key: cord-0798026-wfwbcwvm
authors: Alves, P. A.; Oliveira, E. G.; Franco-Luiz, A. P. M.; Almeida, L. T.; Goncalves, A. B.; Borges, I. A.; Rocha, F. S.; Rocha, R. P.; Bezerra, M. F.; Miranda, P.; Capanema, F. D.; Martins, H.; Weber, G.; Teixeira, S. M. R.; Wallau, G. L.; Monte-Neto, R. L.
title: Clinical validation of colorimetric RT-LAMP, a fast, highly sensitive and specific COVID-19 molecular diagnostic tool that is robust to detect SARS-CoV-2 variants of concern
date: 2021-06-02
journal: nan
DOI: 10.1101/2021.05.26.21257488
sha: 461e5a05566f1a922539013128a5b6048bb47a98
doc_id: 798026
cord_uid: wfwbcwvm

The COVID-19 pandemics unfolded due to the widespread SARS-CoV-2 transmission reinforced the urgent need for affordable molecular diagnostic alternative methods for massive testing screening. We present the clinical validation of a pH-dependent colorimetric RT-LAMP (reverse transcription loop-mediated isothermal amplification) for SARS-CoV-2 detection. The method revealed a limit of detection of 19.3 viral genomic copies/uL when using RNA extracted samples obtained from nasopharyngeal swabs collected in guanidine-containing viral transport medium. Typical RT-LAMP reactions were performed at 65 C for 30 min. When compared to RT-qPCR, up to Ct value 32, RT-LAMP presented 97% (87.4-99.4% 95% CI) sensitivity and 100% (86.2-100%) specificity for SARS-CoV-2 RNA detection targeting N gene. No cross-reactivity was detected when testing other non-SARS-CoV virus, confirming high specificity. The test is compatible with primary RNA extraction free samples. We also demonstrated that colorimetric RT-LAMP can detect SARS-CoV-2 variants of concern (VOC) and variants of interest (VOI), such as variants occurring in Brazil named P.1, P.2, B.1.1.374 and B.1.1.371. The method meets point-of-care requirements and can be deployed in the field for high-throughput COVID-19 testing campaigns, especially in countries where COVID-19 testing efforts are far from ideal to tackle the pandemics. Although RT-qPCR is considered the gold standard for SARS-CoV-2 RNA detection, it requires expensive equipments, infrastructure and highly trained personnel. In contrast, RT-LAMP emerges as an affordable, inexpensive and simple alternative for SARS-CoV-2 molecular detection that can be applied to massive COVID-19 testing campaigns and save lives.

Emerging viral infections continue to pose a major threat to global public health. In the past decades different viral emergencies have been reported including the severe acute respiratory syndrome coronavirus (SARS-CoV), H1N1 influenza, Middle East respiratory syndrome coronavirus (MERS-CoV), Ebola vírus, Zika virus and most recently the new coronavirus has been described, which cause COVID-19 (1, 2) . COVID-19 has as etiologic agent the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which belongs to the Coronaviridae family, Betacoronavirus genus (3, 4) . People with COVID-19 have a wide range of symptoms reported such as fever, cough, anosmia, ageusia, headache, fatigue, muscle or body aches, sore throat, shortness of breath or difficulty breathing. Some of these symptoms help spread the virus, however human-to-human transmission from infected individuals with no or mild symptoms has been extensively reported (5, 6) . This outbreak has spread rapidly, as of May 2021, there were over 165 million confirmed COVID-19 cases with over 3,4 million deaths recorded worldwide (https://coronavirus.jhu.edu/). Isolation and quarantine of infected individuals is essential to viral spread and community dissemination of airborne pathogens and requiring an accurate, fast, affordable, readily available tests for massive population testing. In contrast do antibody detection, which may take weeks after the onset of the infection. Detection of viral RNA is the best way to confirm the acute infection phase, the most important phase for viral shedding, so that rationally managed social distancing and lockdown can be implemented (1, 7) .

