key: cord-0699972-nw2y03ss
authors: López‐Jiménez, J. J.; Peña‐Iñiguez, D. I.; Fletes‐Rayas, A. L.; Flores‐Martínez, S. E.; Sánchez‐Corona, J.; Rosales‐Gomez, R. C.; Montoya‐Fuentes, H.
title: Distribution of IFITM3 polymorphism (dbSNP: rs12252) in mestizo populations in four states of Mexico
date: 2018-03-25
journal: Int J Immunogenet
DOI: 10.1111/iji.12361
sha: 848ccf2611da45f6591e6c23d76bec6676582414
doc_id: 699972
cord_uid: nw2y03ss

Interferon‐inducible transmembrane protein 3 (IFITM3) participates in the defense against viral infections. This study identified and compared the frequency of the IFITM3 rs12252 polymorphism in 410 individuals in western Mexico. The western Mexican allelic frequencies (frequency of the “C” allele = 0.18) differ from some American, East Asian and European populations.

an antiviral role, controlling the infection of multiple alphaviruses (Poddar, Hyde, Gorman, Farzan, & Diamond, 2016) . Currently, the mechanism of cellular resistance to viruses mediated through IFITM family proteins is not fully understood. Thus far, diverse approaches have provided evidence that IFITM proteins inhibit viral fusion with the cellular membrane and do not function at steps of receptor binding or conformational changes in pH-dependent virus proteins required for membrane fusion (Brass et al., 2009; Feeley et al., 2011; Li et al., 2013) . In 2013, Li et al. showed that IFITM proteins block hemifusion through changes in the topology of the cellular membrane and protect against virus infections at early stages (Feeley et al., 2011; Li et al., 2013) .

pdm09 virus (Echevarría-Zuno et al., 2009) , and cases of chikungunya Macías-Hernández, López-Magaña, Fletes-Rayas, & Cambero-González, 2014 ) and ZIKV infections have recently been reported (Jimenez Corona et al., 2016) . The severity of infections reflects a combination of host and viral genetic components. Therefore, it is important to investigate the molecular aspects of IFITM proteins. The human IFITM3 gene has two exons, and multiple genetic variants have been identified in the coding region (Everitt et al., 2012) . One of these variants, rs12252 (T/C substitution mutation), is an SNP that generates a splice acceptor site, resulting in an isoform (∆2IFITM3) characterized by the absence of the first N-terminal 21 amino acids (Everitt et al., 2012) . The frequency of the "C" allele for SNP rs12252 is | 147 LÓPEZ-JIMÉNEZ Et aL. heterogeneous and varies between different human populations: the "C" allele is rare in European populations (C allele frequency = 0.041) and some American countries, and it is particularly rare in Colombia and Puerto Rico (C allele frequency = 0.074 and 0.111, respectively) (1000 Genomes Project Consortium et al., 2015 .

A recent meta-analysis concluded that SNP rs12252 is associated with severe influenza susceptibility (Yang et al., 2015) .

Notwithstanding, studies with larger patient sample sizes and various ethnicities are necessary because Asian and European populations have primarily been analysed, wherein the extremes of the frequencies are represented: on the one hand, the C/C genotype is rare in Europe (markedly in Northern Europe), while on the other hand, this genotype is common in Asiatic populations (Mills et al., 2014; Yang et al., 2015; Zhang et al., 2013) . Currently, there are no reports concerning the frequency of the rs12252 polymorphism in mestizos born and raised in Mexico, and western regions of Mexico are similar in proportions between native Mexican components (pre-Columbian diversity) and European ancestries, with a minor African component, according to Moreno-Estrada et al. (2014) .

The main objective of this study was to identify the frequency of the rs12252 polymorphism in four mestizo populations of western Mexico and compare the results with those previously reported in all populations analysed in the "1000 Genomes Project Consortium phase 3" (1000 Genomes Project Consortium et al., 2015 .

A total of 410 samples from healthy urban volunteer donors who attended western Mexico hospitals (blood banks) were studied by convenience, generating a DNA library comprising the following states: Nayarit (n = 100), Jalisco (n = 135), Colima (n = 84) and Michoacan (n = 91). For descriptive studies, sample size was calculated using "Epi Info™ StatCalc" software, considering a 3% true prevalence of genotype C/C in North American populations with Mexican ancestry established in the 1000 Genomes Project phase 3 (342 subjects were calculated as a sufficient sample, assuming a confidence level of 97%). The subjects were between 18 and 50 years of age. Demographic and hereditary information was obtained from all recruited individuals confirmed as unrelated up to the previous two generations. None of the included individuals had a genetic condition diagnosed at the onset of the study.

The SNP rs12252 was analysed based on PCR-RFLP. Blood samples were collected from all subjects in EDTA-Na2 tubes, and genomic DNA was purified from peripheral blood leucocytes according to a standard method (Gustincich, Manfioletti, Del Sal, Schneider, & Carninci, 1991) . The selected markers were genotyped using a previously described method (Mills et al., 2014) with the modified primers, ACTGTTGAGAAACCGAAACTACTGG (F) and CTATAGGGAGAACTGCTCTGGGCT (R) for yield optimization. MscI (New England Biolabs, Ipswich, MA, USA) was used to digest the PCR product in the presence of the T allele (wild). Fragments with lengths of 624, 490 and/or 134 base pairs were observed. The genotypes were identified using polyacrylamide gel electrophoresis (29:1, 6%) and stained with silver nitrate. Additionally, two PCR products (homozygote CC and heterozygote CT) were sequenced using the same primers with the Sanger method (CEQ ™ 8000 Genetic Analysis System, Beckman Coulter) to confirm the genotype (Figure 1 ). The samples were genotyped at CIBO, IMSS (Guadalajara, Mexico).

