key: cord-0761975-askn1d11
authors: Prieto, Cinta; Martínez-Lobo, Francisco Javier; Díez-Fuertes, Francisco; Aguilar-Calvo, Patricia; Simarro, Isabel; Castro, José María
title: Immunisation of pigs with a major envelope protein sub-unit vaccine against porcine reproductive and respiratory syndrome virus (PRRSV) results in enhanced clinical disease following experimental challenge
date: 2011-09-30
journal: The Veterinary Journal
DOI: 10.1016/j.tvjl.2010.07.010
sha: 8a39f14301511311ce0f762caf653fca753c8f04
doc_id: 761975
cord_uid: askn1d11

Abstract Disease exacerbation was observed in pigs challenged with virulent porcine reproductive and respiratory syndrome virus (PRRSV) following immunisation with a recombinant GP5 sub-unit PRRSV vaccine (rGP5) produced in E. coli. Eighteen animals were divided into three experimental groups: group A were immunised twice IM with rGP5, 21days apart; group B acted as positive controls (challenged but not immunised); and group C were negative controls. Pigs in groups A and B were challenged 21days after the second immunisation of the group A animals. Following challenge, three pigs given rGP5 exhibited more severe clinical signs than the positive controls, including respiratory distress and progressive weight-loss. Although not statistically significant, the more severe disease exhibited by group A animals may suggest previous immunisation as a contributory factor. The mechanisms of these findings remain unclear and no association could be established between the severity of disease, non-neutralising antibody concentrations and tissue viral loads.

Immunisation of pigs with a major envelope protein sub-unit vaccine against porcine reproductive and respiratory syndrome virus (PRRSV) results in enhanced clinical disease following experimental challenge Introduction Porcine reproductive and respiratory syndrome (PRRS) is characterised by reproductive failure in sows and respiratory distress in pigs of all ages (Rossow, 1998) . The causative agent, PRRS virus (PRRSV), is a small, enveloped, RNA virus classified within the Arteriviridae family (Cavanagh, 1997) . The viral genome consists of 15 kb long, linear, polyadenylated RNA that encodes nine open reading frames (ORFs). ORFs 1a and 1b encode proteins with replicase and polymerase activities, while ORFs 2-7 encode virusassociated proteins, of which the glycosylated protein GP5, encoded by ORF 5, is a major component of the virus envelope (Meulenberg et al., 1995) . GP5 is associated with the development of neutralising antibodies and host protection (Gonin et al., 1999; Meulenberg, 2000; Ostrowski et al., 2002; Plagemann, 2004a,b) and has been a key target in the design of novel vaccines that overcome safety problems associated with modified live vaccines Mengeling et al., 1999) and the limited efficacy of inactivated vaccines (Nielsen et al., 1997; Prieto et al., 1997; Scortti et al., 2007) .

Experimental vaccines that express native or modified GP5, either alone or in combination with protein M, have been devel-oped, including DNA vaccines (Pirzadeh and Dea, 1998; Kwang et al., 1999; Barfoed et al., 2004; Xue et al., 2004; Fang et al., 2006; Jiang et al., 2006) , bacterial vaccines such as Mycobacterium bovis BCG or E. coli that express recombinant proteins (Pirzadeh and Dea, 1998; Bastos et al., 2004) , recombinant viral vaccines such as baculovirus (Plana-Durán et al., 1997) , pseudorabies virus (Qiu et al., 2005; Jiang et al., 2007b) and adenovirus (Gagnon et al., 2003; Kheyar et al., 2005; Jiang et al., 2007a) , and, more recently, replicon-based vaccines (Mogler et al., 2008; Jiang et al., 2009) . However, despite the development of a large number of vaccine candidates, studies in mice or pigs have indicated that their use results in limited protection with, at best, partial reductions in viraemia and tissue viral loads. This lack of protection has been attributed to the induction of weak immune responses, which are usually insufficient to prevent infection after viral challenge, especially where this challenge is heterogeneous in character.

