key: cord-1009600-k38jdbow
authors: Yu, Jingyou; Tostanoski, Lisa H.; Mercado, Noe B.; McMahan, Katherine; Liu, Jinyan; Jacob-Dolan, Catherine; Chandrashekar, Abishek; Atyeo, Caroline; Martinez, David R.; Anioke, Tochi; Bondzie, Esther A.; Chang, Aiquan; Gardner, Sarah; Giffin, Victoria M.; Hope, David L.; Nampanya, Felix; Nkolola, Joseph; Patel, Shivani; Sanborn, Owen; Sellers, Daniel; Wan, Huahua; Hayes, Tammy; Bauer, Katherine; Pessaint, Laurent; Valentin, Daniel; Flinchbaugh, Zack; Brown, Renita; Cook, Anthony; Bueno-Wilkerson, Deandre; Teow, Elyse; Andersen, Hanne; Lewis, Mark G.; Martinot, Amanda J.; Baric, Ralph S.; Alter, Galit; Wegmann, Frank; Zahn, Roland; Schuitemaker, Hanneke; Barouch, Dan H.
title: Protective efficacy of Ad26.COV2.S against SARS-CoV-2 B.1.351 in macaques
date: 2021-06-23
journal: Nature
DOI: 10.1038/s41586-021-03732-8
sha: 9064fb90b402b949c07592b26edc06a30b597108
doc_id: 1009600
cord_uid: k38jdbow

The emergence of SARS-CoV-2 variants that partially evade neutralizing antibodies poses a threat to the efficacy of current COVID-19 vaccines(1,2). The Ad26.COV2.S vaccine expresses a stabilized spike protein from the WA1/2020 strain of SARS-CoV-2, and has recently demonstrated protective efficacy against symptomatic COVID-19 in humans in several geographical regions—including in South Africa, where 95% of sequenced viruses in cases of COVID-19 were the B.1.351 variant(3). Here we show that Ad26.COV2.S elicits humoral and cellular immune responses that cross-react with the B.1.351 variant and protects against B.1.351 challenge in rhesus macaques. Ad26.COV2.S induced lower binding and neutralizing antibodies against B.1.351 as compared to WA1/2020, but elicited comparable CD8 and CD4 T cell responses against the WA1/2020, B.1.351, B.1.1.7, P.1 and CAL.20C variants. B.1.351 infection of control rhesus macaques resulted in higher levels of virus replication in bronchoalveolar lavage and nasal swabs than did WA1/2020 infection. Ad26.COV2.S provided robust protection against both WA1/2020 and B.1.351, although we observed higher levels of virus in vaccinated macaques after B.1.351 challenge. These data demonstrate that Ad26.COV2.S provided robust protection against B.1.351 challenge in rhesus macaques. Our findings have important implications for vaccine control of SARS-CoV-2 variants of concern.

SARS-CoV-2 variants of concern have shown increased transmissibility and pathogenicity in humans 4, 5 , and some variants have also demonstrated partial evasion of natural and vaccine-elicited neutralizing antibodies 1,2,6,7 . Ad26.COV2.S is a replication-incompetent human adenovirus type 26 vector 8 that expresses a prefusion stabilized SARS-CoV-2 spike protein (S) 9,10 from the Wuhan 2019 strain of SARS-CoV-2. It was previously reported that Ad26.COV2.S demonstrated protective efficacy against SARS-CoV-2 WA1/2020 challenges in hamsters and nonhuman primates [11] [12] [13] , and also showed safety and immunogenicity in humans 14, 15 . A recent phase III efficacy trial has shown that Ad26.COV2.S provided 86%, 88% and 82% protection against severe COVID-19 disease by day 28 after vaccination in the USA, Brazil and South Africa, respectively 3 .

We developed a B.1.351 challenge stock by expansion of a seed stock (BEI Resources, NR-54974) in Calu-3 cells (ATCC HTB-55). We immunized 24 rhesus macaques in 4 experimental groups (n = 6 macaques per group) as follows: groups 1 and 3 received a sham vaccine (sham control macaques), and groups 2 and 4 received a single immunization with 5 × 10 10 viral particles of Ad26.COV2.S; after vaccination, groups 1 and 2 were challenged with the original SARS-CoV 2 strain WA1/2020, and groups 3 and 4 were challenged with the SARS-CoV-2 variant B.1.351.

