This is a table of named entities, their types, and their frequencies from sentences in your study carrel. Use it to search & browse the list to learn more about your study carrel. Please keep in mind that named-entity extraction is not as accurate as more generic parts-of-speech extraction. Unusual results will appear here.
entity | type | frequency |
---|---|---|
virus | TAXON | 204 |
monensin | ORG | 158 |
rats | TAXON | 136 |
mice | TAXON | 131 |
viral | TAXON | 103 |
ada | ORG | 98 |
nec | ORG | 85 |
golgi | GPE | 83 |
infection | DISEASE | 69 |
iga | ORG | 66 |
animals | TAXON | 64 |
ifn | ORG | 60 |
rat | TAXON | 59 |
igg | ORG | 54 |
viruses | TAXON | 50 |
golgl | ORG | 49 |
ty | PERSON | 46 |
na | ORG | 45 |
human | TAXON | 44 |
jhmv | TAXON | 42 |
nucleotide | CHEMICAL | 38 |
monensln | PERSON | 35 |
piglets | TAXON | 34 |
animal | TAXON | 32 |
clsternae | ORG | 30 |
k | CHEMICAL | 29 |
monensin | PERSON | 28 |
ipc | ORG | 28 |
mouse | TAXON | 27 |
sla | ORG | 27 |
gvhd | ORG | 27 |
cuu | ORG | 26 |
pseudomonas aeruginosa | TAXON | 26 |
nucleotides | CHEMICAL | 26 |
swelling | DISEASE | 25 |
dystonia | GPE | 25 |
sendai | ORG | 25 |
oxygen | CHEMICAL | 24 |
rna | ORG | 24 |
elh | ORG | 24 |
ca | CHEMICAL | 24 |
pseudomonas | GPE | 23 |
na | ORG | 21 |
infections | DISEASE | 21 |
yeast | TAXON | 20 |
murine | TAXON | 20 |
amino acid | CHEMICAL | 19 |
ards | DISEASE | 19 |
sheep | TAXON | 18 |
bacteria | TAXON | 18 |
sfv | TAXON | 18 |
garoff | PERSON | 18 |
bacterial | TAXON | 17 |
mhc | ORG | 17 |
coronavirus | TAXON | 17 |
demyelination | DISEASE | 17 |
toxicity | DISEASE | 17 |
trnas | CHEMICAL | 16 |
infectious | DISEASE | 16 |
sendai virus | TAXON | 16 |
escherichia | ORG | 16 |
asn | CHEMICAL | 16 |
aplysia | TAXON | 15 |
atp | ORG | 15 |
bcv | TAXON | 15 |
n | ORG | 15 |
pmb38 | CHEMICAL | 15 |
rabbit | TAXON | 14 |
leucine | CHEMICAL | 14 |
rcv | ORG | 14 |
np | ORG | 14 |
hrt | ORG | 14 |
hiv | TAXON | 14 |
bfs | ORG | 14 |
bamhl | ORG | 13 |
igm | ORG | 13 |
ethanol | CHEMICAL | 13 |
spasmodic torticollis | DISEASE | 12 |
rodent | TAXON | 12 |
pneumonia | DISEASE | 12 |
uua | ORG | 12 |
tgn | ORG | 12 |
rats | TAXON | 12 |
ata | ORG | 12 |
hbv | ORG | 11 |
ha | ORG | 11 |
gastroenteritis | DISEASE | 11 |
mice | TAXON | 11 |
pbs | ORG | 11 |
pain | DISEASE | 10 |
bovine | CHEMICAL | 10 |
tk | ORG | 10 |
tgev | ORG | 10 |
cdc | ORG | 10 |
interstitial pneumonia | DISEASE | 9 |
