key: cord-0953239-qddlc6az
authors: Cui, Sheng; Hao, Wei
title: Deducing the Crystal Structure of MERS-CoV Helicase
date: 2019-09-14
journal: MERS Coronavirus
DOI: 10.1007/978-1-0716-0211-9_6
sha: eb265b07935811bc052549f3780c9af843ecf45e
doc_id: 953239
cord_uid: qddlc6az

RNA virus encodes a helicase essential for viral RNA transcription and replication when the genome size is larger than 7 kb. Coronavirus (CoV) has an exceptionally large RNA genome (~30 kb) and it encodes an essential replicase, the nonstructural protein 13 (nsp13), a member of superfamily 1 helicases. Nsp13 is among the evolutionary most conserved proteins not only in CoVs but also in nidovirales. Thus, it is considered as an important drug target. However, the high-resolution structure of CoV nsp13 remained unavailable even until more than a decade after the outbreak of the severe acute respiratory syndrome coronavirus (SARS-CoV) in 2003, which hindered the structure-based drug design. This is in part due to the intrinsic flexibility of nsp13. Here, we describe protocols of deducing the crystal structure of Middle East respiratory syndrome coronavirus (MERS-CoV) helicase in detail, which include protein expression, purification, crystallization, enzymatic characterization, and structure determination. With these methods, catalytically active recombinant MERS-CoV nsp13 protein can be prepared and crystallized and the crystal structure can be solved.

Coronavirus (CoV) remains a public health concern 16 years after the outbreak of the severe acute respiratory syndrome coronavirus (SARS-CoV) in 2003 [1] . The Middle East respiratory syndrome coronavirus (MERS-CoV) emerged in 2012, reemerged in 2015, and is still circulating in the Middle East region, which reminds the international community that the threat of CoVs persists [2, 3] . However, neither vaccine nor drugs against CoVs are currently available. Outbreaks of CoVs initiated extensive structural investigation on CoV encoded proteins thereafter, which not only shed light on the life cycle of CoVs but also laid foundation for the structure-based drug design (SBDD). CoV contains a positive single-stranded RNA genome of~30 kb, one of the largest among +RNA viruses [4, 5] . To maintain the unusually large RNA genome, CoV encodes two replicase polyproteins pp1a and pp1ab, which are broken down into 16 nonstructural proteins (nsps) via proteinase cleavage [6, 7] . The nsps are then recruited to cytoplasm membranes, on which they form the membraneassociated replication-transcription complex (RTC). An RNAdependent RNA polymerase nsp12 and a helicase nsp13 are the central components of RTC [8, 9] . However, while high-resolution structures of most CoV encoded proteins had been determined soon after SARS-CoV outbreak, the first CoV nsp13 structure, MERS-CoV nsp13, was only solved recently [10] . Nsp13 belongs to helicase superfamily 1 and shares conserved features with the eukaryotic Upf1 helicase [11, 12] . Nsp13 is a multi-domain protein comprising of an N-terminal Cys/His rich domain (CH domain) and a C-terminal SF1 helicase core [10] . Nsp13 exhibits multiple enzymatic activities, including hydrolysis of NTPs and dNTPs, unwinding of DNA and RNA duplexes with 5 0 -3 0 directionality and the RNA 5 0 -triphosphatase activity [13, 14] . To investigate the structure of CoV nsp13, we overexpressed the full-length MERS-CoV nsp13 (1-598aa) in insect cells and purified. The activity of the recombinant MERS-CoV nsp13 was verified by ATPase and helicase assays. Crystallization of MERS-CoV nsp13 was achieved by adding a synthetic single-stranded 15 poly dT DNA with 5 0 -triphosphate (ppp-15 T) to the protein, which restrains the intrinsic flexibility of nsp13. Benefiting from the presence of an N-terminal zinc-binding domain with three zinc atoms, multi-wavelength anomalous diffraction (MAD) data at the zinc absorption edge was collected, which allowed the determination of the crystal structure of MERS-CoV nsp13 [10] .

Prepare all solutions using ultrapure water (prepared by purifying deionized water, to attain a sensitivity of 18 MΩ-cm at 25 C) and analytical grade reagents. Prepare and store all reagents at room temperature (unless indicated otherwise). Diligently follow all waste disposal regulations when disposing waste materials. We do not add sodium azide to reagents. 2. The forward primer (gaaattggatccgctgtcggttcatgc) and the reverse primer (gaaattctcgagtcactggagcttgtaatt) of full-length nsp13. Primers stocks are either supplied or diluted by molecular biology grade water to 100 μM and stored at À20 C.

