key: cord-0993340-rqw26rk7
authors: Scroggs, Stacey L.P.; Gass, Jordan T.; Chinnasamy, Ramesh; Widen, Steven G.; Azar, Sasha R.; Rossi, Shannan L.; Arterburn, Jeffrey B.; Vasilakis, Nikos; Hanley, Kathryn A.
title: Evolution of resistance to fluoroquinolones by dengue virus serotype 4 provides insight into mechanism of action and consequences for viral fitness()
date: 2020-10-01
journal: Virology
DOI: 10.1016/j.virol.2020.09.004
sha: e94eae39eadc5f562d96224cd6a29ea915631c12
doc_id: 993340
cord_uid: rqw26rk7

Drugs against flaviviruses such as dengue (DENV) and Zika (ZIKV) virus are urgently needed. We previously demonstrated that three fluoroquinolones, ciprofloxacin, enoxacin, and difloxacin, suppress replication of six flaviviruses. To investigate the barrier to resistance and mechanism(s) of action of these drugs, DENV-4 was passaged in triplicate in HEK-293 cells in the presence or absence of each drug. Resistance to ciprofloxacin was detected by the seventh passage and to difloxacin by the tenth, whereas resistance to enoxacin did not occur within ten passages. Two putative resistance-conferring mutations were detected in the envelope gene of ciprofloxacin and difloxacin-resistant DENV-4. In the absence of ciprofloxacin, ciprofloxacin-resistant viruses sustained a significantly higher viral titer than control viruses in HEK-293 and HuH-7 cells and resistant viruses were more stable than control viruses at 37 °C. These results suggest that the mechanism of action of ciprofloxacin and difloxacin involves interference with virus binding or entry.

J o u r n a l P r e -p r o o f with 5% CO 2 in MEM supplemented with 10% heat-inactivated FBS, 2mM L-glutamine, 2mM 140 nonessential amino acids (Gibco), and 0.05 mg/mL gentamycin. Viral titers were determined via 141 serial dilution onto HEK-293, Vero, HuH-7 or C6/36 cells followed by immunostaining using 142 previously described methods (5,55,56). Briefly, each virus was serially diluted ten-fold and 143 inoculated onto confluent cells in 24-well plates. After two hours of incubation at 37°C with 144 occasional rocking, infected cells were overlaid with 1% methylcellulose in OptiMEM (Gibco) 145 that had been supplemented with 2% FBS, 2mM L-glutamine, and 0.05 mg/mL gentamycin. 146

Plates were incubated for five days under maintenance conditions, after which cells were fixed 147 with ice cold methanol: acetone (1:1) for HEK-293 and 90% methanol for Vero, HuH-7, and 148 supernatants were collected, clarified, frozen, and viral titers determined via plaque assay. As 194 shown in Figure 1 , resistance of the ciprofloxacin lineage to ciprofloxacin was suspected and 195 formally tested as described above at passage 2 (P2) but resistance was not detected; resistance 196 was suspected and confirmed at P7. Resistance of difloxacin-passaged lineages to difloxacin 197 was suspected at P3 and P6, but resistance was not detected; resistance was suspected and 198 confirmed at P10. Resistance of enoxacin-passaged lineages to enoxacin was never suspected 199 and was only evaluated at P10. 200