botulinum | PERSON | 9 |
ii | ORG | 9 |
pge1 | CHEMICAL | 9 |
er | GPE | 9 |
pigs | TAXON | 9 |
slip | DISEASE | 9 |
sucrose | CHEMICAL | 9 |
plants | TAXON | 9 |
hpv | ORG | 8 |
mycoplasma | ORG | 8 |
miller | PERSON | 8 |
ile | ORG | 8 |
ifna | CHEMICAL | 8 |
hsrv | ORG | 8 |
frameshifting | ORG | 8 |
golga | PERSON | 8 |
e coli | TAXON | 8 |
cmv | ORG | 8 |
bev | ORG | 8 |
phe | ORG | 8 |
pmnl | ORG | 8 |
cpe | ORG | 8 |
semliki forest | ORG | 8 |
glutaraldehyde | CHEMICAL | 8 |
tya | ORG | 8 |
rodents | TAXON | 8 |
phosphate | CHEMICAL | 8 |
oxalate | CHEMICAL | 8 |
organisms | TAXON | 8 |
poisoning | DISEASE | 8 |
fungal | TAXON | 8 |
cattle | TAXON | 8 |
calcium | CHEMICAL | 8 |
breast milk | DISEASE | 8 |
acid | CHEMICAL | 8 |
viral | TAXON | 7 |
barn | TAXON | 7 |
cgg | ORG | 7 |
charley | PERSON | 7 |
clare | ORG | 7 |
dr | DISEASE | 7 |
hbeag | CHEMICAL | 7 |
narl | ORG | 7 |
tonb | ORG | 7 |
ibr | TAXON | 7 |
virus | TAXON | 7 |
animal cells | TAXON | 7 |
diarrhoea | DISEASE | 7 |
eukaryotes | TAXON | 7 |
hepatitis | DISEASE | 7 |
methionine | CHEMICAL | 7 |
plaque | DISEASE | 7 |
tumor | DISEASE | 7 |
wilson | PERSON | 7 |
pcr | ORG | 6 |
mg | CHEMICAL | 6 |
nev | ORG | 6 |
sindbis | ORG | 6 |
pi | CHEMICAL | 6 |
s71 | ORG | 6 |
sds | ORG | 6 |
jcv | ORG | 6 |
kurane | PERSON | 6 |
e2 | CHEMICAL | 6 |
human | TAXON | 6 |
hcv | PERSON | 6 |
h202 | CHEMICAL | 6 |
capobianchi | GPE | 6 |
car | ORG | 6 |
aug | ORG | 6 |
agg | ORG | 6 |
amino acids | CHEMICAL | 6 |
tbi | ORG | 6 |
farabaugh | ORG | 6 |
depressed | DISEASE | 6 |
neuropeptide | CHEMICAL | 6 |
torticollis | GPE | 6 |
swelhng | ORG | 6 |
sodium | CHEMICAL | 6 |
pig | TAXON | 6 |
paralysis | DISEASE | 6 |
trauma | DISEASE | 6 |
pancreatitis | DISEASE | 6 |
organism | TAXON | 6 |
enterocolitis | DISEASE | 6 |
monensin poisoning | CHEMICAL | 6 |
hemorrhagic gastroenteritis | DISEASE | 6 |
fluorescer | DISEASE | 6 |
gel electrophoresis | PERSON | 6 |
metaplasia | GPE | 6 |
hepatitis b | DISEASE | 6 |
individuals | TAXON | 6 |
lucigenin | CHEMICAL | 6 |
tge | ORG | 5 |
ivig | ORG | 5 |
sdav | ORG | 5 |
perussia | GPE | 5 |
nb | ORG | 5 |
nag | ORG | 5 |
mof | ORG | 5 |
mmtv | TAXON | 5 |
kpnl | ORG | 5 |
shine | PERSON | 5 |
hcc | ORG | 5 |
iii | ORG | 5 |
hsv | DISEASE | 5 |
uuu | ORG | 5 |
fmdv | ORG | 5 |
cmv pneumonia | DISEASE | 5 |
cl | GPE | 5 |
animal | TAXON | 5 |
3h ile | ORG | 5 |
32p | CHEMICAL | 5 |
uga | ORG | 5 |
iptg | ORG | 5 |
