key: cord-1027615-asbkljsf
authors: Wang, Zhihan; Guo, Kai; Gao, Pan; Pu, Qinqin; Li, Changlong; Hur, Junguk; Wu, Min
title: Repurposable drugs for SARS-CoV-2 and influenza sepsis with scRNA-seq data targeting post-transcription modifications
date: 2021-08-28
journal: Precis Clin Med
DOI: 10.1093/pcmedi/pbab022
sha: e1d456e287d806a4cb1572ff5642bc51eef5290a
doc_id: 1027615
cord_uid: asbkljsf

Coronavirus disease 2019 (COVID-19) has impacted almost every part of human life worldwide, posing a massive threat to human health. The lack of time for new drug discovery and the urgent need for rapid disease control to reduce mortality have led to a search for quick and effective alternatives to novel therapeutics, for example drug repurposing. To identify potentially repurposable drugs, we employed a systematic approach to mine candidates from U.S. FDA-approved drugs and preclinical small-molecule compounds by integrating gene expression perturbation data for chemicals from the Library of Integrated Network-Based Cellular Signatures project with a publicly available single-cell RNA sequencing dataset from patients with mild and severe COVID-19 (GEO: GSE145926, public data available and accessed on 22 April 2020). We identified 281 FDA-approved drugs that have the potential to be effective against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, 16 of which are currently undergoing clinical trials to evaluate their efficacy against COVID-19. We experimentally tested and demonstrated the inhibitory effects of tyrphostin-AG-1478 and brefeldin-a, two chemical inhibitors of glycosylation (a post-translational modification) on the replication of the single-stranded ribonucleic acid (ssRNA) virus influenza A virus as well as on the transcription and translation of host cell cytokines and their regulators (IFNs and ISGs). In conclusion, we have identified and experimentally validated repurposable anti-SARS-CoV-2 and IAV drugs using a systems biology approach, which may have the potential for treating these viral infections and their complications (sepsis).

Coronavirus disease 2019 (COVID-19) is a highly contagious respiratory disease resulting from a lifethreatening novel coronavirus, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). It has spread rapidly across the globe, resulting in over 198 million confirmed cases and 4 million deaths as of 2 August 2021. 1,2 SARS-CoV-2 is an enveloped RNA virus that belongs to the genus Betacoronavirus of the family Coronaviridae, which includes well-known severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV). 3 Advancement in the management of these coronaviruses and other viruses, such as influenza virus H1N1 and Ebola infections, has provided insight into treating COVID-19. However, a portion of patients develop serious disease and subsequent complications including sepsis and septic shock, largely as a result of aberrant host inflammatory responses. 4, 5 Sepsis and its related conditions are associated with 20% of total deaths and 20 deaths every minute globally. 6 Of patients with COVID-19, 6.8%-100% are diagnosed with sepsis. [7] [8] [9] A retrospective study of hospitalized patients with COVID-19 showed that, of the non-survivors, 100% of patients had sepsis and 70% were noted to have septic shock. 10 Unfortunately, there is a lack of mechanistic understanding of septic progression linked to pathogen-mediated pathogenesis and host immune response, impeding the discovery of effective treatments.

More than 3600 active clinical trials for COVID-19 are under way. 11, 12 According to the World Health Organization (WHO), there are more than 154 candidate vaccines in preclinical evaluation and 44 candidate vaccines in phase 1 trials or beyond (last updated: 25 October 2020), several of which have entered phase 3 large-scale randomized clinical trials and shown benefits. 13 Unexpected side effects and immune-escape mutations pose a great challenge for the safety and efficacy of vaccines. 14 Chloroquine 15, 16 and its hydroxyl analog hydroxychloroquine, 17 lopinavir/ritonavir, [18] [19] [20] and remdesivir, 16, 21 developed for treating malaria, human immunodeficiency virus (HIV), and Ebola virus, respectively, have been suggested as treatments for COVID- 19 and are being tested in clinical trials. However, some clinical trials have shown that these drugs have little or no effect on the treatment of patients hospitalized with COVID-19. [22] [23] [24] [25] [26] Drug repurposing is a fast and cost-efficient approach to identifying new potential uses for existing drugs to treat different diseases. 27 Hence, there is an urgent need to search for repurposed drugs.

COVID-19 is not the first outbreak of zoonotic coronaviruses. The severe acute respiratory syndrome (SARS) outbreak, first identified in the Guangdong Province of southern China in 2002, lasted for eight months, resulting in 8098 confirmed human cases in 29 countries, with 774 deaths (case fatality rate of 9.6%). 28, 29 Approximately 10 years later, in 2012, Saudi Arabia isolated another highly pathogenic coronavirus, MERS-CoV, from the sputum of a male patient who died of acute pneumonia and renal failure. 30 MERS-CoV caused an outbreak with 2260 cases and 803 deaths (case fatality rate of 35.5%). 31, 32 Although COVID-19 has caused fewer fatalities than SARS and MERS, older patients with comorbidities tend to experience more severe symptoms, making them more vulnerable. Most patients infected with SARS-CoV-2 display mild symptoms and generally have a good prognosis, classified as mild COVID-19. 18, 33 However, a large proportion of patients, especially older men with underlying chronic diseases, have rapidly progressed to severe COVID-19 and suffered from respiratory distress requiring emergent medical interventions. 34 Unfortunately, as yet, there are no specific and effective drugs for COVID-19. 11, 12 Recent studies have shown the critical roles of host immune responses in protection and the pathogenesis of respiratory viral infections, for instance, SARS-CoV, MERS-CoV, and influenza A viruses. 35, 36 Liao et al. 37 reported that an increase in CD8 + T cells in patients with COVID-19 correlates with an improved outcome. They also proposed therapeutic strategies by targeting the myeloid cell compartment to treat COVID-19-associated inflammation.