Article rank-sum test). Live-virus neutralizing antibody assays 19 showed a greater reduction of neutralizing antibody titres against B.1.351 (Extended Data Fig. 1) .

Median receptor-binding domain (RBD)-specific enzyme-linked immunosorbent assay (ELISA) titres in macaques that received Ad26. COV2.S vaccine were less than 25 at week 0, and were 4,050, 3,186 and 805 against the WA1/2020, B.1.1.7 and B.1.351 strains, respectively, in Ad26.COV2.S-vaccinated macaques at week 6 ( Fig. 1b) . These data show a median 5.0-fold reduction of RBD-specific ELISA titres against B.1.351 as compared to WA1/2020 (P < 0.0001, Wilcoxon rank-sum test). We also used an electrochemiluminescence assay (ECLA) 20 to evaluate Sand RBD-specific binding antibody responses to WA1/2020, B.1.1.7, P.1. and B.1.351 (Extended Data Fig. 2 ). Similar to the ELISA titres, median RBD-specific ECLA responses were reduced against P.1 and B.1.351 as compared to WA1/2020 at week 6, whereas we observed a smaller effect with S-specific ECLA responses. Antibody-dependent cellular phagocytosis and antibody-dependent complement deposition responses 21 were more comparable against WA1/2020 and B.1.351 than were ELISA titres or ECLA responses (Fig. 1c) .

We assessed S-specific cellular immune responses using pooled peptide IFNγ enzyme-linked immunospot (ELISPOT) assays in peripheral blood mononuclear cells at week 4. ELISPOT responses were comparable among the WA1/2020, B.1.351, B.1.1.7, P.1 and CAL.20C strains, with no evidence of decreased responses against the variants (Fig. 2a) . We also evaluated S-specific CD8 + and CD4 + T cell responses using multi-parameter intracellular cytokine staining assays at week 6 ( Supplementary Fig. 1 ). IFNγ CD8 + and CD4 + T cell responses were comparable among the WA1/2020, B.1.351, B.1.1.7, P.1 and CAL.20C strains (Fig. 2b) . Similarly, IFNγ central memory CD28 + CD95 + CD4 + and CD28 + CD95 + CD8 + T cell responses were comparable across these variants (Fig. 2c) . These data show that S-specific cellular immune responses were comparable for these SARS-CoV-2 variants.

We challenged all macaques at week 6 with a 5 × 10 5 50% tissue culture infectious dose (TCID 50 ) of SARS-CoV-2 WA1/2020 12, 16, 17, 22 or B.1.351 by the intranasal and intratracheal routes. We assessed viral loads in bronchoalveolar lavage (BAL) and nasal swabs by reverse-transcription PCR (RT-PCR) specific for subgenomic mRNA (sgRNA), which is believed to measure replicating virus 16, 23, 24 . All sham control macaques were infected and showed higher median peak sgRNA of 6.16 (range of 4.93-6.80) log 10 (sgRNA copies per ml) in BAL for B.1.351, as compared to 4.80 (range of 4.70-5.52) log 10 (sgRNA copies per ml) for WA1/2020 (Fig. 3a) . By contrast, vaccinated macaques demonstrated a median peak of 3.62 (range of 3.37-4.43) log 10 (sgRNA copies per ml) in BAL for B.1.351, as compared with less than 1.69 (range of <1.69 to 3.23) log 10 (sgRNA copies per ml) in BAL for WA1/2020 (Fig. 3a) . Sham control macaques also showed a trend towards a higher median peak sgRNA of 5.90 (range of 4.73-6.47) log 10 (sgRNA copies per swab) in nasal swabs for B.1.351, as compared with 5.48 (range of 4.44-6.00) log 10 (sgRNA copies per swab) for WA1.2020 (Fig. 3b) . Vaccinated macaques demonstrated a median peak of 3.57 (range of 2.41-4.21) log 10 (sgRNA copies per swab) in nasal swabs for B.1.351, as compared with 2.64 (range of <1.69 to 3.89) log 10 (sgRNA copies per swab) in nasal swabs for WA1/2020 (Fig. 3b) .