weiss | GPE | 5 |
infectious diseases | DISEASE | 5 |
xho | PERSON | 5 |
zymosan | TAXON | 5 |
vivo | GPE | 5 |
viral infections | DISEASE | 5 |
viral genome | TAXON | 5 |
trypsin | CHEMICAL | 5 |
swine | TAXON | 5 |
necrosis | DISEASE | 5 |
luminol | CHEMICAL | 5 |
inflammation | DISEASE | 5 |
mebus | GPE | 5 |
heparin | CHEMICAL | 5 |
fed | ORG | 5 |
diarrhea | DISEASE | 5 |
cobalt | CHEMICAL | 5 |
bovine coronavirus | TAXON | 5 |
aplasia | DISEASE | 5 |
acetate | CHEMICAL | 5 |
fowl | TAXON | 5 |
xhol | PERSON | 5 |
lebon | PERSON | 4 |
gomez | ORG | 4 |
hiv infection | DISEASE | 4 |
hepatitis b | DISEASE | 4 |
jhm | ORG | 4 |
jacks et al 1988a | PERSON | 4 |
klebsiella | PERSON | 4 |
mycoplasmal | TAXON | 4 |
mayer | PERSON | 4 |
murine | TAXON | 4 |
el | ORG | 4 |
neonatal | GPE | 4 |
occurnng acid | CHEMICAL | 4 |
percoll | ORG | 4 |
philippsen | ORG | 4 |
gafford | GPE | 4 |
eae | ORG | 4 |
eibl | CHEMICAL | 4 |
ehrlich | ORG | 4 |
ec | ORG | 4 |
cmv infection | DISEASE | 4 |
briggs | PERSON | 4 |
bhk | ORG | 4 |
austria | GPE | 4 |
aspergillus rhinitis | DISEASE | 4 |
animals | TAXON | 4 |
acad sci usa | PERSON | 4 |
abb | PERSON | 4 |
aug codon | CHEMICAL | 4 |
aag | ORG | 4 |
3h phe | CHEMICAL | 4 |
prv | ORG | 4 |
amann | PERSON | 4 |
plasmid | PERSON | 4 |
sall | ORG | 4 |
proton | PERSON | 4 |
kd | GPE | 4 |
murine coronavirus | TAXON | 4 |
necrotizing enterocolitis | DISEASE | 4 |
pcp62dhfr | ORG | 4 |
porcine | TAXON | 4 |
porphyrins | CHEMICAL | 4 |
respiratory distress syndrome | DISEASE | 4 |
hypoxia | DISEASE | 4 |
tyrosine | CHEMICAL | 4 |
uracil | CHEMICAL | 4 |
viral infection | DISEASE | 4 |
viral proteins | TAXON | 4 |
virus proteins | TAXON | 4 |
sendai virus infection | DISEASE | 4 |
iron | CHEMICAL | 4 |
weight gain | DISEASE | 4 |
hepatitis a | DISEASE | 4 |
angiotensin | CHEMICAL | 4 |
exudate | DISEASE | 4 |
uk | GPE | 4 |
vsv | TAXON | 4 |
vienna | GPE | 4 |
adenovirus | TAXON | 4 |
al 1988 | PERSON | 4 |
sera | PERSON | 4 |
biotin | CHEMICAL | 4 |
carcinogenesis | DISEASE | 4 |
codon | PERSON | 4 |
death | DISEASE | 4 |
botulinum a | CHEMICAL | 4 |
dihydrofolate | CHEMICAL | 4 |
mhv | TAXON | 3 |
na acetate | CHEMICAL | 3 |
mrad | ORG | 3 |
mouse | TAXON | 3 |
monensln | PERSON | 3 |
membrane | ORG | 3 |
ll | GPE | 3 |
m44 | ORG | 3 |
lung | PERSON | 3 |
laude 1988 | PERSON | 3 |
lps | ORG | 3 |
jhmv infected | DISEASE | 3 |
nacl | CHEMICAL | 3 |
ips | ORG | 3 |
influenza | PERSON | 3 |