Although the vaccines developed to date have demonstrated little protective efficacy, the only report of an adverse effect was increased lesion severity in infected pigs that had been immunised with E. coli GST-ORF5 recombinant fusion protein (Pirzadeh and Dea, 1998) . Adverse effects have occasionally been found following the use of other genetically engineered viral vaccines including those against equine infectious anaemia (Wang et al., 1994) , herpes simplex-1 (Ghiasia et al., 1999) and influenza (Heinen et al., 2002) viruses. The present study reports disease exacerbation in pigs, previously immunised with a PRRSV GP5 sub-unit vaccine produced in E. coli, following challenge with PRRSV.

All experimental procedures were approved by The Animal Ethics Committee of The Universidad Complutense de Madrid.

Eighteen 3-week-old cross-bred piglets from a PRRSV-seronegative herd were randomly divided into three groups of six and housed in isolation in pens with concrete floors and an automatic watering system.

The ORF5-encoding region of PRRSV was amplified by RT-PCR (Suárez et al., 1994) , prior to cloning in the commercial plasmid pRSET-A (Invitrogen) to generate a pR-PR5 plasmid, which was then used to express the recombinant GP5 protein (rGP5) in E. coli. BL21(DE 3 )pLysS competent E. coli cells were transfected with pR-PR5 and exponential cultures of transformed bacteria were induced at an optical density (OD 600 nm ) of 0.6 by adding 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) to the culture media. After 4 h of culture, the cells were lysed and separated by 15% SDS-PAGE. The band corresponding to rGP5 was excised from the gel, electroeluted and the nature of the eluted protein determined by SDS-PAGE analysis followed by Western blotting using hyperimmune PRRSV-specific porcine serum (a-PRRS). The protein concentration in the purified antigen preparation was determined by spectrophotometry.

The sixth passage in porcine alveolar macrophages (PAM) of strain Spain 6/1992 was used as a template for amplification of the ORF5-encoding region of PRRSV. This strain belongs to the Lelystad-like cluster of type 1 PRRSV. Experimental challenge of immunised pigs was carried out with the seventh passage of field strain 5710 in PAM, which also belongs to the Lelystad-like cluster of European strains (Suárez et al., 1996; Forsberg et al., 2002) . The nucleotide sequence of ORF5 from strain Spain 6/1992 (deposited in GenBank with accession number DQ 345733) is 97.50% identical to that of strain 5710 (deposited in GenBank with accession number DQ 345729 under the name Spain 2/1991). The predicted amino acid sequence of the corresponding GP5 protein is 96.52% identical to that of strain 5710. The alignment of the nucleotide sequences of both PRRSV strains is illustrated in Fig. 1 . Samples collected after viral challenge were evaluated using PAM cultures (Prieto et al., 1997) . Serum neutralisation (SN) assays were performed on MARC-145, a cell clone highly permissive for PRRSV derived from the MA-104 cell line (Kim et al., 1993) .