3. The pFastbac-1 baculovirus transfer vector is modified; 6 Â Histidine-SUMO tag with a C terminal PreScission protease (PPase) site coding sequence in the N terminal of open reading frame [15] .

All procedures should be carried out at room temperature unless otherwise specified.

Transposition in E. coli DH10 Bac 1. Amplify MERS-nsp13 full-length by PCR method with BamHI and XhoI restriction sites at 5 0 and 3 0 termini, respectively.

2. The amplified MERS-nsp13 gene should be digested by BamHI/XhoI at 37 C for 1 h. The pFast-bac-6ÂHistidine-SUMO plasmid should also be digested by BamHI/XhoI at the same time.

3. Digested nsp13 DNA should be ligated with pFast-bac-6ÂHistidine-SUMO vector using the rapid DNA ligation kit. 

1. Prepare 50 mL high-5 cells in express-5 medium at a density of 0.38 Â 10 6 cells/mL, and culture in a 300 mL cell conical flask. Incubate the culture at 28 C with shaking at 120 rpm for 48 h, the density of cells will grow to 1.5-2.5 Â 10 6 cells/mL (see Note 2).

2. Add 1.5 mL MERS-CoV nsp13 P2 or P3 virus into the culture, and incubate at 22 C with shaking at 120 rpm for 44-60 h.

3. Centrifuge the culture at 3000 Â g for 30 min. Collect the cells pellet. 10. Prepare the Ni-NTA resin, and add the resin into 2-3 empty Econo-Columns (5 mL 50% resin per column), wash and balance the resin with 10 mL lysis and wash buffer(II) twice.

11. Place the columns at 4 C. Apply the clarified cell lysates supernatant to the balanced Ni-NTA resin, and flow through the column by gravity.

12. Wash the resin in the column with 10 mL lysis and wash buffer (II) 3 times.

13. Resuspend the resin by 3.5 mL L lysis and wash buffer(II), and add 100 μL PPase. Incubate the resin at 4 C for 10-12 h.

14. Apply the buffer to the column and let it flow under gravity. Collect the flow through in a 50 mL tube.

15. Add another 25 mL lysis and wash buffer(II) to the resin and flow through the column. Also collect the flow through in the previous 50 mL tube. 16 . To remove the PPase, add the flow through to another column which contains the NS4B resin. Collect the flow through from the NS4B resin column.

17. Apply the flow through to an Amicon Ultra protein concentrator (30 kDa filter, 50 mL), centrifuge at 2465 Â g at 4 C until the sample volume is concentrated to 1 mL. 18 . Transfer the concentrated sample to a 1.5 mL tube and centrifuge at 17,949 Â g for 3 min to remove the aggregates and particulates.

19. Load the sample onto the superdex 200 column in the size exclude chromatography (SEC) buffer using an Ä KTA-purify chromatography at 4 C.

20. Analyze 8 μL of each peak fractions by SDS-PAGE (Fig. 2) . 21 . Collect the fractions that contain the single band of MERS-CoV nsp13, mix the fractions, and concentrate the mixture to a final density of 6-8 mg/mL. 22 . 50 μL packaged the protein sample, quickly freeze them by liquid nitrogen and store them at À80 C. 5. Spot 1 μL sample from the mixture on the thin-layer chromatography cellulose TLC plates and resolve with running buffer for 20 min.

6. Dry the plates and press the plate onto phosphor screen for 2 h. Analyze the result by storage phosphor screen and Typhoon Trio Variable Mode Imager (Fig. 3) . 5. Take 4 μL sample from each reaction mixtures and load the samples onto 10% native PAGE gel.

6. Run the native PAGE gel at 100 V for 40 min on ice.

7. Scan the gel (Fig. 4 ).

Crystals of the unliganded MERS-CoV nsp13 diffracted the X-rays poorly, >3.6 Å . The addition of 5 0 -triphosphate-15 dT DNA (ppp-15T) greatly improves the resolution. 2. Mix 1 μL sample with 1 μL reservoir buffer from the crystallization conditions screen kits, and incubate at 18 C using the hanging-drop vapor-diffusion system.

3. Crystallize MERS-CoV nsp13 by mixing with the equal volume of reservoir buffer containing 0.1 M Tris-HCl (pH 8.5), 1 M (NH4) 2 SO 4 , and 15% glycerol. Crystals grow to their maximum in a week (Fig. 5 ).

Crystal Structure 1. Highly redundant multi-wavelength anomalous diffraction data should be collected using the X-ray with wavelengths close to the absorption edge of zinc. High energy remote wavelength should be 1.2810 Å , peak wavelength: 1.2827 Å (two datasets were collected to improve the redundancy), and inflection wavelength 1.2831 Å .

