key: cord-0787877-jj340ke1
authors: Orfinger, Alexander B.; Morse, John C.; Hix, Raymond L.
title: Associating life stages and sexes of Nearctic Polycentropus Curtis, 1835 (Trichoptera: Polycentropodidae) using mitochondrial DNA barcoding
date: 2022-03-24
journal: Ecol Evol
DOI: 10.1002/ece3.8741
sha: 52a8a336a24c610432627d2aedf702e1051979cb
doc_id: 787877
cord_uid: jj340ke1

Alpha taxonomy of caddisflies (order Trichoptera) is based primarily on male genital morphology. As such, associations of adult females and other life stages typically require conclusive association with the species’ identifiable male. The aim of this study was to use molecular methods to associate females and larvae of Polycentropus species represented in the Nearctic. Analysis of mtCOI sequences using distance‐ and tree‐based methods resulted in the association of larvae for 14 species of Polycentropus (P. alabamensis Hamilton, Harris & Lago, 1990, P. blicklei Ross & Yamamoto 1965, P. carlsoni Morse 1971, P. carolinensis Banks 1905, P. colei Ross 1941, P. confusus Hagen 1861, P. denningi Smith 1962, P. elarus Ross 1944, P. gertschi Denning 1950, Polycentropus halidus Milne 1936, P. maculatus Banks 1908, P. pentus Ross 1941, P. rickeri Yamamoto 1966, and P. variegatus Banks 1900) and females for 2 species (P. carolinensis and P. chelatus Ross & Yamamoto 1965). Searches for, and descriptions of, diagnostic morphological characters for these previously unidentifiable life forms are now possible. The identity of the larva of P. centralis Banks, 1914 is confirmed and some interesting phylogenetic relationships and a possible cryptic species and potential synonyms are implied in the results. Targets for future immature‐ and female–male associations are discussed along with a preliminary assessment of morphological differences among larvae.

The caddisflies (order Trichoptera) are a prime example of a holometabolous order for which our knowledge of nonmales is relatively poor. Among the caddisflies, the taxonomy and identification tools used for aquatic larvae and terrestrial females for most species lag behind those of terrestrial males, on which alpha taxonomy is mostly based. The inability to identify larvae and females limits detailed study of these organisms' ecology, evolution, and water quality tolerance for development of biomonitoring indices.

There are some notable exceptions to this pattern, however. For example, larvae of the central European caddisfly fauna have been well characterized (Waringer & Graf, 2011) . Still, in many regions and for most taxa, male taxonomic knowledge far surpasses that of females, larvae, and eggs. Our taxonomic understanding of the Oriental and Neotropical Trichoptera faunas typify this generality, with immature and female knowledge poorly resolved relative to male taxonomy (Morse, 2016; Pes et al., 2018, respectively) .

The Nearctic caddisfly fauna also exemplifies the disparity of male and nonmale caddisfly knowledge (Ruiter et al., 2013) .

One example of such a taxonomic knowledge gap exists among Nearctic species of the cosmopolitan genus Polycentropus Curtis, 1835 (Trichoptera: Polycentropodidae) . The genus Polycentropus is represented by 30 species in the Nearctic (Rasmussen & Morse, 2020) . Larvae of Polycentropus construct bag-like silken filter nets in clean, flowing water with which they capture various small invertebrate prey (Wiggins, 1996) . The Nearctic Polycentropus fauna can be divided according to geographic distribution, with 23 eastern species and seven western species. This distributional scheme corresponds to the east Nearctic and west Nearctic recognized Trichoptera biogeographical regions (de Moor & Ivanov, 2008) and is reflected in the Nearctic Polycentropus species and Species Group distributions (e.g., Hamilton, 1986) . The 30

Nearctic Polycentropus species are assigned to four monophyletic Species Groups based on synapomorphies of male genital characters (Armitage & Hamilton, 1990; Hamilton, 1986) . These include the Polycentropus arizonensis Species Group (1 Nearctic species, western), the P. confusus Species Group (19 Nearctic species, eastern), the P. colei Species Group (3 Nearctic species, eastern), and the P. gertschi Species Group (4 species in the Nearctic, western) (Armitage & Hamilton, 1990; Hamilton, 1986) . Two additional western species, P. denningi Smith, 1962 and P. variegatus Banks, 1900 are unplaced (Armitage & Hamilton, 1990) . One additional unplaced eastern species, P. timesis Denning 1948 , is currently assigned to Polycentropus but merits redescription and transfer to Holocentropus McLachlan, 1878.

