regenerative medicine took advantages while avoided disadvantages of mRNA theraputics which clearly addressed their potential for successfully clinical translation. Furthermore ,the clinical application of mRNA have to overcome two main hurdles :the poor pharmacokentics (unstable) and high immunogenicity. Several methods were designed to resolve the problems such as modifying the 5′ cap, the 5′ and 3′UTRs, and the poly(A) tail [36, 37] . We previously reported the combination of the special UTRs and pseudouridine based modified for high translational efficiency and lower immunological responses to mRNA [38] . In this study, we provided proof-of-principle evidence for the first time that administration of chemically nucleoside-modified mRNA encoding TGF-β3 enhanced BMSCs into rat joints is capable of healing critical- Preparation of chemically modified mRNA(cmRNA) encoding TGF-β3, luciferase, TGF-β3-Wasabi achieve mRNA modification, the following modified ribonucleic acid triphosphates were added to the reaction at a ratio of 100%: pseudouridine-5'-triphosphate and 5-methylcytidine-5'triphosphate. Synthesized mRNA was purified and analyzed for size and purity. After the TGFb cmRNA was synthesized, the degree of immune response to unmodified and modified TGF-b3 mRNA were evaluated by transfection of the human Peripheral blood mononuclear cell,PBMC). RNA transfections were conducted using RNAiMAX (Invitrogen). RNA and reagent were first diluted in Opti-MEM basal media (Invitrogen). 100 ng/uL RNA was diluted 5x and 5 uL of RNAiMAX per microgram of RNA was diluted 10x, then these parts were pooled and incubated 15 minutes at room temperature (RT) before being added to culture media. Transfected cells were lysed using 400 uL CellsDirect reagents (Invitrogen), and 20 uL of each lysate was taken forward to a 50 uL reverse transcription reaction using the VILO cDNA synthesis kit (Invitrogen). Reactions were purified on QIAquick columns (Qiagen). qRT-PCR of the interferon related genes such as RIG-I (Forward primer: GTTGTCCCCATGCTGTTCTT;Reverse primer: GCAAGTCTTACATGGCAGCA) and TLR7 (Forward primer: CCTTGAGGCCAACAACATCT; Reverse primer: GTAGGGACGGCTGTGACATT). Transfected cells were lysed using 400 uL CellsDirect reagents (Invitrogen), and 20 uL of each lysate was taken forward to a 50 uL reverse transcription reaction using the VILO cDNA synthesis kit (Invitrogen). Reactions were purified on QIAquick columns (Qiagen). qRT-PCR reactions were performed using SYBR FAST qPCR supermix (KAPA) Biosystems). The transfection efficiency of PEI-cmRNA polyplexes was assessed by western blotting and RT-PCR. 1.0×10 5 HEK 293T cells were seeded in 6-well plates, and after overnight, the medium was exchanged with serum-free medium. The polyplexes were assembled by mixing PEI and cmRNA-TGF-β3 at N/P=8 followed by an incubation for 15 min at room temperature. A complex containing 2 µg of TGF-β3 cmRNA was added to the med ium, and after 24 hours of treatment, cells were lysed by RIPA Reagent (Pierce, USA) containing 1% proteinase inhibitor (Thermo Fisher Scientific, USA) on ice for 30 min. The supernatants were harvested after centrifugation for 30 min at 12, 000 ×g. The bicinchoninic acid (BCA; Biocolors, China) method was used for estimation of total protein content. About 50 μL of protein samples were denatured and separated by 10% SDS-polyacrylamide gels and transferred onto nitrocellulose membranes (Millipore, USA). The membranes were blocked in 5% commercial skim milk at room temperature for 1 h and probed with primary antibodies for TGF-β3 (Abcam, USA, 1: 1000) or GAPDH (Abcam, USA, 1: 5000) at 4℃ overnight, washed, and incubated with secondary antibodies (Cell Signaling Technology, USA, 1: 10000) at room temperature for 1 h. The membranes were visualized by enhanced chemiluminescence (ECL; Millipore, USA), and densitometry was performed using ImageJ software (Version 1.50i, USA). Luciferase cmRNA only and Luciferase cmRNA/PEI compounds were injected into both leg joint of rats(n = 6 per group). The compounds were first assembled by mixing PEI and Luciferase cmRNA at N/P=8(Luciferase cmRNA: 20-200μg) . Bioluminescence imaging of rats was proceeded using an IVIS Spectrum system (PerkinElmer, USA) at 24h and 96h after the injection. Firstly, rats were anesthetized with isoflurane, and the fur of inspection area was shaved to avoid the luminescent signal interference from the white fur. Rats were placed supine in the IVIS chamber. Superposition of bright field and dark field photos can intuitively show the location and intensity of specific bioluminescence signal in rats. For non-immunotherapy applications including protein replacement therapy investigated in this study, an important factor influencing the therapeutic outcome of mRNA is the inherent innate To determine the appropriate N/P ratio of transfection, EGFP mRNA was transfected at N/P=4, 6, 8, 10, and 12 respectively in HEK293T cells and BMSCs. The fluorescence indensity showed that the efficiency of cell transfection was significantly improved when N/P=6 and 8 (Supplemental Figure 3a, b) . Next, we evaluated the cytotoxicity of transfected HEK293T and BMSCs over 24h using a CCK-8 assay in order to confirm that the PEI-cmRNA complex has no negative effect on cellular growth. As shown in Fig. 4c , whatever the N/P ratio is, the proliferation of transfected cells was similar to the untransfected group, suggesting that PEI-cmRNA complex have no influence on cell proliferation. We choose EGFP cmRNA as a reporter to demonstrate the transfection efficiency in HEK 293T cells and BMSCs. HEK 293T cells and BMSCs were seeded at 1×10 5 cells per well in 12-well plate, left to recover for overnight then transfected by EGFP cmRNA at N/P=0, 4, 6, 8, 10, and 12 respectively. 