ATGAGATGTTCTCACAAATTGGAGCGTTTCTTGACTCCTCACTCTTGCTTCTGGTGGCTT 60 Spain 6/1992 ATGAGATGTTCTCACAAATTGGAGCGTTTCTTGACTCCTCACTCTTGCTTCTGGTGGCCT 60 ********************************************************** * 5710 (Spain 2/1991) TTTTTGCTGTGTACCGGCTTGTCTTGGTCCTTTGTCGATGGCAACGACAGCAGCTCGACA 120 Spain 6/1992 TTTTTGCTGTGTACCGGCTTGTCTTGGTCCTTTGTCGATGGCGACGACAACAGCTCGACA 120 ****************************************** ****** ********** 5710 (Spain 2/1991) TACCAATACATATATAATTTGACGATATGCGAGCTGAATGGGACCGAATGGTTGTCCAGC 180 Spain 6/1992 TACCAATACATATATAATTTGACGATATGCGAGCTGAATGGGACCAATTGGTTGTCCAGC 180 ********************************************* * ************ 5710 (Spain 2/1991) CATTTTGACTGGGCAGTCGAGACCTTTGTGCTTTACCCGGTTGCCACTCATATCCTTTCA 240 Spain 6/1992 CATTTTGACTGGGCAGTCGAGACCTTTGTGCTTTACCCGGTTGCCACTCATATCCTTTCA 240 ************************************************************ 5710 (Spain 2/1991) CTGGGTTTTCTCACAACAAGCCATTTTTTTGATGCGCTCGGTCTCGGCGCTGTGTCCACT 300 Spain 6/1992 CTGGGTTTTCTCACAACAAGCCATTTTTTTGATGCGCTCGGTCTTGGCGCTGTGTCCATT 300 ******************************************** ************* * 5710 (Spain 2/1991) ACAGGATTTGTTGGCGGGCGGTATGTACTCAGCAGCGTGTACGGCGCTTGTGCTTTCGCA 360 Spain 6/1992 ACAGGATTTGTTGGCGGGCGGTATGTACTCAGCAGCATGTACGGCGCTTGTGCTTTCGCA 360 ************************************ *********************** 5710 (Spain 2/1991) GCGCTCGTATGTTTTGTCATCCGCGCTGCTAAAAATTGCATGGCTTGCCGTTATGCCCGT 420 Spain 6/1992 GCGCTCGTATGTTTTGTCATCCGTGCTGCTAAAAATTGCATGGCTTGCCGTTATGCCCGT 420 *********************** ************************************ 5710 (Spain 2/1991) ACCCGGTTTACCAACTTCATTGTGGACGACCGGGGGAGGATCCATCGATGGAAGTCTCCA 480 Spain 6/1992 ACCCGGTTTACTAACTTCATTGTGGACGACCGGGGGAGGATCCATCGATGGAAGTCTCCA 480 *********** ************************************************ 5710 (Spain 2/1991) ATAGTGGTAGAGAAATTGGGCAAAGCTGAAGTCGGTGGCGACCTCGTCACCATCAAACAT 540 Spain 6/1992 ATAGTGGTAGAGAAATTGGGCAAANCNGAAGTCGGTGGCGACCTCGTCACCATTAAACAT 540 ************************ * ************************** ****** 5710 (Spain 2/1991) GTCGTCCTCGAAGGGGTTAAAGCTCAACCCTTGACGAGGACTTCGGCTGAGCAATGGGAA 600 Spain 6/1992 GTCGTCCTGGAAGGGGTTAAAGCTCAACCCTTGACGAGGACTTCGGCCGAGCAATGGGAA 600 ******** ************************************** ************ 5710 (Spain 2/1991) GCCTAG 606 Spain 6/1992 GCCTAG 606 ****** 

The study had three experimental groups: in group A six pigs (numbered 1-6)

were immunised twice IM, once 42 days prior to challenge (day À 42) with 600 lg of rGP5 in 2 mL of incomplete Freund adjuvant and once 21 days prior to the experimental inoculation (day À 21) with 300 lg of rGP5 in 2 mL of incomplete Freund adjuvant. The first immunisation dose was given when the pigs were 28 days old, following an acclimatisation period of 7 days; the six pigs in group B (numbered 7-12) were positive controls and were thus experimentally challenged but not vaccinated; the group C pigs (numbered 13-18) were negative controls and were neither vaccinated nor challenged. Three weeks following the second immunisation, pigs from groups A and B were inoculated intranasally with 5 mL of PAM culture lysates containing 10 5 tissue culture infectious doses 50 (TCID 50 ) of PRRSV strain 5710. Pigs from group C were inoculated intranasally on the same day with 5 mL of an uninfected PAM culture lysate.

Clinical signs and food intake were evaluated daily for each pig following vaccination and experimental inoculation, respectively. Clinical signs were graded using a scoring system adapted from Álvarez et al. (2008) . Signs evaluated included lethargy, anorexia, skin discolouration, sneezing, coughing, laboured and abdominal breathing and respiratory rate (Table 1) . Serum samples were collected from pigs on the day of each vaccination and at various time-points post-vaccination (p.v.) and post-challenge (p.c.). Serum was stored at À80°C until used for virus isolation and to determine PRRSV antibody titres. Pigs were euthanased 18 days after virus inoculation and examined post mortem. Samples of lung, tonsil, liver, kidney, spleen and of submandibular, retropharyngeal and superficial inguinal lymph nodes were collected and stored at À80°C until used for virus isolation.