Quantitative reverse transcription-polymerase chain reaction (RT-qPCR) is considered the gold standard method for SARS-CoV-2 RNA detection, mainly targeting combinations of viral genome regions that codes for nucleocapsid protein (N), envelope protein (E), RNA-dependent RNA polymerase (RdRp) and other targets on the open reading frame (ORF1ab) (8) . Although been shown to be an affordable technique applied to detect different pathogens (18, 19) . RT-LAMP has been used during Ebola outbreak (20, 21) and for tracking Zika virus (22) or Wolbachia (23) in Brazilian mosquitoes. The method relies on specific DNA amplification at constant temperature without the need for sophisticated thermal cyclers (24) . The amplified products can be visually detected by magnesium pyrophosphate precipitation; fluorescence emission by DNA intercalating dyes; agarose gel electrophoresis; lateral flow immunochromatography; magnesium chelating color indicators and pH-dependent colorimetric reaction that changes from fuchsia (pink) to yellow (positive result) due to proton release during nucleic acid amplification (25) (Figure 1 ). The possibility of accessing results by naked eye, made RT-LAMP an exciting alternative that facilitates the use of COVID-19 molecular testing. Simple, scalable, cost-effective RT-LAMPbased alternatives for SARS-CoV-2 detection, has emerged during pandemics including protocols for viral inactivation, quick run, RNA extraction-free and LAMP-associated CRISPR/Cas strategies (10, 11, 14, 16, 17, (26) (27) (28) (29) (30) (31) (32) . On April 14 th , 2020, the RT-LAMP received the emergency use authorization from the United States Food and Drug Administration for SARS-CoV-2 detection in COVID-19 diagnostics.

In this study, we validate a colorimetric RT-LAMP assay to detect SARS-CoV-2 RNA in clinical samples collected in different parts of Brazil, including samples with known SARS-CoV-2 variants of interest and concern. After testing primers used by RT-LAMP SARS-CoV-2 RNA detection targeting different regions, best results were achieved when using N gene or N/E genesbased strategies. One hundred nasopharyngeal swabs collected in a guanidine-containing viral transport medium (VTM) (33) from symptomatic hospitalized patients were tested. The clinical validation revealed a sensitivity of 97% (87.4-99.4 95% CI) with samples ranging Ct values from 15 to 32 with 100% specificity. The use of RNA extraction-free samples was also tested, although there is a loss in sensitivity. We also demonstrated that RT-LAMP is affordable for the detection of more transmissible SARS-CoV-2 variants encompassing a number of genomic nucleotide changes. Part of the results presented here are the research basis of OmniLAMP ® SARS-CoV-2 kit which was approved by the Brazilian Heath Regulatory Agency for COVID-19 molecular testing (Anvisa nº: 10009010368) as an alternative for massive decentralized diagnostic in Brazil, that records the third-highest COVID-19 cases number worldwide (https://coronavirus.jhu.edu).

Together with vaccination, RT-LAMP for COVID-19 diagnosis could help to improve better life quality during pandemics, offering an alternative molecular testing for monitoring lock-down . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted June 2, 2021. . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted June 2, 2021. 

In order to access absolute analytical sensitivity of the colorimetric RT-LAMP for SARS-CoV-2 detection, we calculated the limit of detection (LoD), which is the lowest detectable concentration of viral nucleic acid -here represented in viral copies per microliter (cps/µL), which was determined based on a calibration curve from a known copy Figure 2 ).

The diagnostic accuracy for RT-LAMP was compared to the "gold standard" technique RT-qPCR. The relative sensitivity was accessed in a panel of 100 clinical specimens from nasopharyngeal swab collected in VTM, including 60 positive and 40 negative samples according to the colorimetric RT-LAMP output ( Figure 3 ) that were previously characterized by RT-qPCR Figure 4A ). However, other four samples were detected as positive on RT-LAMP with RT-qPCR Ct values ranging from 32-36 ( Figure 4A ). Analysis by receiver operating characteristic (ROC) curve confirmed high Samples were obtained from different parts including Brazilian Southeast and Northeast regions. The reaction was performed at 65 °C during 30 min using WarmStart Ò colorimetric LAMP master mix (NEB #M1800) in 20 µL final volume. The RT-LAMP reaction targeted SARS-CoV-2 N gene. Yellow content indicate positive reaction while pink pattern reveal non-reagent samples. Amplicons were resolved in 2% agarose gel and stained with GelRed Ò (Biotium #41003) to confirm DNA amplification. Latter pattern confirmed specific SARS-CoV-2 amplification that matches with yellow output tubes which is not observed in pink non-reagent tests. +C: positive control using RNA extracted from laboratory-Vero E6 cultured inactivated SARS-CoV-2. NTC: non-template control.

sensitivity and specificity at RT-PCR equivalent Ct value 31.8 for RT-LAMP on COVID-19 diagnostics ( Figure 4B )

