key: cord-0985461-p2h6nysu
authors: Monger, Wendy; Alamillo, Josefa M.; Sola, Isabel; Perrin, Yolande; Bestagno, Marco; Burrone, Oscar R.; Sabella, Patricia; Plana‐Duran, Joan; Enjuanes, Luis; Garcia, Juan A.; Lomonossoff, George P.
title: An antibody derivative expressed from viral vectors passively immunizes pigs against transmissible gastroenteritis virus infection when supplied orally in crude plant extracts
date: 2006-06-29
journal: Plant Biotechnol J
DOI: 10.1111/j.1467-7652.2006.00206.x
sha: 8762d7b4f8e9dc2eda865e7adff3a5ccadf6934c
doc_id: 985461
cord_uid: p2h6nysu

To investigate the potential of antibody derivatives to provide passive protection against enteric infections when supplied orally in crude plant extracts, we have expressed a small immune protein (SIP) in plants using two different plant virus vectors based on potato virus X (PVX) and cowpea mosaic virus (CPMV). The ɛSIP molecule consisted of a single‐chain antibody (scFv) specific for the porcine coronavirus transmissible gastroenteritis virus (TGEV) linked to the ɛ‐CH4 domain from human immunoglobulin E (IgE). In some constructs, the sequence encoding the ɛSIP molecule was flanked by the leader peptide from the original murine antibody at its N‐terminus and an endoplasmic reticulum retention signal (HDEL) at its C‐terminus to allow the expressed protein to be directed to, and retained within, the endoplasmic reticulum. Western blot analysis of samples from Nicotiana clevelandii or cowpea tissue infected with constructs revealed the presence of SIP molecules which retained their ability to dimerize. The analysis of crude plant extracts revealed that the plant‐expressed ɛSIP molecules could bind to and neutralize TGEV in tissue culture, the levels of binding and neutralization reflecting the level of expression. Oral administration of crude extracts from SIP‐expressing plant tissue to 2‐day‐old piglets demonstrated that the extracts which showed the highest levels of in vitro neutralization could also provide in vivo protection against challenge with TGEV.

Plants are attractive expression systems for the production of heterologous proteins, such as pharmaceuticals, as they produce large amounts of biomass relatively simply and cheaply without the need for fermentation apparatus and without the danger of contamination by animal pathogens.

Furthermore, plants offer the prospect of supplying immunologically active material orally without the need for extensive downstream processing. Particular interest has focused on the production of antibodies (often termed 'plantibodies' when expressed in plants), and a significant number of antibody and antibody-based derivatives have been produced in a variety of plant species (Stoger et al ., 2002 (Stoger et al ., , 2005 .

Although plant-expressed antibodies specific for proteins from Streptococcus mutans and herpes simplex virus have been shown to be capable of preventing disease when supplied topically (Ma et al ., 1998; Zeitlin et al ., 1998) , there is no report of protection being afforded by the oral route.

Protection against enteric infections can be provided by the oral administration of neutralizing antibodies. This approach, termed 'passive immunization', is a particularly attractive method for protecting newborn animals against such infections. Transmissible gastroenteritis virus (TGEV) is a coronavirus which is an important pathogen that infects both the respiratory and enteric tissues of pigs. In newborn pigs, TGEV causes close to 100% mortality (Enjuanes and van der Zeijst, 1995) , and it would be of great benefit if passive immunization could be used to protect such animals. The major antigenic sites of TGEV, involved in the induction of virus-neutralizing antibodies, are located in the globular portion of the spike (S) protein (Gebauer et al ., 1991) . The monoclonal antibody (mAb) 6A.C3 has been shown to recognize a highly conserved epitope in the S protein and can neutralize all TGEV isolates tested, as well as TGEV-related coronaviruses infecting pigs, dogs and cats (Suñe et al ., 1990; Gebauer et al ., 1991) . The recombinant immunoglobulin A (IgA) form of mAb 6A.C3 has been shown to be highly efficient at neutralization when expressed in the milk of transgenic mice (Castilla et al ., 1997 Sola et al ., 1998) , raising the possibility of basing passive immunization against TGEV on this molecule.