There is an urgent need to find potentially useful drugs for COVID-19 among currently available drugs. Drug repurposing is an essential and universal strategy in developing new drugs and a potentially important strategy for discovering existing medicines to tackle COVID-19. 38 It may facilitate the discovery of new mechanisms of action for existing drugs, which would be less time-consuming and more cost-effective than discovery of novel drugs, and the pharmaceutical supply chains for formulation and distribution already exist. 39, 40 Gordon et al. 41 also reported 69 repurposable known compounds targeting 66 human proteins based on 332 highconfidence SARS-CoV-2-human protein-protein interactions, which were physically associated using affinitypurification mass spectrometry. Another study 42 presented data on the antiviral activity of 20 FDA-approved drugs against SARS-CoV-2 that have previously been shown to inhibit SARS-CoV and MERS-CoV. Another research team 43 conducted a high-throughput analysis of the ReFRAME library to identify 30 candidate existing drugs that prevent SARS-CoV-2 from replicating in mammalian cells. In a study 44 based on public data of patients with pulmonary fibrosis and the Library of Integrated Network-Based Cellular Signatures (LINCS), 45 Figure 1 . Workflow of drug repurposing for treating different durations of COVID-19. Publicly available scRNA-seq data and transcriptomic data of BALF from patients with COVID-19 were input against the LINCS database using the CLUE platform. Candidates were selected to have the potential to reverse the expression of upregulated differentially expressed genes (DEGs) upon drug treatment and were compared by connectivity score and the number of major cell subtypes across healthy, mild, and severe groups. This figure was created by modifying illustrations provided by Servier Medical Art (SMART, smart.servier.com) and Vecteezy.com. several drugs targeting ACE2 were identified to be repurposable against COVID-19.

Considering that an RNA virus exhibits a considerable degree of sequence variation, drugs targeting host factors may cause less mutational resistance with more significant and broader antiviral spectrum potential. 46 Hence, there is an urgent need to identify potential therapeutics with new strategies for emerging infectious diseases. Repurposing clinically assessed drugs represents one of the most practical strategies for rapidly identifying treatments to combat COVID-19.

In this study, we analyzed a publicly available singlecell RNA sequencing (scRNA-seq) dataset of bronchoalveolar lavage fluid (BALF) collected from patients with mild and severe COVID-19 as well as separate bulk RNA-seq data of BALF from patients with COVID-19 ( Fig. 1 ). Data mining was performed using the drug perturbation database LINCS to identify potential therapies for COVID-19. A total of 281 candidates with different courses of COVID-19 independent of cell subtypes were identified. Additionally, we identified and validated two candidates without adverse drug reactions (ADRs), tyrphostin-AG-1478 and brefeldin-a, exhibiting antiviral activity against the single-stranded ribonucleic acid (ssRNA) virus influenza A virus (IAV), as we do not have the experimental resources to perform live SARS-CoV-2 infection on campus (lacking BSL3 facility). These drug candidates may function at inhibiting viral replication and spread through a number of mechanisms, including targeting nucleic acid metabolisms and protein synthesis of pathogens as well as the transcription, translation, and post-translational modifications (PTM) of the host cytokines. 47, 48 Our findings may aid in the rapid preclinical and clinical evaluation of these therapeutics and provide an important drug discovery pipeline to accelerate and facilitate the development of potential treatments for COVID-19 and other viral infections as well as the associated sepsis.

The gene-barcode matrix files of all six COVID-19 donors including three mild cases and three severe cases (lung BALF), and of three healthy controls (lung tissues) were downloaded from the NCBI Gene Expression Omnibus database (accession ID: GSE145926). 37 The expression matrices were loaded into the R statistical analysis platform using Seurat v3, 49 keeping only the cells with gene numbers between 200 and 6 000, unique molecular identifier (UMI) count above 1 000, and mitochondrial gene percentage below 0.1. A total of 43 914 cells from nine samples were used for our further analyses. In addition to these scRNA-seq data, we also collected a list of differentially expressed genes (DEGs) in a separate cohort of SARS-CoV-2-infected lung BALF using a bulk RNA-seq analysis to compare against the single cell-based data. This DEG list was obtained from the Chinese National Genomics Data Center (https://bigd.big.ac.cn/; accession ID: CRA002390). 50

The LogNormalize method in Seurat was used for normalizing the filtered gene-barcode matrix. Principal component analysis (PCA) was performed using the top 2 000 most variable genes. Uniform Manifold Approximation and Projection (UMAP) was performed on the top 50 principal components for visualizing the cells. Graphbased clustering was performed on the PCA-reduced data with Seurat.

MAST, a generalized linear model framework treating the cellular detection rate as a covariate, was used to perform differential analysis. DEGs were identified by comparing each cluster between all three groups. Genes with average |log2FC| > 0.25 and adjusted P value < 0.05 were deemed DEGs.