Of the 30 species, the larva of only one species (3.3%) and females of only 15 species (50%) have been described. While larvaladult caddisfly associations have traditionally been achieved by rearing larvae or employing the metamorphotype method (sensu Milne, 1938) , larval and pupal Nearctic Polycentropus are morphologically similar, difficult to sample due to their cryptic nature, and

have not yet been successfully reared. Female associations are conventionally based on reared individuals, geographic associations, or individuals sampled in copula with identifiable males. Modern molecular techniques offer an alternative solution in the form of DNA barcoding.

DNA barcoding employs the mitochondrial cytochrome c oxidase subunit I (mtCOI) fragment of 658 base pairs to identify species in light of the sequence's low intraspecific variability and high interspecific divergence, or barcoding gap, allowing for high success of animal species delineation (Hebert et al., 2003; Ruiter et al., 2013) .

DNA barcoding has been suggested as an option for associating the different trichopteran life stages and sexes Ruiter et al., 2013; Zhou et al., 2007) , as well of those of other aquatic insects including stoneflies (e.g., Mynott, 2015; Mynott et al., 2011) and mayflies (e.g., Malakauskas & Zonca, 2018; Molina et al., 2017) . The technique has been used successfully to associate larvae and adults in multiple cases, including in a large variety of caddisfly taxa in North America and Asia Ruiter et al., 2013; Stroil et al., 2018; Zhou et al., 2007) . In fact, barcoding exhibits high sequencing success and >95% success in species assignment, including for Trichoptera (Hajibabaei & McKenna, 2012) . Even shorter fragments of the COI barcode region of at least 200 bp can reliably identify species in 95% of cases across a variety of taxa (Meusnier et al., 2008; Yeo et al., 2020) .

Thanks in part to the Trichoptera Barcode of Life (TBOL) campaign, a robust framework and reference library exist for sequencing, sourcing, and analyzing caddisfly barcoding data Zhou et al., 2016) . By employing DNA barcoding analyses on a wide geographical and morphological variety of larvae and adult males and females, the present study aims to assign species identities to currently unidentifiable larvae and females of the genus mined from BOLD. Each of the male specimens whose sequences were mined from BOLD has been identified by a taxonomic expert, including the first author in most cases, and vouchered in a public natural history collection. Each of the female and immature specimens whose sequences were mined from BOLD have been identified by a taxonomic authority, including the first author in many cases, or by Barcode Index Number (BIN) matching sensu Ratnasingham and Hebert (2013) . Species for which no unknown larval or unknown female sequences of at least 300 base pairs were available were excluded.