Recent work has shown that small immune proteins (SIPs) derived from mAb 6A.C3, expressed in mammalian cells, can neutralize TGEV infections in tissue culture and can confer protection against TGEV infection when supplied orally to newborn pigs (M. Bestagno et al ., in preparation) . SIPs are derivatives of single-chain antibodies (scFvs), in which the scFv sequence is fused to the constant domain of a heavy chain that is responsible for dimerization (Li et al ., 1997; Figure 1a, b) . SIPs combine the advantages of the bivalency of full-length antibodies with the small size of scFvs, and have been shown to have higher tissue penetration than complete antibodies and slower clearance than scFvs (Borsi et al ., 2002) . Thus, they are attractive candidates for passive immunotherapy. In the case of ε SIPs, the scFv sequence is fused to the CH4 domain of the S2 subclass of IgE, which permits efficient and stable dimerization via a C-terminal cysteine residue (Batista et al ., 1996; Borsi et al ., 2002) .

If passive immunization against TGEV with mAb 6A.C3 or its derivatives is to become a practical reality, it is essential that large amounts of immunotherapeutic material be produced at low cost. Effective passive immunization through the administration of crude plant extracts requires that the original tissue contains high levels of the appropriate antibody. One way of achieving the necessary levels is through the use of virus-based vectors rather than stable transformation (Porta and Lomonossoff, 2002) . In this paper, we report the use of two different plant virus vectors based on potato virus X (PVX) and cowpea mosaic virus (CPMV) to express an anti-TGEV ε SIP molecule in two different plant species. The plant-expressed SIP molecules retain their ability to dimerize, bind to TGEV particles and neutralize TGEV infections in vitro.

Extracts from plants expressing high levels of ε SIP were able to confer protective immunity in newborn piglets against TGEV infection when supplied orally, thus demonstrating the utility of plant-derived antibodies in providing passive oral immunity.

The sequence of the anti-TGEV ε SIP (Figure 1a ,b) was inserted into the two plant virus-based vectors in different ways to allow the release of a free protein in each case. For expression from PVX, the sequence of ε SIP was inserted, with or without its leader peptide, behind a duplicated coat protein subgenomic promoter to give plasmids pGR106-eSIP and pGR106-eSIPnaked, respectively. To express ε SIP using CPMV, the sequence was inserted downstream of a footand-mouth disease virus (FMDV) 2A catalytic peptide at the C-terminus of the RNA-2-encoded polyprotein to give plasmid pBinP-YP2. The 2A-mediated cleavage reaction is at least 90% efficient and results in the release of a protein with an additional proline residue at its amino terminus. The sequence encoding ε SIP was flanked by the leader peptide from the original 6A.C3 scFv at its N-terminus and an endoplasmic reticulum (ER) retention signal (HDEL) at its Cterminus to allow the expressed protein to be directed to, and retained in, the ER.

Agroinoculation was used to initiate infections for constructs based on the two viruses. Nicotiana clevelandii plants agroinoculated with the PVX constructs, with and without the leader peptide, developed systemic symptoms 7-9 days post-inoculation (d.p.i.). The resulting viruses were termed PVX-hueSIP and PVX-nakedhueSIP, respectively ( Figure 1c ).

In each case, the symptoms were milder than those obtained with the corresponding wild-type construct. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis confirmed that the insert was retained until 10-14 d.p.i. indicated that the levels of ε SIP obtained in N. clevelandii using PVX were only about 5%-6% of this level.

To investigate whether plant-expressed ε SIP molecules retained their ability to bind to TGEV particles, ELISA was carried out using plates coated with partially purified TGEV.

The level of binding obtained with extracts from leaves infected with each human ε SIP-expressing PVX and CPMV construct was compared with that obtained from equivalent extracts from leaves infected with the parental virus (negative controls) and with that observed with the same human ε SIP expressed in mammalian cells (hueSIP; positive control). In the case of the PVX-based constructs, an enhanced level of binding compared with the control extracts could be observed when the leader sequence was present (PVX-hueSIP), but not in its absence (PVX-nakedhueSIP; Figure 3a ). However, the binding activity with the PVX-hueSIP extracts was less than that obtained with supernatants from mammalian cells expressing the equivalent human ε SIP. When extracts of cowpea leaves infected with CPMV-hueSIP were analysed, leaves infected with CPMV-hueSIP (approximately 10 4 -and 10 3 -fold in lung and gut, respectively) was significantly greater than that obtained with N. clevelandii leaves infected with PVX-hueSIP (approximately 10 and 10 2 -fold in lung and gut, respectively), and, in gut tissue, was similar to that obtained with the mammalian cell-expressed εSIP (Figure 4) .