DEGs were first sorted by the log2FC values. The upregulated and downregulated genes were then chosen to identify drugs and compounds against the LINCS database using the Connectivity Map Linked User Environment (CLUE: https://clue.io) platform. 45 The drug connectivity score (CS) with a negative value smaller than -90 was used to determine candidate drugs and compounds. The COVID-19 database from the International Clinical Trials Registry Platform (ICTRP) (https:// www.who.int/ictrp/en/, updated on 25 October 2020) was searched for clinical trial information associated with these drugs.

Both on-label and off-label adverse drug reactions (ADRs) of all candidate drugs with CS values smaller than -90 were collected from the Side Effect Prediction based on L1000 (SEP-L1000) database (https://maayanlab.net/SEP-L1000/). The SEP-L1000 data include on-label ADRs of FDA-approved drugs collected from SIDER 51 and off-label ADRs from the PharmGKB database, 52 based on the postmarketing ADR reports in the FDA Adverse Event Report System (FAERS).

Calu-3 and Vero E6 cells were maintained in Eagle's minimum essential medium (EMEM, Quality Biological Inc) supplemented with 10% heated-inactivated fetal bovine serum (FBS, Gibco) and penicillin and streptomycin (100 U/ml; Gibco) at 37 • C with 5% CO 2 . Influenza A virus (IAV, Puerto Rico/8/1934(H 1 N 1 )) viral stocks were titered by TCID 50, as described previously. 53 These experiments were performed under biosafety level 2 (BSL-2) conditions.

The drug-induced cytotoxicity of the test drugs (tyrphostin-AG-1478 and brefeldin-a, MedChemExpress, HY-13524 and HY-16592) on Calu-3 and Vero E6 cells was determined by a cell counting kit 8 (CCK-8, APExBIO). Cells were cultured overnight in 96-well cellculture Petri dishes at a density of 1 × 10 4 cells/well. A 10 mM stock of drug was serially diluted in 100% DMSO to obtain a 10-point dilution series. Plates were cultured with fresh drug-containing medium at 37 • C for 24 h. The DMSO concentration remained constant under all conditions at 0.05%. The absorbance of each well was determined using a 96-well multiscanner. After subtracting background absorption, the results were expressed as a percentage of viability relative to that of control cultures that received no drug. Drug concentrations that inhibited cell viability by 50% (IC 50 ) were determined using GraphPad Prism 8 software.

To evaluate the antiviral efficacy of these drugs, Calu-3 and Vero E6 cells were plated in 48-well cell culture Petri dishes at a density of 5 × 10 4 cells/well. Cells were inoculated with IAV (MOI of 1) for 1 h and rocked manually every 10 min to redistribute the inoculum. At 24 h post-infection (hpi), the cells were further treated with the same 10-point dilutions of drugs as described above. Supernatants were collected and processed by heat inactivation (10 min at 95 • C) or stored at -80 • C until use. Then, viral RNA levels in the supernatant of infected cells were quantified by quantitative reverse transcription PCR (RT-qPCR), representing the quantity of IAV replicated and secreted from cells. 54 A standard curve of 1:5 dilutions of IAV PCR target fragments from 1.5 × 10 10 to 7.5 × 10 5 copies/ml was used to quantify the viral RNA with specific primers (fwd, CAAGCA GCAGAGGCCATGGA; rev, GACCAGCACTGGAGCTAGGA). Additionally, the infected cells were harvested with TRIzol, and total cellular RNA was extracted, reverse transcribed into cDNA and subjected to qPCR as previously described. 55 mRNA levels of MX1, ISG15, IFNB1, ACE2 and the housekeeping gene GAPDH were measured with specific primers (MX1: fwd, GTTTCCGAAGTGGACATC GCA, rev, CTGCACAGGTTGTTCTCAGC; ISG15: fwd, CG CAGATCACCCAGAAGATCG, rev, TTCGTCGCATTTGTCC ACCA; IFNB1: fwd, GCTTGGATTCCTACAAAGAAGCA, rev, ATAGATGGTCAATGCGGCGTC; ACE2: fwd, ACAGTCCACA CTTGCCCAAAT, rev, TGAGAGCACTGAAGACCCATT; and GAPDH: fwd, GGAGCGAGATCCCTCCAAAAT, rev, GGCT GTTGTCATACTTCTCATGG). Fold changes were calculated using the CT method compared with untreated noninfected cells. Three technical replicates were used for each sample.

Our study highlighted the identification of different therapeutic effects during various disease courses using publicly available single-cell RNA sequencing data. With the high variability of the cellular compartments underlying disease progression, our drug repurposing profiles from major cell subtypes included T, B, NK, epithelial cells, and macrophages. A total of nine scRNA-seq BALF samples, including three healthy cases, three mild cases, and three severe cases, were collected from publicly available scRNA-seq data (Supplementary Table 1 ). After quality filtering, approximately 250 000 gene expression values from 43 914 cells were obtained. The clustering analysis identified six major clusters of macrophages, NK cells, CD4 + T cells, CD8 + T cells, B cells, and epithelial cells ( Supplementary Fig. 1 ), which were determined based on the unique signature genes CD68 (macrophage cell), IL7R, CD4 (CD4 + T cell), CD8A (CD8 + T cell), MS4A1 (B cells), and TPPP3 (epithelial cells), respectively (Supplementary Fig. 2 ). We then compared these six major clusters across the healthy, mild, and severe COVID-19 cases and identified differentially expressed genes (DEGs) between any of the two courses, as summarized in Supplementary  Table 2A . Briefly, the mild-vs-healthy comparison (Supplementary Table 2B ) had 439 (CD8 + T cell) ∼ 1 639 (B cell) DEGs, while the severe-vs-healthy comparison (Supplementary Table 2C ) had 255 (CD8 + T cell) ∼ 1 127 (epithelial cell) and the severe-vs-mild comparison (Supplementary Table 2D ) had 467 (CD8 + T cell) ∼ 1 132 (macrophage cell).