Samples were processed as previously described (Prieto et al., 1997) and were inoculated onto PAM monolayers in duplicate. Cells were incubated for 90 min at 37°C to facilitate adsorption. The monolayers were then washed twice with Dulbecco's modified Eagle's medium (DMEM) and fresh DMEM supplemented with 10% fetal bovine serum (FBS) was added.

The cells were incubated for 6 days at 37°C in a humidified atmosphere containing 5% CO 2 . Strain 5710 was added to DMEM to final concentrations of 10 4 , 10 3 and 10 2 TCID 50 /mL (i.e. 10 3 , 10 2 and 10 TCID 50 /well) as positive controls. Only batches of PAM with a minimum sensitivity to infection of >50% of the wells to which 10 TCID 50 was introduced were used. Virus-free DMEM or FBS were used as negative controls. The presence of a cytopathic effect (CPE) characteristic of PRRSV was determined on days 4-6 post-inoculation. If a CPE was observed, RT-PCR was carried out to confirm the presence of PRRSV (Suárez et al., 1994) . Viral titres were determined as described by Scortti et al. (2007) , and calculated as described by Reed and Muench (1938) and were expressed as TCID 50 /g (for tissue samples) or TCID 50 /mL (for serum or fluid samples).

Serum samples were examined for PRRSV-specific antibodies using a commercial ELISA (CIVTEST-suis PRRS, Hipra Laboratories). Serum samples collected on days pigs were immunised (days -42 and -21), challenged (day 0), and at experiment termination (day 18), were tested using a neutralisation assay performed in MARC-145 cultures (Yoon et al., 1994) .

Tissue samples collected post mortem were fixed in 10% neutral buffered formalin and dispatched to Dr. J. Segales at The Centre de Recerca en Sanitat Animal (Barcelona, Spain) for histopathological examination and determination of porcine circovirus type 2 (PCV-2) infection status.

Tissues were paraffin-embedded and 4 lm thick sections were cut and stained using haematoxylin and eosin. The potential presence of PCV-2 was evaluated using in situ hybridisation (Rosell et al., 1999) , and the possibility of secondary bacterial pulmonary infection assessed using routine bacteriological culture.

The occurrence of clinical signs and mean daily weight gains over the entire period p.c. were evaluated for significance using Kruskal-Wallis' non-parametric and Dunn's multiple comparison tests. A Student's t test was used to assess significance in differences in rectal temperature prior to and after challenge. Differences in viral and neutralising antibody titres at each sampling point were analysed using a one-way analysis of variance and Duncan's multiple range test. The clinical signs and viral titres recorded for each animal were converted to an approximate area under the curve (AUC) using the trapezoidal rule (Hennen, 2003) . AUC was computed from the day of challenge to the end of the experiment (day 18). In the case of clinical signs, the resulting data were compared using Kruskal-Wallis' non-parametric and Dunn's multiple comparison test. AUC values for viraemia were compared using a one-way analysis of variance and Duncan's multiple range tests. All tests were carried out using SPSS software and results were considered statistically significant when P < 0.05.

No adverse reactions to immunisation were observed and pigs from all experimental groups remained clinically normal until virus inoculation, at which point moderate to severe clinical signs were exhibited by animals in groups A and B. Clinical signs were more severe in pigs in group A than in the positive controls (B) (Fig. 2) . The highest mean clinical score was recorded for pigs from group A between days 2 and 9 p.c., with three pigs exhibiting severe clinical signs including lethargy, anorexia, mild tachypnoea and laboured breathing. Pig numbers 1, 5 and 6 presented with these signs on days 2-10, 2-7, and 3-7 p.c., respectively.

The most striking sign was severe weight loss, which resulted in significantly lower daily weight gain in group A relative to the other two groups (Fig. 3) . The significant decrease in daily weight gain observed in group A was mostly due to the effect on pig 1, which lost 211 g/day, and pig 5, which gained only 33 g/day p.c. However, due to large individual variations in both clinical scores and daily weight gains within each group, differences were not found to be statistically significant. Pigs in groups A and B developed pyrexia (defined as rectal body temperature P39.7°C) for at least one day p.c. and mean body temperatures correlated with clinical scores (Fig. 4) .

