key: cord-0719551-78k5b4s9
authors: Dikdan, Ryan J.; Marras, Salvatore AE.; Field, Amanda P.; Brownlee, Alicia; Cironi, Alexander; Hill, D. Ashley; Tyagi, Sanjay
title: Multiplex PCR Assays for Identifying All Major SARS-CoV-2 Variants
date: 2022-02-02
journal: J Mol Diagn
DOI: 10.1016/j.jmoldx.2022.01.004
sha: 522440aab85eae3f8ffe3a174e2660866f07df7c
doc_id: 719551
cord_uid: 78k5b4s9

Variants of Concern (VOC) of SARS-CoV-2, including Alpha, Beta, Gamma, Delta, and Omicron threaten to prolong the pandemic leading to more global morbidity and mortality. Genome sequencing is the mainstay of tracking the development and evolution of the virus, but is costly, slow, and not easily accessible. Multiplex qRT-PCR assays for SARS-CoV-2 were developed, which identify all VOC as well as other mutations of interest in the viral genome, nine mutations in total, using single nucleotide discriminating molecular beacons. The presented variant molecular beacon assays showed a limit of detection of fifty copies of viral RNA, with 100% specificity. Twenty-six SARS-CoV-2 positive patient samples were blinded and tested using a two-tube assay. When testing patient samples, the assay was in full agreement with results from deep sequencing with a sensitivity and specificity of 100% (26/26). We have used our design methodology to rapidly design an assay which detects the new Omicron variant. This Omicron assay was used to accurately identify this variant in 17 of 33 additional patient samples. These qRT-PCR assays identify all currently circulating VOC of SARS-CoV-2 as well as other important mutations in the Spike protein coding sequence. These assays can be easily implemented on broadly available five-color thermal cyclers and will help track the spread of these variants.

Tables: 3  Figures: 5  Introduction   53 The COVID-19 pandemic has changed the world, leading to at least 5.3 million deaths and many permanent 54 injuries, with over 271 million cases worldwide as of 20 December 2021 55 (https://www.who.int/emergencies/diseases/novel-coronavirus-2019, date of last access: 12/20/2021). 56 Despite advances in diagnosis and vaccination, the emergence of SARS-CoV-2 variants threatens to keep the 57 pandemic going 1 . The World Health Organization and the US Centers for Disease Control (CDC) 58 (https://www.cdc.gov/coronavirus/2019-ncov/variants/variant-info.html, date of last access: 12/20/2021) 59 have identified SARS-CoV-2 Variants of Concern (VOCs), which lead to increased disease severity 60 (https://www.gov.uk/government/publications/nervtag-paper-on-covid-19-variant-of-concern-b117, date of 61 last access: 12/20/2021), increased transmission 2 , and immune/vaccine evasion [3] [4] [5] . Variants of Interest (VOIs) 62 have also been identified that present theoretical risks because they possess mutations similar to the 63 mutations in the VOC. Specific frequently occurring mutations have also been identified which can affect 64 therapeutic antibody treatments for patients infected with such variants 6 . These new variants and analysis 9 , and several other strategies such as PerkinElmer's PKamp (Waltham, MA), and Aldatu Biosciences 76 (Watertown,MA). However, most of these assays either target single mutations per reaction or lack the 77 appropriate number of targets to thoroughly characterize SARS-CoV-2. Simple assays that detect multiple 78 mutations at the same time are needed for identification of circulating VOCs, VOIs, and for the identification 79 of specific mutations. 80 Our approach is to create a multiplex assay for SARS-CoV-2 variants by exploiting the superior selectivity and 81 self-quenching characteristics of molecular beacons. Molecular beacons can be designed to selectively bind to 82 a mutant target sequence, while avoiding the wild-type sequence, which differs from the mutant by a single 83 nucleotide substitution. The interaction of a molecular beacon with its target is inherently more specific than 84 linear oligonucleotides that do not have a stem and loop structure, because target binding requires the 85 dissociation of the stem, which is thermodynamically costly 10 . The utility of this discriminatory power has been 86 previously demonstrated in real-time PCR for a number of applications 11, 12 . 87 Here we present a two-tube multiplex qRT-PCR assay that identifies current VOCs by detecting eight different 88 mutations in the SARS-CoV-2 spike protein. We selected mutations that have been shown to increase immune 89 escape, avoid neutralization, and increase transmissibility. Targeting these causative mutations is fruitful, 90 because these strains may mutate and lose certain coincidental mutations, but mutations that increase 91 transmission and immune evasion are likely to be maintained. Also, by targeting these types of mutations, it is 92 possible to detect new variants that arise from combinations of previously confirmed mutations, as is the case We designed our primers so that they will function at the PCR annealing temperature of 58 °C. We selected a 122 region of sequence around the site of each mutation such that the Tm of the perfect probe-target hybrid was 123 above the annealing temperature, but that the mismatched single-nucleotide polymorphism had a Tm lower 124 than the annealing temperature. These Tm's were predicted by using the then all values in that channel were divided by the maximum intensity for that molecular beacon, to derive 147 relative fluorescence units, which range between 0 and 1. These data are shown in Supplemental Figure S1 . Table 1 along with their   158 sequences.

