key: cord-0336542-opvfknwj
authors: Patel, Paresh; Siddappa, Shilpa; Ravindran, Balachandran; Saiyed, Taslimarif
title: Therapeutic role of Filarial HSP70 in murine models of polymicrobial sepsis and H1N1 Influenza
date: 2021-09-17
journal: bioRxiv
DOI: 10.1101/2021.09.17.460786
sha: ed7d66bb71f4891ad635d1fb66a19e90b552b4f5
doc_id: 336542
cord_uid: opvfknwj

Nematodes characteristically modulate effector immune responses by synthesizing and releasing both anti-inflammatory as well as proinflammatory molecules in infected hosts. Pre-clinical studies suggest that immuno-modulatory molecules and synthetic small molecules that mimic parasite products could have therapeutic value to ameliorate tissue damage found in inflammatory diseases. We report here identification of a glycoprotein from filarial parasite, a homologue of mammalian Heat Shock Protein 70 with immunostimulatory attributes. The purified native glycoprotein designated as FHSP70 and its recombinant protein moiety, WFL were found to be TLR2 and TLR4 agonists in vitro in human myeloid cells and induce systemic inflammatory cytokines in vivo. Cecal ligation and puncture (CLP) performed in mice which leads to onset of poly microbial sepsis and mortality could be treated by therapeutic administration of a single dose of FHSP70, along with antibiotics, suggesting its potential as a immunotherapeutic adjuvant for clinical management of Sepsis. Intra-nasal administration of WFL to mice followed by challenge with virulent human Influenza-A virus resulted in decreased viral growth as well as improved survival. The protective effect was demonstrable by both prophylactic as well as therapeutic intranasal administration of WFL. Further, therapeutic administration of WFL by intraperitoneal route 5 days post viral challenge also resulted in significant decrease in viral load in the respiratory tract. One sentence Summary Systemic administration of a Filarial HSP70 acts as an adjuvant therapy, through immuno-modulation, for improved survival against murine Polymicrobial Sepsis and Viral Infection while its intra nasal administration protects mice prophylactically as well as therapeutically against H1N1 Influenza viral challenge.

2 have therapeutic value to ameliorate tissue damage found in inflammatory diseases. We report here identification of a glycoprotein from filarial parasite, a homologue of mammalian Heat Shock Protein 70 with immunostimulatory attributes. The purified native glycoprotein designated as FHSP70 and its recombinant protein moiety, WFL were found to be TLR2 and TLR4 agonists in vitro in human myeloid cells and induce systemic inflammatory cytokines in vivo. Cecal ligation and puncture (CLP) performed in mice which leads to onset of poly microbial sepsis and mortality could be treated by therapeutic administration of a single dose of FHSP70, along with antibiotics, suggesting its potential as a immunotherapeutic adjuvant for clinical management of Sepsis. Intra-nasal administration of WFL to mice followed by challenge with virulent human Influenza-A virus resulted in decreased viral growth as well as improved survival. The protective effect was demonstrable by both prophylactic as well as therapeutic intranasal administration of WFL. Further, therapeutic administration of WFL by intraperitoneal route 5 days post viral challenge also resulted in significant decrease in viral load in the respiratory tract.

Several immunomodulatory molecules have been identified from nematodes (1, 2) . These molecules largely have been found to induce anti-inflammatory host responses by generating a dominant Th2 cytokines such as IL-4 and IL-13 (3) (4) (5) and/or activate macrophages by alternate pathway characterized by decreased generation of inflammatory cytokines viz., TNF-a, IL-1b, IL-6 etc., (6, 7) .

Nematode mediated suppression of inflammation has been attributed to release of anti-inflammatory molecules by adult parasites and have also been proposed for therapeutic management of auto-immune inflammatory diseases such as IBD, Crohn's disease and experimental models of arthritis (8) (9) (10) .

