key: cord-0892946-1zyxhw97 authors: Sun, Meiqing; Wang, Hong; Li, Xiaoyan title: Modification of cellulose microfibers by polyglutamic acid and mesoporous silica nanoparticles for Enterovirus 71 adsorption date: 2020-07-12 journal: Mater Lett DOI: 10.1016/j.matlet.2020.128320 sha: 2e59437670870f0a0dd609db6bf92b51a18a6486 doc_id: 892946 cord_uid: 1zyxhw97 In this study, we synthesized a novel kind of cellulose-based microfibers for efficient adsorption of Enterovirus 71 (EV71), the leading causative agent of life-threatening hand, foot and mouth disease. The initial cellulose microfibers (CEL) were activated by (3-aminopropyl) triethoxysilane (APTES), and then covalently modified by polyglutamic acid (PGA) and mesoporous silica nanoparticles (MSN), obtaining the microfibers CEL-PGA-MSN. Owing to the electrostatic interaction between the negatively charged components (i.e., PGA and MSN) and positively charged amino acids of the epitope of EV71 capsid protein VP2 (VP2-ep), the obtained microfibers strongly adsorbed the epitope, and exhibited high EV71-adsorption capacity. This study sheds a novel light on development of cellulose-based materials for application in virus-capturing equipment. Viruses transmitted through the gastrointestinal system (e.g., enteroviruses) or the respiratory system (e.g., SARS-Cov-2, MERS, SARS-Cov-1) are becoming world-wide concerns severely threatening human beings, owing to their extremely strong infectivity, high morbidity and high mortality [1, 2] . Among them, Enterovirus 71 (EV71) is a non-enveloped single-strand RNA virus, constituting the dominant causative agent of hand, foot and mouth disease (HFMD) [3] . This serious disease frequently outbreaks in children in the Asia-Pacific region and Europe, and is frequently associated with meningitis, encephalitis, polio-like syndrome leading to high mortality [4] . In 2012, HFMD outbreaks in the mainland China, causing more than 2 million cases and 567 death [5] . Transmission of EV71 between children is frequently mediated by water, food, and air [6, 7] . Therefore, cleaning of the water and air exposing to children by EV71-adsorption materials may facilitate prevention of EV71 infections. Recently, several EV71-adsorption materials (e.g., graphene oxides, metal ion-binding chitosan) have been developed [8, 9] . However, it remains to be investigated to develop EV71-asorption microfibers for preparation of EV71-capturing membranes and masks. In this study, we synthesized a readily prepared EV71-adsorbing material based on the natural and low-cost cellulose microfibers ( Figure S1 ). The initial microfibers were covalently modified by polyglutamic acid (PGA) and mesoporous silica nanoparticles (MSNs), obtaining negatively charged microfibers. The obtained microfibers strongly adsorbed the surface epitope of the EV71 capsid protein VP2, and further exhibited high virus-adsorption activity to EV71 particles. This study enlightens development of cellulose microfiber-based adsorption materials for virus capture. Tetraethyl orthosilicate (TEOS), hexadecyltrimethylammonium bromide (CTAB), (3- The CEL exposing amino groups was covalently modified by PGA (exposing carboxyl groups) and MSNs (exposing amino groups) by two steps of the EDC/NHSS reaction ( Figure 1a ). Firstly, 1 g of cellulose (CEL) was originally obtained from filter papers, cut and suspended in 100 mL deionized water (dH 2 O) containing 1.5 g NaOH and 6 g urea. The suspension was vigorously stirred at -10 °C for To assess the adsorption ability of the modified microfibers, the solution of the EV71 epitope peptide VP2-ep (in PBS) were added into the microfiber suspension (100 mg/L, prepared in PBS) to a final concentration of 100 mg/L. The mixture was shaken for 24 h and then filtered, obtaining filtering liquid for determining fluorescence intensity by a microplate reader (PerkinElmer, USA). 100 μL of EV71 solution were diluted in 10 mL dH 2 O, and then 100 mg of the microfibers were added. The mixture was shaken for 2 h or for indicated time and filtered. The filtered liquid was used for RNA extraction in a nucleotide extractor (QIAcube HT, USA). EV71 nucleotides were detected using the QX100 Droplet Digital PCR (ddPCR) System (Bio-Rad, USA) [11] , with the EV71 detecting primers EV71-S (GCAGCCCAAAAGAACTTCAC) and EV71-A (ATTTCAGCAGCTTGGAGTGC). Owing to the presence of positively charged epitopes on the surface of EV71, two negatively VP2 is one of the most important surface proteins of the EV71 capsid, and the neutralizing epitope VP2-ep (AGGTGTEDTHPPYK) is a representative exposure region [12] . VP2-ep contains two exposed positively charged amino acids (i.e., His10 and Lys14, Figure 2a) , which may interact with negatively charged PGA and MSNs on CEL-PGA-MSN (Figure 2b ). Epitope adsorption assays were performed to verify the strong interaction between VP2-ep and the negatively charged microfibers. Expectedly, the negatively charged microfibers (i.e., CEL-PGA and CEL-PGA-MSN) had much higher K d values than CEL and CEL-APTES, and CEL-PGA-MSN showed the highest K d value (15255 L/kg) ( Figure 2c) . Therefore, the final microfibers had highest activity to bind the EV71 epitope VP2-ep. The high binding activity of CEL-PGA-MSN to the EV71 VP2 epitope suggests its high EV71-adsorption ability. To verify this, the virus was firstly cultured in RD cells, which displayed obvious shrinking morphology as compared to un-infected RD cells (Figure 3a) , and then isolated from the host cells for adsorption assays. ddPCR analysis revealed that as compared to the supernatant samples after CEL adsorption that exhibited highest positive droplets (blue colors), the supernatants after adsorption by the modified microfibers had obvious decreased positive droplets, and the supernatants after CEL-PGA-MSN adsorption had the least positive droplets (Figure 3b ). Statistical analysis further showed that CEL-PGA-MSN adsorbed highest levels of EV71 (>80%) among these microfibers after 2 h (Figure 3c ). Time-dependent experiment further showed that the adsorption capacity increased with increase in incubation time, and reached >95% after 4 h ( Figure S2 ). Moreover, even after 5 operating times, the microfibers kept the adsorption capacity >65% ( Figure S3 ), indicating its good reusability. Therefore, CEL-PGA-MSN had the strongest ability to adsorb EV71 virus. by the microfibers. * indicates significant difference between the groups (P < 0.05). In conclusion, we prepared a novel kind of cellulose microfibers by covalent co-modification of negatively charged polymers (PGA) and inorganic nanoparticles (MSN). The obtained CEL-PGA-MSN showed excellent adsorption capacity to the EV71 VP epitopes and consequent EV71 virus. This study sheds a novel light on development of low-cost, reusable, and high-efficient virus-removing materials. Enterovirus 71 adsorption on metal ion-composite chitosan beads Meiqing Sun: Conceptualization, Investigation, Supervision, Methodology, Software, Writing-Original draft preparation, Reviewing and Editing. Hong Wang: Data curation, Investigation, Reviewing. Xiaoyan Li: Software, Validation This work is supported by Project of Science and Technology Development in Wuqing District, Cellulose microfibers were modified by polyglutamic acid and mesoporous silica nanoparticles.The modified microfibers strongly adsorbed the epitope of EV71 capsid.The modified microfibers high-efficiently adsorbed EV71 virus particles.