In all cases, the decrease in virus titre with the εSIP-containing extracts was less than that found with the full-length parental mAb 6A.C3. This may reflect the higher level of neutralization found with extracts containing the full-length mAb compared with εSIP (Figure 3) , or the fact that the full-length mAb is able to mediate additional mechanisms of protection, such as antibody-dependent cell-dependent cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC), which will not be invoked by SIP molecules as they lack the relevant portions of the constant region of the full-length antibody. The difference in in vivo efficacy between the PVX-and CPMV-expressed εSIP parallels the difference in binding and neutralization activity found in the respective extracts, and is consistent with the lower level of εSIP accumulation in the former case.

Thus, the in vitro data on the expression levels provide a good indication of the ability of leaf extracts to confer protection in vivo.

The Although the in vivo experiments were on a relatively small scale, they are important because they demonstrate that orally administered SIP molecules are stable during the preparation of plant extracts and are resistant to the enzymatic and pH conditions of the enteric tract. This is especially relevant as it validates the general approach of using the oral administration of SIP molecules to achieve passive immunization against enteric pathogens. Furthermore, no toxic effects of the administration of plant extracts containing SIP molecules from either N. clevelandii or cowpea were observed, suggesting that this approach is safe as well as efficacious. In addition, the correlation between in vitro neutralization and in vivo protection means that it is possible to assess the efficacy of any particular batch of plant extract prior to its administration to animals.

We chose to use a viral vector rather than a transgenic approach to express the εSIP molecules, as this can potentially

give the high levels of expression necessary to achieve passive immunization. In addition, large amounts of material can be produced in a relatively short time (Porta and Lomonossoff, 2002) . Prior to the work reported here, in terms of antibody production, virus-based vectors have mainly been used to express scFvs in plants (McCormick et al., 1999; Ziegler et al., 2000) , although there is a single report of the assembly of a full-length antibody using this approach (Verch et al., 1998) .

The viral vectors used in the current study (PVX and CPMV) were capable of directing the expression of εSIP molecules which had the ability to bind to TGEV, although the expression levels achieved varied. In the case of expression from PVX, inclusion of the original leader peptide from the mouse immunoglobulin V H domain was found to be essential for the accumulation of detectable levels of εSIP. The presence of this leader peptide allows the expressed SIP molecules to be directed to the plant secretory pathway, where posttranslational modifications can take place, rather than accumulating in the cytoplasm.

To maximize εSIP accumulation using a CPMV vector, the εSIP coding sequence was flanked by a leader peptide at its N-terminus and an ER retention signal (HDEL) at its Cterminus. The εSIP sequence was expressed at the C-terminus of the RNA-2-encoded polyprotein, and thus targeting to the secretory pathway should not affect any viral protein. The HDEL sequence was included because retention in the ER enhances the levels of accumulation of single-chain antibodies in plants (Schouten et al., 1996) . Furthermore, the presence of this sequence has been shown to be necessary to achieve high levels of expression of green fluorescent protein (GFP), which had been directed to the secretory pathway after expression from CPMV (L. Nicholson et al., unpublished data) . The strategy was successful, as levels of εSIP sufficient to protect newborn pigs against TGEV accumulated in leaf tissue. The levels of antibody expression (approximately 2% total soluble protein) are similar to those previously reported for an ER-retained version of an scFv expressed from a PVX vector (Ziegler et al., 2000) , and considerably higher (about 15-20-fold) than the levels obtained when εSIP was expressed from PVX without an ER retention signal. The fact that CPMV infects an edible plant, cowpea, is a further advantage of the system as it reduces potential concerns about administering plant tissue, such as that from Nicotiana species, which contains significant levels of alkaloids.

