adverb

This is a table of type adverb and their frequencies. Use it to search & browse the list to learn more about your study carrel.

adverb	frequency
not	10608
also	4938
only	2811
more	2810
however	2608
well	1990
as	1797
most	1540
then	1379
thus	1330
previously	1222
significantly	1170
even	1107
respectively	1033
therefore	1020
very	1019
out	984
so	945
up	848
first	826
often	775
rather	766
highly	743
here	718
e.g.	717
further	686
less	627
recently	596
relatively	570
now	569
at	530
still	527
above	494
particularly	468
approximately	468
furthermore	462
especially	434
directly	431
much	430
otherwise	420
least	404
together	393
finally	391
generally	382
later	376
currently	370
just	363
strongly	355
yet	351
indeed	343
similarly	329
far	329
re-	319
potentially	319
clearly	319
too	316
prior	311
long	310
always	310
usually	307
about	302
moreover	297
online	296
fully	289
almost	288
likely	284
specifically	281
by	277
all	273
instead	272
typically	268
alone	256
clinically	255
back	252
statistically	251
genetically	249
primarily	248
ever	247
already	245
n’t	242
perhaps	236
on	234
slightly	231
probably	228
again	227
frequently	225
additionally	224
commonly	223
interestingly	221
never	220
widely	218
simply	216
once	214
closely	212
nearly	210
nevertheless	204
largely	202
subsequently	202
in	196
down	195
better	195
moderately	190
possibly	188
genome	186
mainly	184
initially	184
sometimes	177
away	175
hence	171
equally	166
de-	159
off	159
thereby	158
longer	153
easily	152
forward	149
extremely	149
no	148
completely	147
that	146
below	146
early	142
rapidly	142
there	141
ago	139
over	138
next	137
briefly	137
quite	136
consequently	136
immediately	135
increasingly	134
elsewhere	134
is	130
earlier	130
mostly	130
really	130
separately	129
partially	129
overall	127
randomly	126
nt	125
necessarily	124
actually	124
successfully	123
substantially	122
consistently	121
notably	121
ultimately	118
apart	118
newly	117
certainly	117
assays	116
properly	115
independently	114
eventually	114
simultaneously	113
correctly	113
effectively	107
namely	105
allele	104
best	104
entirely	103
before	103
rarely	102
twice	101
severely	101
regardless	99
pre-	99
normally	98
enough	98
per-	98
alternatively	96
culturally	95
poorly	94
importantly	94
greatly	94
markedly	93
solely	92
readily	92
originally	92
somewhat	90
positively	90
right	87
tively	87
predominantly	85
soon	82
accurately	82
partly	79
quickly	75
apparently	75
overnight	74
sufficiently	73
daily	73
essentially	71
nonetheless	71
virtually	70
cally	70
considerably	70
spatially	69
in-	69
carefully	69
presumably	69
merely	69
explicitly	67
exclusively	67
cantly	67
broadly	67
age-	67
negatively	67
extensively	66
proudly	66
obviously	65
morally	65
inversely	65
historically	65
second	65
accordingly	64
individually	63
appropriately	62
differentially	61
close	61
n	61
deeply	60
conversely	60
worldwide	59
unfortunately	59
fairly	59
slowly	58
nominally	58
ex-	58
around	58
precisely	57
routinely	57
whole	56
roughly	56
exactly	56
remarkably	55
surprisingly	54
mildly	54
likewise	54
truly	52
critically	52
collectively	52
else	51
outside	51
rcmb.2016	51
ahead	50
publicly	50
heavily	50
occasionally	49
spontaneously	49
transiently	48
selectively	48
atopy	48
actively	48
ously	47
commercially	47
of	47
physically	47
systematically	47
socially	47
seriously	46
late	46
functionally	46
course	46
associ-	46
gratefully	45
either	45
physiologically	45
naturally	44
locally	44
high	44
indirectly	43
freely	42
dramatically	42
continuously	42
reasonably	41
lower	41
home	41
annually	40
adequately	40
efficiently	40
uniformly	40
shortly	39
regularly	39
preferentially	39
jointly	39
uniquely	38
seemingly	38
putatively	38
medically	38
after	37
gradually	37
forth	37
strikingly	37
sig-	37
strictly	37
stably	37
ob-	36
manually	36
und	35
mately	35
hard	35
environmentally	35
dis-	35
reliably	35
traditionally	34
sup-	34
closer	34
experimentally	33