Connecting to the LINCS database of small-molecule perturbations of gene expression, we identified candidate drugs and compounds that can reverse the upregulation and downregulation of these genes via the Connectivity Map Linked User Environment (CLUE) platform. The closer the connectivity score (CS) is to -100, a score indicating a complete reversal, the higher the chance of identification of drug-adverse effect associations with upregulated or downregulated DEGs. In other words, drugs may show a better response to reverse expression of DEGs upregulated or downregulated in major cell subtypes in the BALF. A total of 281 candidates were selected by CLUE with a CS lower than -90 based on DEGs among all three comparisons between two courses (Supplementary Table 3 ). These candidates include potential anticoronavirus agents, focusing on FDA-approved drugs and experimental agents that have already been tested in clinical trials. To prioritize known drugs for preclinical and clinical evaluation of the therapeutic effect of SARS-CoV-2, we selected candidates shared by at least three cell types and in ongoing COVID-19 clinical trials, as listed in Tables 1-3 .

To search for therapeutic candidates for mild cases, we ranked drugs and compounds according to their CSs (Supplementary Table 4A ). A total of 133 candidate drugs were identified as potential candidates in at least one cell type among the mild-vs-healthy group, and 53 of these were included in more than one cell subtype ( Fig. 2A, Supplementary Table 3B ). The 10 drugs identified in three or more cell types included tubulin inhibitors (flubendazole, mebendazole, nocodazole, and vincristine), a DNA methyltransferase inhibitor (azacytidine), BCL inhibitor (ABT-737), M5 modulator (VU-0365114-2), calcium channel blocker (calmidazolium), apoptosis stimulant (kinetin-riboside), and opioid receptor antagonist (JTC-801). Six additional drugs are currently undergoing COVID-19 clinical trials (Table 1) , including the HIV protease inhibitor lopinavir/ritonavir 56 combination (phase 4), glucocorticoid receptor agonist dexamethasone (phase 3/4), 57 DNA replication inhibitor niclosamide (phase 2/3), antineoplastic agent lenalidomide (phase 4), and calcineurin inhibitor tacrolimus (phase 3). 58

A total of 60 drugs were also found to have the potential to be effective in severe cases compared with controls (severe vs. healthy group), according to their average CS between the replicates, and 25 of these were involved in more than one cell subtype (Fig. 2B , Supplementary Table 3C , 4B). As listed in Table 2 , nine drugs presented in at least three separate cell types, including ABT-737 (BCL inhibitor), brefeldin-a (protein synthesis inhibitor), indirubin (CDK inhibitor), TPCA-1 (IKK inhibitor), lopinavir (HIV protease inhibitor), GW-441756 (growth factor receptor inhibitor), treprostinil (prostacyclin analog), tyrphostin-AG-1478 (EGFR inhibitor), and epoxycholesterol (LXR agonist). In this group, lopinavir/ritonavir and hydrocortisone are ongoing in COVID-19 clinical trials.

A total of 111 candidate drugs were identified in severe cases compared with mild cases (severe-vs-mild group), 39 of which were involved in more than one cell subtype (Fig. 2C, Supplementary Table 3D , 4C). As listed in Table 3 , nine drugs (those for which drugs were selected in three separate cell types or more), including fostamatinib (SYK inhibitor), VER-155008 (HSP inhibitor), KU-0063794 (MTOR inhibitor), PIK-90 (PI3K inhibitor), linsitinib (IGF-1 inhibitor), TAK-715 (p38 MAPK inhibitor), Y-27632 (Rho-associated kinase inhibitor), AZ-628 (RAF inhibitor), and lestaurtinib (FLT3 inhibitor), were identified. In this group, except lopinavir, we also assessed the eight listed drugs in clinical trials for the treatment of COVID-19 in Table 3 , including the insulin sensitizer metformin (phase 3), HMGCR inhibitor atorvastatin (phase 2/3), phosphodiesterase inhibitor sildenafil (phase Table 1 3), calcium channel blocker verapamil (phase 2/3), phosphodiesterase inhibitor sildenafil (phase 1/2/3), HMGCR inhibitor rosuvastatin (phase 3), CC chemokine receptor antagonist maraviroc (phase 1/2), and dipeptidyl peptidase inhibitor sitagliptin (phase 2/3).

As shown in Fig. 3A 59 and prevents cardiac ischemia. 60 JTE-907 is a cannabinoid receptor inverse agonist that produces antiinflammatory effects. 61 To further demonstrate the usefulness of the drug repurposing strategy, we identified potential therapeutic drugs based on the transcriptional changes in BALF of patients with COVID-19 obtained using bulk RNA-seq data. 50 Ten candidate drugs were identified using the same analysis pipeline, two of which, including the GSK inhibitor SB-216763 and PPAR receptor antagonist GW-6471, were also included in the single cell-based candidate lists (Supplementary Table 5 ).