Paradoxically, induction of inflammatory host responses are also common features of acute as well as chronic symptoms in systemic helminth infections (11) . Growth and development of nematodes in their mammalian hosts have been proposed to depend on induction of inflammatory host responses suggesting presence of inflammatory molecules by worms (12) Molecules with inflammatory attributes that activate innate immunity contributing to virulence of parasites in infected hosts have also been reported although less frequently (2, 13) Homologues of mammalian alarmin classified as a Danger Associated Molecular Patterns (DAMP) which have been associated with virulence of pathogens have been identified in several eukaryotic parasites (14) and reviewed in (13).

Approaches using molecules such as Eritoran (lipid A derivative) and recombinant anticoagulant molecule, Xigris (Activated Protein C) and other anti-inflammatory molecule have been attempted as Sepsis therapeutic, but, without success in clinical trials (15, 16) . Failure of clinical trials for anti-inflammatory molecules that appeared promising in pre-clinical studies has been attributed to induction of immune paralysis in patients with septic shock/severe sepsis rather than hyperinflammation and cytokine storm observed in Sterile Inflammatory Response Syndrome (SIRS) and early stages of sepsis (17) and adverse prognosis is attributable to immune paralysis rather than hyperinflammation. Not surprisingly, several recent studies suggest potential use of pro-inflammatory molecules for Sepsis treatment (18) . We had identified a large molecule weight glycoprotein from filarial parasites, designated as AgW displaying high affinity for TLR-4 (7). The glyco moiety was identified to be poly N-Acetyl D Glucosamine (Chitin). We had further demonstrated that its hexasaccharide, Chitohexose bound to TLR4 and activated macrophages by alternate pathway and blocked endotoxemia (7) . In the current manuscript, we describe the protein back-bone of AgW which was found to be a nematode homologue of heat shock protein 70. The molecule designated as FHSP70 was found to be a TLR2 and TLR4 agonist in vitro. In a murine model of polymicrobial sepsis FSHP70 improved survival of animals as an adjunct to antibiotics. More significantly, it also protected mice in a challenge model of viral sepsis. Induction of suppression of innate anti-viral responses in upper respiratory tract by viral pathogens play a critical role in progression of infection leading to lung pathology (19) . Intra-nasal application of TLR2/6 agonists that activate the innate immune system have been shown to protect experimental hosts against viral infections (20, 21) . In this context the findings being reported here on a single intra-nasal dose of a recombinant filarial HSP70, WFL, inhibiting virulent Influenza-A viral challenge in mice suggests its potential as a candidate anti-viral drug for management of viral influenza in infected humans.

Soluble filarial extracts and their WGA lectin binding glycoproteins (AgW) were found to have immunomodulatory properties (7) . However, the active protein(s) that contributed to the immunomodulatory property of AgW were not identified. For this, the AgW protein was purified and subjected to size exclusion chromatography for sub-fractionation. The profile showed multiple peaks, P1, P2, P3 and P4 (Fig 1A) . The major protein was found to be eluting in P1. The yields of other peaks P2-P4 were low and they were pooled together and designated as pooled peaks (Pp) for further experimentation. AgW, P1 and Pp activated monocytic cell line, THP-1 and secreted inflammatory cytokines viz., IL6, IL-10, IL-1b, TNF-a and MCP-1 in a dose dependent manner, (Fig 1B) suggesting the inflammatory potential of AgW and purified P1 (but not Pp fraction ) Characterization of P1 protein and its immunomodulatory activity P1 protein was analysed using western blot with biotinylated lectin before and after treatment with de-glycosylating enzymes viz; O-glycosidase, PNGase A and PNGase F. PNGase F reduced P1 protein to a 70 KDa molecule ( Fig 1C) suggesting presence of N-linked glycan. Further analysis by mass spectrometry based proteomic analysis revealed that P1 protein is a homologue of mammalian Heat Shock Protein 70, designated as FHSP70 (Supplementary Figure 1) . The gene for FHSP70 was cloned and expressed in a bacterial system to generate its de-glycosylated full Length protein, referred herein after as WFL. Filarial HSP70 sequence is highly conserved among filarial species and displays 77% homology with human HSP70. Given the immune-stimulatory properties of HSP70, we investigated the potential of both Human HSP70 and Filarial HSP70 as a therapeutic molecule against pathogens in this study. Although FHSP70 shares significant homology to its mammalian counterpart, it was essential to investigate its immunogenicity in human filariasis patients with acute or chronic filariasis. Antibodies to native filarial HSP70 (P1) could be detected ( Fig 1D) while the reactivity was found to be directed primarily towards carbohydrate moieties since there was no significant reactivity to WFL (Fig 1D) suggesting the protein backbone was either not exposed to the immune system or was not immunogenic owing to its sequence conservation with its mammalian counterpart.