DNA amplification and alignment generally follow procedures used by Zhou et al. (2007) , Baird et al. (2011 ), Ruiter et al. (2013 , and Barcelos-Silva et al. (2018) . One leg was subsampled from each specimen, and molecular methods follow standard DNA barcoding protocols (Ivanova et al., 2006) . DNA extraction and sequencing were accomplished at the Canadian Centre for DNA Barcoding, Biodiversity Institute of Ontario, University of Guelph, Canada (CCDB). DNA was extracted using an AcroPrep 96-well 3.0μm glass-fiber plate and eluted with 50 μl of distilled water. Extracted DNA was then amplified targeting the full 658-bp barcoding fragment of COI using polymerase chain reaction DNA amplification and alignment (PCR) in a 12.5 μl reaction volume following the protocol of Ivanova et al. (2006) . The reaction was comprised of 6.25 μl of 10% trehalose (D-(+)-trehalose dehydrate) (per CCDB standard protocols), 2 μl of ddH 2 O, 1.25 μl 10x of reaction buffer, 0.625 μl 50 mM MgC l2 , 0.0625 μl of 10 mM dNTP, 0.06 μl of 5 U/μl Taq DNA polymerase (Invitrogen), 0.125 μl of 10 μM of both forward and reverse primer, and 2 μl of DNA. The primer used to amplify the full barcoding region was (LCO1490 50-GGTCAACAAATCATAAAGATATTGG-3'/ HC02198 50-TAAACTTCAGGGTGACCAAAAAATCA-30) (Folmer et al., 1994) , applied to those specimens preserved in >95% ethanol since collection or preserved in <95% ethanol but that were collected within one year of DNA extraction. For older or more degraded samples, that is, those preserved in <95% ethanol and that were more than 1 years old, the following primers were used to target shorter, overlapping segments of COI: Uni-MinibarF1 (59-TCCACTAATCACAARGATATTGGTAC-39) and UniMinibarR1 (59-G AAAATCATAATGAAGGCATGAGC39). These are primers designed for a short fragment at the 5' terminus of the standard barcode region (Meusnier et al., 2008) . Each PCR reaction was thermocycled at 94°C for 1 min; 5 cycles at 94°C for 40 s, 45°C for 40 s, 72°C for 1 min; 35 cycles at 94°C for 40 s, 51°C for 40 s, 72°C for 1 min; held at 72°C for 5 min, and stored at 4°C. Successful PCR reactions was evaluated using an Invitrogen 2% agarose E-gel with an ethidium bromide stain and developed with UV, and if successful, was subsequently bi-directionally sequenced using BigDye and an Applied Biosystems 3730XL DNA analyzer (Hajibabaei et al., 2005) .

All data associated with each specimen included in this study, including collection information, storing institution, ecological data, taxonomy, photographs, and COI sequences, are available in BOLD under the publicly accessible dataset titled "DS-POLYCSS Nearctic Polycentropodidae (Trichoptera)" .

A two-tiered analytical approach was applied to datasets. Initially, a "pooled" dataset including all available sequences was used in executing all tree-and distance-based analyses. Not only were initial associations gathered from the pooled analysis but species for which associations were not currently attainable were also recovered as targets for future association efforts. Following analysis of the pooled dataset, "filtered" datasets composed of only those species for which successful associations were recovered are used in a subsequent iteration of tree-based and distance-based analyses described below. The filtered datasets were delineated according to biogeographical assignment, with western Nearctic species assigned to the "western" dataset and eastern Nearctic species assigned to the "eastern" dataset following biogeographical patterns recognized in many Nearctic caddisfly taxa, including Polycentropus (e.g., Cooper & Morse, 1998; Hamilton, 1986; Lago & Harris, 1987; Prather & Morse, 2001; Trivette, 1969) . The east-west geographic delineation follows a slight variation of the definition of Lago and Harris (1987) and Cooper and Morse (1998) , where "eastern" refers to Manitoba and the US states adjacent to either side of the Mississippi River and eastward, and "western" pertains to the remaining Nearctic region.

A total of 262 sequences of males, females, pupae, and larvae representing 23 total species were included in the initial, pooled analysis. A total of 66 sequences of western species (representing 23 adults and 43 larvae) and 88 sequences of eastern species (representing 48 adults and 40 larvae) were used in the filtered datasets. All sequences used consisted of at least 325 base pairs. All data associated with specimens incorporated in the filtered datasets are accessible in Supplementary File 4 for the western fauna and Supplementary File 5 for the eastern fauna. COI sequences were aligned using default settings of MUSCLE (Edgar, 2004) in MEGA v. X 10.1.0 (Kumar et al., 2018) for each western and eastern taxon. The alignments were checked manually to avoid stop codons, indels, and amino acid translation frame shifts. Pairwise divergence distances (p-distances) within-and between-species divergences of COI nucleotides were calculated in MEGA v. X 10.1.0 (Kumar et al., 2018) using the Kimura 2-parameter evolution model (K2P) (Kimura, 1980) and pairwise deletion of missing sites. P-distance describes the proportion of nucleotide sites at which sequences being compared are different and is obtained by dividing the number of nucleotide differences by the total number of nucleotides compared. Lower pairwise distances are an indication of fewer changes in the nucleotide, with lower p-distance values expected intraspecifically than interspecifically, termed the barcoding gap (Meyer & Paulay, 2005) .