The demonstration that quantities of an antibody sufficient to afford protection to target animals through the oral supply of crude plant extracts can be produced using viral vectors, in particular CPMV, indicates that this approach could provide a general method for oral passive immunization. It will be very straightforward to express εSIP molecules with different specificities simply by substituting the scFv domain of the construct. In this regard, it is noteworthy that, although the plant tissue expressing the anti-TGEV εSIP was supplied only orally, a significant decrease in virus titre was observed not only in enteric tissue, but also in the lungs. This could be a result of the prevention of virus shedding by the faecal-oral route or, alternatively, may reflect the fact that SIP molecules exhibit high tissue penetration and may therefore prevent the internal distribution of the virus to the respiratory organs.

Whatever the reason for this observation, it suggests that the oral administration of SIP molecules may provide passive protection against respiratory as well as enteric pathogens, although further animal studies will be required to establish this unequivocally. Overall, the results presented here indicate that plantibodies are safe and efficacious molecules which can provide immediate protection against virus infections, as required in newborn animals or healthcare workers. Furthermore, their expression via viral vectors allows plant material expressing antibodies with different specificities to be rapidly produced, thus opening up the way to a new approach to control diseases such as severe acute respiratory syndrome coronavirus and other enteric and respiratory pathogens.

Plasmids Functional recombinant mAb 6A.C3 genes were originally described in Castilla et al. (1997) . The source of the sequence of the anti-TGEV εSIP for all the experiments was pcDNA-6AC3-huεsip (Figure 1a ; M. Bestagno et al., in preparation) .

The viral vectors used for the expression of the εSIP sequence were pGR106 (Jones et al., 1999) and pBinP-NS-1 (Liu et al., 2005) for the expression from PVX and CPMV RNA-2, respectively. Full-length CPMV RNA-1 was supplied by plasmid pBinPS1NT (Liu and Lomonossoff, 2002) .

For cloning in pGR106, the εSIP gene in pcDNA-hu6AC3-εsip was amplified by PCR using CCATCGATCCATGGGCTGGAGC or CCATCGATCCATGGACAT TGTG as the forward primer to produce εSIP constructs with and without the original murine leader peptide, respectively. In each case, a ClaI site (italic) was introduced upstream of the SIP-specific sequence. In both cases, GCGTCGACCTAGCAGCCACC, containing a SalI site, was used as the reverse primer. The PCR products were digested with ClaI and SalI and ligated into ClaI/SalI-digested pGR106 to give pGR106-eSIP and pGR106-eSIPnaked, respectively.

To create a CPMV-based vector containing the sequence of anti-TGEV εSIP, pcDNA-6AC3-huεsip was modified by PCR-based mutagenesis. To remove the intron in the leader sequence, to introduce a unique ApaI site at the 5′-terminus of the coding sequence and to eliminate the original ATG start codon, the forward primer ACTCTAGCCAAGCT TGT-CGGGGCCCGGCTGGAGCCTGATCCTCCTGT TCCTCGTCGCT-GTGGCTACAGGTGTGCACTCGGACATTGTGATGACCC was used. The reverse primer GCTAACCGAGCTCGGTACCTA-GAGT TCGTCGTGGCAGCCACCCCTCCTCG was used to fuse the sequence encoding an ER retention signal, HDEL, to the C-terminus of the CH4 domain. In addition, an internal ApaI site in the CH4 domain was removed using the mutagenic primer GTCTCCTCCGGAGGCTCTGGCGGC to introduce a silent G to C change. The construct (pYP-2) containing the modified version of ε-SIP was digested with ApaI and EcoRV, and the 1.5-kb fragment encoding the sequence of SIP was used to replace that of GFP in ApaI/StuI-digested pBinP-NS-1 to give plasmid pBinP-YP2.

The structure of the various ε-SIP constructs was verified by sequence analysis, and appropriate Agrobacterium tumefaciens strains (GV3010 for pGR106-eSIP and pGR106-eSIPnaked, and LBA4404 for pBinP-YP2) were transfected by electroporation.

In all cases, plants were initially infected by agroinoculation. 

Infected plant tissue was collected at several times postinoculation and macerated with 2 mL /g ice-cold 0.05 M sodium phosphate buffer (pH 7.2) to break open the cells.