Nonparametric statistical analysis for all comparisons (Fisher's exact test) was performed using spss v.22 (Crosstabs) for Windows (IBM, Armonk, NY, USA), and statistical significance was considered when p < .05. Allele frequencies were directly obtained through gene counting, and conformance to the Hardy-Weinberg equilibrium (HWE) was analysed using the Fisher's exact test, comparing the observed genotype frequencies with the expected genotype frequencies.

The results of frequency analyses within the western population (410 subjects) are highlighted in Table 1 , wherein rs12252 polymorphism frequencies did not show differences between the four states using Fisher's exact test (p > .17). Nonetheless, by ordering from the highest to lowest allelic frequency, the state that showed the highest frequency of the C allele was Michoacan, Nayarit, Jalisco and Colima showed the lowest frequency, without exhibiting a clear geographical trend. In this study, the C allele frequency in Nayarit and Jalisco (northern states in the western region) was similarly contrasted with the total frequency of the western population (Table 1) . Mendelian segregation analyses of the rs12252-polymorphism in the western Mexican population revealed that genotype frequencies were in HWE agreement.

The findings obtained from western Mexico are summarized in Table 1 . and four populations belonging to South Asia (total = five) did not show statistically significant differences (p > .05) ( Table 2) . The T/C substitution (rs12252) in the gene encoding IFITM3 protein is an important host mutation associated with severe influenza susceptibility (Yang et al., 2015) . The frequency of the "C" allele for SNP rs12252 is heterogeneous in different admixed American populations (Table 2 ). In the present study, we selected four states of western Mexico, as pre-Columbian diversity currently remains a TA B L E 2 Genotypic and allelic frequencies of rs12252 in Western Mexico states and other populations belonging to the 1000 Genomes Project Consortium phase 3 (2015) In the present study, the IFITM3-C allele was detected in the four states of western Mexico, and the highest prevalence of the C allele was in identified in Michoacan state (0.225) ( Table 1) 

Consortium phase 3 data), we observed differences primarily in In conclusion, this study is the first report of rs12252 polymorphism among Mexican mestizo populations born and raised in Mexico. In Mexican mestizo populations, the allelic frequency of the rs12252 polymorphism makes it a potentially useful and informative genetic biomarker for future association studies. The major prevalence of the "C" allele was identified in the Michoacan population.

An understanding of the frequency distribution of marker rs12252 in Mexico in conjunction with other genetic and environmental factors is necessary for personalized medicine and could provide support to delineate therapeutic schemes in viral diseases currently identified as a public health emergency in Mexico.

The authors would like to thank Dr. Francisco Mendoza Carrera for valuable support in the confirmation of genotypes through sequencing.

Written informed consent was obtained from all subjects for the use of their DNA samples in the present study. The procedures were performed in accordance with the principles of the Helsinki Declaration, and the protocol was approved by the Institutional Scientific and Ethics Committee (registration number 2000-03-02-033).

The authors declare no conflict of interests.

H. Montoya-Fuentes http://orcid.org/0000-0002-8922-8225

The IFITM proteins mediate cellular resistance to influenza A H1N1 virus, West Nile virus, and dengue virus

Identification of Asian genotype of chikungunya virus isolated in Mexico

Infection and death from influenza A H1N1 virus in Mexico: A retrospective analysis

IFITM3 restricts the morbidity and mortality associated with influenza

IFITM3 inhibits influenza A virus infection by preventing cytosolic entry

An integrated map of genetic variation from 1,092 human genomes

A global reference for human genetic variation

The genetic structure of Mexican Mestizos of different locations: Tracking back their origins through MHC genes, blood group systems, and microsatellites

A fast method for high-quality genomic DNA extraction from whole human blood

Distinct patterns of IFITMmediated restriction of filoviruses, SARS coronavirus, and influenza A virus

Identification of five interferon-induced cellular proteins that inhibit west nile virus and dengue virus infections

Clinical and epidemiological characterization of laboratory-confirmed autochthonous cases of Zika virus disease in Mexico

IFITM proteins restrict viral membrane hemifusion

The IFITM proteins inhibit HIV-1 infection

Virus de Chikungunya, una amenaza latente para la Salud Pública de México

IFITM3 and susceptibility to respiratory viral infections in the community

Human genetics. The genetics of Mexico recapitulates Native American substructure and effects biomedical traits

The interferon-stimulated gene IFITM3 restricts infection and pathogenesis of arthritogenic and encephalitic alphaviruses

Pre-hispanic mesoamerican demography approximates the present-day ancestry of mestizos throughout the territory of Mexico

The IFITMs inhibit Zika virus replication

Interferon signalling network in innate defence

Interferon-induced cell membrane proteins, IFITM3 and tetherin, inhibit vesicular stomatitis virus infection via distinct mechanisms

Interferon-inducible transmembrane protein 3 genetic variant rs12252 and influenza susceptibility and severity: A metaanalysis

Interferon-induced transmembrane protein-3 genetic variant rs12252-C is associated with severe influenza in Chinese individuals

Distribution of IFITM3 polymorphism (dbSNP: rs12252) in mestizo populations in four states of Mexico