5a	33
altogether	33
aside	33
quently	33
hereby	33
minimally	33
thereafter	33
insofar	32
hba1	32
inevitably	32
perfectly	32
tially	32
tightly	32
unusually	31
low	31
higher	31
formally	31
acutely	31
totally	31
faster	30
ac-	30
al-	30
as-	30
asso-	30
telomere	30
progressively	30
repeatedly	30
wide	30
theoretically	30
thoroughly	29
openly	29
upstream	29
secondly	28
sarcomere	28
safely	28
lastly	28
geographically	28
dif-	28
through	28
left	27
chronically	27
firmly	27
globally	27
incompletely	27
purely	27
out-	27
politically	27
under	27
unexpectedly	27
ingly	26
ately	26
fundamentally	26
cor-	26
maybe	26
weakly	26
nificantly	26
irrespective	25
along	25
differently	25
en-	25
fast	25
axis	25
recessively	25
sincerely	25
somehow	25
undoubtedly	25
visually	25
personally	24
node	24
mentally	24
deliberately	24
definitely	24
be-	24
postnatally	23
arguably	23
empirically	23
n''t	23
phenotypically	23
prospectively	23
postoperatively	23
qualitatively	23
though	23
universally	23
suddenly	22
reportedly	22
phe-	22
nor-	22
evenly	22
inherently	21
ac	21
biologically	21
hardly	21
mutually	21
last	21
objectively	21
subfamily	21
superfamily	21
im-	20
automatically	20
disproportionately	20
ethnically	20
evolutionarily	20
ically	20
pro-	20
implicitly	20
larly	20
modestly	20
non-	20
structurally	20
ideally	19
behind	19
constantly	19
dmft	19
dose	19
economically	19
exceptionally	19
freshly	19
generously	19
electronically	19
kindly	19
robustly	19
marginally	19
stent	19
sequentially	19
short	19
retrospectively	19
sug-	19
presently	19
near	19
evidently	18
absolutely	18
barely	18
cially	18
covalently	18
definitively	18
developmentally	18
-	18
externally	18
histologically	18
meanwhile	18
quantitatively	18
rently	18
¼	18
financially	18
graphically	17
ably	17
ajplung.00345.2016	17
com-	17
conclusively	17
deep	17
digitally	17
double	17
ficantly	17
http://	17
massively	17
neously	17
overly	17
profoundly	17
surely	17
ther	17
third	17
versa	17
forever	16
ade-	16
alike	16
causally	16
densely	16
dynamically	16
concurrently	16
iden-	16
ng	16
viously	16
spectively	16
temporarily	16
ubiquitously	16
maximally	16
eaes	15
fortunately	15
formerly	15
firstly	15
eq	15
adversely	15
dominantly	15
dem-	15
literally	15
abnormally	15
intrinsically	15
incorrectly	15
maternally	15
paternally	15
periodically	15
permanently	15
remotely	15
seldom	15
sively	15
surgically	15
therein	15
ticularly	15
un-	15
ciently	14
gen-	14
free	14
exceedingly	14
downstream	14
anteriorly	14
caerphilly	14
bleomycin-	14
anywhere	14
internally	14
hemodynamically	14
cho-	14
intraperitoneally	14
posteriorly	14
monly	14
voluntarily	14
sub-	14
pretty	14
rightly	14
orally	14
onward	14
nome	14
nationally	14
convincingly	13
everywhere	13
ently	13
electrically	13
drastically	13
doubt	13
abroad	13
computationally	13
comparatively	13
basically	13
ajhga	13
little	13
51-y	13
intentionally	13
ill	13
open	13
tice	13
sharply	13
†	13
vastly	13
varilly	13
tionally	13
top	13
therapeutically	13
sure	13
super	13
subcutaneously	13
somewhere	13
shepard	13
donnelly	12
intermittently	12
inadvertently	12
icantly	12
fluorescently	12
exam-	12
matter	12
distantly	12
conceptually	12
comprehensively	12
classically	12
asthma	12
ajplung.00120.2016	12
legally	12
how-	12
meaningfully	12
reverse	12
tually	12
technically	12
synergistically	12
syndactyly	12
sus-	12
sarily	12
narrowly	12
religiously	12
worldly	12
potently	12
optimally	12
nowhere	12
prenatally	12
dysarthria	11
https://doi.org/10.1017/s002193201600002x	11
height	11
gently	11
fine	11
excessively	11
emotionally	11
congenitally	11
crucially	11
continually	11
coarse	11
admittedly	11
abundantly	11
lim-	11
inwardly	11
loosely	11
unequivocally	11
par-	11
mally	11
taneously	11
straight	11
steadily	11
rationally	11
radically	11
sexually	11
numerically	11
nos	11
noninvasively	11
nicely	11
more-	11
molecularly	11
es-	10
incidentally	10
inadequately	10
impor-	10
haps	10
fold	10