To prioritize the candidates for COVID-19 treatment, we characterized these candidates' known ADRs, which are a central consideration during drug development. 62 We conducted a computational approach using the SEP-L1000 database to predict relationships between drugs and the emergence of ADRs (Supplementary Tables 6 and  7 ). Figure 4 shows a heatmap of the top 50 drug-ADR associations for on-label (Fig. 4A ) and off-label (Fig. 4B ) ADRs. Interestingly, the majority of the candidate drugs were shown with few ADRs. Only lopinavir (associated with seven off-label ADRs), ritonavir (13 off-label ADRs), and memantine (unexpectedly, 44 on-and eight off-label ADRs) were included in two or more comparisons. In addition, for mild cases, mebendazole (six off-label), vincristine (31 on-label), dexamethasone (20 on-label and 37 off-label), and lenalidomide (18 off-label) showed drugassociated ADRs; for severe cases, there were two drugs, treprostinil (35 on-and six off-label) and valproic acid (44 on-label); and for comparison between mild and severe cases, metformin was associated with 31 on-and 25 offlabel ADRs, atorvastatin 32 off-label, sildenafil 44 onlabel, verapamil 32 on-and 27 off-label and dasatinib 45 on-and 22 off-label ADRs. These findings highlighted drug-ADR associations and may lead to informed clinical decisions regarding treatments for COVID-19. 

Two candidates, tyrphostin-AG-1478 (AG-1478) and brefeldin-a (BFA), were selected as our top candidates and examined for potent activity against the ssRNA virus influenza A virus (IAV; strain Puerto Rico/8/1934 (H1N1)). IAV is a negative-sense ssRNA virus with eight genomic segments of different lengths (ranging from 0.89 to 2.3 kb). IAV was chosen because both SARS-CoV-2 and IAV are contagious ssRNA viruses that cause respiratory tract infections and their disease symptoms are quite similar. 63 Additionally, SARS-CoV-2 preferentially infects type II pneumocytes, which is the primary site of IAV replication. 64,65 AG-1478, an epidermal growth factor receptor (EGFR) inhibitor and cancer chemotherapy agent inhibits hepatitis C virus and encephalomyocarditis virus in cells. 66 BFA blocks the envelopment and egress of a mature viral particle by inhibiting protein transfer from the endoplasmic reticulum to the cis-Golgi. 67 BFA treatment inhibits the egress of both DNA viruses (herpes simplex virus) 67 and RNA viruses (Newcastle disease virus), 67 the entry of human papillomavirus and polyomavirus, 68 and the replication of mouse hepatitis coronavirus 69 and human immunodeficiency virus type 1. 70 We tested whether these two drugs reduce viral RNA levels in Calu-3 and Vero E6 cells after infection with IAV by measuring IAV viral RNA levels in the cell culture supernatant by RT-qPCR. Upon treatment, both AG-1478 and BFA reduced IAV viral RNA levels dose-dependently at 24 h post-infection (Fig. 5A, Supplementary Fig. 3A -C). Neither compound caused significant cytotoxicity, but BFA slightly reduced viability in Vero E6 cells at high concentrations. Consistent with the reduction in viral replication, we observed that AG-1478 treatment elevated the mRNA levels of interferon-stimulated genes (ISGs) (ISG15 and MX1) and IFNβ in Calu-3 cells (Fig. 5B) . The cellular receptor angiotensin-converting enzyme 2 (ACE2) is a key mediator of SARS-CoV-2 host cell entry. 71 We found that cellular mRNA levels of ACE2 increased in AG-1478treated Calu-3 cells. In contrast, BFA treatment significantly reduced the expression of ACE2, MX1, ISG15, and IFNβ ( Supplementary Fig. 3D ). These data offer the possibility to further assess whether additional effects such as PTMs (glycosylation and phosphorylation) may be impacted by these inhibitors. Collectively, these results showed that AG-1478 and BFA exhibit a good antiviral effect on IAV, which provided novel possibilities for further preclinical development research.

COVID-19 has spread rapidly worldwide, highlighting the urgent need to develop effective therapies. Various types of drugs, including antivirals, small-molecule drugs, biologics, and vaccines, 11, 12 could potentially be used to control or prevent emerging coronavirus disease. However, because of the lack of effective therapeutic agents and long development cycles of vaccines, it is reasonable to consider repurposing existing drugs and compounds for COVID-19 as an alternative approach. Both IAV and CoVs are common respiratory viruses. The flu season occurs annually, and its symptoms are similar to the respiratory symptoms caused by coronaviruses. In the United States, IAV has caused approximately 9.2-35.6 million illnesses with a mortality rate of 0.04%-0.83%, 72 while COVID-19 has caused more than 8 million positive cases and 220 000 deaths, with mortality rates of approximately 2.7%. 1 Although COVID-19 has higher morbidity and mortality than IAV infections, plasma cells were increased significantly in both patients with COVID-19 and IAV. 73 T cells and NK cells also were activated in both types of patients, which may contribute to the defense against the viruses. 73 SARS-CoV-2 needs to be manipulated in BSL-3 conditions for biosafety considerations, while certain IAV strains allow rapid assessment of antiviral activity in vitro in a BSL-2 laboratory.

In silico approaches to systematically predicting COVID-19 drug repurposing candidates are rapidly growing. In general, there are several computational strategies, including structure-based and deep-learningbased methods targeting virus, and signature-based and network-based approaches targeting host. 74 Our approach relied on a signature-based host-targeting method to identify potential drugs that can induce expression signatures that reversely correlate with the disease development and progression by altering the host immune response against viral pathogenesis. 45 Our approach is different from previous methods [41] [42] [43] [44] for drug repurposing for coronavirus as it does not merely rapidly identify likely effective therapeutic agents in preventing or treating COVID-19, but tries to filter specific medications targeting immune reactions and specific modulators during the patients' disease courses. Furthermore, the scRNA-seq and transcriptome data were derived from human patients with COVID-19 at different disease states (mild vs severe), and two independent publicly available datasets were used for this study. . Data are represented as the mean ± SD with three technical replicates each. Statistical significance was determined using one-way ANOVA. * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * * P < 0.0001.