Unrooted neighbor-joining (NJ) trees of all available haplotypes, with pairwise deletion of missing sites and K2P distances (Kimura, 1980) , were constructed in MEGA v. X 10.1.0 (Tamura et al., 2007) . Branch support was calculated using 1,000 bootstrap replicates.

Maximum likelihood (ML) analysis was performed to evaluate support further for the monophyletic groupings of species using a model-based method. The optimal substitution model was identified using ModelTest-NG v0.1.7 (Darriba et al., 2020) and assessed using AIC, AICc, and BIC criteria. The partitioning scheme was identified and implemented using RAxML version 8 (Stamatakis, 2014) via rax-mlGUI 2.0.0 (Edler et al., 2021) . Unrooted ML trees were inferred with a TIM2+G4 model using RAxML version 8 (Stamatakis, 2014) via raxmlGUI 2.0.0 (Edler et al., 2021) . Bootstrap support was calculated from 1000 replicates. Resulting trees were visualized and annotated using the Interactive Tree Of Life (iTOL) v5 (Letunic & Bork, 2021) and Adobe Illustrator ® version 24.3. Adobe Illustrator version 24.3 was used to make final cosmetic edits, without altering branch lengths, bootstrap values, and topologies.

The molecular association of larval and female specimens follows criteria proposed by Zhou et al. (2007) and employed by Ruiter et al. (2013) based on a phylogenetic species conceptual approach. Briefly, when the sequence of an individual of an unknown species is identical to that of a confirmed male of a species (i.e., pairwise p-distance is zero), is nested among near-identical COI sequences of males of a species, or is nested in a monophyletic group of specimens of a given species on both trees, the corresponding species name was applied to the unknown female or larval individual.

A total of 14 novel larval-male associations and two malefemale associations were indicated in the pooled analysis. Both the neighbor-joining tree ( Figure 1 ) and maximum likelihood tree ( Figure 2 ) yielded species-level monophyletic groupings with strong bootstrap support with two notable exceptions. While each species formed a monophyletic group with strong statistical support, P. alabamensis Hamilton et al., 1990 was nested among P. elarus Ross, 1944 sequences in both NJ and ML trees. Similarly, F I G U R E 1 Initial neighbor-joining tree for pooled mtCOI barcoding sequence data. Only bootstrap values ≥50% are shown. Specimen labels at branch tips include taxon, BOLD Sample ID, sex (if adult and available), and life stage. Scale bar indicates genetic distance P. aileenae Orfinger & Moulton, 2021 was found to be nested within P. blicklei Ross & Yamamoto, 1965 in the NJ tree with low (<50) bootstrap support while the two species were formed a single, more admixed clade (P. aileenae + P. blicklei) with low (<50) bootstrap support in the ML tree.

The identities of four lineages were equivocal. These were termed clades 'A', 'B', 'C', and 'D'. Clades B and C contained two specimens each, while A and D were each represented by a single unplaced specimen. Clade A occurred only in the ML tree and consisted of a male specimen (NECAD245-08) identified as P. blicklei and sister to the P. aileenae + P. blicklei clade. This specimen is recovered in the NJ tree as a member of the P. blicklei clade. Clade A is sister to Clade B, which also occurs only in the ML tree. Clade B consists of two males identified as P. blicklei and P. carolinensis Banks, 1905 (specimens NECAD247-08 and ORFIN052-20, respectively). Both of these specimens are recovered as members of the P. carolinensis clade with strong support in the NJ tree. Clade C was recovered in both trees and is represented by two unassociated larval specimens, ORFIN047-20 and LEPTO1466-13, collected in South Carolina and Pennsylvania, respectively. Finally, Clade D occurs in each tree and is represented by a single, unassociated larva (ORFIN073-20).