The analytical specificity was confirmed by performing RT-LAMP for SARS-CoV-2 on putative cross-reacting viruses such as pathogens that colonizes the human upper respiratory tract Table 1 , high sensitivity and specificity values were obtained at the predicted cut-off. . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted June 2, 2021. Chikungunya viruses) presented cross-reactivity on RT-LAMP using N gene as SARS-CoV-2 target ( Figure 5 ). It reinforces the high specificity observed on clinical validation with no false positive results (Figure 3 ). Thermodynamic and alignment analyses were performed on SARS-CoV-2 N, E and RdRp RT-LAMP primer sets, revealing that there is no cross-reactivity over more than 300 non-SARS coronaviruses-derived genomes (Table S1 ).

Six clinical samples previously confirmed as SARS-CoV-2 positive by RT-qPCR were subclassified as presenting low, medium or high Ct values for E gene as target. All of them were tested by colorimetric RT-LAMP in independent reactions to test the performance of N, E and RdRp genes as target to detect SARS-CoV-2. The low Ct values (18.9 and 21.7) samples were positive for all tested primer sets, while E and RdRp genes started to present false negative results from medium (26.6 and 28.4) Ct values ( Figure 6 ). It indicates that the SARS-CoV-2 N gene is a The test was performed using potentially cross-reacting respiratory viruses (A) or local occurring arboviruses (B). RT-LAMP reaction was performed at 65 °C during 30 min, with additional 10 min, to confirm the absence of cross-reactivity when using SARS-CoV-2 N gene as target. The assay was performed using the WarmStart Ò colorimetric LAMP 2x master mix (NEB #M1800). Yellow (positive) reaction is only observed when the template is SARS-CoV-2 viral RNA. hRSV: human respiratory syncytial virus; NTC: non-template control; M: molecular size marker. RT-LAMP amplification products were resolved in 2% agarose gel and stained with GelRed Ò (Biotium #41003) to confirm DNA amplification. DENV3: Dengue virus serotype 3; ZIKV: Zika virus; CHIKV: Chikungunya virus; Influenza A (H1N1/H3N2); Influenza B (Yamagata/Victoria).

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted June 2, 2021. ; https://doi.org/10.1101/2021.05.26.21257488 doi: medRxiv preprint better target for colorimetric RT-LAMP, detecting viral RNA in samples with equivalent RT-qPCR Ct values over 30 ( Figure 6 ).

Colorimetric RT-LAMP sensitivity depends on the set of LAMP primers that can vary even within the same target. When RT-LAMP was performed on low viral load samples (Ct value for E gene ranging from 31.8 -36.2), the N gene_Set1 was able to identify 4 out of 12 (33.3%) true positive samples. In contrast, N gene_Set2 or primer multiplex strategy (N gene Set1/Set2) allowed the detection of 11/12 (91,6%) true positive samples (Supplemental Table S2 ).

RT-LAMP performed in clinical samples, without any chemical or physical pre-treatment or RNA extraction, returned positive with three out of five positive samples ( Figure 7A ). In this Ct values for E gene. They were included as input for colorimetric RT-LAMP reaction using primers targeting N, RdRp (A) and E genes (B). RT-LAMP SARS-CoV-2 false negative samples are more frequent when using E and RdRp genes as target (C). RT-LAMP reaction was performed at 65 °C during 30 min, using the WarmStart Ò colorimetric LAMP 2x master mix (NEB #M1800). RT-LAMP amplification products were resolved in 2% agarose gel and stained with GelRed Ò (Biotium #41003) to confirm DNA amplification. +C: positive control using SARS-CoV-2 RNA extracted from laboratory-cultured inactivated SARS-CoV-2. NTC: non-template control.

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted June 2, 2021. assay we used laboratory-cultured and inactivated SARS-CoV-2 and clinical samples without previous RNA extraction, showing that it is possible to use direct patients' samples without preprocessing ( Figure 7A ). However, this should be taken with caution, as crude clinical samples may contain interferents. Previous heat-inactivation can be used to reduce this possibility. Here, only 1 µL of 1:10 solution of hydrochloride guanidine-containing VTM from nasopharyngeal swabs was added as a template to the SARS-CoV-2 LAMP reaction. Further analyses are being performed to establish the method sensitivity and feasibility for massive patient screening. All five samples had had previous RNA extraction, for RT-PCR analysis, supporting that extraction process can increase detection sensitivity. We also tested the incubation time at 65 °C reaction temperature.