Each reaction had a final volume of 20 µL comprised of TaqPath or TaqMan Master 1-Step Mix (No ROX), 160 water, and primers and probes as previously described. 15 µL of this complete master mix was pipetted into 161 each PCR tube, and then 5 µL of sample was added and mixed, before running on the thermal cycler.

Assay sensitivity and specificity 163 The sensitivity of the assay was determined by preparing dilution series of in vitro transcribed targets, which 164 were diluted 10-fold from 1,000 copies/µL to 0.1 copies/µL. 5 µL of each of these dilutions were combined 165 with 15 µL of completed master mix per reaction. The tubes were sealed, briefly shaken, spun down at 800 g for 1 min. and then run on a to Rutgers's laboratory for initial testing of the multiplex variant molecular beacon assay. Table 2 . 196 The RdRp and N genes were chosen as targets to detect lowly and highly expressed transcripts generated by Before assembling our multiplex assay, we designed molecular beacons for each targeted mutation, 246 determined their thermal denaturation profiles, and tested them in monoplex PCRs. To determine whether 247 the molecular beacons were allele discriminating at the annealing temperature, we determined the thermal 248 denaturation profiles of the molecular beacons by themselves, and together with mutant or wild-type targets. 249 In these experiments, the targets were synthetic oligonucleotides, and they were used in a molar excess above 250 the molecular beacon concentration. A representative profile is shown in Figure 2 , and the profiles of all the 251 molecular beacons are shown in Supplemental Figure S2 . Although, the window of discrimination varies 252 somewhat from molecular beacon to molecular beacon, all of our molecular beacons permitted single 253 nucleotide discrimination (see Figure 3A ). After qualifying the molecular beacons in this manner, we After demonstrating the specificity and sensitivity of the variant molecular beacon assay with in vitro-279 transcribed RNAs, we performed this assay on RNA purified from inactivated virus obtained from ZeptoMetrix 280 (Buffalo, NY). As can be seen in Figure 4A , our assay identified each of the mutations as listed in Figure 1B for 281 the respective VOC. We next tested a set of patient samples (RNA extracted from mid-nasal swabs) that were 282 SARS-CoV-2 positive, as identified by a multiplex screening assay, which we previously developed 283 (Supplemental Figure S2 ). After being identified as positive for SARS-CoV-2 by this assay, the samples were 284 sequenced to identify all mutations present in the strains' genomes, this sequencing data is available online at 285 https://data.mendeley.com/datasets/v3n2dzt8st/1, date of last access: 1/13/2022. Afterwards, the RNA 286 extracted from the samples were then provided to Rutgers in a blinded manner for variant identification.

287 These RNA samples were tested using the two-tube variant molecular beacon assay, as described above.

288 Figure 4B shows the threshold cycles for each molecular beacon target in each sample. All samples tested After strain identification was performed with the variant molecular beacon assay, the results were compared 295 with sequencing data, which was in complete agreement. Our results indicate 100% sensitivity and specificity 296 of the assay as tested so far. It is also notable that one of the samples possessed an L452Q mutation, which is 297 similar to the L452R mutation, but the L452R molecular beacon did not show a fluorescent signal due to the 298 L452Q mutation, further confirming the specificity of the results of our single nucleotide discriminating 299 molecular beacons.