The results of virus isolation from serum samples collected p.c. are detailed in Table 2 . All pigs in groups A and B were viraemic from day 2 p.c. to the end of the experiment, with the exception of pig 1, which was negative on day 18. No virus was found in samples collected from pigs in group C. There was no statistically significant difference in the AUCs between groups A and B and, as would be anticipated, pigs in both challenged groups had statistically significantly higher AUC values than group C pigs (P 6 0.05). Differences in mean viral titres in serum samples from groups A and B had statistical significance on day 12 p.c. only. The results of virus isolation from tissue samples are summarised in Table 3 . PRRSV was detected in at least one tissue sample from all pigs in groups A and B. No virus was recovered from tissue samples from group C pigs and no statistically significant differences were found between groups A and B in terms of virus tissue distribution or load.

ELISA and SN tests were negative for all serum samples from all pigs prior to immunisation. On day of challenge, 2/6 pigs in group A had seroconverted as detected by ELISA, although neither had neutralising antibodies. All pigs in groups B and C remained seronegative until challenge. Post-challenge, group B pigs were found to have seroconverted by ELISA and increased antibody titres were noted in pigs from group A. Statistically significantly higher titres were found in group A relative to group B animals at day 18 p.c. (P < 0.05). No statistically significant differences were observed between groups A and B in the SN response p.c. (data not shown).

Group C pigs did not exhibit macroscopic or microscopic lesions. Group B animals had mild gross lesions including moderate lymph node enlargement and congestion, especially of the mediastinal and mesenteric nodes. No significant microscopic lesions were recorded in these pigs. Similar moderate lymph node enlargement and congestion was observed in three of the pigs from group A. A moderate, sub-acute interstitial pneumonia characterised by alveolar septal thickening and mononuclear cell infiltration was Fig. 4 . Graph illustrating the mean rectal temperature (°C) for each experimental group from 10 days before to 18 days post-challenge with porcine reproductive and respiratory syndrome virus. Red squares, group A (vaccinated with GP5 protein and challenged); green triangles, group B (challenged only); mauve squares, group C (not vaccinated or challenged).

Results of virus isolation from porcine serum samples collected post-challenge with porcine reproductive and respiratory syndrome virus in groups A (vaccinated with GP5 protein and challenged), B (challenged only), and C (not vaccinated or challenged). Positive results represent infectivity titres (log 10 TCID 50 /mL). 

observed microscopically in three of the group A pigs (numbers 3, 5 and 6). There was no microscopic evidence of PCV-2 infection and PCV-2 was not detected by in situ hybridisation.

The development of safe and effective vaccines against PRRSV infection remains a challenge and a significant priority of the pig production industry. Several promising candidates have failed to deliver effective protection likely due to the fact that even the virus itself, elicits a weak, strain-specific, immune response (Lager et al., 1997a,b; Prieto et al., 2008) .

Given that some strains of PRRSV have a greater potential to induce neutralising, cross-reacting antibodies that others , we set out to assess if a sub-unit vaccine, based on the GP5 protein from one of those PRRSV strains, might induce such protection. However, no protection against a closely related, virulent PRRSV strain was observed in the pigs immunised with this protein, as demonstrated by the induced clinical signs and tissue viral loads p.c.

The lack of protection afforded by vaccines against PRRSV has been attributed to their inability to elicit a robust immune response and to the significant antigenic diversity of the virus (Lager et al., 1997a,b; Prieto et al., 2008) . Given that it is possible that neutralising antibodies play a role in the development of protective immunity , it was interesting to note that none of the vaccinated animals in the present study developed detectable levels of such antibodies prior to challenge, and only two pigs had developed specific antibodies by day 42 p.v. Somewhat unexpectedly, more severe clinical signs, including respiratory distress and anorexia, were encountered in more of the vaccinated than in the positive control animals. Given this clinical presentation it was important to rule out confounding infection with PCV-2 (Quintana et al., 2001) .