All SARS-CoV-2 control samples turned reaction color from fuchsia to yellow as indicative of DNA amplification, confirming positive reaction from the earliest time point tested ( Figure 7B ).

In all tested intervals non-template controls were pink/fuchsia (negative) as expected, without any spurious late amplification, as confirmed by agarose gel electrophoresis showing no amplification bands on it ( Fig 7B) . . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted June 2, 2021. ; https://doi.org/10.1101/2021.05.26.21257488 doi: medRxiv preprint

As a worldwide concern, SARS-CoV-2 VOI and VOCs molecular detection could fail when applying S region-based RT-qPCR diagnostic methods due to mutations that would prevent primer annealing. In order to provide experimental evidences that RT-LAMP as a powerful molecular tool for detecting SARS-CoV-2 RNA, including VOC and VOI, we performed the tests on clinical samples that were previously identified as VOC/VOI by complete genome sequencing. is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted June 2, 2021. 

The COVID-19 pandemics demanded a rapid global response in massive diagnostic solution to face the worldwide crisis. In this context, the RT-qPCR -considered the gold-standard technique for SARS-CoV-2 RNA detection -requires high-cost equipments, trained personnel and specialized laboratory structure. In addition, during COVID-19 pandemics, several health care centers and private laboratories competed for RT-qPCR kits and related products to meet the high diagnostic demand. In order to overcome the lacking of molecular testing and provide affordable alternatives, RT-LAMP had become one of the main hopes. Due to its simplicity, accuracy comparable with RT-qPCR to detect SARS-CoV-2 RNA, does not require PCR machine and naked eye readable colorimetric output, RT-LAMP was the focus of massive testing campaigns (14, 16, 28) . This screening strategy is compatible with: home, primary care clinics, point of entry (borders), schools, universities, sport leagues, companies and can help to achieve a safe back to work and quarantine monitoring (10, 14, 16, 28, 30) . Since April 14 th , 2020 the U.S. In order to provide an affordable SARS-CoV-2 detection tools, we validate a colorimetric RT-LAMP for the COVID-19 diagnosis using clinical samples collected from different parts of Brazil. The country has a flawed screening performance, testing less than 220 individuals per 1,000 people (May 2021) (https://www.worldometers.info/coronavirus) where the majority of tests rely on antibodies-based rapid tests which are not the most reliable and recommended for mass screening and decision making to control local outbreaks. The test sensitivity of RT-LAMP, which is comparable to gold standard RT-qPCR and clearly relies on: the target choice, incubation time, viral load (asymptomatic patients, days of symptoms, correct sampling), output reading, sample integrity and quality (viral transport media, sample storage condition, pre-analytical treatments, extraction procedure, crude RNA extraction free samples) and sample type (nasal, nasopharyngeal, saliva, sputum, gargle lavage) ( Table 2) .

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted June 2, 2021. ; is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted June 2, 2021. ; https://doi.org/10.1101/2021.05.26.21257488 doi: medRxiv preprint SARS-CoV-2 genome with the potential to generate RT-LAMP primers. Once, the majority of primers were designed using the open source software Primer Explorer, it is expected that at some point, the default algorithm returned the same result or overlapping regions, independently identified in a context where molecular biology scientists everywhere in the world are working to tackle COVID-19 ( Figure 9 ). According to our data compilation, N gene and ORF1ab regions (overlapping NSP3, As1e and RdRp-coding sequences) were the most frequent targets chosen for SARS-CoV-2 RT-LAMP (Table 2 and Figure 9 ). Ganguli and cols. (2020) and Zhang and cols.

(2020) arrived at the same conclusion when selecting the SARS-CoV-2 N gene-targeting primer set after confirming better performances for RNA viral detection when compared to other targets (42, 54) . When testing N, E and RdRp genes in true positive -previously RT-qPCR characterized clinical samples -we observed more false negative outputs from assays using E and RdRp genes, corroborating what was previously reported. We also highlight that primer subsets within the same N target gene, can contribute differentially to RT-LAMP test sensitivity (Supplementary Table   S2 ). Furthermore, multiplexing different primer sets is encouraged in order to increase sensitivity ( Figure 9 ) (54, 60, 61) .