Cell debris was removed by centrifugation at high speed for 20 min at 4 °C, and the supernatant containing total soluble plant proteins was collected. The ability of SIP molecules in the plant extracts to bind to TGEV was determined by ELISA and virus neutralization assays, following previously reported procedures (Correa et al., 1988) . Purified TGEV virions were adsorbed to ELISA plates before the extracts (50 µL) were added to the wells. TGEV-bound SIPs were detected with a goat anti-human IgE antibody (Nordic, Tilburg, the Netherlands), diluted 1 : 500 in PBS/T containing 0.3% bovine serum albumin, with horseradish peroxidase-conjugated rabbit 

Between 70 and 90 g of infected tissue was snap-frozen in liquid nitrogen, ground to fine powder and extracted in 2 mL/g ice-cold 0.05 M sodium phosphate buffer (pH 7.2).

After removal of cell debris, the cleared extract was frozen at −80 °C and lyophilized. About 2.6 g of lyophilized material was obtained from each sample; 0.03 g of each sample was reconstituted with 1 mL of phosphate buffer and the in vitro SIP activity was assayed. To assess the ability of the plantexpressed SIP to confer protection, 0.3 g of lyophilized plant tissue dissolved in 4 mL of water and TGEV PUR46 C11 [10 7 plaque-forming units (pfu) per animal] were added to milk, and the mixture was supplied to 2-day-old piglets via an oral cannula. The piglets were subsequently fed, via baby bottles, with milk mixed with 0.3 g of lyophilized plant tissue dissolved in 4 mL of water. The antibody-containing mixture was administered twice more on the day of challenge and three times on the following 2 days post-challenge. Piglets were killed 2 and 3 days post-challenge, a time at which the virus levels reach a peak in TGEV-infected piglets (Sánchez et al., 1999) , and virus titres in gut and lung tissue were determined as described by Jiménez et al. (1986) . Protection against TGEV by plant extracts was expressed as the ratio of pfu obtained after the administration of extracts from plants infected with the wild-type vectors to that obtained when the corresponding SIP-expressing extracts were supplied. As positive controls, the protection afforded by the administration of 4 mL of a 1 : 10 dilution of ascitic fluid containing mAb 6A.C3 compared with ascitic fluid not containing the antibody, and that afforded by 4 mL of supernatants from Sp2/0 cells expressing anti-TGEV εSIP compared with supernatants expressing a SIP of irrelevant specificity, were assessed.

Characterization of a second secreted IgE isoform and identification of an asymmetric pathway of IgE assembly

Selective targeting of tumoral vasculature: comparison of different formats of an antibody (L19) to the ED-B domain of fibronectin

Interference of coronavirus infection by expression of immunoglobulin G (IgG) or IgA virus-neutralizing antibodies

Engineering passive immunity in transgenic mice secreting virus-neutralizing antibodies in milk

Antigenic structure of the E2 glycoprotein from transmissible gastroenteritis coronavirus

Molecular basis of TGE coronavirus epidemiology

Residues involved in the formation of the antigenic sites of the S protein of transmissible gastroenteritis coronavirus

Critical epitopes in transmissible gastroenteritis virus neutralization

RNA-DNA interactions and DNA methylation in post-transcriptional gene silencing

Mammalian cell expression of dimeric small immune proteins (SIP)

Agroinfection as a rapid method for propagating cowpea mosaic virus-based constructs

Cowpea mosaic virus-based systems for the production of antigens and antibodies in plants

Characterisation of a recombinant plant monoclonal secretory antibody and preventative immunotherapy in humans

Rapid production of specific vaccines for lymphoma by expression of the tumorderived single-chain Fv epitopes in tobacco plants

The use of viral vectors to produce hepatitis B virus core particles in plants

Viruses as vectors for the expression of foreign sequences in plants

Targeted recombination demonstrates that the spike gene of transmissible gastroenteritis coronavirus is a determinant of its enteric tropism and virulence

The C-terminal KDEL sequence increases the expression level of a single-chain antibody designed to be targeted to both the cytosol and the secretory pathway in transgenic tobacco

Transgenic mice secreting coronavirus neutralizing antibodies in milk

Plantibodies: application, advantages and bottlenecks

Sowing the seeds of success: pharmaceutical proteins from plants

Mechanisms of transmissible gastroenteritis coronavirus neutralisation

Expression and assembly of a full-length monoclonal antibody in plants using a plant virus vector

A humanized monoclonal antibody produced in transgenic plants for immunoprotection of the vagina against genital herpes

Facile assessment of cDNA constructs for the expression of functional antibodies in plants using the potato virus X vector