In total, larvae of four of the seven western species were newly associated with confirmed adults, namely Polycentropus denningi, Polycentropus gertschi Denning, 1950 , Polycentropus halidus Milne, 1936 , and Polycentropus variegatus. Both the neighbor-joining tree 

In total, larvae of 10 of the 23 eastern species were newly associated with confirmed adults, namely P. alabamensis, P. blicklei, P. carlsoni Morse, 1971 , P. carolinensis, P. colei Ross, 1941 Yamamoto, 1966 . A notable molecular association confirmed the identity of the previously described Polycentropus centralis Banks, 1914 , which was known from a single, geographically associated specimen (Ross, 1944) . Two novel female associations were also achieved for P. carolinensis and P. chelatus Ross & Yamamoto, 1965 . 

ambiguity of clade B. Also notable is the very small p-distance range between P. alabamensis and P. elarus, spanning a minimum of 0 and a maximum of only 0.01. The complete pairwise p-distance comparison for pooled fauna is available in Supplementary File 1.

The complete pairwise p-distance matrix for western fauna is available in Supplementary File 2. P-distance analysis corroborates treebased analyses with instances of pairwise p-distances between sequences of adults and immature specimens being zero. For example, the larval specimen of P. halidus with BOLD specimen ID SCCWRP0137008 shared an identical sequence with the male with BOLD specimen ID 09BBTUS-074, indicating that they are the same species. There were no instances of high p-distance values between congeners including immature and female specimens, with all intraspecific values ≤0.01.

Summary p-distance data of the western fauna are presented in Table 2 . Maximum intraspecific p-distance values were always far less than minimum interspecific values, indicating the existence of barcoding gaps. Considering the inclusion of larvae in pairwise p-distance comparison, the presence of a barcode gap supports the specific assignments of larvae obtained from the phylogenetic analyses.

The full pairwise p-distance matrix for eastern fauna is available in Supplementary File 2. As with the western faunal analysis, pdistance analysis corroborates tree-based analyses with instances of pairwise p-distances between sequences of adults and immature specimens being zero. For example, the female P. carolinensis with BOLD specimen ID CCDB-34606-D05 had an identical COI sequence as the male with BOLD specimen ID CCDB-34606-E10 and the larva with BOLD specimen ID CCDB-34606-E07. Similarly, the female P. chelatus with BOLD specimen ID CCDB-34606-G06 produced a COI sequence identical to the male with BOLD specimen ID CCDB-34606-E12.

Summary p-distance data of the eastern fauna are presented in 

Like males, female caddisflies are generally identified to species according to morphological aspects of the genitalia. For example, Ross The newly associated larvae reported here also appear separable by various aspects of their morphology. For example, Figure 7 illustrates the apparently consistent interspecific differences in head coloration, roundness, pigment banding, and muscle scar patterning.

The degree to which anal claws are curved also appears intraspecifically consistently similar and interspecifically consistently different, with some demonstrating sharply curved anal claws and others possessing gradually curved anal claws.

While the work presented here is not intended to infer phylogenetic relationships, some interesting observations arose that merit brief discussion. First, the nested position of P. alabamensis relative to the P. elarus clade recovered in neighbor-joining and maximum likelihood phylogenies suggests a very close relationship between the species, or even that P. alabamensis could be a synonym of P. elarus. Genetic distances presented in Tables 1 and 2 suggest the latter conclusion.

Still, synonymy is unlikely given the distinct differences readily observable in the male genitalia of each species [e.g., see figures 1A-1F by Hamilton et al. (1990) and figures 245A-245C of P. elarus by Ross (1944) ]. Instead, it seems more plausible that these two species are closely related sister taxa. A robust phylogenetic study of the Polycentropus confusus Species Group, of which these two species belong, will help to resolve this question. Such a study is currently under way, incorporating multiple loci and morphology. So, too, will comparative descriptions of the now-identified larval stages of each species shed light on their relationships.