Another important (almost) neglected point, is the fact that, although inspired by RT-qPCR target selection, few SARS-CoV-2 RT-LAMP approaches reported an internal control target to confirm the presence of human RNA and monitor sampling or extraction process (39) . Wilson-Davies and colleagues (2021) pointed out that the lack of amplification can happen for different reasons concerning the whole reaction, a specific well or due to inhibitory substances; highlighting the importance of including internal control even before nucleic acid extraction, in order to be considered a reliable SARS-CoV-2 LAMP assay (62). We have not include internal controls in the clinical validation presented here, since all accessed samples had been previously characterized by RT-qPCR, including human RNAse P as housekeeping gene. However, in the current OmniLAMP ® assay, we included human b-actin RNA (rACTB) as internal control. Other constitutive targets for SARS-CoV-2 RT-LAMP include BPIFA1 (29), human 18S RNA (39) and

Statherin RNA (51) ( Table 2 ). Similar to its high sensitivity, obtained in our and by other studies, the SARS-CoV-2 RT-LAMP specificity is undoubtebly high and is frequently reported as 100% without any crossreactivity with other respiratory or SARS-CoV unrelated viruses (11, 28, 34, 49, 63) . We also . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted June 2, 2021. ; https://doi.org/10.1101/2021.05.26.21257488 doi: medRxiv preprint confirm that the SARS-CoV-2 RT-LAMP solution presented here is highly specific and does not cross-react with Brazilian occurring seasonal Influenza A and B, hRSV or arboviruses.

Despite the advantages presented by purified and nucleic acid enriched samples for SARS-CoV-2 RT-LAMP, RNA extraction-free protocols have attracted attention since they can be noninvasive saliva-based; do not require additional steps and equipment and fulfill point-of-sampling requirements. Indeed, the pre-analytical phase on RT-LAMP is the bottleneck for point-of-care applications. For this reason, several studies highlighted the feasibility of primary RNA extractionfree approaches for SARS-CoV-2 RNA detection (8, 9, 14, 27, 35, 36, 47, 53, 57, 64) . Pre-treatment of saliva samples includes heat sample inactivation and the use of lysis/stabilizing buffers that can contain proteinase K, TCEP, EDTA, DTT could help the viral RNA assessment maintaining its integrity (27, 36, 47, (65) (66) (67) (68) . Caution must be taken when running colorimetric RT-LAMP since pre-treatment could interfere on result outputs. One of the main limitations for direct sample test by colorimetric RT-LAMP based on pH-sensing is the false positive results upon input sample addition (previous to amplification), due to naturally acidic samples (30, 52) . To prevent spurious amplification due to the presence of DNA from oral microbiome, food or host cells on primary samples, Bokelmann and cols (2021) treated samples with λ exonuclease that acts by preferentially digesting 5'-phosphorylated DNA leaving non-phosphorylated primers or LAMP products intact (30) . Here we shown preliminary results on RNA extraction-free, pre-treatment free, primary 10x diluted hydrochloride guanidine-containing VTM nasopharyngeal samples directly accessed to compared colorimetric results. Three out of five RT-qPCR true positives directly accessed samples returned positive yellow output on colorimetric RT-LAMP for SARS-CoV-2 detection. This provides clues on the use of unextracted samples for massive COVID-19 testing campaigns with a trade-off on cost-benefits for limit of detection and test sensitivity. Most high and medium viral load samples will be detected on unextracted protocols. However, to meet RT-qPCR detection sensitivity levels, this requires some type of purification step and RNA concentration (11, 24, 31) .

We are currently observing rapid converging evolution of SARS-CoV-2 during COVID-19 pandemics worldwide. Several reports alert for the emergence of variants of concern and interests such the B. is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted June 2, 2021. ; https://doi.org/10.1101/2021.05.26.21257488 doi: medRxiv preprint Health Ministry official report). The regional selection of SARS-CoV-2 VOC is associated with higher transmissibility, mortality and reduced neutralizing antibody response (71) (72) (73) (74) . In Brazil, we observed the emergence of different SARS-CoV-2 VOC and VOI, including P.1, B.1.28.2 (P.2) (75,76); B.1.1.33.9 (N.9) (77); B.1.1.33.10 (N.10) (78, 79) . A plethora of mutations is observed in these variants, including N501Y, E484K/Q, K417N/T, A570D and the Δ69-70 at the SARS-CoV-2 S protein sequence, which was associated with detection failures by S-target RT-qPCR methods (80) . For SARS-CoV-2 RT-LAMP detection, few studies selected S-coding protein region as a target (Figure 9 ). In addition, isothermal amplification for SARS-CoV-2 RNA detection strategies is commonly addressed as multiplex targeted, making RT-LAMP a good choice even for SARS-CoV-2 variants detection. Indeed, here we reported that singleplex N gene-based or multiplex 