Design and implementation of an Omicron identifying molecular beacon assay 301 The recent emergence of the omicron variant, which possesses over 30 mutations in the spike protein, 302 necessitates the design of a new identifying single nucleotide discriminating molecular beacon. Since a 303 number of Omicron mutations occur in the target regions of the two-tube assay, it is not feasible to 304 incorporate uniquely Omicron specific molecular beacons into the two-tube assay discussed above in a 305 straightforward manner. Therefore, a new two-color Omicron specific assay was designed by targeting the 306 E484A mutation, which is unique in the Omicron variant (represented in Figure 5A ), along with N gene 307 detection. Previous studies have also shown that this mutation is important for immune evasion 19 . The melt 308 curve for the designed molecular beacon is shown in Figure 5B , which shows high specificity for its intended 309 target at the annealing temperature of the assay of 58°C. Next the sensitivity was tested using in vitro-310 transcribed Omicron spike fragment RNA, similar to what was done previously. The results in Figure 5C show 311 the sensitivity to detect 50 copies of the RNA target. The sequences of probes and primers are listed in Table 3 312 and the amplicon schematic is shown in Figure 5A . This Omicron assay was tested against the other VOC 313 sequences and the results in Figure 5D show targets can be designed and added to the assay in two or three weeks. This assay not only enables the 329 identification of the four variants of concern and many variants of interest, but since it targets many known 330 mutations that confer increased transmission and immune evasion, it will be able to identify new variants that 331 recombine with existing mutations. An example of the assay's ability to pick up newer variants lies in the Delta 332 variant's mutations, which include the L452R mutation that is also present in the Epsilon variant as can be 333 seen in Figure 1B . 5'-TTGTTTAGGAAGTCTAATCTCAAACC-3' 100 nM S.E484A-MB 5'-Cy5.5-ccgcctTTGTAATGGTGTTGCAGGTTTTAATTaggcgg-BHQ2-3' 250nM N501Yr

5'-ACAAACAGTTGCTGGTGCAT-3' 500 nM CDC-N1-F 5'-GACCCCAAAATCAGCGAAAT-3' 50 nM N1-MB 5'-CFR610-cgcgagACCCCGCATTACGTTTGGTGGACCctcgcg-BHQ2-3' 50 nM CDC-N1-R 5'-TCTGGTTACTGCCAGTTGAATCTG-3' 250 nM 

SARS-CoV-2 variants and ending the 375 COVID-19 pandemic

Estimated transmissibility and impact 379 of SARS-CoV-2 lineage B.1.1.7 in England

Transmission, infectivity, 381 and antibody neutralization of an emerging SARS-CoV-2 variant in California carrying a L452R spike 382 protein mutation

Increased resistance of SARS-CoV-2 variant P.1 to antibody neutralization

Monitoring SARS-CoV-2 402 circulation and diversity through community wastewater sequencing, the netherlands and belgium

Thermodynamic basis of the enhanced specificity of 405 structured DNA probes

Multiplex detection of single-nucleotide variations using molecular 407 beacons

Spectral genotyping of human alleles

Primer3-new 411 capabilities and interfaces

DINAMelt web server for nucleic acid melting prediction

Multicolor molecular beacons for allele discrimination

Detection of 419 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR

Im W. Differential Interactions Between Human ACE2 and

Spike RBD of SARS-CoV-2 Variants of Concern

SARS-CoV-2 new variants is associated with K417N/T, E484K, and N501Y mutants: An insight from 424 structural data

SARS-CoV-2 variants, spike mutations and immune escape

CoV-RdRP molecular beacon 5'-FAM -CGCAG GGTGGAACCTCATCAGGAGATGC CTGCG -BHQ1-3

CoV-N molecular beacon 5'-CFR -CGCGAG ACCCCGCATTACGTTTGGTGGACC CTCGCG -BHQ2-3' ACTB forward 5'-CCCAGCACAATGAAGATCAAGATC-3' ACTB reverse 5

ACTB molecular beacon 5'-Q705 -CGCCCG GCAAGCAGGAGTATGACGAGTCCGG CGGGCG -BHQ2-3