pvm | ORG | 3 |
newcastle | GPE | 3 |
newcastle disease | ORG | 3 |
pah | CHEMICAL | 3 |
pbmc | ORG | 3 |
ppkm | ORG | 3 |
prcv infection | DISEASE | 3 |
payne | PERSON | 3 |
psti | ORG | 3 |
roi | ORG | 3 |
rodents | TAXON | 3 |
st | ORG | 3 |
side | ORG | 3 |
smerwt | ORG | 3 |
sorensen | PERSON | 3 |
hsv ag | CHEMICAL | 3 |
hughes | ORG | 3 |
dhpg | ORG | 3 |
hjc | ORG | 3 |
hbsag | CHEMICAL | 3 |
sperm | PERSON | 3 |
3h leucine | CHEMICAL | 3 |
ab | ORG | 3 |
asw | ORG | 3 |
amerlite | ORG | 3 |
bnlfi | ORG | 3 |
bailey | PERSON | 3 |
bovine coronavirus | TAXON | 3 |
brierley et al | PERSON | 3 |
cmvseronegative | ORG | 3 |
ca 2 | ORG | 3 |
ca2 | CHEMICAL | 3 |
clostridia | PERSON | 3 |
clostridium | GPE | 3 |
cscl | LOC | 3 |
damp | ORG | 3 |
davis | PERSON | 3 |
dengue | GPE | 3 |
drosophila | TAXON | 3 |
dystonia | GPE | 3 |
eco ri | ORG | 3 |
ecorv | GPE | 3 |
ehrlich ascites | DISEASE | 3 |
eibl | PERSON | 3 |
encephalitis | DISEASE | 3 |
equine | PERSON | 3 |
fleming | ORG | 3 |
gln | ORG | 3 |
hav | ORG | 3 |
spasmodic torticollis | PERSON | 3 |
viral diseases | DISEASE | 3 |
sturman | PERSON | 3 |
rabbits | TAXON | 3 |
infectious complications | DISEASE | 3 |
influenza | ORG | 3 |
leukemia | DISEASE | 3 |
mammals | TAXON | 3 |
man | TAXON | 3 |
nephrotoxicity | DISEASE | 3 |
osmium | CHEMICAL | 3 |
oxalic acid | CHEMICAL | 3 |
paralytic demyelinating disease | DISEASE | 3 |
phenylalanine | CHEMICAL | 3 |
poisoned | CHEMICAL | 3 |
posttraumatic | DISEASE | 3 |
propylene oxide | CHEMICAL | 3 |
rabbit reticulocyte | TAXON | 3 |
respiratory disease | DISEASE | 3 |
hydrazine | CHEMICAL | 3 |
rhinitis | DISEASE | 3 |
rhinovirus | TAXON | 3 |
sera | PERSON | 3 |
spasmodic dysphonia | DISEASE | 3 |
trans golgi | ORG | 3 |
tunicamycin | CHEMICAL | 3 |
urea | CHEMICAL | 3 |
viral membrane proteins | TAXON | 3 |
viral protein | TAXON | 3 |
viremia | DISEASE | 3 |
virus infection | DISEASE | 3 |
vitro | PERSON | 3 |
weight loss | DISEASE | 3 |
swollen | ORG | 3 |
idiopathic spasmodic torticollis | DISEASE | 3 |
simian | TAXON | 3 |
host animal | TAXON | 3 |
capitis | DISEASE | 3 |
tyb | ORG | 3 |
herpes | DISEASE | 3 |
uau | ORG | 3 |
ucg | ORG | 3 |
uuc | ORG | 3 |
weiner | ORG | 3 |
yeast | TAXON | 3 |
acetone | CHEMICAL | 3 |
al 1985 | PERSON | 3 |
amines | CHEMICAL | 3 |
ampicillin | CHEMICAL | 3 |
arginine | CHEMICAL | 3 |
asparagine | CHEMICAL | 3 |
calves | TAXON | 3 |
acz | ORG | 3 |