Ciprofloxacin-resistant lineages (hereafter termed DENV-Cipro A,B or C) were tested for 201 cross-resistance to enoxacin and difloxacin at 7.6µM and 10.1µM, the EC 50 of each drug, 202 respectively, and difloxacin-resistant viruses (DENV-Diflox A,B,C) were tested for cross-203 resistance to enoxacin and ciprofloxacin at 7.6 µM and 19.6 µM, the EC 50 of ciprofloxacin, 204 respectively. To test for cross-resistance, triplicate T25 flasks of HEK-293 cells were infected 205 with each of the three lines of viruses resistant to the specified fluoroquinolone, the three control 206 lines, or the parent virus (N = 7 virus lines) at MOI: 1.0. Two hours after infection, one flask of 207 University of Texas at El Paso using the amplification primers listed above as well as four 255 validated internal primers (996R: 5' ATGCTCCACCTGAGACTCCTTCC 3', 860F: 5' 256 GGCTTATATGATTGGGCAAACAGG 3', 1683R: 5' CCTGTCTCTTGGCATGAGGAACC 257 3', 1551F: 5' ACATGGCTCGTGCATAAGCAATGG 3') (55). The resulting forward and 258 reverse sequences were clipped for quality and aligned in Geneious (version 9.0.5 (66)) with the 259 reference genome (GenBank AY648301.1). Mutations were identified in the passaged viruses 260 compared to DENV-P. 261 262

To evaluate the impacts of ciprofloxacin resistance on DENV-4 replication dynamics in 264 human and mosquito cells, 7 T25 flasks of 80% confluent HEK-293, HuH-7, Vero, or C6/36 265 cells were infected at MOI 0.1, based on the viral titer determined in HEK-293, with each of the 266 DENV-Cipro or DENV-DMEM lineages (both from passage seven) or DENV-P. After 2 hours 267 of incubation with occasional rocking, the flasks were washed with 1X PBS and 5ml of cell-268 specific media was added to each flask. Viral supernatants were collected on the day of infection 269 as well as 1, 2, 3, 4, 6, and 8 days post-infection (dpi). For replication curves with HuH-7 and 270

Vero cells, the time points for collection were extended to include 9, 10, 11, and 12 dpi as the 271 plateau viral titer was not detected by 8 dpi. At each time point, 1 ml of the media was removed 272 from each flask and 1 ml of fresh media was added back to each flask. The viral supernatants 273 were clarified by centrifugation at 1200 rpm for 10 minutes at 4˚C, stored at -80 °C in 1X SPG, 274 and viral titers were determined using the same cell line as that used for the replication dynamics Eggs from Aedes aegypti (Rockefeller strain) were hatched and reared as described in 294 (67). Infectious bloodmeals were prepared and mosquito feeding was conducted as described in 295 (56). Briefly, 1 mL of virus was mixed with 2 mL of washed red blood cells from defibrinated 296 rabbit blood (Hemostat, Dixon, CA, USA) in 10% sucrose; 75 µl of 120 mM ATP was added to 297 each meal immediately prior to feeding. Sealed cartons containing ~30 mosquitoes were starved 298 for 24 hours, placed under parafilm-covered feeders warmed to 37°C, and allowed to feed for 20 299 80% relative humidity on a 12-hour light and 12-hour dark cycle. The mosquitoes were provided 301 10% sucrose in cotton pledgets ad libitum. After 10 days, mosquitoes were cold-killed and 302 stored at -80 °C, after which whole mosquitoes were homogenized in Hank's balanced salt 303 solution (Gibco) supplemented with 10% FBS, 250µg/mL amphotericin B (Gibco), 1% 304 ciprofloxacin, and 150 µg/mL clindamycin and viral titer was determined as described above in 305 C6/36 cells with the addition of 5 µg/mL amphotericin B to the methylcellulose overlay media. 306 307

Viral titer data were log transformed, assessed for normality and then compared using t-309 tests or two-way ANOVAs as appropriate. Repeated measures ANOVA was used to detect 310 differences in replication kinetics and percent change in viral titer from the stability assay 311 between the ciprofloxacin-resistant and media control viruses. DENV-P was not included in the 312 repeated measures ANOVA as there was only one parental replicate. Differences in variant 313 frequency, Shannon entropy, and mosquito mortality (%) were detected by ANOVA. 314

Differences in variant frequency and Shannon entropy among genes and between treatments 315 were identified using a two-way ANOVA. Differences in the counts of mosquito bodies positive 316 for DENV-4 infection was detected using contingency table analyses. Tukey-Kramer or pairwise 317 t-tests, as specified, were used to ascertain post hoc pairwise differences. Statistics were 318 conducted in R using packages: tidyverse, plyr, dplyr, lme4, car, emmeans, lsmeans, and 319 pbkrtest. 320