Filarial glycoproteins have been previously observed to interact with TLR4 (7). To understand whether FHSP70 activates TLR4 mediated signalling, HEK-Blue TLR4 reporter assay was utilized (22) and a dose dependent activation was observed. Activation by FHSP70 and LPS were synergistic as shown in 5 TLR4 reporter assay and THP-1 cells (Fig 1F and 1G ). 50ng/ml or 100ng/ml of P1 was tested in HEK-Blue TLR4 cells along with increasing doses of LPS, where additive activation of TLR4 was observed ( Fig 1F) . This was further confirmed in THP-1 cells (Fig 1G) . The results indicated synergy between FHSP70 and LPS in inducing cytokines and chemokines such as IL-6, IL-10, IL-1b, TNF-a and MCP-1 ( Fig 1G) .

Both native FHSP70 (P1) and recombinant FHSP70 (WFL) display comparable TLR2 and TLR4 agonist activity: Immunomodulatory activity of native FHSP70 and WFL were tested using different TLR reporter assays including TLR2, TLR3 and TLR4 (Fig 2A-2C) . The results indicated stimulation through TLR 2 (Fig 2A) and TLR 4 ( Fig 2C) with no stimulatory activity for TLR3 ( Fig 2B) . These observations were further confirmed in THP-1 cells using LPS and IL-4 as controls for classical and alternate activation, respectively. P1 and WFL had similar effects on induction of IL-1b, TNF-a, CD274, CCL-13, IL-18 ( Fig 2D-2H ). Both P1 and WFL significantly increased the levels of CCL-13 ( Fig 2F) and CD274 ( Fig 2G) and reduced the levels of IL-18 ( Fig 2H) consistent with classical activation as seen with LPS.

Previously, the protective effects of Chitosugars associated with filarial glycoprotein AgW was studied only in a murine model of endotoxemia and not in a polymicrobial sepsis model. In microbial sepsis model, antibiotics are used to control the pathogens while PAMPs continue to activate the immune system leading to uncontrolled immune hyperactivation followed by immune paralysis at a later stage (23) . FHSP70 and its recombinant form WFL were tested for early as well as late stage therapeutic effect. A single dose of either 10 ug or 25 ug of test protein was administered intra-peritoneally along with antibiotics at 6 hours post-surgery ( Fig 3A) and for late stage intervention, similar doses were administered 24 hours post-surgery and animals were scored for survival ( Fig 3B) . In the early stage intervention, group treated with 25 ug FHSP70 showed about 40% survival, while in mice treated with only antibiotics around 20% survived ( Fig 3A) and none of the control mice survived post CLP.

However, late stage intervention with FHSP70 (P1) protected about 80% of mice in a dose dependent manner (Fig 3B left panel ) and Pp treatment showed 50% survival (Fig 3B right panel) .