cardiac myocyte degeneration | DISEASE | 3 |
electron | ORG | 3 |
guinea pigs | TAXON | 3 |
guinea pig | TAXON | 3 |
chemiluminescence | CHEMICAL | 3 |
gram | PERSON | 3 |
fungal rhinitis | DISEASE | 3 |
formaldehyde | CHEMICAL | 3 |
encephalomyelitis | DISEASE | 3 |
deaths | DISEASE | 3 |
cyclophosphamide | CHEMICAL | 3 |
coronaviruses | TAXON | 3 |
chronic disease | DISEASE | 3 |
chicken | TAXON | 3 |
lesions | PERSON | 2 |
le | GPE | 2 |
mdbk | PERSON | 2 |
leu codon | CHEMICAL | 2 |
lysosomal | PERSON | 2 |
maw | ORG | 2 |
md usa | ORG | 2 |
laude 1981 | PERSON | 2 |
mda | ORG | 2 |
moore | PERSON | 2 |
mann whitney | PERSON | 2 |
med j aust | GPE | 2 |
mewhinney | PERSON | 2 |
mierendorf | PERSON | 2 |
monensm | PERSON | 2 |
mt | PERSON | 2 |
mycoplasrna | GPE | 2 |
lgl | ORG | 2 |
n terminal amino acid | CHEMICAL | 2 |
nadph | ORG | 2 |
lmp | ORG | 2 |
infected bfs | GPE | 2 |
l 35s methionine | ORG | 2 |
knobler | PERSON | 2 |
nrs | ORG | 2 |
hv | PERSON | 2 |
ibv | ORG | 2 |
ipv | ORG | 2 |
ig iga | ORG | 2 |
immune | LOC | 2 |
immunoelectron | ORG | 2 |
infectious diseases | DISEASE | 2 |
infectivity | ORG | 2 |
inhtbltlon | PERSON | 2 |
interferon | ORG | 2 |
iron | ORG | 2 |
its | ORG | 2 |
jc | GPE | 2 |
jhmv 2 2 v 1 | ORG | 2 |
jhmv infection | DISEASE | 2 |
jacks | GPE | 2 |
jersey18176 | GPE | 2 |
kirchner | PERSON | 2 |
nd | GPE | 2 |
raji | GPE | 2 |
na h | ORG | 2 |
peter | PERSON | 2 |
proc natl | PERSON | 2 |
proline | ORG | 2 |
protosol | ORG | 2 |
pullman wa usa | PERSON | 2 |
ritc | CHEMICAL | 2 |
rv | ORG | 2 |
heparin | ORG | 2 |
results | PERSON | 2 |
robert weiss | PERSON | 2 |
robinson | PERSON | 2 |
rothman | PERSON | 2 |
rustan | GPE | 2 |
s71 s | GPE | 2 |
sda | ORG | 2 |
sdav infection | DISEASE | 2 |
srp | ORG | 2 |
srv | ORG | 2 |
sspe | DISEASE | 2 |
salmon 1979 | ORG | 2 |
porcine | ORG | 2 |
pescovitz | PERSON | 2 |
nasal | PERSON | 2 |
perkin elmer cetus | ORG | 2 |
nearophysin | LOC | 2 |
newcomb | PERSON | 2 |
neweomb | ORG | 2 |
nl | GPE | 2 |
non | PERSON | 2 |
northern | LOC | 2 |
northern blot | LOC | 2 |
novikoff | PERSON | 2 |
orf | ORG | 2 |
orci | GPE | 2 |
oser | PERSON | 2 |
osmium | GPE | 2 |
pge 1 injury | ORG | 2 |
pgei | ORG | 2 |
pha | ORG | 2 |
prcv | CHEMICAL | 2 |
pth amino acids | CHEMICAL | 2 |
padilla lugo | PERSON | 2 |
perinatal | ORG | 2 |
herpes simplex virus type 1 | TAXON | 2 |
eseherichia | ORG | 2 |
hemidystonia | GPE | 2 |
bartlett | PERSON | 2 |