HIV transfer from dendritic cells to T cells. 75 Azacytidine partially reversed aberrant DNA methylation. Azacytidine combined with chemotherapy (fludarabine and cytarabine) in treating childhood leukemia is in a phase 1 clinical trial, and azacytidine in conjunction with APR-246 for myelodysplastic syndrome is in a phase 3 clinical trial. 76 The BCL inhibitor ABT-737 exhibits potential pro-apoptotic and antineoplastic activities. 77, 78 The protein synthesis inhibitor brefeldin-a has been widely used to inhibit the entry of some viruses, such as human papillomavirus and polyomavirus, 79 and egress of others, such as herpesviruses and paramyxoviruses. 80 Indirubin, an active ingredient of the traditional Chinese medicine "Danggui Longhui Wan", has potent activity against myelocytic leukemia 81 and therapeutic potential as an antiviral agent against IAV. 82 The SYK inhibitor fostamatinib produced clinically meaningful responses for adult persistent and chronic immune thrombocytopenia in two parallel, phase 3 randomized trials. 83 Fostamatinib is now in a phase 2 COVID-19 trial as it reduces the protein abundance of mucin-1, a biomarker of acute lung injury and respiratory distress syndrome. 84 The HSP inhibitor VER-155008 could regulate Kaposi's sarcoma-associated herpesvirus lytic replication, highlighting its potential as a novel antiviral agent. 85 The FLT3 inhibitor lestaurtinib has secured orphan drug approval from the FDA for acute myeloid leukemia 86 and is in a phase 2 trial for advanced multiple myeloma and phase 1 trials for prostate cancer.

We also explored the underlying risk factors associated with some side effects of the candidates. Understanding toxic on-and off-label ADRs linked to drugs affecting vital organs can improve patient safety and reduce financial costs. 87 Although the mechanisms of ADRs are complicated and not well understood, SEP-L1000 provides insights into the connection between general structural information and ADRs. 88 Notably, our candidate drugs did not show many ADRs.

The selection and validation of AG-1478 and BFA were performed because 1) both were shared in the drug repurposing analysis of patients with mild and severe COVID-19; 2) both were expected to be effective in multiple immune cell types (Fig. 3b) ; 3) they can inhibit viruses according to recent reports; [66] [67] [68] [69] [70] and 4) no adverse side effects were found in our analyses. These two candidates also showed robust antiviral activities against IAV in vitro in cell lines. Interestingly, AG-1478 or BFA treatment enhanced or inhibited the expression of IFNβ and ISGs, respectively. It is known that type I interferons (IFN-Is) and ISGs confer antiviral activities to host cells. However, inappropriate amounts of IFN-Is and ISGs at the wrong time and/or wrong places result in excessive inflammation, tissue damage and sepsis, especially in severe or critical COVID-19. 89 Although ACE2 mediates the cell entry of coronavirus, it also offers protection in acute lung injury against SARS-CoV-2. 90 Recombinant human ACE2 therapy to prevent S-protein interactions with endogenous ACE2 is currently in a phase 2 clinical trial in Europe. 91 Thus, these candidates have therapeutic potential for rational selection to target patients with mild or severe COVID-19. Overall, our data serve as a basis for future pharmacological studies in the treatment of SARS-CoV-2 and will guide the future development of therapies for the different severities of COVID-19 and other viral respiratory infections.

As PTMs regulate host-pathogen interaction, immune response, and virion packaging and budding, several studies have focused on SARS-CoV-2 Spike protein modifications. [92] [93] [94] Glycosylation is one of the most prominent PTMs, and Spike glycans are essential for SARS-CoV-2 virus binding, fusion, and entry into host cells. 95 These findings highlight the potential of chemical inhibitors of glycosylation for treatment of COVID-19. Interestingly, the candidate BFA may indirectly block glycosylation by interfering with protein transport between the endoplasmic reticulum and Golgi. 48 AG-1478 exhibits BFA-like activity by inducing reversible Golgi disruption and inhibiting the secretory transport in human cells. 47 Therefore, AG-1478 and BFA potentially provide a new way to treat COVID- 19. This study has several limitations. First, the public scRNA-seq data had a small number of clinical samples (n = 9) without detailed patient information available at the time of our analysis, making comparisons between studies difficult and making it impossible to dissect the patient's clinical features with the particular cell type-mediated immune responses. Given the relatively small number of individuals and all data based on the same race/ethnicity and single virus strain, the inclusion of more ethnically diverse populations and multiple strains of SARS-CoV-2 virus is recommended for future studies to rule out possible treatment effect heterogeneity. Second, IAV was chosen to test candidate drugs antiviral activity. Although both SARS-CoV-2 and IAV are enveloped ssRNA viruses, their genomes are different in genetic polarity and segmentation as well as surface proteins, which may result in different immune responses and gene expression patterns during viral infection. 64, 65 We tested the transcriptional and translational levels of some critical cytokines and their regulators (e.g. IFN-Is and ISGs) after infection. It would be beneficial to further test their alterations and regulations at PTMs (glycosylation and phosphorylation) levels. Future work on large-scale international data mining and experimental validation in COVID-19 animal models and human subjects would help us better identify antiviral drugs to combat the disastrous pandemic.