The colorimetric RT-LAMP is a reliable molecular tool for detecting SARS-CoV-2, providing rapid and easy to read results; compatible with high-throughput screenings and pointof-care requirements. This test is especially important for nations with a poor diagnostic conditions, like in Brazil, where RT-qPCR COVID-19 diagnostic is far from ideal to control disease spreading. The RT-LAMP sensitivity can be equivalent to those reported from the gold standard RT-qPCR method and also present 100% specificity. Results are commonly obtained after 30 min reaction and if needed, additional 20 min was not associated with spurious unspecific amplification. Alternative directly accessed samples from diluted guanidine-containing VTM (nasopharyngeal) without any pre-treatment interventions can also be used, however, with lower sensitivity. Sample collection in guanidine-containing VTM has been described as a useful strategy to avoid contamination of health care workers during sample manipulation. RT-LAMP primer selection can directly interfere on sensitivity being N gene the best target for SARS-CoV-2 RNA detection with less false negative results, especially in low viral load samples. Colorimetric RT-. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted June 2, 2021. ; https://doi.org/10.1101/2021.05.26.21257488 doi: medRxiv preprint LAMP is also compatible with detecting SARS-CoV-2 variants of interest and concern, being robust to cope with the monitoring of emerging new SARS-CoV-2 variants and that can be easily adapted. We thus, reinforce and recommend the use of RT-LAMP for massive testing as a decentralized point-of-care alternative for SARS-CoV-2 containment and to tackle COVID-19. The free energy (DG) of selected primers was less than -4 kcal/mol, as a parameter chosen based on oligo stability (83) . The set of primers used in this study are listed in Table 1 and additional information can be found in Figure 9 and Supplementary Figures S3, S4 and S5. We designed and validated different LAMP primer sets, such as N gene Set1 and Set2 that appeared in other independent researches (Figure 9 and Table 3 ). N2 and E1 primer sets were previously designed Table S1 ). GGTTTACCCAATAATACTGCGTCTT . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. TTCAGATTTTTAACACGAGAGT  E1_FIP  ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG  E1_BIP  TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT  E1_LF  CGCTATTAACTATTAACG  E1_LB GCGCTTCGATTGTGTGCGT . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted June 2, 2021. Structural representation of SARS-CoV-2 virion shows the main particle parts. LAMP primer regions are indicated as previously reported (9, (12) (13) (14) 16, 17, 24, 26, 28, 30, (36) (37) (38) 42, 43, 52, 63, 65, 85, 86) ; ORF: open reading frame; RdRp: RNA-dependent RNA polymerase; NSP: non-structural protein.

Schematic representation created using Snap Gene Viewer software version 5.0.7; N1, N2 and N3_CDC correspond to the amplicons for SARS-CoV-2 detection by RT-PCR (86).

All mix preparations for RT-LAMP reaction were performed on ice inside a biosafety level 

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted June 2, 2021. ; https://doi.org/10.1101/2021.05.26.21257488 doi: medRxiv preprint

A novel coronavirus outbreak of global health concern

A Novel Coronavirus from Patients with Pneumonia in China

A dynamic nomenclature proposal for SARS-CoV-2 lineages to assist genomic epidemiology

The species Severe acute respiratory syndrome-related coronavirus : classifying 2019-nCoV and naming it SARS-CoV-2

Presumed Asymptomatic Carrier Transmission of COVID-19

Transmission of 2019-nCoV Infection from an Asymptomatic Contact in Germany

Clinical and immunological assessment of asymptomatic SARS-CoV-2 infections

Overcoming the bottleneck to widespread testing: a rapid review of nucleic acid testing approaches for COVID-19 detection

Clinical Assessment and Validation of a Rapid and Sensitive SARS-CoV-2 Test Using Reverse Transcription Loop-Mediated Isothermal Amplification Without the Need for RNA Extraction. Open Forum Infectious Diseases

Evaluation of the expanded Southampton pilot study (Phase 2) for use of saliva-based lamp testing in asymptomatic populations: Final report

Development of Reverse Transcription Loop-Mediated Isothermal Amplification Assays Targeting Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). The Journal of Molecular Diagnostics