ethically	10
infrequently	10
doc-	10
custom	10
conneely	10
cognitively	10
chemically	10
catheter	10
inferiorly	10
suitably	10
invariably	10
phenotype	10
logically	10
thereof	10
reproducibly	10
proximately	10
plausibly	10
r91c	10
peacefully	10
outdoors	10
ostensibly	10
mea-	10
man-	10
longitudinally	10
bilaterally	9
hereafter	9
exponentially	9
e11.5	9
di-	9
der	9
charac-	9
centrally	9
antenatally	9
bet	9
asymptotically	9
artificially	9
appen-	9
ap-	9
anymore	9
ana-	9
ajplung.00463.2016	9
idly	9
hypothe-	9
genotypically	9
intimately	9
prematurely	9
linearly	9
systemically	9
simul-	9
serially	9
reproductively	9
pub-	9
prominently	9
preoperatively	9
rospectively	9
predominately	9
persistently	9
organically	9
ordinarily	9
nitroprusside	9
nano	9
marily	9
practically	9
main-	9
fourth	8
environmen-	8
expressly	8
falsely	8
fore	8
identically	8
glyburide	8
grossly	8
highest	8
ily	8
ecologically	8
edly	8
afterwards	8
doubly	8
cul-	8
constitutively	8
cently	8
boglibose	8
bly	8
badly	8
anyway	8
anecdotally	8
insufficiently	8
af-	8
3d	8
1):361	8
immune	8
https://doi.org/10.1038/s41467-019-09831-5	8
intravenously	8
rep-	8
linguistically	8
wisely	8
understandably	8
unambiguously	8
tically	8
thirdly	8
terly	8
syn-	8
supposedly	8
stable	8
spe-	8
sec-	8
tantly	8
reilly	8
nucleotide	8
ran-	8
nearby	8
neither	8
notoriously	8
nowadays	8
nach	8
overdose	8
pendently	8
pletely	8
proximally	8
hopefully	7
entanto	7
favorably	7
full	7
genuinely	7
ho-	7
inappropriately	7
imately	7
corre-	7
indefinitely	7
intensely	7
ironically	7
ele-	7
laterally	7
constitutionally	7
conceivably	7
cifically	7
chiefly	7
cautiously	7
both	7
biochemically	7
because	7
ase	7
any	7
anatomically	7
al1	7
judicially	7
reg-	7
materially	7
scully	7
meta	7
utterly	7
usefully	7
urgently	7
titin	7
thermodynamically	7
tentially	7
temporally	7
subtly	7
strategically	7
sin-	7
sequently	7
thermally	7
sc	7
oxide	7
rigorously	7
nally	7
nm	7
north	7
onwards	7
oligonucleotide	7
pathologically	7
principally	7
vertically	7
regionally	7
fre-	6
inductively	6
gentlemanly	6
half	6
henceforth	6
ibid	6
immunologically	6
mechanically	6
informally	6
intensively	6
io	6
iso-	6
lately	6
farther	6
foremost	6
ancestrally	6
erroneously	6
epidemiologically	6
em-	6
downward	6
derisi	6
dently	6
cru-	6
correspondingly	6
concomitantly	6
clear	6
car-	6
bravely	6
appreciably	6
metabolically	6
abruptly	6
mechanistically	6
improperly	6
mimo	6
vaginally	6
sparsely	6
specially	6
splendidly	6
superficially	6
technologically	6
tistically	6
vividly	6
since	6
weekly	6
whatsoever	6
wholly	6
©	6
μm	6
monotonically	6
sooner	6
war-	6
serendipitously	6
preferably	6
nately	6
scarcely	6
neo-	6
officially	6
optically	6
ogtt	6
prophylaxis	6
prosocially	6
psychiatrically	6
racially	6
radiologically	6
round	6
egly	5
enzymatically	5
insulin-	5
evi-	5
federally	5
geometrically	5
horizontally	5
http://dx.doi.org/doi:10.1016/j.bbabio.2008.05.016	5
https://doi.org/10.1017/s0033291700008217	5
inextricably	5
justifiably	5
intranasally	5
invasively	5
irregularly	5
iteratively	5
ively	5
lightly	5
mannose	5
mem-	5
distin-	5
na+	5
domly	5
alternately	5
diffusely	5
desperately	5
nec-	5
accom-	5
across	5
actin	5
adaptively	5
admirably	5
apnea	5
approxi-	5
arbitrarily	5
atically	5
batf2	5
bezüglich	5
broad	5
character-	5
communally	5
conscientiously	5
consciously	5
cov-	5
deeper	5
neatly	5
ph	5
neutrally	5
sys-	5
south	5
spiritually	5
spuriously	5
sstnt	5
stout	5
stringently	5
subjectively	5
succinctly	5
superiorly	5
tem	5
siderably	5
tently	5
ub	5
unanimously	5
unnecessarily	5
uously	5
usu-	5
willingly	5
yearly	5
normatively	5
signifıcantly	5
unduly	5
shorter	5
parallel	5
objective	5
sembly	5
operatively	5
orly	5
overtly	5
oxidatively	5
pachore	5
paradoxically	5
ot	5
rectly	5
polydactyly	5
precipitously	5
psychologically	5
pur-	5
purportedly	5
realistically	5
secondarily	5
platelet	5
easy	4
exome	4
exogenously	4
exhaustively	4
esterly	4