B.1.351 led to higher peak viral loads, faster kinetics of viral replication and a longer duration of viral replication as compared with WA1/2020 in sham control macaques, which suggests that B.1.351 is a more stringent challenge in the macaque model. Ad26.COV2.S provided robust protection against peak viral replication for both strains, including a 3.13 and 2.54 log reduction of peak sgRNA copies per ml in BAL for WA1/2020 and B.1.351, respectively, and a 2.84 and 2.33 log reduction of peak sgRNA copies per swab in nasal swabs for WA1/2020 and B.1.351, respectively (P = 0.0022 for both BAL and nasal swabs for both WA1/2020 and B.1.351, Wilcoxon rank-sum tests) (Fig. 4a) . By day 4 after challenge, viral loads were undetectable in Ad26.COV2.S-vaccinated macaques after both WA1/2020 and B.1.351 challenge, whereas viral loads were positive in most sham control macaques for WA1/2020 and in all sham control macaques for B.1.351 (Fig. 4b) . Ad26.COV2.S also provided similar robust protection against day 2 infectious virus titres, as assessed by TCID 50 assays (Extended Data Fig. 3) . were assessed by ELISA at week 0 (top panels) and week 6 (bottom panels). c, Antibody-dependent cellular phagocytosis (ADCP) (phagocytic score) and antibody-dependent complement deposition (ADCD) (mean fluorescence intensity) were evaluated against WA1/2020 and B.1.351 at week 6. Macaques that eventually were challenged with WA1/2020 (triangles) or B.1.351 (squares) are depicted. Horizontal red bars reflect median responses. P values reflect two-sided Wilcoxon rank-sum tests. Dotted lines reflect the limits of quantification of the assay. n = 24 independent samples (12 sham and 12 Ad26.COV2.S).

On day 10 after challenge (study week 8), sham control macaques developed both humoral and cellular immune responses, as expected (Extended Data Figs. 4-6). In sham control macaques, WA1/2020 challenge led to higher neutralizing antibody titres to WA1/2020 than to B.1.351, whereas B.1.351 challenge led to higher neutralizing antibody titres to B.1.351 than to WA1/2020 (Extended Data Fig. 4a) , and cellular responses were comparable across all strains regardless of the challenge virus (Extended Data Fig. 6 ), consistent with the vaccine immunogenicity data. Ad26.COV2.S-vaccinated macaques developed increased humoral and cellular immune responses after challenge. The low ELISA titres in sham control macaques probably reflect the early (day 10) time point after challenge (Extended Data Fig. 4b ).

Peak log 10 (sgRNA) in BAL (Extended Data Fig. 7 ) and in nasal swabs (Extended Data Fig. 8 ) after challenge inversely correlated with log 10 ELISA, neutralizing antibody and ELISPOT responses at week 6, which suggests that both antibody and T cell responses correlate with protection. Correlations were slightly stronger for immune responses against the homologous challenge virus as compared with the heterologous challenge virus.

Ad26.COV2.S-vaccinated macaques demonstrated reduced lung histopathology compared with sham control macaques at necropsy on day 10 after WA1/2020 or B.1.351 challenge (Fig. 5a, b) , although viral replication had largely resolved by day 10. Sham control macaques infected with WA1/2020 and B.1.351 had histopathological lesions that were consistent with previous reports 16 , including focal to locally extensive interstitial pneumonia with neutrophilic and mononuclear interstitial infiltrates, alveolar syncytia, and increased numbers of alveolar macrophages. Perivascular inflammation and type II pneumocyte hyperplasia were prominent features in both groups of sham control macaques, as were multifocal regions of fibrosis ( Fig. 5c , d, Extended Data Fig. 9 ). Ad26.COV2.S-vaccinated macaques had only rare lesions, predominantly small and focal regions of interstitial inflammation, and rare syncytia in isolated lung lobes (Fig. 5e , f, Extended Data Fig. 10) . 

No evidence of eosinophilic infiltrates or enhanced respiratory disease was observed in Ad26.COV2.S-vaccinated macaques.