Hyperinflammation is a consistent feature of sepsis and cytokines such as TNF-a, IL-6, IL-10, IL-1b and MCP-1 are significantly elevated resulting in a characteristic cytokine storm observed during sepsis. Plasma cytokines were measured to correlate their levels with clinical outcome viz., mortality versus survival in mice undergoing CLP. To understand, whether the protective effects of Pp and P1 are mediated through the control of these cytokine, circulating plasma IL-6 levels were analyzed 6 hours post intervention. Only Pp treated group showed significant reduction as compared to the untreated group ( Fig 3C) . IL-10, IL-1b, TNF-a and MCP-1 levels were also checked 48 hours post intervention ( Fig 3D) and the results showed no significant difference between levels of these cytokines in different groups indicating that the protective effects of late stage intervention with FHSP70 (P1) are independent of regulation of these cytokines.

HSP70 is a conserved molecule across species and in-silico docking study revealed that C-terminal domain of filarial HSP70 is important for its interaction with TLR4 (data not shown). The protein sequence of Setaria digitata, W.bancrofti and B.malayi HSP70 were found to be highly conserved (95-98% sequence similarity), while the human HSP70 displayed only 77% similarity to filarial sequence ( Fig 4A) . This difference in sequence may contribute to difference in immunomodulatory properties of Human and filarial HSP70. To assess this, a recombinant version of Human full length HSP70, was cloned and purified from bacterial expression system, referred further as HFL. The activity of WFL and HFL were compared in the TLR2 and TLR4 reporter assays. WFL was found to be more potent than HFL in mediating NF-kB and AP-1 signalling ( Fig 4B) . These findings were consistent when THP-1 cells were used for activation -WFL treatment led to significantly higher induction of IL-6, IL-10, IL-1b and TNF-a ( Fig 4C) .

The respiratory infection caused by viruses and other pathogens are encountered by the nasal mucosa and innate immune responses by activation of TLRs is proven to be beneficial to the host (20) .

To investigate if WFL is tolerated in-vivo in mice and is capable of inducing the innate immune system, a single dose of 25ug of WFL or HFL was administered through intranasal route. The body temperature and body weight over 7 days post treatment were measured and the plasma samples were collected 24 hours post treatment. All treated mice were healthy and showed no change in weight and temperature when compared to untreated mice (Fig 4D and 4E ). Analysis of plasma samples from these mice revealed the ability of only WFL in inducing a systemic innate immune response when 7 administered by intra-nasal route (Fig 4F) similar to observation made in vitro (Fig 4C ) , where WFL induced relatively more potent response than HFL.

Lung is the major organ affected during respiratory infections and infections get initiated in the nasal mucosa. Effect of intra-nasal administration of WFL was evaluated in mouse influenza model to monitor viral growth, lung pathology as well as mortality (Fig 5A) . In first group, a single prophylactic dose of 25ug was given through intranasal route, 1 day prior to infection. In second group, a single therapeutic dose of 25ug was given, 1 day after the infection to understand the protective effects in early stages of infection. In the third group, single intraperitoneal dose of either 25ug or 50ug was given five days post infection to study the protective effects in viral sepsis. The lungs were harvested fifteen days post infection and visible haemorrhage was observed in mice infected with influenza, which was substantially reduced in the WFL treated mice (Fig 5B) . Further histological analysis revealed that immune infiltration and haemorrhage was significantly reduced in all WFL treated group as compared to the infected control mice (Fig 5C) . The viral load was measured in the harvested lungs by infectivity assays and the results indicated two to three log reduction in viral titers in treated group when compared to the infected control mice (Fig 5D) .