esp	4
ere	4
endogenously	4
erally	4
epigenetically	4
endovascularly	4
elegantly	4
effectfully	4
faithfully	4
echocardiography	4
extraordinarily	4
http://www.molvis.org/molvis/v5/p10	4
famously	4
immu-	4
infinitely	4
eagerly	4
inde-	4
incredibly	4
inconsistently	4
imperfectly	4
human	4
harder	4
http://refhub.elsevier.com/s0161-6420(16)31127-7/sref4	4
honestly	4
ho	4
hm	4
his-	4
hematopoietically	4
east	4
amide	4
ditionally	4
acute	4
anddatp),withthecombined	4
aminoglycoside	4
al20	4
afterward	4
afterload	4
admin-	4
accidentally	4
distinctly	4
abt-263	4
aberrantly	4
ab-	4
10-	4
+	4
interchangeably	4
aptly	4
atively	4
autologously	4
besides	4
characteristically	4
che-	4
cheaply	4
clin-	4
competitively	4
comprehensibly	4
controversially	4
conventionally	4
demographically	4
dependently	4
diately	4
direct	4
disassembly	4
intelligently	4
respectfully	4
intuitively	4
sex-	4
sta-	4
sporadically	4
sort	4
sometime	4
smoothly	4
sically	4
serologically	4
rately	4
sensitively	4
semi	4
secretory	4
satisfactorily	4
richly	4
rec-	4
stantially	4
suboptimally	4
successively	4
symbolically	4
terminally	4
torsina	4
transcriptionally	4
turally	4
ularly	4
uncertainly	4
under-	4
unknowingly	4
upward	4
verbally	4
versely	4
irreversibly	4
vigorously	4
real	4
tremely	4
quarterly	4
matically	4
morbidly	4
monthly	4
mod-	4
microbial	4
meticulously	4
medially	4
lymphocyte	4
nantly	4
luckily	4
logistically	4
legitimately	4
isometrically	4
proportionally	4
lb	4
mul-	4
macroscopically	4
neonatally	4
polysyndactyly	4
neurologically	4
promptly	4
prohibitively	4
proactively	4
predictably	4
posterior	4
privately	4
politely	4
patho-	4
passively	4
nonviolently	4
nonethe-	4
new	4
hand2	3
gloriously	3
gravely	3
grb10	3
halfway	3
handsomely	3
har-	3
hap-	3
gentamicin-	3
hardest	3
geospatially	3
expo-	3
gabriely	3
etymologically	3
forcefully	3
fiercely	3
exten-	3
exquisitely	3
experientially	3
expectedly	3
existentially	3
heretofore	3
evolutionally	3
heckenlively	3
inside	3
het-	3
hos-	3
kaptin	3
esti-	3
jus-	3
inward	3
involuntarily	3
intriguingly	3
intraoperatively	3
internationally	3
interactively	3
intellectually	3
institutionally	3
infl	3
incrementally	3
incor-	3
inaccurately	3
imaginatively	3
illus-	3
ilarly	3
iis	3
hydrophobically	3
hy-	3
http://refhub.elsevier.com/s1071-9091(19)30005-1/sbref0082	3
http://refhub.elsevier.com/s0952-7915(18)30021-9/sbref0185	3
estingly	3
biophysically	3
esnps	3
cat-	3
bstatistically	3
blindly	3
blind	3
biweekly	3
beyond	3
beautifully	3
backward	3
autonomously	3
asymmetrically	3
asp-59	3
arteritis	3
argumento	3
arately	3
anytime	3
analogously	3
am-	3
aggressively	3
agarose	3
affirmatively	3
ad-	3
abstractly	3
abcam	3
lele	3
cal-	3
catalytically	3
energetically	3
cheerfully	3
encour-	3
encephalitis	3
emergently	3
elias	3
electrophoretically	3
echocardiographically	3
eas-	3
distally	3
dark	3
cur-	3
cumulatively	3
creatively	3
coordinately	3
cooperatively	3
contrary	3
conspicuously	3
consid-	3
conservatively	3
conser-	3
confidently	3
collaboratively	3
coarsely	3
classi-	3
kind	3
rhetorically	3
lipoprotein	3
sentially	3
tra-	3
thoughtlessly	3
thanatos	3
tentatively	3
sympathetically	3
sur-	3
sumably	3
suf-	3
subunit	3
su-	3
strong	3
strangely	3
straightforwardly	3
squarely	3
sq	3
sorely	3
someday	3
smaller	3
slow	3
sixfold	3
singly	3
single	3
sim-	3
translationally	3
tremendously	3
tunately	3
vice	3
live	3
wrongly	3
wonderfully	3
without	3
win-	3
wider	3
west	3
ward	3
vul-	3
violently	3
ver	3
unacceptably	3
variously	3
variably	3
uti-	3
usly	3
unselfconsciously	3
unilaterally	3
uni-	3
uneventfully	3
undeniably	3
uncommonly	3
shrna	3
tratamento	3
securely	3
overwhelmingly	3
oth-	3
orthogonally	3
oncotarget	3
oncorhynchus	3
oft	3
octreotide	3
o]nly	3
nously	3
noticeably	3
neuropathy	3
nar-	3
munnelly	3
morphologically	3
mitotically	3
min-	3
microscopically	3
mg	3
mentais	3
meantime	3
mckusickva	3
mamm	3
secretly	3
lly	3
outward	3