In this study, we passaged DENV in the presence and absence of ciprofloxacin, 324 difloxacin, and enoxacin until resistance was detected or 10 total passages were completed. 325

Drug resistant viruses provide the opportunity to further assess the mechanism-of-action for each 326 drug by identifying mutations associated with resistance and evaluate the consequences of 327 resistance. Resistance was defined as a lack of a difference between the mean viral titers of the 328 media-passaged control viruses cultured in media and viruses passaged in a specific 329 fluoroquinolone cultured in the presence of that fluoroquinolone. 330

Resistance of the three DENV-4 Cipro lineages to 19.6µM and 39.2µM ciprofloxacin, 331 which represent the EC 50 and twice the EC 50 of this drug, was assessed after two passages but not 332 detected ( Figure S1a significant decrease in titer for both virus lineages relative to treatment with media, but the 339 decrease in viral titer of DENV-DMEM after ciprofloxacin treatment was greater than that of 340 DENV-Cipro (4.2 log decrease vs 1.9 log decrease). There was no significant difference in mean 341 viral titers between DENV-DMEM treated with media and DENV-Cipro treated with 342 ciprofloxacin. In the absence of ciprofloxacin, replication of DENV-Cipro was not different than passages ( Figure S2c ) but was not confirmed. After ten passages (Figure 1c Table 1) . One of these substitutions, E417A, was also found in one replicate of DENV-Diflox 373 (Table 2 ). Other coding mutations in the E, NS2B and NS4B genes and non-coding mutations in 374 the untranslated regions (UTRs), many of which had been previously identified in the literature 375 as HEK-adapting mutations, were found in at least a subset of both drug-resistant and control 376 viruses (Table 1) . No consensus mutations were identified in DENV-P compared to the 377 reference sequence (AY648301). Silent mutations within the open reading frame are listed in 378 Table S1 . The variants for all three viral populations were distributed across the genome (Figure 4 ). There 406 was no significant interaction between viral population (DENV-Cipro, DENV-DMEM, DENV-407

We evaluated whether DENV resistance to one fluoroquinolone can confer resistance to 416 another. As shown in Figure 6 , the efficacy of difloxacin and ciprofloxacin to suppress DENV-417

Cipro and DENV-Diflox, respectively, was significantly diminished. Remarkably, enoxacin 418 retained its ability to suppress viral replication of both DENV-Cipro and DENV-Diflox. 419

However, there was some evidence of nascent cross-resistance to enoxacin. The diminution of 420 titer for DENV-DMEM treated with enoxacin (3.7 log decrease) was substantially greater than 421 that for DENV-Cipro gained fitness in the HEK-293 cells in which they were passaged relative to DENV-P, and that 431 DENV-Cipro lineages reach equivalent peak titer to DENV-DMEM lineages but declined in titer 432 more slowly (Figure 7 ). Viral titers of DENV-Cipro and DENV-DMEM were an average of 2.7 433 log and 2.5 log higher, respectively, than DENV-P from days 1 to 3 p.i. Viral titers of DENV-434 Cipro were greater than DENV-DMEM on days 3, 4, and 6 p.i. 435