24h after the transfection, cells were captured by fluorescence microscope for imaging, and the fluorescence indensity of each image was quantified by ImageJ to determine the appropriate N/P ratio of transfection. Subsequently, the cell cytotoxicity detection was carried out followed by the above processes using CCK-8 assay (Beyotime Biotechnology, China). Briefly, the cells were treated by CCK-8 reagent solution at 10:1 ratio per well. 1h after incubating in incubator, the absorbance was determined spectrophotometrically at 450 nm using a SpectraMax iD3 (Molecular Devices, USA). Supplemental ) Immunohistochemical (collagen II)semi-quantitative analysis. Composition and dynamics of articular cartilage: structure, function, and maintaining healthy state Evaluation of equine articular cartilage degeneration after mechanical impact injury using cationic contrast-enhanced computed tomography Osteoarthritis year in review 2018: mechanics. Osteoarthritis and cartilage Articular cartilage repair. The American journal of sports medicine Chondroprotective Factors in Osteoarthritis: a Joint Affair Years lived with disability (YLDs) for 1160 sequelae of 289 diseases and injuries 1990-2010: a systematic analysis for the Global Burden of Disease Study Early loss of subchondral bone following microfracture is counteracted by bone marrow aspirate in a translational model of osteochondral repair. Scientific reports Bone tissue engineering and regeneration: from discovery to the clinic-an overview Repair and tissue engineering techniques for articular cartilage Multilineage potential of adult human mesenchymal stem cells. science Safety of mesenchymal stem cells for clinical application Sarcoma derived from cultured mesenchymal stem cells. Stem cells Osteosarcoma originates from mesenchymal stem cells in consequence of aneuploidization and genomic loss of Cdkn2 Mesenchymal stem cells for cartilage regeneration Growth factors in wound healing: the present and the future? Clinics in podiatric medicine and surgery A critical review of recombinant human bone morphogenetic protein-2 trials in spinal surgery: emerging safety concerns and lessons learned. The spine journal Growth factor engineering strategies for regenerative medicine applications. Frontiers in bioengineering and biotechnology Sustained delivery of plasmid DNA from polymeric scaffolds for tissue engineering Off-target RNA mutation induced by DNA base editing and its elimination by mutagenesis mRNA-based therapeutics-developing a new class of drugs Development of anti-human mesothelin-targeted chimeric antigen receptor messenger RNA-transfected peripheral blood lymphocytes for ovarian cancer therapy TriMix and tumor antigen mRNA electroporated dendritic cell vaccination plus ipilimumab: link between T-cell activation and clinical responses in advanced melanoma A simple method for deriving functional MSCs and applied for osteogenesis in 3D scaffolds Fighting Cardiac Fibrosis with CAR T Cells CAR T cells produced in vivo to treat cardiac injury An update on transforming growth factor-β (TGF-β): Sources, types, functions and clinical applicability for cartilage/bone healing Safety and Efficacy of the BNT162b2 mRNA Covid-19 Vaccine Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine Dual mRNA therapy restores metabolic function in long-term studies in mice with propionic acidemia Modified mRNA directs the fate of heart progenitor cells and induces vascular regeneration after myocardial infarction Murine liver repair via transient activation of regenerative pathways in hepatocytes using lipid nanoparticle-complexed nucleoside-modified mRNA Intradermal delivery of modified mRNA encoding VEGF-A in patients with type 2 diabetes Liver injury after mRNA-based SARS-CoV-2 vaccination in a liver transplant recipient Systemic delivery of factor IX messenger RNA for protein replacement therapy Myocarditis Cases Reported After mRNA-Based COVID-19 Vaccination in the US From Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA Messenger RNA modifications: Form, distribution, and function Modeling the mitochondrial cardiomyopathy of Barth syndrome with induced pluripotent stem cell and heart-on-chip technologies The authors thank the study participants and the authors thank Yuting Yang,Yuanyuan Zhang and Shi Chen for administrative support.