new-	3
rod-	3
problematically	3
schematically	3
p=0.016	3
right-	3
riely	3
rescently	3
relentlessly	3
recursively	3
quirement	3
quantita-	3
purposely	3
profitably	3
recurrently	3
probabilistically	3
pnas.0607661103	3
pally	3
percutaneously	3
peripherally	3
plainly	3
pecially	3
polesky	3
polysac-	3
positionally	3
good	2
fresh	2
foundly	2
furosemide	2
fymetrix	2
gely	2
generically	2
genitally	2
gladly	2
gleefully	2
glutarylcarnitine	2
gly	2
homogeneously	2
gov-	2
greedily	2
hamshere	2
handily	2
happily	2
harmoniously	2
heterogeneously	2
heterologously	2
hexagonally	2
hierarchically	2
histopathologically	2
forcibly	2
forsythe	2
emberly	2
fol-	2
etiologically	2
horrendously	2
electrostatically	2
embryologically	2
endedly	2
enormously	2
enthusiastically	2
entially	2
entropy	2
epi-	2
erably	2
essas	2
mean6sem	2
foetally	2
facere	2
fam	2
farrell	2
farrelly	2
fatally	2
fcer1	2
ferently	2
fifth	2
fil-	2
flatly	2
flexibly	2
hopelessly	2
mammographically	2
http://refhub.elsevier.com/s0952-7915(18)30021-9/sbref0205	2
http://refhub.elsevier.com/s1028-4559(15)00091-1/sref5	2
itionally	2
itively	2
j.molcel.2012.10.016	2
jolly	2
joyously	2
knowingly	2
labiolingually	2
laboriously	2
lactis	2
lally	2
leisurely	2
leukocyte	2
liberately	2
lingually	2
lipopolysaccharide	2
local-	2
logarithmically	2
lovingly	2
lowest	2
main	2
maliciously	2
educationally	2
manifestly	2
mathematically	2
mb	2
isotropically	2
isis-	2
irrevocably	2
immensely	2
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids=10225909	2
https://doi.org/10.1172/jci11948	2
https://github.com/vcflib/vcflib	2
https://www.tandfonline.com/doi/mlt/10.1080/03066150.2019.1695601	2
hugely	2
humanly	2
ideologically	2
il-8	2
il2	2
illegally	2
illness	2
imperfecta	2
irreducibly	2
inantly	2
indiscriminately	2
indisputably	2
ini-	2
innately	2
insincerely	2
insistently	2
inst	2
instrumentally	2
intracranially	2
iprgcs	2
ef-	2
bitterly	2
edu-	2
ectopically	2
amazingly	2
ame-	2
amici	2
analytically	2
andere	2
animal	2
anonymously	2
ansehen	2
apob	2
apolipoprotein	2
areg	2
arily	2
arms2	2
articip	2
assertively	2
assess-	2
asterisks	2
astray	2
asympto-	2
atender	2
aufgefordert	2
autopsy	2
avidin	2
bac-	2
bacterial	2
although	2
alphabetically	2
aloud	2
abreast	2
/courier	2
/czarnormal	2
11-yr	2
3,3-diaminobenzidine	2
4.16762e-05	2
5.8986(4	2
55–64	2
6(21	2
6.25143e-05	2
a2	2
abo-	2
academically	2
allegedly	2
accompa-	2
acetate	2
acetazolamide	2
act-	2
adj	2
agree”/“strongly	2
agricultural	2
agriculturally	2
aka	2
al.6	2
algorithm	2
bayly	2
bestehen	2
bfgf	2
das	2
conly	2
conveniently	2
core	2
cosmetically	2
curiously	2
curtly	2
cutoff	2
cysteinyl	2
cystically	2
d1	2
dangerously	2
depressão	2
concordantly	2
dgene	2
directionally	2
disagree”/“strongly	2
discretely	2
do-	2
doubtless	2
dry-	2
due	2
dyspnea	2
earnestly	2
echocardiogr	2
concretely	2
con	2
bially	2
ceptionally	2
bidirectionally	2
biotin	2
bipolară	2
bluntly	2
bolditalicmt	2
broader	2
brutally	2
but	2
caspr2	2
caudally	2
ccaggagctctgtgggtca	2
ceptor-	2
competently	2
cessfully	2
char-	2
chelly	2
chi,	2
chronologically	2
cipally	2
closest	2
cohere	2
coincidentally	2
colorfully	2
comfortably	2
mds.23641	2
evolution	2
meiotically	2
sam-	2
stronger	2
stupidly	2
substantively	2
suc-	2
suggestively	2
sullivan	2
sum-	2
suma	2
supremely	2
surreptitiously	2
swiftly	2
symptomatically	2
szekely	2
tai-	2
tandemly	2
tar-	2
tem-	2
tenaciously	2
tenfold	2
territorially	2
tfdp2	2
thematically	2
theologically	2
therapsid	2
tinually	2
stricter	2
stitutively	2
stemi	2
sich	2
sarık	2
scat-	2
schaller	2
scientifically	2
sciously	2
score	2
seasonally	2
sedly	2
sem	2
semiautomatically	2
sibly	2
silander	2
starkly	2
silently	2
sirna	2
sistently	2
snugly	2
softly	2
somatically	2
southeast	2
sparse	2
speculatively	2
sphere	2
standardly	2
tinuously	2
tional	2
titer	2
wistfully	2
vanishingly	2
velously	2
ver-	2
veri-	2
viably	2
vitally	2
warmly	2
way	2