In HuH-7 cells, replication of DENV-Cipro reached a higher peak titer by day 2 post-436 infection than DENV-DMEM and sustained that titer for the 12 days over which sampling was 437 conducted (Figure 7 ). Viral titers of DENV-Cipro were greater than DENV-DMEM on days 2 -438 12 p.i. In African green monkey kidney cells (Vero), replication of DENV-P, DENV-Cipro, and 439 DENV-DMEM lineages were all remarkably similar and no differences in viral titer were 440 detected (Figure 7) . In contrast to mammalian cells, DENV-P replicated to higher levels in 441 mosquito C6/36 cells compared to DENV-Cipro and DENV-DMEM (Figure 7) . DENV-DMEM viral titers were reduced by 52% (Figure 8) . 452 average titer of 2.25 log 10 PFU/body, however, none of mosquitoes that fed on bloodmeals 461 containing DENV-Cipro or DENV-DMEM became infected (Table 3 ; χ 2 = 22.0, df = 2, P < 462 0.0001). Of the infected mosquitoes that fed on bloodmeals spiked with DENV-P, 45% of the 463 heads were also infected with an average titer of 2.69 log 10 PFU/head (Table 3) We found that DENV-4 evolved resistance to ciprofloxacin within seven passages and 475 difloxacin within ten passages but the virus failed to evolve resistance to enoxacin within ten 476 passages, suggesting a higher barrier to resistance against enoxacin than the other two drugs. 477

The variation in the rate of evolution of resistance could be due to stochasticity in evolution, 478 particularly as our definition of resistance required that all three replicates within a treatment 479 evolve resistance, but variation in resistance evolution could also reflect differences among the 480 drugs in mechanism-of-action. In our previous study of these drugs, time-of-addition assays 481 may share a mechanism-of-action that is different than that of enoxacin (5). Supporting this 485 contention, ciprofloxacin resistance conferred resistance to difloxacin and vice versa, but neither 486 resistance to ciprofloxacin nor difloxacin conferred resistance to enoxacin according to our a 487 priori definition of resistance. However, there were more subtle difference in the responses of 488 the virus lineages to enoxacin that did suggest that resistance to ciprofloxacin or difloxacin did 489 engender some degree of cross-resistance to enoxacin. Differences in biochemical activities 490 among the three drugs are documented (71); in particular, while enoxacin strongly enhances 491

RNAi, ciprofloxacin and difloxacin have a moderate and marginal effect on RNAi, respectively 492 (24). Cross-resistance does raise concerns about the long-term sustainability of ciprofloxacin 493 and difloxacin as flaviviral inhibitors, but combination therapies with other antiviral compounds 494 that are not similar in structure and do not share a mechanism-of-action may mitigate these 495 concerns. 496

To gain further insight into the antiviral mechanism-of-action, we sequenced the whole 497 genome of each of the three DENV-Cipro viruses, three DENV-DMEM viruses, and DENV-P. 498

We discovered two coding mutations, both in the envelope glycoprotein, that were unique to the 499 DENV-Cipro viruses. These mutations produced a V15L substitution in two replicates and an 500 E417A substitution in one replicate. E417A was also detected in one replicate of the DENV-501 Diflox viruses, but neither substitution was detected in the DENV-Enox viruses. DENV-Cipro 502 viruses were sequenced by Illumina while DENV-Diflox and DENV-Enox viruses were 503 analyzed via Sanger sequencing, thus it is possible that the mutations detected in the DENV-504

Cipro lineages occurred in these two groups at frequencies below the level of detection. Also, 505 resistance to difloxacin was not as complete as resistance to ciprofloxacin, as resistance was confirmed at the EC 50 (10.1µM), but not at 2x EC 50 (20.2µM). We note that although these 507 findings are suggestive, reverse genetics will be needed to formally confirm the role of these 508 mutations in resistance. HEK-293 and HuH-7 cells, but not Vero cells is dependent on the lack of interferon and/or is an 575 will impact infection in vivo. 577

Further, fitness of the DENV-Cipro and DENV-DMEM viruses were equivalent, but 578 lower than that of DENV-P, in C6/36 cells, a mosquito cell line that lacks a functional RNAi 579 response (98) and both lineages failed to infect live Ae. aegypti mosquitoes fed on artificial 580 bloodmeals spiked with these viruses. The failure of the passaged viruses to infect mosquitoes is 581 likely due to the suite of mutations in NS4B that they accrued; some of these mutations have 582 previously been associated with mammalian adaptation and loss of mosquito infectivity (40,74-583 77). This finding is consistent with the trade-off hypothesis, which states that a gain in fitness in 584 the mammalian host will negatively impact fitness in the mosquito vector (51-53). Our data 585 underscore the complexity of viral fitness and how the patterns are likely influenced by a 586 combination of drug resistance-associated and cell culture adaptation mutations. 587