The clinical parameter such as temperature, body weight and overall survival were investigated in the different study group described in Fig 5A. The uninfected group showed no change in the temperature over 12 days of the study, while the infected group showed signs of hypothermia with minimum temperature reaching below 94 0 F on day 6 and the temperature returned to normal in surviving animal by day 10 (Fig 6A-6C) . The extent of hypothermia as well as its duration was reduced in the group that received a single prophylactic dose of WFL (Fig 6A) . Similar results on hypothermia were observed in the second study group that received a single therapeutic dose 24 hours post infection through the intranasal route (Fig 6B) . In the third group, that received an intraperitoneal dose between day 4 and 5 post infection, no significant changes were observed in the temperature between different groups ( Fig   6C) . Body weight post infection was another clinical parameter that was assessed. Marked reduction in in the body weight was observed in the infected group within 3-4 days post infection as compared to uninfected mice (Fig 6D-6F ). The mice that received a single prophylactic dose of WFL or HFL showed no loss in body weight (Fig 6D) . Similar results were observed in the group that received a single therapeutic dose 24 hours post infection (Fig 6E) . In the late intervention group the weight was reduced for first four days and post intervention on the 5 th day with a single dose of 50 ug, both WFL and HFL treated group showed recovery in the lost body weight that returned to baseline levels by day 8 to 9 (Fig 6F) . Mice that received the WFL either by intranasal route (Fig 6G and 6H ) or by intraperitoneal route (Fig 6I) survived better than control infected mice, WFL being superior to HFL.

The current manuscript reports two striking novel observations on the filarial heat shock protein70, FHSP70 or its recombinant version, WFL. A single intra-peritoneal administration protected mice against mortality from poly microbial sepsis induced by cecal ligation and puncture, a gold standard for evaluating potential drugs in pre-clinical studies for clinical improvement of Sepsis.

Second, a single intranasal or intraperitoneal administration of WFL protected mice from developing severe pathology and mortality induced by challenge with influenza-A virus, H1N1 by intra nasal route.

Historically, immuno-modulation using anti-inflammatory molecules as potential drugs have been the mainstay for management of experimental sepsis since induction of unregulated inflammation associated with production of very high levels of inflammatory cytokines has been one of the cardinal features of experimental and human sepsis. However impressive success using anti-inflammatory molecules in pre-clinical studies failed uniformly in subsequent clinical trials (15, 16, 24) . This has been attributed to induction of severe immune paralysis observed in patients with septic shock (that follows sepsis) rather than hyper-inflammation per se for adverse prognosis in clinical sepsis (25) .

This has led to the realisation that use of inflammatory molecules or enhancement of host innate immunity (rather than anti-inflammation) could be more beneficial for management of immunosuppression observed in patients with septic shock. Not surprisingly, inflammasome activation and IL-1b has been found to be beneficial for overcoming immunosuppression in Sepsis (26) clinical trials using IFN-g (NCT01649921), GM-CSF (NCT03769844) and IL-7 (NCT03821038) etc are being currently tested (27) (28) (29) for clinical use.

In the current study, a dominant filarial glycoprotein, a homologues of human heat shock protein70, designated as FHSP70, identified by fractionation and mass spectrometry of previously unexplored glycoprotein (AgW), was found to be a potent immune-modulator and its characterization revealed significant homology of this fraction with HSP70 (Fig 1) . It induced significant protection 9 when tested in a murine sepsis model of ceacal ligation and puncture. Our observation that FHSP70 being a pro-inflammatory molecule improves survival against polymicrobial Sepsis only when administered after onset of sepsis (which simulates real life scenario in human patients) and not when administered early (within 6 hours) after CLP procedure, fits into the existing conundrum of pathogenesis of Sepsis viz., immune paralysis observed in later stages of sepsis needing reversal and reprogramming by induction of host inflammatory responses using pro-inflammatory molecules. A recent report on therapeutic benefit of extracellular mammalian HSP72 in a mouse model of peritonitis offers further credence (30) since FHSP70 was found to be a TLR2 and TLR4 agonist as shown in this manuscript. Filarial HSP70 homologue was superior to human HSP70 in inducing protection against sepsis possibly attributable to 22% dissimilarity between Human and Filarial HSP70 in their Cterminal sequence. Administration of Mycobacterium w (Mw), another TLR2 agonist, has been reported to be beneficial to patients with severe sepsis patients as shown by improved clinical score and reduced stay in ICU (31).