The COVID-19 pandemic represents a great global public health crisis. Repurposing existing drugs is a fast and cost-efficient way to accelerate and optimize drug development. We investigated potentially repurposable candidates for treatment of COVID-19 progression. The findings can guide additional repurposing studies tailored to different stages of disease progression.

Supplementary data are available at PCMEDI online.

The scRNA-seq and bulk-RNA-seq data are available from the NCBI Gene Expression Omnibus database (http s://www.ncbi.nlm.nih.gov/geo/; accession ID: GSE145926) and the Chinese National Genomics Data Center (https: //bigd.big.ac.cn/; accession ID: CRA002390), respectively. All the codes used in this study are available at https: //github.com/guokai8/COVID19/.

K.G., M.W., C.L., and J.H. designed the project and revised the manuscript. Z.W. and K.G. collected data, performed the analyses, prepared figures, and wrote the manuscript. P.G. performed analyses, prepared tables, and wrote the manuscript. Q.P. revised the manuscript.

World Health Organization. Coronavirus disease (COVID-19) outbreak

A novel coronavirus from patients with pneumonia in China

Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding

COVID-19: immunopathogenesis and Immunotherapeutics

Characteristics and outcomes of patients hospitalized for COVID-19 and cardiac disease in Northern Italy

Global, regional, and national sepsis incidence and mortality, 1990-2017: analysis for the Global Burden of Disease Study

Causes of death and comorbidities in hospitalized patients with COVID-19

COVID-19 patients exhibit less pronounced immune suppression compared with bacterial septic shock patients

Clinical features and short-term outcomes of 221 patients with COVID-19 in Wuhan

Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study

Pharmacologic treatments for coronavirus disease 2019 (COVID-19): a review

Therapeutic options for the 2019 novel coronavirus (2019-nCoV)

World Health Organization. Draft landscape of COVID-19 candidate vaccines

A systematic review of SARS-CoV-2 vaccine candidates

Breakthrough: Chloroquine phosphate has shown apparent efficacy in treatment of COVID-19 associated pneumonia in clinical studies

Remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-nCoV) in vitro

In vitro antiviral activity and projection of optimized dosing design of hydroxychloroquine for the treatment of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)

Clinical features of patients infected with 2019 novel coronavirus in Wuhan

A rapid advice guideline for the diagnosis and treatment of 2019 novel coronavirus (2019-nCoV) infected pneumonia (standard version)

Role of lopinavir/ritonavir in the treatment of SARS: initial virological and clinical findings

Remdesivir in adults with severe COVID-19: a randomised, double-blind, placebo-controlled, multicentre trial

Immunogenicity and safety of a SARS-CoV-2 inactivated vaccine in healthy adults aged 18-59 years: report of the randomized, double-blind, and placebo-controlled phase 2 clinical trial

A trial of lopinavir-ritonavir in adults hospitalized with severe Covid-19

Effect of high vs low doses of chloroquine diphosphate as adjunctive therapy for patients hospitalized with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection: a randomized clinical trial

The QT interval in patients with COVID-19 treated with hydroxychloroquine and azithromycin

Hydroxychloroquine and azithromycin as a treatment of COVID-19: results of an openlabel non-randomized clinical trial

Boosting the arsenal against COVID-19 through computational drug repurposing

CDC) CfDCaP. Revised U.S. surveillance case definition for severe acute respiratory syndrome (SARS) and update on SARS cases-United States and worldwide

Chance missed, but still there! Memoirs at the 10(th) anniversary of 2003 SARS outbreak

Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia

World Health Organization. MERS-CoV news archive

Comparative analysis of eleven healthcare-associated outbreaks of Middle East respiratory syndrome coronavirus (Mers-Cov) from 2015 to 2017

Breadth of concomitant immune responses prior to patient recovery: a case report of non-severe COVID-19

Characteristics of and important lessons from the coronavirus disease 2019 (COVID-19) outbreak in China: summary of a report of 72314 cases from the Chinese Center for Disease Control and Prevention

Immune responses in influenza A virus and human coronavirus infections: an ongoing battle between the virus and host

Immunopathogenesis of coronavirus infections: implications for SARS

Single-cell landscape of bronchoalveolar immune cells in patients with COVID-19

Renovation as innovation: is repurposing the future of drug discovery research?

Drug repurposing for viral infectious diseases: how far are we?

Drug repurposing: progress, challenges and recommendations

A SARS-CoV-2 protein interaction map reveals targets for drug repurposing

Broad anticoronavirus activity of Food and Drug Administrationapproved drugs against SARS-CoV-2 in vitro and SARS-CoV in vivo

A large-scale drug repositioning survey for SARS-CoV-2 antivirals

Repurposing didanosine as a potential treatment for COVID-19 using single-cell RNA sequencing data

A next generation connectivity map: L1000 platform and the first 1,000,000 profiles

Target virus or target ourselves for COVID-19 drugs discovery?-Lessons learned from antiinfluenza virus therapies

BML-265 and tyrphostin AG1478 disperse the Golgi apparatus and abolish protein transport in human cells

Chemical tools for inhibiting glycosylation

Normalization and variance stabilization of single-cell RNA-seq data using regularized negative binomial regression

Transcriptomic characteristics of bronchoalveolar lavage fluid and peripheral blood mononuclear cells in COVID-19 patients