Fluoroquinolones show some promise for repurposing as anti-flavivirals, but this study 588 also suggests several lines of inquiry that should be pursued to further evaluate the consequences 589 of evolution of fluoroquinolone resistance. While the barrier to resistance to enoxacin was 590 relatively high, DENV-4 evolved resistance to ciprofloxacin and difloxacin within ten passages 591 at or near the EC 50 of each drug. Furthermore, resistance to either ciprofloxacin or difloxacin 592 confers cross-resistance to the other drug. Unexpectedly, mutations associated with resistance 593 occurred in the envelope gene of the virus; the phenotypic impact of these E mutations should be 594

We would like to thank Brett Moehn for assistance with the analysis. J o u r n a l P r e -p r o o f comparisons. Full pairwise statistics for differences within and between genes by treatment are in 967 Table S2 . * P < 0.05. 968 

The global 625 distribution and burden of dengue

Broad-spectrum agents for flaviviral 627 infections: dengue, Zika and beyond

Zika in 629 the Americas, year 2: What have we learned?

Global Virus Network

A screen of FDA-approved drugs for inhibitors of Zika virus infection

Old drugs with new tricks: Efficacy of fluoroquinolones to suppress replication of 636 al. Reduced replication of 3TC-resistant HIV-1 variants in primary cells due to a 668 processivity defect of the reverse transcriptase enzyme

HIV population dynamics in vivo: implications for genetic variation, 670 pathogenesis, and therapy

Escape of tick-borne 672 flavivirus from 2′-C-methylated nucleoside antivirals is mediated by a single conservative 673 mutation in NS5 that has a dramatic effect on viral fitness

Coronaviruses resistant to a 3C-like protease inhibitor are attenuated for replication and 677 pathogenesis, revealing a low genetic barrier but high fitness cost of resistance

Evolutionary 680 Pathways to Persistence of Highly Fit and Resistant Hepatitis C Virus Protease Inhibitor 681

Escape Variants

A small molecule enhances 691 RNA interference and promotes microRNA processing

Enhancement of RNAi by a small molecule antibiotic enoxacin

Fluoroquinolones inhibit HCV by 696 targeting its helicase

Application of an 698 integrated cheminformatics-molecular docking approach for discovery for 699 physicochemically similar analogs of fluoroquinolones as putative HCV inhibitors

Ciprofloxacin is 702 an inhibitor of the Mcm2-7 replicative helicase

The capsid-binding nucleolar helicase DDX56 is 704 important for infectivity of West Nile virus

Quantitative mass 706 spectrometry of DENV-2 RNA-interacting proteins reveals that the DEAD-box RNA

helicase DDX6 binds the DB1 and DB2 3'UTR structures

Cellular DDX3 regulates Japanese 709 encephalitis virus replication by interacting with viral un-translated regions

sensitive in vero cells or human liver cells and attenuated in mice

A single-739 amino acid substitution in West Nile virus 2K peptide between NS4A and NS4B confers 740 resistance to lycorine, a flavivirus inhibitor

Novel dengue virus-742 specific NS2B/NS3 protease inhibitor, BP2109, discovered by a high-throughput 743 screening assay

A novel dengue virus 745 inhibitor, BP13944, discovered by high-Throughput screening with dengue virus replicon 746 cells selects for resistance in the viral NS2B/NS3 protease

Novel antiviral 749 activity of bromocriptine against dengue virus replication

Characterization of dengue 751 virus resistance to brequinar in cell culture

A novel 759 inhibitor of dengue virus replication that targets the capsid protein