A second notable observation is the high intraspecific genetic distance observed in the P. rickeri (Tables 1 and 2 ). From sequences of only two male specimens and one immature specimen, pairwise intraspecific distances spanned 0.04 to 0.05, or 4% to 5%.

These data more than twice exceed the 2% COI distance threshold often employed to delineate species (Hebert et al., 2003; Meyer & Paulay, 2005; Rivera & Currie, 2009; Sweeney et al., 2011; White et al., 2014) . The high values suggest the existence of cryptic species. This species has been reported from seven eastern U.S. states (Rasmussen & Morse, 2020) . Future sampling and generation of additional molecular data coupled with morphological study of exemplars from throughout its range should be performed to test for potential cryptic species. Such an in-depth investigation will be necessary to verify the association proposed here based on the monophyly of the P. rickeri clade in the inferred trees.

If combined with investigations of P. barri Ross & Yamamoto, 1965 and P. colei, a phylogenetic study will also evaluate the relationships of the P. colei Species Group, which consists of P. barri, P. colei, and P. rickeri. Among the eastern NJ and ML tree topologies, P. colei and P. rickeri are recovered as sister taxa with high statistical support. This relationship makes sense within the current classification scheme. While no phylogeny exists yet for this Species Group, the relationship observed in the trees produced here suggests the Species Group is monophyletic. Similarly, among the western taxa, P. denningi and P. variegatus were recovered as sister taxa with high statistical support within both NJ and ML trees. This suggests close relatedness of these taxa currently unplaced in any Species Group, despite the distinct genitalia of their males (e.g., see figures by Armitage & Hamilton, 1990) .

The relationship between P. aileenae and P. blicklei is similar to that of P. alabamensis and P. elarus, although with much lower statistical support in separating the former pair. This is not surprising considering a close sister relationship was hypothesized by Orfinger and

Moulton (2021) Group (Apataniidae), morphology and more than 2 million bp of double digest RAD sequencing (ddRAD-seq) sequence data supported the species hypotheses (Salokannel et al., 2021) . A robust phylogeny combining morphology, COI DNA barcoding data, and additional molecular data will be needed to better refine our understanding of the relationship between these two taxa.

Several specimens merit further examination to resolve their specific identity. While ambiguous in the pooled ML tree, the male specimen NECAD247-08 is recovered with strong support as a member of the P. carolinensis clade in the pooled NJ tree. The first author examined the other male specimen of clade B (ORFIN052-20)

which agrees with P. carolinensis. Therefore, it is likely that specimen NECAD247-08 was misidentified as P. blicklei and is in fact P. carolinensis, although examination of that specimen is needed to confirm.

The unassociated larvae of clade C are interesting targets for additional scrutiny. Specimen ORFIN047-20 from South

Carolina does not completely agree with any of the associated larvae. Examination of the other specimen from Pennsylvania, LEPTO1466-13, is required to confirm that these two unassociated larvae represent the same species. Unfortunately, this specimen is currently unavailable for examination due to the ongoing COVID-19 pandemic but will be examined in the future once available. Another larva of ambiguous identify is specimen AMII094-08, which may represent P. aileenae or P. blicklei. Its examination and comparison to P. blicklei larvae will be helpful in understanding its identity. As with specimen LEPTO1466-13, however, this specimen is housed in the same collection and currently unavailable. Hamilton et al., 1990; (b) P. blicklei Ross & Yamamoto, 1965;  (c) P. carlsoni Morse, 1971 ; (d) P. carolinensis Banks, 1905 ; (e) P. centralis Banks, 1914;  (f) P. colei Ross, 1941;  (g) P. confusus Hagen & Uhler, 1861;  (h) P. denningi Smith, 1962, (i) P. elarus Ross, 1944;  (j) P. gertschi Denning, 1950;  (k) P. halidus Milne, 1936;  (l) P. maculatus Banks, 1908;  (m) P. pentus Ross, 1941; P. rickeri Yamamoto, 1966;  (o) P. variegatus Banks, 1900 . Note that the head capsule of the P. halidus specimen underwent lysis during DNA extraction, removing soft tissue but maintaining the sclerotized head capsule before it was photographed

A single pupal specimen (ORFIN384-21) was identified as P. arizonensis. Unfortunately, examination of this specimen revealed that the pupal casing was absent and larval sclerites were lost. Therefore, the specimen is not useful in associating the male and larva of the species via the metamorphotype method (Milne, 1938) . Still, while pupal association was not a goal of this study, this is the first reported identification of the pupa of this species, enabling its future morphological study.