A side effect resource to capture phenotypic effects of drugs

Data-driven prediction of drug effects and interactions

Protection against Streptococcus pneumoniae invasive pathogenesis by a proteinbased vaccine is achieved by suppression of nasopharyngeal bacterial density during influenza A virus coinfection

Programmable inhibition and detection of RNA viruses using Cas13

CRISPR-Cas13 inhibitors block RNA editing in bacteria and mammalian cells

Efficacy and safety of lopinavir/ritonavir or arbidol in adult patients with mild/moderate COVID-19: an exploratory randomized controlled trial

Dexamethasone treatment for the acute respiratory distress syndrome: a multicentre, randomised controlled trial

Recurrent hepatitis C virus infection post liver transplantation: impact of choice of calcineurin inhibitor

Selective smallmolecule inhibitors of glycogen synthase kinase-3 activity protect primary neurones from death

Delayed cardioprotection afforded by the glycogen synthase kinase 3 inhibitor SB-216763 occurs via a KATP-and MPTP-dependent mechanism at reperfusion

The cannabinoid CB2 receptor inverse agonist JTE-907 suppresses spontaneous itch-associated responses of NC mice, a model of atopic dermatitis

Clinical and economic burden of adverse drug reactions

Coinfection with influenza A virus enhances SARS-CoV-2 infectivity

SARS-CoV-2 reverse genetics reveals a variable infection gradient in the respiratory tract

Influenza A H1N1 induces declines in alveolar gas exchange in mice consistent with rapid post-infection progression from acute lung injury to ARDS

Tyrphostin AG1478 inhibits encephalomyocarditis virus and hepatitis C virus by targeting phosphatidylinositol 4-kinase IIIα

Effect of brefeldin A on alphaherpesvirus membrane protein glycosylation and virus egress

Human papillomavirus type 16 infection of human keratinocytes requires clathrin and caveolin-1 and is brefeldin a sensitive

Mouse hepatitis coronavirus RNA replication depends on GBF1-mediated ARF1 activation

Brefeldin A inhibits the processing and secretion of envelope glycoproteins of human immunodeficiency virus type 1

Structural and functional basis of SARS-CoV-2 entry by using human ACE2

Annual estimates of the burden of seasonal influenza in the United States: A tool for strengthening influenza surveillance and preparedness

Single-cell sequencing of peripheral mononuclear cells reveals distinct immune response landscapes of COVID-19 and influenza patients

Resources and computational strategies to advance small molecule SARS-CoV-2 discovery: Lessons from the pandemic and preparing for future health crises

Pharmaceutical screen identifies novel target processes for activation of autophagy with a broad translational potential

A phase 1 study of azacitidine combined with chemotherapy in childhood leukemia: a report from the TACL consortium

An inhibitor of Bcl-2 family proteins induces regression of solid tumours

The BH3 mimetic ABT-737 targets selective Bcl-2 proteins and efficiently induces apoptosis via Bak/Bax if Mcl-1 is neutralized

Human papillomavirus type 16 infection of human keratinocytes requires clathrin and caveolin-1 and is brefeldin a sensitive

Antiviral activity of brefeldin A and verrucarin A

Molecular mechanisms of indirubin and its derivatives: novel anticancer molecules with their origin in traditional Chinese phytomedicine

Anti-inflammatory effects of indirubin derivatives on influenza A virus-infected human pulmonary microvascular endothelial cells

Fostamatinib for the treatment of adult persistent and chronic immune thrombocytopenia: Results of two phase 3, randomized, placebo-controlled trials

A high content screen for mucin-1-reducing compounds identifies fostamatinib as a candidate for rapid repurposing for acute lung injury during the COVID-19 pandemic

Hsp70 isoforms are essential for the formation of Kaposi's sarcoma-associated herpesvirus replication and transcription compartments

Results from a randomized trial of salvage chemotherapy followed by lestaurtinib for patients with FLT3 mutant AML in first relapse

Large-scale prediction and testing of drug activity on side-effect targets

Drug-induced adverse events prediction with the LINCS L1000 data

The type I interferon response in COVID-19: implications for treatment

A crucial role of angiotensin converting enzyme 2 (ACE2) in SARS coronavirus-induced lung injury

Angiotensin-converting enzyme 2 (ACE2) as a SARS-CoV-2 receptor: molecular mechanisms and potential therapeutic target

Deducing the N-and O-glycosylation profile of the spike protein of novel coronavirus SARS-CoV-2

Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein

Site-specific glycan analysis of the SARS-CoV-2 spike

Inhibition of SARS-CoV-2 viral entry upon blocking N-and O-glycan elaboration

The work was partially supported by the National Institutes of Health (NIH, grants No. P20GM113123 to J.H., R01AI138203 and AI109317 to M.W.) and the Science and

Technology Department of Sichuan Province (grant No. 2019YJ0050) to C.L. The funders of the study had no role in study design, data collection, data analysis, data interpretation, or writing of the paper. Influenza A virus (IAV, Puerto Rico/8/1934(H1N1)) viral stocks were provided by the laboratory of Dr. Nadeem Khan (University of North Dakota). Figure 1 was created by modifying illustrations provided by Servier Medical Art (SMART) licensed under a Creative Commons Attribution 3.0 Unported License (smart.servier.com) and Vecteezy.com.

As an Editorial Board Member of Precision Clinical Medicine, the corresponding author Min Wu was blinded from reviewing and making decision on this manuscript.