It has previously been reported that Ad26.COV2.S provided robust protection against challenge with SARS-CoV-2 WA1/2020 in both rhesus macaques and hamsters [11] [12] [13] . In this study, we show that Ad26. COV2.S induced cross-reactive antibody and T cell responses against SARS-CoV-2 variants of concern-including the B.1.351 variant, which has several mutations (including E484K) that lead to partial evasion of natural and vaccine-elicited neutralizing antibodies 1,2,6,7 . Binding and neutralizing antibody titres were suppressed 4-5-fold against B.1.351 as compared to WA1/2020, but Fc functional antibody responses were affected less, and T cell responses were not affected at all by the SARS-CoV-2 variants. Ad26.COV2.S provided robust protection against both high-dose WA1/2020 and B.1.351 challenges. These data have important implications for the potential utility of current vaccines and inform boosting strategies against SARS-CoV-2 variants of concern.

Our data are consistent with findings in humans in a recent phase III clinical trial of Ad26.COV2.S that was conducted in the USA, Latin America (Argentina, Brazil, Chile, Colombia, Mexico and Peru) and South Africa 3 . Robust protection was observed in all geographical regions, with similar levels of protection against severe COVID-19 disease regardless of variant, including in the USA, in Brazil (where 69% of cases with sequence data were the P.2 variant) and in South Africa (where 95% of cases with sequence data were the B.1.351 variant). In the current study in macaques, B.1.351 infection led to a higher magnitude of and more prolonged viral replication in the upper and lower respiratory tracts than did WA1/2020. Nevertheless, Ad26.COV2.S provided robust protection against both viruses, although levels of virus in BAL and nasal swabs were higher after B.1.351 challenge than after WA1/2020 challenge. To the best of our knowledge, this is the first report of a SARS-CoV-2 vaccine evaluated for efficacy against a SARS-CoV-2 variant of concern in macaques. Several SARS-CoV-2 vaccines have previously been reported to protect against homologous WA1/2020 challenges, but have not yet been reported against B.1.351 challenges. Our study does not define mechanistic correlates of protection against SARS-CoV-2 variants, but it has previously been reported that IgG was sufficient for protection against homologous SARS-CoV-2 challenge in macaques and that CD8 T cell responses also contributed to protection if antibody titres were subprotective 22 .

In conclusion, Ad26.COV2.S induced cross-reactive humoral and cellular immune responses and provided robust protection against the heterologous SARS-CoV-2 variant B.1.351 in rhesus macaques. Future studies will determine whether Ad26.COV2.S, as well as other vaccines, protect against other SARS-CoV-2 variants of concern.

Online content Any methods, additional references, Nature Research reporting summaries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contributions and competing interests; and statements of data and code availability are available at https://doi.org/10.1038/s41586-021-03732-8.

Twenty-four outbred Indian-origin adult male and female rhesus macaques (Macaca mulatta) (3-11 years old) were randomly allocated to groups. All macaques were housed at Bioqual. Macaques received a single immunization of 5 × 10 10 viral particles of Ad26.COV2.S (n = 12) or sham (n = 12) by the intramuscular route without adjuvant at week 0. At week 6, all macaques were challenged with 5 × 10 5 TCID 50 SARS-CoV-2 from strains USA-WA1/2020 (BEI Resources; NR-5228) (which was grown in VeroE6 cells and deep sequenced as previously described 16 ) or B.1.351 (BEI Resources; NR-54974). The B.1.351 stock was grown in Calu-3 cells and was deep-sequenced, which confirmed the expected sequence identity with no mutations in the S greater than 2.5% frequency and no mutations elsewhere in the virus at greater than 13% frequency. Virus was administered as 1 ml by the intranasal route (0.5 ml in each nare) and 1 ml by the intratracheal route. All immunological, virological and histopathological studies were performed blinded. Animal studies were conducted in compliance with all relevant local, state and federal regulations and were approved by the Bioqual Institutional Animal Care and Use Committee.