Polycentropus species with an associated larva, based on a presumed geographic association (Ross, 1944) . This association and description were based on a single specimen from Illinois and was confirmed with the molecular association of two additional specimens from

Missouri in light of corroborating morphology to be described in a future publication.

In addition to P. centralis, the larvae of four western and 10 eastern species are newly associated, bringing the total number of identified Nearctic Polycentropus larvae to 15 of 30 species, or 50% of the known fauna. These novel associations pave the way for the morphological description and diagnoses of those species' larvae.

The noted morphological characters that appear useful in separating larvae of different species treated here agree with previously published morphological data used to separate polycentropodid larvae, for example, in the former USSR (Lepneva, 1964 (Lepneva, , 1970 , England (Hickin, 1967) , and central Europe (Waringer & Graf, 2011) . It is likely that these characters, coupled with distinct eastern or western Nearctic geographic distributions, will enable the generation of diagnostic matrices and dichotomous keys to species for identification of the now-associated larvae.

This study constitutes the initial step in this taxonomic process, which aims to culminate in identification tools useful for basic research and applied freshwater bioassessment strategies that utilize caddisfly larvae as sentinels of water quality (Behrens-Chapuis et al., 2021; Resh et al., 1995; Sweeney et al., 2011; White et al., 2014 Efforts by the authors will continue to attempt to associate additional Nearctic Polycentropus larvae, pupae, females, and males using both mtDNA barcoding and traditional methods such as the metamorphotype method (Milne, 1938) . Additional sampling and sequencing of the now-associated larvae and females will also be targeted to capture geographic haplotype and morphological variation.

The ultimate goal is to associate and describe all life stages of the Nearctic Polycentropodidae. From there, the study of each species' morphology and ecology will be tractable. This study represents a significant step in this direction.

The authors greatly appreciate the constructive recommendations of two anonymous reviewers and the anonymous handling editor. Dr 

The authors have no competing interests to declare. 

This article has been awarded Open Materials, Open Data Badges.

All materials and data are publicly accessible via the Open Science 

Diagnostic atlas of the North American Caddisfly Adults, II. Ecnomidae, Polycentropodidae, Psychomyiidae, and Xiphocentronidae

Building freshwater macroinvertebrate DNA-barcode libraries from reference collection material: formalin preservation vs specimen age

New genera and species of Nearctic neuropteroid insects

Article XII.-Descriptions of new species of neuropterous insects from the Black Mountains, N.C

Some Trichoptera, and allied insects, from Newfoundland

American Trichoptera -notes and descriptions

Associating larvae and adults of the Neotropical caddisfly genus Synoestropsis Ulmer (Trichoptera: Hydropsychidae) using morphology and DNA mitochondrial sequences

Adding DNA barcoding to stream monitoring protocols-What's the additional value and congruence between morphological and molecular identification approaches?

Females of Chimarra (Trichoptera: Philopotamidae) from eastern North America

British entomology

ModelTest-NG: A new and scalable tool for the selection of DNA and protein evolutionary models

Global diversity of caddisflies (Trichoptera: Insecta) in freshwater

Records and descriptions of Nearctic caddis flies. Part II

MUSCLE: Multiple sequence alignment with high accuracy and high throughput

raxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML

Females do count: Documenting Chironomidae (Diptera) species diversity using DNA barcoding

DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates

Using DNA barcode data to add leaves to the Trichoptera tree of life

Synopsis of the Neuroptera of North America, with a list of the South American species. Prepared for the Smithsonian Institution