bergen | ORG | 2 |
bovine | TAXON | 2 |
cca | DISEASE | 2 |
cd8 | ORG | 2 |
cmv infections | DISEASE | 2 |
cns | ORG | 2 |
cuu leu | ORG | 2 |
calcium | CHEMICAL | 2 |
cancer | DISEASE | 2 |
candida | TAXON | 2 |
cardiovascular disease | PERSON | 2 |
chehimi | PERSON | 2 |
chemiluminescence | DISEASE | 2 |
clsterna | PERSON | 2 |
cohn fraction ii | ORG | 2 |
collins | ORG | 2 |
concentrahon | PERSON | 2 |
conformations | ORG | 2 |
corona | GPE | 2 |
batenburg | GPE | 2 |
bamhi kpnl | PERSON | 2 |
heckman | PERSON | 2 |
balb | PERSON | 2 |
scharmann | PERSON | 2 |
a23187 | ORG | 2 |
aaa | ORG | 2 |
ag | CHEMICAL | 2 |
aids | DISEASE | 2 |
atg | ORG | 2 |
acridine | GPE | 2 |
alussr | ORG | 2 |
alan scott | PERSON | 2 |
amino acid | CHEMICAL | 2 |
apgar | PERSON | 2 |
aplysia californica | TAXON | 2 |
asn 3 | ORG | 2 |
asp | ORG | 2 |
atomic energy of canada ltd | ORG | 2 |
azodicarbonamide | CHEMICAL | 2 |
balf | ORG | 2 |
bhv | ORG | 2 |
brlfi | ORG | 2 |
coxsackie | TAXON | 2 |
crine | PERSON | 2 |
cutler | PERSON | 2 |
da | CHEMICAL | 2 |
gly | CHEMICAL | 2 |
glycine | PERSON | 2 |
gnfflng | PERSON | 2 |
golg | PERSON | 2 |
golgx | CHEMICAL | 2 |
grifiiths | ORG | 2 |
ha hi | ORG | 2 |
hbs antigen | PERSON | 2 |
hbs vaccine | CHEMICAL | 2 |
hcmv | ORG | 2 |
hd | DISEASE | 2 |
hem | ORG | 2 |
his4a | CHEMICAL | 2 |
hiv antibodies | TAXON | 2 |
hmpa | ORG | 2 |
hsv infection | DISEASE | 2 |
hantaan | PERSON | 2 |
hashimoto | DISEASE | 2 |
helz | LOC | 2 |
gamma | ORG | 2 |
gp | GPE | 2 |
gev | ORG | 2 |
electron | ORG | 2 |
dpa | CHEMICAL | 2 |
dengue virus | TAXON | 2 |
dianzani | GPE | 2 |
digitalis | PERSON | 2 |
dobberstein | PERSON | 2 |
enx | GPE | 2 |
ehrlich ascites tumor | DISEASE | 2 |
ehrlich mouse | TAXON | 2 |
encephalitis virus | TAXON | 2 |
foki | ORG | 2 |
epstein barr | PERSON | 2 |
escherwhia | PERSON | 2 |
etbr | CHEMICAL | 2 |
experimental procedures | ORG | 2 |
fmlp | CHEMICAL | 2 |
fallis | GPE | 2 |
fe | ORG | 2 |
ferric | PERSON | 2 |
sandberg | ORG | 2 |
n linked carbohydrate | CHEMICAL | 2 |
schurig | CHEMICAL | 2 |
murine viruses | TAXON | 2 |
methylene chloride | CHEMICAL | 2 |
ml | PERSON | 2 |
mltochondrla | ORG | 2 |
molecules | PERSON | 2 |
monensin fccp | PERSON | 2 |
monensin prohormone | ORG | 2 |
mouse cells | TAXON | 2 |
mouse coronavirus | TAXON | 2 |
murine cells | TAXON | 2 |
mycoplasmal | TAXON | 2 |
grain | DISEASE | 2 |
myocardial damage | DISEASE | 2 |