2. Data processing and reducing by XDS Package and Truncate software from CCP4. The crystals belong to the space group P6 1 22, and contained two copies of nsp13 per asymmetric unit. 3. An interpretable electron density map should be calculated using SHARP/autoSHARP [20] .

Coot [21] .

5. Collect native data with highest resolution (3.0 Å ) using the X-rays with the wavelength of 0.978 Å .

6. Higher resolution structure should be solved by molecular replacement using the initial nsp13 structure as the searching model. 7. Manual model building with the improved electron density map. While most part of nsp13 can be located, the electron density of 1B subdomain is very weak, reflecting that this part is highly flexible.

8. Structure refinement to resolution limit of 3.0 Å using software PHENIX [22] .

In the final model (Fig. 6) , 145-230aa (the entire 1B domain) of molecule A are disordered, probably due to mobility of 1B and the lack of crystal contacts, whereas in molecule B, 591 out of 598 amino acids were located in the electron density maps (Fig. 7) . Data collection and refinement statistics are summarized in Table 1 . 4 Notes 1. When we prepare P1 virus in six-well plates, the medium in the wells always evaporated. Sealing the gap of the plate by medical tape can reduce the evaporation of medium (don't seal the gap completely, leave a small gap to keep the ventilation). Having a water trough in incubator also can reduce the evaporation of the medium.

2. The culture of insect cells sometimes was harassed by the contamination of bacteria or other microbes. To avoid the contamination, we treat the conical flasks not only by conventional autoclave sterilization, but also leave the 3 L conical flask (sealed by tinfoil) in the oven at 200 C for 3-5 h before using.

3. To remove nucleic acids bound to nsp13, we used the lysis buffer containing high concentrate salt; this is a key step and improves the crystallization of nsp13 [10] . In practice, when sonicated in the buffer containing high concentrate salt, we found that the SUMO-tagged recombinant proteins lead the supernatant of the high-5 cell lysate to be turbid, which finally blocks the affinity columns. We have tried four concentrations of NaCl in lysis buffer, including 300 mM, 500 mM, 1 M, and 1.5 M. The first three concentrations of NaCl render the supernatant to be unable to use, we can't improve it by highspeed centrifugation (47,850 Â g), and it also can't be filtered by 0.45 μm syringe filter. The last concentration, 1.5 M NaCl in lysis buffer, could generate a bit better supernatant of cell lysates than other three concentrations of salt. We centrifuge the supernatant twice, then can filter it by 0.45 μm syringe filters (100 mL supernatant consumed about 8-10 filters). This clarified supernatant can flow through the affinity columns well.

4. The results of helicase assay always face the contamination of background fluorescence. Keep the gel from contacting any items containing fluorescence in the lab, including fluorescent dyes, some plastic boxes, hand towel, and so on.

SARS--beginning to understand a new virus

Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia

INFECTIOUS DIS-EASES. Amid panic, a chance to learn about MERS

Nidovirales: evolving the largest RNA virus genome

The footprint of genome architecture in the largest genome expansion in RNA viruses

Mechanisms and enzymes involved in SARS coronavirus genome expression

SARS-CoV ORF1b-encoded nonstructural proteins 12-16: replicative enzymes as antiviral targets

One severe acute respiratory syndrome coronavirus protein complex integrates processive RNA polymerase and exonuclease activities

Identification and characterization of severe acute respiratory syndrome coronavirus replicase proteins

Crystal structure of Middle East respiratory syndrome coronavirus helicase

Viral proteins containing the purine NTP-binding sequence pattern

Structural basis for the regulatory function of a complex zinc-binding domain in a replicative arterivirus helicase resembling a nonsense-mediated mRNA decay helicase

Multiple enzymatic activities associated with severe acute respiratory syndrome coronavirus helicase

Biochemical characterization of Middle East respiratory syndrome coronavirus helicase

Crystal structure of NLRC4 reveals its autoinhibition mechanism

Automated parallel synthesis of 5 0 -triphosphate oligonucleotides and preparation of chemically modified 5 0 -triphosphate small interfering RNA

Solid-phase chemical synthesis of 5-0 -triphosphate DNA, RNA, and chemically modified oligonucleotides

The C-terminal regulatory domain is the RNA 5 0 -triphosphate sensor of RIG-I

Cooperative translocation enhances the unwinding of duplex DNA by SARS coronavirus helicase nsP13

Automated structure solution with autoSHARP

Features and development of coot

PHENIX: a comprehensive python-based system for macromolecular structure solution