Rapid and visual detection of 2019 novel coronavirus (SARS-CoV-2) by a reverse transcription loop-mediated isothermal amplification assay

Coronavirus Using a Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) Diagnostic Platform

Optimizing direct RT-LAMP to detect transmissible SARS-CoV-2 from primary nasopharyngeal swab samples

One-pot Detection of COVID-19 with Real-time Reverse-transcription Loopmediated Isothermal Amplification (RT-LAMP) Assay and Visual RT-LAMP Assay. bioRxiv

A Single and Two-Stage, Closed-Tube, Molecular Test for the 2019 Novel Coronavirus (COVID-19) at Home, Clinic, and Points of Entry

Development of a reverse transcription-loop-mediated isothermal amplification as a rapid early-detection method for novel SARS-CoV-2. Emerging Microbes & Infections

Loop-mediated isothermal amplification (LAMP): A novel rapid detection platform for pathogens

Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases

Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea

Deployment of a Reverse Transcription Loop-Mediated Isothermal Amplification Test for Ebola Virus Surveillance in Remote Areas in Guinea

Development and Validation of Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for Rapid Detection of ZIKV in Mosquito Samples from Brazil. Sci Rep

Wolbachia detection in insects through LAMP: loop mediated isothermal amplification. Parasit Vectors

Rapid Molecular Detection of SARS-CoV-2 (COVID-19) Virus RNA Using Colorimetric LAMP

Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes

SARS-CoV-2 detection using isothermal amplification and a rapid, inexpensive protocol for sample inactivation and purification

EasyCOV : LAMP based rapid detection of SARS-CoV-2 in saliva. medRxiv

Simple, Inexpensive, and Mobile Colorimetric Assay COVID-19-LAMP for Mass On-Site Screening of COVID-19

Accessible LAMP-Enabled Rapid Test (ALERT) for Detecting SARS-CoV-2. Viruses

Point-of-care bulk testing for SARS-CoV-2 by combining hybridization capture with improved colorimetric LAMP

CRISPR-Cas12-based detection of SARS-CoV-2

Point-of-care testing for COVID-19 using SHERLOCK diagnostics

Genomic characterisation of an emergent SARS-CoV-2 lineage in Manaus: preliminary findings -SARS-CoV-2 coronavirus / nCoV-2019 Genomic Epidemiology

Colorimetric RT-LAMP SARS-CoV-2 diagnostic sensitivity relies on color interpretation and viral load

A scalable salivabased, extraction-free rt-lamp protocol for sars-cov-2 diagnosis. medRxiv

Direct on-thespot detection of SARS-CoV-2 in patients

High-surety isothermal amplification and detection of SARS-CoV-2, including with crude enzymes. bioRxiv

Shotgun Transcriptome and Isothermal Profiling of SARS-CoV-2 Infection Reveals Unique Host Responses, Viral Diversification, and Drug Interactions. bioRxiv

Essential properties and pitfalls of colorimetric Reverse Transcription Loop-mediated Isothermal Amplification as a point-of-care test for SARS-CoV-2 diagnosis

A simple direct RT-LAMP SARS-CoV-2 saliva diagnostic. medRxiv

A highly effective reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay for the rapid detection of SARS-CoV-2 infection. medRxiv

Rapid isothermal amplification and portable detection system for SARS-CoV-2

Colorimetric loop-mediated isothermal amplification (LAMP) for cost-effective and quantitative detection of SARS-CoV-2: the change in color in LAMPbased assays quantitatively correlates with viral copy number

RT-LAMP for rapid diagnosis of coronavirus SARS-CoV-2

Diagnostic accuracy of LAMP versus PCR over the course of SARS-CoV-2 infection

Evaluation of rapid diagnosis of novel coronavirus disease (COVID-19) using loop-mediated isothermal amplification

Rapid and Extraction-Free Detection of SARS-CoV-2 from Saliva by Colorimetric Reverse-Transcription Loop-Mediated Isothermal Amplification

A Novel Reverse Transcription Loop-Mediated Isothermal Amplification Method for Rapid Detection of SARS-CoV-2

Colorimetric reverse transcription loop-mediated isothermal amplification (RT-LAMP) as a visual diagnostic platform for the detection of the emerging coronavirus SARS-CoV-2. Analyst