The SARS-CoV-2 pseudoviruses expressing a luciferase reporter gene were generated essentially as previously described 12, [16] [17] [18] . In brief, the packaging plasmid psPAX2 (AIDS Resource and Reagent Program), luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene) and S expressing pcDNA3.1-SARS CoV-2 SΔCT of variants were co-transfected into HEK293T cells by lipofectamine 2000 (ThermoFisher). Pseudoviruses of SARS-CoV-2 variants were generated by using WA1/2020 strain (Wuhan/ WIV04/2019, GISAID accession identifier EPI_ISL_402124), D614G mutation, B.1.1.7 variant (GISAID accession identifier EPI_ISL_601443) or B.1.351 variant (GISAID accession identifier EPI_ISL_712096). The supernatants containing the pseudotype viruses were collected 48 h after transfection, and were purified by centrifugation and filtration with a 0.45-μm filter. To determine the neutralization activity of the plasma or serum samples from participants, HEK293T cells expressing human ACE2 (HEK293-hACE2 cells) were seeded in 96-well tissue culture plates at a density of 1.75 × 10 4 cells per well overnight. Threefold serial dilutions of heat-inactivated serum or plasma samples were prepared and mixed with 50 μl of pseudovirus. The mixture was incubated at 37 °C for 1 h before adding to HEK293T-hACE2 cells. Forty-eight hours after infection, cells were lysed in Steady-Glo Luciferase Assay (Promega) according to the manufacturer's instructions. SARS-CoV-2 neutralization titres were defined as the sample dilution at which a 50% reduction in relative light units (RLU) was observed relative to the average of the virus control wells.

Full-length SARS-CoV-2 WA1/2020, B.1.351 and B.1.1.7, viruses were designed to express nanoluciferase (nLuc) and were recovered via reverse genetics 19 . One day before the assay, Vero E6 USAMRID cells were plated at 20,000 cells per well in clear-bottom black-walled plates. Cells were inspected to ensure confluency on the day of assay. Serum samples were tested at a starting dilution of 1:20 and were serially diluted threefold up to nine dilution spots. Serially diluted serum samples were mixed in equal volume with diluted virus. Antibody-virus and virus-only mixtures were then incubated at 37 °C with 5% CO 2 for 1 h. After incubation, serially diluted sera and virus-only controls were added in duplicate to the cells at 75 plaque-forming units at 37 °C with 5% CO 2 . Twenty-four hours later, the cells were lysed, and luciferase activity was measured via Nano-Glo Luciferase Assay System (Promega) according to the manufacturer specifications. Luminescence was measured by a Spectramax M3 plate reader (Molecular Devices). Virus neutralization titres were defined as the sample dilution at which a 50% reduction in RLU was observed relative to the average of the virus control wells. ELISA WA1/2020, B.1.1.7 and B.1.351 RBD-specific binding antibodies were assessed by ELISA essentially as previously described 12, 16, 17 . In brief, 96-well plates were coated with 0.5 μg ml −1 RBD protein in 1× DPBS and incubated at 4 °C overnight. After incubation, plates were washed once with wash buffer (0.05% Tween-20 in 1× DPBS) and blocked with 350 μl casein block per well for 2-3 h at room temperature. After incubation, block solution was discarded and plates were blotted dry. Serial dilutions of heat-inactivated serum diluted in casein block were added to wells and plates were incubated for 1 h at room temperature, before three further washes and a 1-h incubation with a 1 μg ml −1 dilution of anti-macaque IgG HRP (Nonhuman Primate Reagent Resource) at room temperature in the dark. Plates were then washed three times, and 100 μl of SeraCare KPL TMB SureBlue Start solution was added to each well; plate development was halted by the addition of 100 μl SeraCare KPL TMB Stop solution per well. The absorbance at 450 nm was recorded using a VersaMax microplate reader. For each sample, ELISA endpoint titre was calculated in GraphPad Prism software, using a four-parameter logistic curve fit to calculate the reciprocal serum dilution that yields an absorbance value of 0.2 at 450 nm. log 10 -transformed endpoint titres are reported.