Mutagen resistance and mutation restriction of St. Louis encephalitis virus

Identification of a new dengue virus inhibitor that targets the viral NS4B protein and 766 restricts genomic RNA replication

West nile 768 virus experimental evolution in vivo and the trade-off hypothesis

Mosquitoes 771 put the brake on arbovirus evolution: Experimental evolution reveals slower mutation 772 accumulation in mosquito than vertebrate cells

The evolution of 774 candidate with a 30 nucleotide deletion in its 3′-untranslated region

Superior infectivity 785 for mosquito vectors contributes to competitive displacement among strains of dengue 786 virus

In vitro resistance 788 selection and in vivo efficacy of morpholino oligomers against West Nile virus

Publication bias in clinical research

Trimmomatic: a flexible trimmer for Illumina sequence 793 data

ABySS: a parallel 796 assembler for short read sequence data

Making the Leap: Maq to BWA

Dengue type four viruses with

E-Glu345Lys adaptive mutation from MRC-5 cells induce low viremia but elicit potent 830 neutralizing antibodies in rhesus monkeys

A 832 trade-off in replication in mosquito versus mammalian systems conferred by a point 833 mutation in the NS4B protein of dengue virus type 4

West Nile virus/dengue type 4 835 virus chimeras that are reduced in neurovirulence and peripheral virulence without loss of 836 immunogenicity or protective efficacy

Passage of dengue virus type 4 vaccine candidates in 838 fetal rhesus lung cells selects heparin-sensitive variants that result in loss of infectivity and 839 immunogenicity in rhesus macaques

Flavivirus population diversity by RNA interference

RNAi targeting of West Nile virus in mosquito 843 midguts promotes virus diversification

Chloroquine, an endocytosis blocking agent, inhibits zika virus infection in different cell 854 models

Chloroquine inhibits dengue virus type 2 856 replication in Vero cells but not in C6/36 cells

Chloroquine interferes with dengue-2 virus replication in U937 cells

Assessment of in vitro 861 prophylactic and therapeutic efficacy of chloroquine against chikungunya virus in Vero 862 cells

Entry of poliovirus type

Mouse Elberfeld (ME) virus into HEp-2 cells: Receptor-mediated endocytosis and 865 endosomal or lysosomal uncoating

Chloroquine induces empty capsid formation during multiple sequence alignment editor and analysis workbench

* P < passages and treated with the designated concentration of ciprofloxacin or media. a) 1051 virus lineages from passage 2 treated with 19.6 µM ciprofloxacin or media (Two-way ANOVA 1052 with Tukey pairwise comparisons, F (1,8) = 0.41, P = 0.54). b) virus lineages from passage 2 1053 treated with 39.2 µM ciprofloxacin or media (Two-way ANOVA with Tukey pairwise 1054 comparisons, F (1,8) = 0.04, P = 0.86). c) virus lineages from passage 7 treated with 19.6µM 1055 ciprofloxacin or media (Two-way ANOVA with Tukey pairwise comparisons (1,8) = 0.94, P = 1056 0.36). Black: DENV-4 passaged in media

Groups that do not share a letter are significantly different

Solid lines indicate mean and dashed line indicates the limit of detection

Dissimilar letters indicate significant differences in the means (P < 0.05). Solid lines 1073 indicate mean and dashed line indicates the limit of detection

Sequence alignment of flavivirus envelope protein, a) amino acids 1-20 and b) amino 1077 acids 401-420. The amino acid sequences for the envelope gene were aligned for DENV-4

DENV-3 Sleman (GenBank AY648961.1), yellow fever virus

Powassan virus PO375 (GenBank KU886216.1), Modoc virus 1084 (GenBank NC003635.1), Rio Bravo virus (GenBank JQ582840.1), and Kamiti River virus 1085 (GenBank NC005064.1) using MUSCLE v3.8 (99) and Jalview (100) v2.11. A blue amino acid 1086 at positions 15 and 417

HEK293 adaptation (74,77)