Detecting SARS-CoV-2 at point of care: preliminary data comparing loop-mediated isothermal amplification (LAMP) to polymerase chain reaction (PCR). BMC Infectious Diseases

Molecular beacons allow specific RT-LAMP detection of B.1.1.7 variant SARS-CoV-2. medRxiv

A colorimetric RT-LAMP assay and LAMP-sequencing for detecting SARS-CoV-2 RNA in clinical samples

Direct diagnostic testing of SARS-CoV-2 without the need for prior RNA extraction

Enhancing colorimetric loopmediated isothermal amplification speed and sensitivity with guanidine chloride

College of American Pathologists (CAP) Microbiology Committee Perspective: Caution must be used in interpreting the Cycle Threshold (Ct) value. Clinical Infectious Diseases: An Official Publication of the Infectious Diseases Society of America

Affordable, Rapid, Stabilized, Colorimetric, Versatile RT-LAMP Assay to Detect SARS-CoV-2

Rapid SARS-CoV-2 testing in primary material based on a novel multiplex RT-LAMP assay

Duration of Culturable SARS-CoV-2 in Hospitalized Patients with Covid-19

Development of a multiplex Loop-Mediated Isothermal Amplification (LAMP) assay for on-site diagnosis of SARS CoV-2

Rapid point-ofcare detection of SARS-CoV-2 using reverse transcription loop-mediated isothermal amplification (RT-LAMP)

A Simple and Multiplex Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid Detection of SARS-CoV

Concerning the OptiGene Direct LAMP assay, and it's use in at-risk groups and hospital staff

Optimization and clinical validation of dual-target RT-LAMP for SARS-CoV-2

Preliminary support for a "dry swab, extraction free" protocol for SARS-CoV-2 testing via RT-qPCR. bioRxiv

Rapid detection of novel coronavirus/Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) by reverse transcription-loop-mediated isothermal amplification

Saliva TwoStep for rapid detection of asymptomatic SARS-CoV-2 carriers. medRxiv

Initial evaluation of a mobile SARS-CoV-2 RT-LAMP testing strategy. medRxiv

Massive and rapid COVID-19 testing is feasible by extraction-free SARS-CoV-2 RT-PCR

Rapid increase of a SARS-CoV-2 variant with multiple spike protein mutations observed in the United Kingdom

Detection of a SARS-CoV-2 variant of concern in South Africa

Mutations in the SARS-CoV-2 spike RBD are responsible for stronger ACE2 binding and poor anti-SARS-CoV mAbs cross-neutralization

The impact of receptor-binding domain natural mutations on antibody recognition of SARS-CoV-2. Signal Transduction and Targeted Therapy

Increased mortality in community-tested cases of SARS-CoV-2 lineage B.1.1.7. Nature

Estimated transmissibility and impact of SARS-CoV-2 lineage B.1.1.7 in England

Genomic Characterization of a Novel SARS-CoV-2 Lineage from Rio de Janeiro, Brazil

Severe Acute Respiratory Syndrome Coronavirus 2 P.2 Lineage Associated with Reinfection Case, Brazil

A Potential SARS-CoV-2 Variant of Interest (VOI) Harboring Mutation E484K in the Spike Protein Was Identified within Lineage B.1.1.33 Circulating in Brazil. Viruses

Evolutionary Dynamics and Dissemination Pattern of the SARS-CoV-2 Lineage B.1.1.33 During the Early Pandemic Phase in Brazil

Identification of a new B.1.1.33 SARS-CoV-2 Variant of Interest (VOI) circulating in Brazil with mutation E484K and multiple deletions in the amino (N)-terminal domain of the Spike protein -SARS-CoV-2 coronavirus / nCoV-2019 Genomic Epidemiology

S-Gene Target Failure as a Marker of Variant B.1.1.7 Among SARS-CoV-2 Isolates in the Greater Toronto Area

LAMP-BEAC: Detection of SARS-CoV-2 RNA Using RT-LAMP and Molecular Beacons. medRxiv

A Sanger-based approach for scaling up screening of SARS-CoV-2 variants of interest and concern. Infection, Genetics and Evolution

Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases

Thermodynamic evaluation of the impact of DNA mismatches in PCRtype SARS-CoV-2 primers and probes. Molecular and Cellular Probes

RT-LAMP for rapid diagnosis of coronavirus SARS-CoV-2

US CDC Real-Time Reverse Transcription PCR Panel for Detection of Severe Acute Respiratory Syndrome Coronavirus 2 -Volume