ECLA plates (MesoScale Discovery SARS-CoV-2 IgG Cat No: N05CA-1; panel 7) were designed and produced with up to nine antigen spots in each well, and assays were performed essentially as previously described 20 . The antigens included were WA1/2020, B.1.1.7, P.1, and B.1.351 S and RBD. The plates were blocked with 50 μl of blocker A (1% BSA in MilliQ water) solution for at least 30 m at room temperature shaking at 700 rpm with a digital microplate shaker. During blocking, the serum was diluted 1:5,000 in diluent 100. The plates were then washed 3 times with 150 μl of the MSD kit wash buffer, blotted dry, and 50 μl of the diluted samples were added in duplicate to the plates and set to shake at 700 rpm at room temperature for at least 2 h. The plates were again washed 3 times and 50 μl of SULFO-tagged anti-human IgG detection antibody (MesoScale Discovery) diluted to 1× in diluent 100 was added to each well and incubated shaking at 700 rpm at room temperature for at least 1 h. Plates were then washed 3 times and 150 μl of MSD GOLD read buffer B was added to each well and the plates were read immediately after on a MESO QuickPlex SQ 120 machine. MSD titres for each sample are reported as RLUs, which were calculated as sample RLU minus blank RLU for each spot for each sample. The limit of detection was defined as 1,000 RLU for each assay.

Fc functional profiling included the assessment of antibody-dependent monocyte phagocytosis and antibody-dependent complement deposition 21 . In brief, fluorescent beads (LifeTechnologies) were coupled via carboxy-coupling, and plasma were added, allowing immune complex formation, excess antibodies were washed away, followed by the addition of THP1 monocytes, primary neutrophils or guinea pig complement, individually, respectively. The level of phagocytosis and complement deposition was assessed by flow cytometry.

Pooled peptide ELISPOT assays were performed essentially as previously described 12, 16, 17 . Peptide pools consisted of 15 amino acid peptides overlapping by 11 amino acids spanning the SARS-CoV-2 S from the WA1/2020 strain or variant strains. ELISPOT plates were coated with mouse anti-human IFNγ monoclonal antibody from BD Pharmigen at 5 μg per well and incubated overnight at 4 °C. Plates were washed with DPBS wash buffer (DPBS with 0.25% Tween-20), and blocked with R10 medium (RPMI with 10% heat-inactivated FBS with 1% of 100× penicillin-streptomycin) for 1-4 h at 37 °C. SARS-CoV-2 peptides (21st Century Biochemicals) were prepared and plated at a concentration of 1 μg per well, and 200,000 cells per well were added to the plate. The peptides and cells were incubated for 18-24 h at 37 °C. All steps after this incubation were performed at room temperature. The plates were washed with ELISPOT wash buffer (11% 10× DPBS and 0.3% Tween-20 in 1 l MilliQ water) and incubated for 2 h with rabbit polyclonal anti-human IFNγ biotin from U-Cytech (1 μg ml −1 ). The plates were washed a second time and incubated for 2 h with streptavidin-alkaline phosphatase from Southern Biotech (2 μg ml −1 ). The final wash was followed by the addition of nitor-blue tetrazolium chloride or 5-bromo-4-chloro 3′ indolyphosphate p-toludine salt (NBT/BCIP chromagen) substrate solution for 7 min. The chromagen was discarded and the plates were washed with water and dried in a dim place for 24 h. Plates were scanned and counted on a Cellular Technologies Limited Immunospot Analyzer.

Multi-parameter pooled-peptide intracellular cytokine staining assays were performed essentially as previously described 12, 16, 17 . Peptide pools consisted of 15 amino acid peptides overlapping by 11 amino acids spanning the SARS-CoV-2 S from the WA1/2020 strain or variant strains. Then, 10 6 PBMCs per well were resuspended in 100 μl of R10 medium supplemented with CD49d monoclonal antibody (1 μg ml −1 ). Each sample was assessed with mock (100 μl of R10 plus 0.5% DMSO; background control), peptide pools (2 μg ml −1 ), or 10 pg ml −1 phorbol myristate acetate and 1 μg ml − sgRNA assay SARS-CoV-2 E gene sgRNA was assessed by RT-PCR using primers and probes as previously described 23, 24 . A standard was generated by first synthesizing a gene fragment of the subgenomic E gene 23 . The gene fragment was subsequently cloned into a pcDNA3.1+ expression plasmid using restriction site cloning (Integrated DNA Techonologies). The insert was in vitro-transcribed to RNA using the AmpliCap-Max T7 High Yield Message Maker Kit (CellScript). log dilutions of the standard were prepared for RT-PCR assays ranging from 1 × 10 10 copies to 1 × 10 −1 copies. Viral loads were quantified from BAL fluid and nasal swabs.