Vaccine-enhanced disease has been reported for numerous enveloped viruses, including flaviviruses, alphaviruses, poxviruses, bunyaviruses, rhabdoviruses, coronaviruses, herpesviruses and reoviruses (Porterfield, 1986; Burke, 1992) . One of the most commonly proposed mechanisms to explain such an adverse effect is antibody-dependent enhancement (ADE) of virus replication, where non-neutralising antibodies induced by immunisation bind virus and enhance target cell infection, particularly of monocytes and macrophages. Such 'enhancing' antibodies have been demonstrated in the serum of PRRSV-infected pigs (Yoon et al., 1996) , as well as in HIV-infected humans (Homsy et al., 1989) , SIV-infected macaques (Montefiori et al., 1990) , Visna virus-infected sheep (Jolly et al., 1989) , and caprine arthritis-encephalitis virusinfected goats (McGuire et al., 1986) . Furthermore, non-neutralising, GP5-specific IgG against PRRSV has also been incriminated in increasing the level and duration of PRRSV viraemia (Yoon et al., 1996) . Pirzadeh and Dea (1998) , found more severe lesions in pigs challenged with a wild-type strain of PRRSV, that had been vaccinated with an E. coli GST-ORF5 recombinant fusion protein, and that had developed non-neutralising antibodies against GP5 at the time of challenge, than in non-immunised controls.

In the present study, although non-neutralising antibodies were demonstrated in some animals that had seroconverted before challenge and that did not have detectable levels of neutralising antibodies, a correlation between this antibody level and more severe disease p.c. was not established. Only 1/2 of the immunised pigs that developed non-neutralising antibodies before challenge exhibited enhanced clinical signs, a finding inconsistent with ADE. Although a definitive association between antibody reactivity and enhancement of disease cannot always be established (Raabe et al., 1998) , in most cases affected animals have measurable levels of non-neutralising antibodies at the time of infection.

The typical correlation between severity of clinical signs and virus burden observed in ADE of disease was not found in this study. Although the two animals that were most severely affected had persistently high viral titres, other pigs exhibiting mild clinical signs also had a consistently high viraemia during most of the experimental period. However, it must also be considered that while high levels of virus replication are necessary, they are ultimately an insufficient component of ADE (Raabe et al., 1998) .

Other immunopathological mechanisms such as T cell responses may be at play in vaccine-induced disease exacerbation, as described for both influenza (Heinen et al., 2002) and respiratory syncytial (Matsuda et al., 1995) viruses. Excess production of pro-inflammatory cytokines, especially interferon-a, tumour Table 3 Results of virus isolation from porcine tissue samples collected at necropsy 18 days post-challenge with porcine reproductive and respiratory syndrome virus in groups A (vaccinated with GP5 protein and challenged), B (challenged only), and C (not vaccinated or challenged). Positive results represent infectivity titres (log 10 TCID 50 /mL necrosis factor (TNF)-a and interleukin-1, has been correlated with lung pathology in the case of a number of viral infections (van Reeth and Nauwynck, 2000) . Interestingly, TNF-a production is linked to weight loss and systemic disease in the case of both respiratory syncytial and influenza virus infection (Hussell et al., 2001) . Th-2 cytokine responses have also been implicated in immunopathological processes associated with bovine and human respiratory syncytial virus and Coxsackie virus infection (Boelen et al., 2000; Kishimoto et al., 2001; Kalina et al., 2004) . Autoimmunity could also be involved as piglets infected with PRRSV can develop severe hypergammaglobulinaemia and lymph adenopathy (Butler et al., 2008) . Further work will be required to assess if any of the above mechanisms are involved in the development of the adverse events described in the current study.