Critical factors for assembling a high volume of DNA barcodes

DNA Mini-barcodes. DNA barcodes

Systematics and biogeography of the new world Polycentropus sensu stricto

Description of two new species of Polycentropus from Alabama with a checklist of the Polycentropus confusus Species-Group (Trichoptera: Polycentropodidae)

Biological identifications through DNA barcodes

Caddis larvae: Larvae of the British Trichoptera

An inexpensive, automation-friendly protocol for recovering high-quality DNA

A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences

MEGA X: Molecular evolutionary genetics analysis across computing platforms

The Chimarra (Trichoptera: Philopotamidae) of eastern North America with descriptions of three new species

Caddisfhes. Larvae and pupae of suborder Annulipalpia. Fauna of USSR

Larvae and pupae of the Annulipalpia

Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation

A simple molecular assay differentiates two burrowing mayfly species, Hexagenia limbata and H. rigida (Ephemeroptera: Ephemeridae), in western Lake Erie

A monographic revision and synopsis of the Trichoptera of the European Fauna

A universal DNA mini-barcode for biodiversity analysis

DNA barcoding: Error rates based on comprehensive sampling

Studies in North American Trichoptera

The "metamorphotype method" in Trichoptera

Associating immatures and adults of aquatic insects using DNA barcoding in high Andean streams

New caddisflies (Trichoptera) from the southeastern United States

Keynote: The Trichoptera fauna of Asia

Mitochondrial DNA allows the association of life stages to facilitate species recognition and delimitation in Australian stoneflies (Plecoptera: Gripopterygidae: Newmanoperla)

Adult and larval associations of the alpine stonefly genus Riekoperla McLellan (Plecoptera: Gripopterygidae) using mitochondrial DNA

Polycentropus aileenae n. sp. (Trichoptera: Polycentropodidae), a caddisfly species from the eastern Nearctic, with new state records for members of the Polycentropus confusus Species Group

Multilocus BOLD dataset for nearctic polycentropodidae

Order Trichoptera

Eastern Nearctic Rhyacophila species, with revision of the Rhyacophila invaria group (Trichoptera: Rhyacophilidae)

Distributional checklist of Nearctic Trichoptera (Fall 2020 revision) (pp. 517). Unpublished

A DNA-based registry for all animal species: the Barcode Index Number (BIN) system

Design and implementation of rapid assessment approaches for water resource monitoring using benthic macroinvertebrates

Identification of Nearctic black flies using DNA barcodes (Diptera: Simuliidae)

Descriptions and records of North American Trichoptera

Bulletin of the Illinois Natural History Survey

New species of the caddisfly genus Polycentropus from eastern North America (Trichoptera, Psychomyiidae)

DNA barcoding facilitates associations and diagnoses for Trichoptera larvae of the Churchill (Manitoba, Canada) area

ddRAD sequencing sheds light on low interspecific and high intraspecific mtDNA divergences in two groups of caddisflies

Two new Idaho Trichoptera

RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies

Illustrations of British Entomology; or, a Synopsis of Indigenous Insects: Containing their Generic and Specific Distinctions; with an Account of their Metamorphoses

The first DNA barcode record for Rhyacophila bosnica Schmid, 1970 and pairing of adult and larval life stages

Can DNA barcodes of stream macroinvertebrates improve descriptions of community structure and water quality

MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0

Caddisflies of the genus Chimarra in western North America (Trichoptera: Philopotamidae) (pp. 195)

Atlas of Central European Trichoptera Larvae

Comparison of four species-delimitation methods applied to a DNA barcode data set of insect larvae for use in routine bioassessment

Larvae of the North American Caddisfly Genera (Trichoptera)

A new species of the genus Polycentropus from Tennessee (Trichoptera: Psychomyiidae)

Longer is not always better: Optimizing barcode length for large-scale species discovery and identification

Insecta Lapponica

The Trichoptera barcode initiative: A strategy for generating a species-level Tree of Life

Associating larvae and adults of Chinese Hydropsychidae caddisflies (Insecta: Trichoptera) using DNA sequences