RNA extraction was performed on a QIAcube HT using the IndiSpin QIAcube HT Pathogen Kit according to manufacturer's specifications (Qiagen). The standard dilutions and extracted RNA samples were reverse-transcribed using SuperScript VILO Master Mix (Invitrogen) following the cycling conditions described by the manufacturer, 25 °C for 10 min, 42 °C for 1 h, then 85 °C for 5 min. A Taqman custom gene expression assay (Thermo Fisher Scientific) was designed using the sequences targeting the E gene sgRNA 23 . The sequences for the custom assay were as follows, forward primer, sgLeadCoV2.Fwd: CGATCTCTT-GTAGATCTGTTCTC, E_Sarbeco_R: ATATTGCAGCAGTACGCACACA, E_Sarbeco_P1 (probe): VIC-ACACTAGCCATCCTTACTGCGCTTCG-MGB. These primers and probes were equally reactive for both variants. Reactions were carried out in duplicate for samples and standards on the QuantStudio 6 and 7 Flex Real-Time PCR Systems (Applied Biosystems) with the thermal cycling conditions, initial denaturation at 95 °C for 20 s, then 45 cycles of 95 °C for 1 s and 60 °C for 20 s. Standard curves were used to calculate sgRNA copies per ml or per swab; the quantitative assay sensitivity was 50 copies per ml or per swab.

Vero TMPRSS2 cells (obtained from A. Creanga) were plated at 25,000 cells per well in DMEM with 10% FBS and gentamicin, and the cultures were incubated at 37 °C, 5.0% CO 2 . Medium was aspirated and replaced with 180 μl of DMEM with 2% FBS and gentamicin. Serial dilution of samples as well as positive (virus stock of known infectious titre) and negative (medium only) controls were included in each assay. The plates are incubated at 37 °C, 5.0% CO 2 for 4 days. Cell monolayers were visually inspected for cytopathic effect. The TCID 50 was calculated using the Read-Muench formula.

Lungs on day 10 after SARS-CoV-2 challenge were evaluated by histopathology. At the time of fixation, lungs were suffused with 10% formalin to expand the alveoli. All tissues were fixed in 10% formalin and blocks sectioned at 5 μm. Slides were incubated for 30-60 min at 65 °C then deparaffinized in xylene and rehydrated through a series of graded ethanol to distilled water. Sections were stained with haematoxylin and eosin. Blinded evaluation and scoring was performed by a board-certified veterinary pathologist (A.J.M.).

Comparisons of virological, immunological and histopathological data were performed using GraphPad Prism 8.4.2 (GraphPad Software). Comparison of data between groups was performed using two-sided Wilcoxon rank-sum tests. Correlation analyses were performed using two-sided Spearman rank-correlation tests. P values of less than 0.05 were considered significant.

Further information on research design is available in the Nature Research Reporting Summary linked to this paper.

All relevant data are available in the Article and its Supplementary Information. Any additional data are available from the corresponding author upon reasonable request. Source data are provided with this paper. 

Last updated by author(s): Jun 12, 2021 Reporting Summary Nature Research wishes to improve the reproducibility of the work that we publish. This form provides structure for consistency and transparency in reporting. For further information on Nature Research policies, see our Editorial Policies and the Editorial Policy Checklist.

For all statistical analyses, confirm that the following items are present in the figure legend, table legend, main text, or Methods section.

The exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement A statement on whether measurements were taken from distinct samples or whether the same sample was measured repeatedly

The statistical test(s) used AND whether they are one-or two-sided Only common tests should be described solely by name; describe more complex techniques in the Methods section.

A description of all covariates tested A description of any assumptions or corrections, such as tests of normality and adjustment for multiple comparisons A full description of the statistical parameters including central tendency (e.g. means) or other basic estimates (e.g. regression coefficient) AND variation (e.g. standard deviation) or associated estimates of uncertainty (e.g. confidence intervals)

For null hypothesis testing, the test statistic (e.g. F, t, r) with confidence intervals, effect sizes, degrees of freedom and P value noted 

Policy information about availability of computer code Data collection QuantStudio 6 was used to collect sgRNA data.