More significantly, administration of a recombinant filarial HSP70, designated as WFL, a scalable molecule for clinical use by intra nasal route induced systemic inflammation suggesting its translational potential and led us to evaluate its efficacy in an intra nasal challenge model of influenza virus, H1N1 in mice. Although several antiviral drugs have been approved for treatment of Influenza in humans viz., neuraminidase inhibitors, cap-dependent endonuclease inhibitors, humanised single chain antibodies, M2 channel blockers etc., there is an acute need to develop effective therapeutics for management of periodic respiratory viral disease outbreaks in human communities (31, 32) . In this backdrop, the data presented here on efficacy of WFL is significant -prophylactic as well as therapeutic administration by intra nasal route significantly decreased the viral load, pathology in the upper respiratory tract and mortality (Fig 5 and 6 ) on challenged with virulent H1N1 strain of Influenza virus. More critically, treatment of infected animals 24hr and even 5 days post viral challenge also mediated measurable protection. These observations offer opportunities for its potential human use as a nasal spray for clinical management of symptomatically infected Influenza patients. Extracellular HSP70 has been reported to innately activate dendritic cells and modulate cytokine production including activation of Interferon regulatory genes (IRGs) and been found to have beneficial effect for cancer treatment (33, 34) and the present study is the first to report their potential as an anti-viral molecule with therapeutic efficacy in a pre-clinical model of murine Influenza. 

AgW, the WGA binding glycoproteins from the adult Setaria digitata worms, was prepared using previously described protocol (7) . The purified AgW was subjected to size exclusion chromatography in ÄKTA pure (GE Healthcare Life Sciences) with the Superdex G75 column. The fractions were collected and lyophilized. The proteins were resuspended and passed through EndoTrap® red endotoxin removal kit (LIONEX GmbH, Germany) and stored in endotoxin free water (Cat.

No.#95289-1L, Sigma-Aldrich).

The Mutiplex immunoassay for Human and Mouse IL-1b, IL-6, IL-10, TNF-a and MCP-1 were purchased from Bio-Rad. For human cytokines, 0.5x10 6/ THP-1 cells were seeded in 24 well plate a day before and treated with 100ng/ml LPS or indicated amounts of protein for 24 hours. The culture supernatants were directly used for the assay without dilution. For mice cytokines, the plasma samples from mice were collected 6 or 48 hours post treatment and the diluted 1:2 before assay. The assay was performed as per the manufacturers protocol and the beads were read and analyzed in Bio-Plex ® MAGPIX™ Multiplex Reader (Bio-Rad). 

The Ceacal ligation and puncture (CLP) study with 7-9 week old C57BL/6 males was conducted, at animal house facility at TheraIndx Lifesciences Pvt. Ltd. (Bangalore, India) in accordance with ethical practices laid down in the CPCSEA guidelines for animal care and use (43) . The CLP was performed as described before (44, 45) . 500ul saline was administered subcutaneously immediately after surgery.

Tramadol (20 mg/kg) was injected subcutaneously for post-operative analgesia. Mice received single IP dose at two different dosages of 10ug and 25ug either 6 hours or 24 hours post CLP. Control untreated group was injected with saline solution.

All group except the CLP alone received a single dose of standard antibiotics (amoxicillin and clavulanate) 6 hours post CLP.

P1 protein was analyzed at C-CAMP's Mass spectrometry-based proteomics facility using Orbitrap Fusion Tribrid Mass Spectrometer (Thermo Fisher Scientific, USA) using optimized protocol for in-gel and in-solution trypsin digested product.

The P1 protein was treated with deglycosylating enzymes, PNgase A, PNgase F and O-Glycosidase 

For Worm full-length (WFL) protein, Setaria Digitata worm was cut into smaller pieces and lysed through TRIzol (Invitrogen, USA) followed by RNA preparation. cDNA was made using RevertAid Reverse Transcriptase (Thermo Fisher Scientific, USA) and the PCR with filarial HSP70 specific primers with appropriate restriction sites (FP: GCAAGATCTATGTCAAAGAACGCAATC and RP: (47) were used for assaying reactivity to WFL and native FHSP70 as described above.