The type of immunogen used in our study may have contributed to disease enhancement as Pirzadeh and Dea (1998) , also using a recombinant fusion GP5 protein expressed in E. coli, found more severe lesions microscopically in immunised animals. The adverse effects of immunisation we report here have not previously been found in vaccination studies using either whole virus or sub-unit PRRSV proteins (Gagnon et al., 2003; Barfoed et al., 2004; Bastos et al., 2004; Xue et al., 2004; Kheyar et al., 2005; Qiu et al., 2005; Scortti et al., 2006 Scortti et al., , 2007 Jiang et al., 2007a,b; Prieto et al., 2008) .

The results of this study demonstrate that immunisation of growing pigs with a recombinant fusion GP5 PRRSV protein not only failed to provide protection from subsequent viral challenge, but appeared to exacerbate disease. However, the mechanisms of such putative, vaccine-induced disease enhancement remain to be elucidated.

None of the authors of this paper has a financial or personal relationship with other people or organisations that could inappropriately influence or bias the content of the paper.

Biological characterization of a recombinant pseudorabies virus

DNA vaccination of pigs with open reading frame 1-7 of PRRS virus

Immune response of pigs inoculated with Mycobacterium bovis BCG expressing a truncated form of GP5 and M protein of porcine reproductive and respiratory syndrome virus

Both immunisation with a formalin-inactivated respiratory syncytial virus (RSV) vaccine and a mock antigen vaccine induce severe lung pathology and a Th2 cytokine profile in RSV-challenged mice

Appearance of acute PRRS-like symptoms in sow herds after vaccination with a modified live PRRS vaccine

Porcine reproductive and respiratory syndrome virus subverts repertoire development by proliferation of germline-encoded B cells of all isotypes bearing hydrophobic heavy chain CDR3

Human HIV vaccine trials: does antibody-dependent enhancement pose a genuine risk?

Nidovirales: a new order comprising Coronaviridae and Arteriviridae

Enhanced immunogenicity of the modified GP5 of porcine reproductive and respiratory syndrome virus

The genetic diversity of European type PRRSV is similar to that of the North American type but is geographically skewed within Europe

Adenoviralexpressed GP5 of porcine respiratory and reproductive syndrome virus differs in its cellular maturation from the authentic viral protein but maintains known biological functions

Vaccination with different HSV-1 glycoproteins induces different patterns of ocular cytokine responses following HSV-1 challenge of vaccinated mice

Seroneutralization of porcine reproductive and respiratory syndrome virus correlates with antibody response to the GP5 major envelope glycoprotein

Vaccination of pigs with a DNA construct expressing an influenza virus M2-nucleoprotein fusion protein exacerbates disease after challenge with influenza A virus

Statistical methods for longitudinal research on bipolar disorders

The Fc and not CD4 receptor mediates antibody enhancement of HIV infection in human cell

Inhibition of tumor necrosis factor reduces the severity of virus-specific lung immunopathology

DNA vaccines coexpressing GP5 and M proteins of porcine reproductive and respiratory syndrome virus (PRRSV) display enhanced immunogenicity

Influence of porcine reproductive and respiratory syndrome virus GP5 glycoprotein N-linked glycans on immune responses in mice

Immunogenicity and protective efficacy of recombinant pseudorabies virus expressing the two major membrane-associated proteins of porcine reproductive and respiratory syndrome virus

A suicidal DNA vaccine co-expressing two major membrane-associated proteins of porcine reproductive and respiratory syndrome virus antigens induce protective responses

Modulation of lentivirus replication by antibodies: Fc portion of immunoglobulin molecule is essential for enhancement of binding, internalization, and neutralization of Visna virus in macrophages

Formalininactivated bovine RSV vaccine enhances a Th2 mediated immune response in infected cattle

Alternative codon usage of PRRS virus ORF5 gene increases eukaryotic expression of GP5 glycoprotein and improves immune response in challenged pigs

Enhanced replication of porcine reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of MA-104 cell line

T cell-mediated immune response enhances the severity of myocarditis in secondary cardiotropic virus infection in mice

Antibody and cellular immune responses of swine following immunisation with plasmid DNA encoding the PRRS virus ORFs 4, 5, 6 and 7

Homologous challenge of porcine reproductive and respiratory syndrome virus immunity in pregnant swine

Duration of homologous porcine reproductive and respiratory syndrome virus immunity in pregnant swine