Analysis of virologic and immunologic data was performed using GraphPad Prism 8.4.2 (GraphPad Software). Flow cytometry data was analyzed with FlowJo v9.9.

For manuscripts utilizing custom algorithms or software that are central to the research but not yet described in published literature, software must be made available to editors and reviewers. We strongly encourage code deposition in a community repository (e.g. GitHub). See the Nature Research guidelines for submitting code & software for further information.

Policy information about availability of data All manuscripts must include a data availability statement. This statement should provide the following information, where applicable:

-Accession codes, unique identifiers, or web links for publicly available datasets -A list of figures that have associated raw data -A description of any restrictions on data availability

All data are available in the manuscript or the supplementary material.

Antibody resistance of SARS-CoV-2 variants B.1.351 and B.1.1.7

SARS-CoV-2 501Y.V2 escapes neutralization by South African COVID-19 donor plasma

Safety and efficacy of single-dose Ad26.COV2.S vaccine against Covid-19

Tracking changes in SARS-CoV-2 spike: evidence that D614G increases infectivity of the COVID-19 virus

Estimated transmissibility and impact of SARS-CoV-2 lineage B.1.1.7 in England

Serum neutralizing activity elicited by mRNA-1273 vaccine

Neutralizing activity of BNT162b2-elicited serum

Comparative seroprevalence and immunogenicity of six rare serotype recombinant adenovirus vaccine vectors from subgroups B and D

Ad26 vector-based COVID-19 vaccine encoding a prefusion-stabilized SARS-CoV-2 spike immunogen induces potent humoral and cellular immune responses

Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation

Ad26 vaccine protects against SARS-CoV-2 severe clinical disease in hamsters

Single-shot Ad26 vaccine protects against SARS-CoV-2 in rhesus macaques

Ad26.COV2.S protects Syrian hamsters against G614 spike variant SARS-CoV-2 and does not enhance respiratory disease

Interim results of a phase 1-2a trial of Ad26.COV2.S Covid-19 vaccine

Immunogenicity of the Ad26.COV2.S vaccine for COVID-19

SARS-CoV-2 infection protects against rechallenge in rhesus macaques

DNA vaccine protection against SARS-CoV-2 in rhesus macaques

Deletion of the SARS-CoV-2 spike cytoplasmic tail increases infectivity in pseudovirus neutralization assays

Chimeric spike mRNA vaccines protect against sarbecovirus challenge in mice

Coronavirus-specific antibody cross reactivity in Rhesus macaques following SARS-CoV-2 vaccination and infection

Dissecting polyclonal vaccine-induced humoral immunity against HIV using systems serology

Correlates of protection against SARS-CoV-2 in rhesus macaques

Virological assessment of hospitalized patients with COVID-2019

peptides were assessed by IFNγ intracellular cytokine staining assays on day 10 after challenge to WA1

1.351) at week 6 after vaccination. Red lines reflect the best linear fit relationship between these variables. P and R values reflect two-sided Spearman rank-correlation tests

Sample size includes N=24 vaccinated animals (N=6 animals/group; Mercado et al Nature 2020)

Replication Virologic and immunologic measures were performed in duplicate. Technical replicates were minimally different. All attempts at replication were successful

Randomization Animals were balanced for age and gender and otherwise randomly allocated to groups. Blinding All immunologic and virologic assays were performed blinded

Reporting for specific materials, systems and methods

We require information from authors about some types of materials, experimental systems and methods used in many studies. Here, indicate whether each material, system or method listed is relevant to your study

CD3 (clone SP34.2, Alexa 700) (BD); for 800CW-conjugated goatanti-human secondary antibody (Li-COR); anti-rhesus IgG1, IgG2, IgG3, IgA, IgM (NIH NHP Reagent Program); tertiary goat anti-mouse IgG-PE antibody

Authentication Commerically purchased (ATCC) and evaluated in control experiments prior to use

Consortium on Pathogen Readiness (MassCPR) and the National Institutes of Health (CA260476). Tick this box to confirm that a figure exemplifying the gating strategy is provided in the Supplementary Information.