well-	2
whereby	2
wird	2
within	2
vagally	2
wkly	2
worse	2
wrong	2
younger	2
youngest	2
µ≤	2
μg	2
’1	2
†variable(s	2
∗significantly	2
metaphorically	2
vaguely	2
upwardly	2
tive	2
uncomfortably	2
tr	2
tragically	2
transcardially	2
transcriptome	2
trophically	2
two-	2
tyly	2
typischen	2
ubiquinone	2
ultrasound	2
unapologetically	2
unconsciously	2
unwittingly	2
unde-	2
underly	2
underway	2
unequally	2
unevenly	2
unintentionally	2
unjustly	2
unlawfully	2
unnaturally	2
unsuccessfully	2
unsurprisingly	2
sardonically	2
vincere	2
sadly	2
passionately	2
normal-	2
normoxia	2
not-	2
notadamente	2
nucleoside	2
obliquely	2
obstetric	2
obstinately	2
oldest	2
ontrast	2
operationally	2
or-	2
origi-	2
outrageously	2
outwardly	2
over-	2
overjet	2
oversupply	2
oxidase	2
o’reilly	2
p.(cys549arg	2
p.m.	2
painfully	2
painstakingly	2
parently	2
nore	2
nonmonotonically	2
noncovalently	2
neely	2
microrna	2
s100b	2
mitochondrially	2
mogu	2
momma	2
monocrotaline	2
myo-	2
na	2
nasally	2
natally	2
nati	2
negligibly	2
nomically	2
nematode-	2
neurally	2
neuro-	2
neurosphere	2
neurovirulence	2
neutral	2
nightly	2
nisly	2
nitrate	2
nly	2
no-	2
partici-	2
natively	2
patchily	2
reim-	2
putationally	2
quietly	2
r	2
radiographically	2
radionuclide	2
rainforest	2
rap-	2
re	2
rea-	2
rede-	2
regrettably	2
relative	2
publically	2
religioso	2
repre-	2
responsibly	2
rigidly	2
rna	2
ro1	2
robust	2
rs	2
rural	2
peaceably	2
rs1937506	2
purposefully	2
rily	2
prudently	2
posterolaterally	2
perimentally	2
perinatally	2
provisionally	2
perceptively	2
permissibly	2
persuasively	2
phd1	2
philosophically	2
pk	2
playfully	2
portantly	2
portionately	2
pharmacologically	2
pow-	2
proportionately	2
preassembly	2
presenten	2
presumptively	2
prin-	2
protonophore	2
prisingly	2
propriately	2
professionally	2
proteolytically	2
focally	1
fndc4	1
fmoc	1
fluently	1
fluori-	1
fluorescein	1
fleetingly	1
fondly	1
formly	1
for-	1
foreign	1
forfamily	1
frankly	1
forthrightly	1
fortuitously	1
fourier	1
fourthly	1
frcm	1
fivefold	1
fractionally	1
flat	1
fgd2d	1
fittingly	1
fest	1
fectly	1
fecund	1
frevently	1
feder	1
feehly	1
fer-	1
ferentially	1
ferfar	1
fervently	1
feverishly	1
firsthand	1
fexh	1
fi	1
fi-	1
fiably	1
ficially	1
ficiently	1
financiamiento	1
finely	1
fiodwuys	1
frequencies9,10	1
goven	1
front	1
habitually	1
gracefully	1
great	1
greater	1
greatest	1
gressively	1
guineously	1
guistically	1
h+	1
h2=87	1
hadalso	1
frovently	1
haemodynamically	1
haploid	1
harm	1
haw	1
hay	1
hd-062783	1
headmasterly	1
feature	1
healthily	1
gpsm2	1
goriely	1
gold	1
godly	1
frühneuzeitlichen	1
fundoscopy	1
furiously	1
furthest	1
furu-	1
gap-	1
gata4	1
gatttgtaagtgtggatggtgttat	1
gener-	1
genomically	1
gergely	1
getically	1
gewährleisten	1
gically	1
gisi	1
gitudinally	1
glp	1
glucose	1
go	1
fect	1
enigmas	1
feasibly	1
endlessly	1
elly	1
eloquently	1
els	1
eluci-	1
embrac-	1
eminently	1
emphatically	1
end-	1
endemic	1
endocrinologically	1
epigallocatechin	1
endodontically	1
endoluminally	1
energy-	1
engende[r	1
entropically	1
entsprechen	1
eoditinically	1
epicardially	1
epide-	1
elig	1
electrophysiologically	1
electrocardiographically	1
electively	1
helminth	1
e13.5	1
e354x	1
e9–e17	1
easier	1
eccentrically	1
ecently	1
echo-	1
eco-	1
ectly	1
ectopy	1
ed-	1
ederally	1
edilmişti	1
edusc	1
eegesinnich	1
efectele	1
eher	1
ein-	1
epidermal	1
epigenome	1
faultlessly	1
extremcly	1
excavatum	1
excitedly	1
exively	1
exo-	1
experi-	1
experienţa	1
explicit	1
extra	1
extrathymically	1
ex­	1
epilepsy	1
facilely	1
factually	1
false	1
fam-	1
famílias	1
far-	1
fascinatingly	1
fastest	1
faucher	1
evolución	1
evidentemente	1
evidence	1
evc.	1
erachten	1
erately	1
eratively	1
ercutaneously	1
erda1	1
erentially	1
erly	1
errant	1
eschew	1
eskimek	1
ess	1
essarily	1
estima	1
eternally	1
eth-	1
ethnographically	1
ethosuximide	1
ets1	1
euphemistically	1
heartily	1
infarct	1
helpfully	1
intracerebrally	1
inson	1
instantaneously	1