Determination of the existence of antigenic groups in European-type porcine reproductive and respiratory syndrome virus isolates

Development of interleukin 6 and tumor necrosis factor-a activity in nasopharyngeal secretions of infants and children during infection with respiratory syncytial virus

Acute arthritis in caprine arthritis-encephalitis virus challenge exposure of vaccinated or persistently infected goats

Identification and clinical assessment of suspected vaccine-related field strains of porcine reproductive and respiratory syndrome virus

PRRSV, the virus

Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus

Replicon particle PRRSV vaccine provides partial protection from challenge

Complementmediated, infection-enhancing antibodies in plasma from vaccinated macaques before and after inoculation with live simian immunodeficiency virus

Examination of virus shedding in semen from vaccinated and from previously infected boars after experimental challenge with porcine reproductive and respiratory syndrome virus

Passive transfer of virus-specific antibodies confers protection against reproductive failure induced by a virulent strain of porcine reproductive and respiratory syndrome virus and establishes sterilizing immunity

Identification of neutralizing and non-neutralizing epitopes in the porcine reproductive and respiratory syndrome virus GP5 ectodomain

Immune response in pigs vaccinated with plasmid DNA encoding ORF5 of porcine reproductive and respiratory syndrome virus

GP5 ectodomain epitope of porcine reproductive and respiratory syndrome virus, strain Lelystad virus

The primary GP5 neutralization epitope of North American isolates of porcine reproductive and respiratory syndrome virus

Baculovirus expression of proteins of porcine reproductive and respiratory syndrome virus strain Olot/91. Involvement of ORF3 and ORF5 proteins in protection

Antibody-dependent enhancement of viral infectivity

Insemination of susceptible and preimmunized gilts with boar semen containing porcine reproductive and respiratory syndrome virus

Similarity of European porcine reproductive and respiratory syndrome virus strains to vaccine strain is not necessarily predictive of the degree of protective immunity conferred

Protective immunity induced by a recombinant pseudorabies virus expressing the GP5 of porcine reproductive and respiratory syndrome virus in piglets

Clinical and pathological observations on pigs with postweaning multisystemic wasting syndrome

Immunization with a recombinant envelope protein (rGP90) of EIAV produces a spectrum of vaccine efficacy ranging from lack of clinical disease to severe enhancement

A simple method to estimating fifty percent end points

Pathological, immunohistochemical, and in-situ hybridization studies of natural cases of postweaning multisystemic wasting syndrome (PMWS) in pigs

Porcine reproductive and respiratory syndrome

Reproductive performance of gilts following vaccination and subsequent heterologous challenge with European strains of porcine reproductive and respiratory syndrome virus

Failure of inactivated porcine reproductive and respiratory syndrome virus vaccine to protect against heterologous PRRSV challenge

Direct detection of the porcine reproductive and respiratory syndrome (PRRS) virus by reverse polymerase chain reaction (RT-PCR)

Phylogenetic relationships of European strains of porcine reproductive and respiratory syndrome virus (PRRSV) inferred from DNA sequences of putative ORF-5 and ORF-7 genes

Proinflammatory cytokines and viral respiratory disease in pigs

Enhancement of EIAV replication and disease by immunization with a baculovirus-expressed recombinant envelope surface glycoprotein

Immune responses of swine following DNA immunization with plasmids encoding porcine reproductive and respiratory syndrome virus ORF5 and 7, and porcine IL-2 and IFNc

A modified serum neutralization test for the detection of antibody to porcine reproductive and respiratory syndrome virus in swine sera

Antibody-dependent enhancement (ADE) of porcine reproductive and respiratory syndrome virus (PRRSV) infection in pigs

We wish to thank Dr. Joaquim Segalés for assessing samples for evidence of PCV-2 infection. This study was supported by Grants AGL2001-2055 and AGL2005-04281 from the Spanish CICYT. Francisco Javier Martínez-Lobo was supported by a pre-doctoral fellowship from the Comunidad Autónoma de Madrid and Francisco Díez-Fuertes by a pre-doctoral fellowship from the Spanish Ministry of Science and Technology.