THP-1 cells treated with the test protein and incubated for 24 hours in a 24 well plate. The cells were harvested and the RNA was prepared using RNeasy Mini Kit (Qiagen, Germany) as per the manufacturers protocol. The cDNA was obtained using RevertAid Reverse Transcriptase (Thermo Fisher Scientific, USA). RT-PCR was performed on QuantStudio™ 3 and 5 Real-Time PCR System (Thermo Fisher Scientific, USA) using KAPA SYBR ® Fast qPCR Master Mix (Kapa Biosystems).

The Influenza infection study with 6-8 weeks old Balb/c mice was conducted at animal house facility at TheraIndx Lifesciences Pvt. Ltd. under specific pathogen-free conditions in accordance to animal ethics guidelines and approvals laid down by the CPCSEA regulations for animal care and use (44) .

The Infection with Influenza A virus (H1N1), strain: A/NWS/33 (ATCC® VR-219™) was performed as per previously described protocol (48) . Briefly, the 1x10 4 PFU/mouse in a total volume of 30 μL/mouse in sterile PBS was used for inoculation. The mice were carefully anesthetized using IP Ketamine (60mg/kg) and Xylazine (10mg/kg). The viral inoculum was added through the nostrils and the mice were monitored for any signs of respiratory distress it regained consciousness. The treatment was done in the similar manner, where the test protein at the mentioned amounts was delivered in the nostrils.

The lung tissue from the mice were harvested and fixed with 10% buffered formalin and embedded in paraffin. The paraffin blocks were sectioned in 3mm slices and the samples were stained with Haematoxylin Eosin (H&E) stain followed by microscopic analysis for tissue infiltration and alveolar haemorrhage at 100X magnification.

The work was conducted at TheraIndx Lifesciences Pvt. Ltd. with appropriate safety precautions and approvals. The lungs were harvested and its homogenate was prepared in PBS. MDCK cells were seeded into 96 well tissue culture plate one day prior to the testing so as to get approx. 80% monolayer on the next day. Lung homogenate samples were serially 10-fold diluted in infectious PBS (iPBS) and each dilution was inoculated into cell line (in 96 well tissue culture plate) and incubated for 3 to 7 days 15 at 37°C in 5 % CO2. CPE in the cell culture was observed and virus titer was calculated by Reed-Muench method. Log10PFU/g Lung was estimated in each group.

The protein sequence alignment analysis for the C-terminal domain of filarial worms and the human HSP70 was performed using ClustalW tool (https://www.genome.jp/tools-bin/clustalw). Experimental data were analyzed using GraphPad Prism 8 (GraphPad Software, Inc.). Kruskal-Wallis test and One-Way ANOVA test was used for analysis of cytokines and reporter assay values. Log-rank (Mantel-Cox) test was utilized for survival analysis. P-values, P < 0.05 were considered statistically significant and are denoted by * throughout if calculated P-values were lower than P = 0.05. 

3A. C) Effects 25ug P1 and Pp administration on plasma IL-6 levels at 6 hours post intervention (12 hour post CLP) in the groups shown in Fig 3A. D) Effects 25ug P1 and Pp administration on Plasma IL-10, IL-1b, TNF-a and MCP-1 levels 48 hours post CLP in the groups shown in Fig 3A and 3B. *p<0.05, ns= non significant

Harnessing helminthdriven immunoregulation in the search for novel therapeutic modalities

The Two Faces of Nematode Infection: Virulence and Immunomodulatory Molecules From Nematode Parasites of Mammals, Insects and Plants

Macrophage activation and functions during helminth infection: Recent advances from the laboratory mouse

Recent Advances in Type-2-Cell-Mediated Immunity: Insights from Helminth Infection