instantly	1
int-	1
integrin-	1
interact	1
interest-	1
interfamily	1
interwoven	1
intramitochondrially	1
ir	1
intraorally	1
intrapartum	1
intratracheally	1
intricately	1
intu-	1
intuitive	1
invariantly	1
investigations	1
iously	1
inseparably	1
insbesondere	1
innocently	1
iniţieze	1
inally	1
inarguably	1
inconsis-	1
inconspicua	1
inconveniently	1
incrimi-	1
individ	1
inefficiently	1
ineluctably	1
inequitably	1
inexorably	1
inexpensively	1
inexplicably	1
infamously	1
e.sph	1
infiltration.144	1
informierten	1
inheri-	1
inhibe	1
iprgc	1
ires	1
impulsively	1
larger	1
kv11.3	1
l-1	1
l[59].†significantly	1
la	1
ladakhis	1
lamely	1
laminin	1
lan	1
lar-	1
lateralis	1
irrationally	1
latterly	1
lay-	1
learly	1
legislatively	1
leitura	1
lentiviral	1
lently	1
lepter	1
lessly	1
koraf3	1
kinda	1
kin-	1
kelİmeler1	1
irreparably	1
irs2—moderately	1
irzspirirlgly	1
isrelatively	1
istically	1
it?j	1
itly	1
iy	1
j.hrthm.2010.12.016	1
j.hrthm.2015.02.016	1
jain2	1
jealously	1
jokingly	1
joyfully	1
justly	1
karyotypically	1
kb-	1
keenly	1
kely	1
inadvertantly	1
impru-	1
hem-	1
http://dx.doi.org/10.2139/ssrn.3544840	1
http://dx.doi.org/10.1016/	1
http://dx.doi.org/10.1016/0921-4534(88)90136-0	1
http://dx.doi.org/10.1016/j.freeradbiomed.2010.07.001	1
http://dx.doi.org/10.1016/j.jaci.2007.01.037	1
http://dx.doi.org/10.1016/j.jaci.2012.02.010	1
http://dx.doi.org/10.1016/s0264-410x(02)00627-8	1
http://dx.doi.org/10.1063/1.3116532	1
http://dx.doi.org/10.1111/all.13220	1
http://dx.doi.org/10.1152/ajplung.00355.2016	1
http://jap.aip.org/jap/copyright.jsp	1
http://www.ncbi.nlm.nih.gov/pubmed/17928596	1
http://nrs.harvard.edu/urn-3:hul.instrepos:5146967	1
http://refhub.elsevier.com/s0952-7915(18)30021-9/sbref0325	1
http://refhub.elsevier.com/s1028-4559(15)00091-1/sref6	1
http://thorax.bmj.com/	1
http://v3.ciliaproteome.org/cgi-bin/	1
http://www.biomedcentral.com/	1
http://www.jwfiles.com/wt_blood/blood.htm	1
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids=15389761	1
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids=19324860	1
http://doi.org/10.1002/ajmg.c.20001	1
http://crossmark.crossref.org/dialog/?doi=10.1371/journal.pone.0174354&domain=pdf&date_stamp=2017-03-31	1
http://creativecommons.org/licenses/by-nc-	1
http:/	1
hematoma	1
hensively	1
hepatically	1
heritable,3	1
hermeneutically	1
hether	1
hexagonal	1
himselfwouldlikely	1
hin-	1
histochemically	1
histocompatibly	1
historiographically	1
hmtppt	1
homepage	1
homozygously	1
hormonally	1
hospitaliz-	1
hotly	1
hourly	1
http://www.ncbi.nlm.nih.gov/pubmed/11015794	1
http://www.ncbi.nlm.nih.gov/pubmed/24304677	1
impressively	1
ifore	1
icam3	1
ice-	1
icmje	1
icnow	1
ideal-	1
identified6–8	1
idiotypically	1
idually	1
ifcc	1
ig-	1
http://www.ncbi.nlm.nih.gov/pubmed/28329706	1
ii.4	1
ima-	1
imagej	1
imally	1
immeasurably	1
impairs	1
impartially	1
impatiently	1
impli-	1
icadı	1
ible	1
ibayg@mail.nih.gov	1
iatrogenically	1
http://www.ncbi.nlm.nih.gov/pubmed/29800320	1
https://doi.org/10.1038/clpt.2008.89	1
https://doi.org/10.1038/nature09764	1
https://doi.org/10.1089/tmj.2011.0027	1
https://doi.org/10.1152/ajplung.00120.2016	1
https://doi.org/10.1177/0733464816642582	1
https://doi.org/10.5751/es-09345-220220	1
https://dx.doi.org/10.1136/jmedgenet-2020-107003	1
https://www.frontiersin.org/article/10.3389/fnut.2019.00016	1
hun-	1
hydrocortisone	1
hydrothermally	1
hyperlipidemia,2	1
hypoadrenalism-	1
hypothetically	1
hâve	1
i)ilod(j	1
i=1	1
iantrogenically	1
e1002532	1
consecutively	1
e-	1
ar2p3	1
apically	1
apo-	1
apoe4	1
apologetically	1
appearance.199,200	1
appendicitis	1
apprixmately	1
aquifer	1
ar-	1
aradoxically	1
aspirin-	1
arhf	1
arly	1
arm-	1
aromp	1
arrays	1
arrogantly	1
ascer-	1
ascertain-	1
asevere	1
aover	1
aos	1
antiretroviral	1
antiporter	1
anap-	1
anc-	1
ancestry8	1
andeventually	1
andformerly	1
andsimilarly	1
andwere	1
andwhere	1
anew	1
angrily	1
animatedly	1
anomaly	1
antennae	1
anteri-	1
anterolaterally	1
anthropometrically	1
anti-	1
antiferromagnetically	1
antigenetically	1
asp130asn	1
assem-	1
amply	1
bebm	1
azimuthally	1
b):2889	1
b0	1
babi	1
bably	1
bacharier	1
backwards	1
balliere	1
basta	1
beforehand	1
assembly	1
befürworten	1
behaviorally	1
behaviourally	1
bemerkt	1
beneath	1
beneficially	1
besprochen	1
bfamily	1
biannually	1
axially	1
awkwardly	1
avidly	1
avail­	1
association,1,2	1
assuredly	1
asthma,10	1
asthma.30,32	1
astlund	1
ath-	1
atherosclerotic	1
athomopathologically	1
atlanto	1
atomically	1
att	1
attentively	1
ausstatten	1
aut-	1
authentically	1
author={david	1
author={lindsey	1
autocatalytically	1
av-	1
an-	1
ampli-	1
biflagellate	1
69:1437–1447	1
594-	1
5:143	1
5e	1
6-bp	1
6.33554e-05	1
6.93927e-05	1
6125e	1
6407986a	1
66:2453–2459	1
6b8	1
absurdly	1
6f	1
7(3	1
723neonatology	1
7q33-q35	1
8,10	1
a''c	1
a003970	1
aarle	1
abetic	1
56:491±508	1
53rd	1
50ggtcacacggctcagctacagatgc	1
4.20931e-05	1
1.315e-08	1
1.31–33	1
10272925electrophoretically	1
11q24.2	1
12q15	1
1441mly	1
14:1585–1596	1
1518:215–220	1
16pwidely	1
17p13.3	1
1984)for	1
1994;78:138–44	1
1–143	1
21360793highly	1
3-	1
3.c	1
34–39	1
39:1046–1054	1
3s	1
absher,32	1
abuzz	1
amildiere	1
alently	1
afield	1
afloat	1
agnósticas	1
agr	1
aicd	1
al.25	1
alarmingly	1
albacore	1
aldehyde	1
alimentaire	1
accen-	1
alkoxide	1
allosterically	1
alongside	1
alrcady	1
alrefai‡§1	1
als	1
alternans	1
ambigen	1
ambitiously	1
aetiologically	1
advertently	1
advantageously	1
adolescenţa	1
accept-	1
acceptably	1
acetaminophen	1
acetonitrile	1
acetyl-	1
acgme	1
acid-	1
acroden-	1
acrylamide	1
actinomycetem-	1
acy-	1
add-	1
additively	1
adecvate	1
adig	1
adipocyte-	1
adiponectin-	1
aditionally	1
adjacently	1
biculturally	1
bil-	1
dutifully	1
derivedfro	1
deftly	1
del-	1
deltarn	1
democratically	1
demokratischen	1
demonstrably	1
denly	1
denomina-	1
dentally	1
derly	1
diagrammatically	1
dermal	1
derway	1
described,3	1
desmin-	1
determinedly	1
development69	1
devoutly	1
dewailly	1
de­	1
defiantly	1
defensively	1
decidedly	1
dearly	1
cozily	1
cpi-203	1
cpreviously	1
cranially	1
creasingly	1
cretely	1
crowell	1
crudely	1
curatively	1
curly	1
current	1
curturally	1
cyclically	1
cys-	1
cyte	1
d15s1014	1
d1s2715	1
davol	1
day-	1
diagnostically	1
diametrically	1
cowardly	1
downright	1
dogmatically	1
doi.org/10.1016/j.cell.2008.08.016	1
doi:10.1159/000181156	1
doi:10.1186/1471	1
dolly	1
dom-	1
domain-	1
down-	1
downhill	1
dra-	1
dic-	1
dropout	1
drph	1
dru-	1
dsrna	1
dually	1
duchly	1
ducibly	1
ductus	1
durably	1
doctrinally	1
divergently	1
disulfide	1
disturbingly	1
die	1
different	1
diffrac-	1
diffusively	1
diligently	1
dimensionally	1
dimly	1
din	1
dine	1
diographically	1
disappointingly	1
discordantly	1
discreetly	1
disen-	1
disguisedly	1
disp	1
dispassionately	1
dissi-	1
distinctively	1
cox)-2	1
courageously	1
bile	1
ccmpletely	1
busily	1
bustly	1
calcimimetic	1
capacitively	1
cardiac	1
carly	1
casually	1
cate-	1
categorically	1
cdc2l5	1
chest.2016	1
cdna	1
ceforanide	1
cefuroxime	1
ceptably	1
cere	1
cerely	1
cessarily	1
cestrally	1
challengingly	1
bronchoscopically	1
bromodomain	1
briskly	1
brilliantly	1
bilistically	1
biotin-	1
bir	1
bivalirudin	1
blakely	1
blatantly	1
blissfully	1
blue	1
bmpr1a	1
boissevain	1
boldly	1
bolically	1
bonly	1
boundedly	1
brachydactyly	1
brainstem	1
brdu(+	1
breath	1
bric	1
changeably	1
circularly	1
counter	1
contin-	1
congregationally	1
coni	1
conneally	1
connelly	1
connor	1
liar18,32	1
consequentially	1
contemptuously	1
contextually	1
continuum	1
cisely	1
contrain-	1
coor-	1
coordina-	1
copy-	1
cordingly	1
corruptly	1
cortically	1
cosmologically	1
cottons－particularly	1
conductively	1
concep-	1
compound	1
compositionally	1
clari-	1
clas-	1
cleanly	1
clearly-	1
clinicaily	1
clonally	1
cogently	1
coincidently	1
col-	1
colloquially	1
colonoscopy	1
colorimetric	1
comely	1
comically	1
communicatively	1