Interleukin-4-and interleukin-13-mediated host protection against intestinal nematode parasites

Similarity and diversity in macrophage activation by nematodes, trematodes, and cestodes

Chitohexaose activates macrophages by alternate pathway through TLR4 and blocks endotoxemia

Nematodes and human therapeutic trials for inflammatory disease

Nematode modulation of inflammatory bowel disease

Protection against arthritis by the parasitic worm product ES-62, and its drug-like small molecule analogues, is associated with inhibition of osteoclastogenesis

Immunology of lymphatic filariasis

Are inflammation and immunological hyperactivity needed for filarial parasite development?

Regulation of the host immune system by helminth parasites

The architectural factor hmgb1 is involved in genome organization in the human malaria parasite plasmodium falciparum

Eritoran tetrasodium (E5564) treatment for sepsis: review of preclinical and clinical studies

Why activated protein C was not successful in severe sepsis and septic shock: are we still tilting at windmills?

The search for effective therapy for sepsis: back to the drawing board?

The pathogenesis of sepsis and potential therapeutic targets

Innate immune sensing of coronavirus and viral evasion strategies

Intranasal Administration of the TLR2 Agonist Pam2Cys Provides Rapid Protection against Influenza in Mice

Prophylactic intranasal administration of a TLR2/6 agonist reduces upper respiratory tract viral shedding in a SARS-CoV-2 challenge ferret model

Use of toll-like receptor assays to detect and identify microbial contaminants in biological products

Mechanisms of mortality in early and late sepsis

In Search of a Cure for Sepsis: Taming the Monster in Critical Care Medicine

Sepsis: Inflammation Is a Necessary Evil

The Role of IFN-β during the Course of Sepsis Progression and Its Therapeutic Potential

Multicentric experience with interferon gamma therapy in sepsis induced immunosuppression. A case series

Randomised controlled trial of GM-CSF in critically ill patients with impaired neutrophil phagocytosis

Interleukin-7 restores lymphocytes in septic shock: the IRIS-7 randomized clinical trial

A single dose of eHSP72 attenuates sepsis severity in mice

A randomized trial of Mycobacterium w in severe sepsis

Landscape of coordinated immune responses to H1N1 challenge in humans

Intracellular and extracellular Hsp70 chaperone as a target for cancer therapy

Activation of NK cells by extracellular heat shock protein 70 through induction of NKG2D ligands on dendritic cells

Extracellular HSPs: The Complicated Roles of

Analysis of plasmacytoid and myeloid dendritic cells in nasal epithelium

Phenotype and function of nasal dendritic cells

Heat shock protein 70 potentiates interferon alpha production by plasmacytoid dendritic cells: relevance for cutaneous lupus and vitiligo pathogenesis

A Protective Hsp70-TLR4 Pathway in Lethal Oxidant Lung Injury

Heat shock protein 70 inhibits the activity of influenza a virus ribonucleoprotein and blocks the replication of virus In Vitro and In Vivo

Comparative structure-function features of Hsp70s of Plasmodium falciparum and human origins

Comparison of immunogenicity and vaccine efficacy between heat-shock proteins, HSP70 and GrpE, in the DnaK operon of Mycobacterium tuberculosis

CPCSEA guidelines for laboratory animal facility

Immunodesign of experimental sepsis by cecal ligation and puncture

Cecal ligation puncture procedure

Computational analysis of the human HSPH/HSPA/DNAJ family and cloning of a human HSPH/HSPA/DNAJ expression library

Filarial antigens mediate apoptosis of human monocytes through toll-like receptor 4

Influenza a virus studies in a mouse model of infection

06/14) provided to TS and RB. Institute of Life Sciences is funded by core grants from Department of Biotechnology

Competing interests: This work has been covered with a PCT patent application.Authors declare that they have no competing interests.

Data and materials availability: All data are available in the main text and request for the material or the patent details can be made to the taslim@ccamp.res.in