neutrophil | GPE | 2 |
nitrate | CHEMICAL | 2 |
nodes | CHEMICAL | 2 |
nonsense codon | CHEMICAL | 2 |
outbreaks | TAXON | 2 |
pgem2alphagx | ORG | 2 |
pgem2dhfr | ORG | 2 |
pgem2dhfr zerial | ORG | 2 |
mammalian cells | TAXON | 2 |
mammalian | TAXON | 2 |
lung lesions | DISEASE | 2 |
liposomes | TAXON | 2 |
guanine | CHEMICAL | 2 |
haemochromatosis | DISEASE | 2 |
halothane | CHEMICAL | 2 |
hemolysis | DISEASE | 2 |
histamine | CHEMICAL | 2 |
horse | TAXON | 2 |
host | TAXON | 2 |
human lymphocytes | TAXON | 2 |
humans | TAXON | 2 |
hyperactive | DISEASE | 2 |
hyperplasia | DISEASE | 2 |
influenza virus infected | DISEASE | 2 |
involuntary movements | DISEASE | 2 |
jejunum ileum | PERSON | 2 |
kanamycin | CHEMICAL | 2 |
lactate | CHEMICAL | 2 |
lambs | TAXON | 2 |
lethargy | DISEASE | 2 |
lipopolysaccharide | CHEMICAL | 2 |
pmb38 smerwt | CHEMICAL | 2 |
papillomavirus | TAXON | 2 |
paraparesis | DISEASE | 2 |
the u s department of health and human services | ORG | 2 |
thymidine | CHEMICAL | 2 |
thyroxine | CHEMICAL | 2 |
trans membrane exchange of sodium | ORG | 2 |
transferrin | CHEMICAL | 2 |
tryptophan | GPE | 2 |
ts | TAXON | 2 |
tumors | DISEASE | 2 |
tumour | DISEASE | 2 |
type ii cell hyperplasia | DISEASE | 2 |
viral dna | TAXON | 2 |
viral enteritis | DISEASE | 2 |
virally | TAXON | 2 |
viruria | CHEMICAL | 2 |
virus protein | TAXON | 2 |
yeast genes | TAXON | 2 |
yeast genome | TAXON | 2 |
yeast mitochondria | TAXON | 2 |
schurig 1986 | PERSON | 2 |
zinc | CHEMICAL | 2 |
thexhol | ORG | 2 |
the new england journal of medicine 17 | ORG | 2 |
peptide asn | CHEMICAL | 2 |
the hybridization protection | ORG | 2 |
pneumatosis | DISEASE | 2 |
potassium permanganate | CHEMICAL | 2 |
propiolactone | CHEMICAL | 2 |
prostaglandin e1 | CHEMICAL | 2 |
pulmonary lesions | DISEASE | 2 |
rabbit antibody | TAXON | 2 |
rat hepatocytes | TAXON | 2 |
reovirus | TAXON | 2 |
respiratory mycoplasmosis | DISEASE | 2 |
retroviral | TAXON | 2 |
retroviruses | TAXON | 2 |
rhesus | TAXON | 2 |
rheumatic diseases | DISEASE | 2 |
ruminants | TAXON | 2 |
sialic acid | CHEMICAL | 2 |
sow | TAXON | 2 |
sulfate | CHEMICAL | 2 |
superoxide | CHEMICAL | 2 |
the bamhi sacl | PERSON | 2 |
guanidinium isothiocyanate | CHEMICAL | 2 |
silver | CHEMICAL | 2 |
goat | TAXON | 2 |
vps | ORG | 2 |
vitamin a | PERSON | 2 |
wasserman | PERSON | 2 |
western blots | LOC | 2 |
shine dalgarno | LOC | 2 |
wistar | ORG | 2 |
yanagashito | GPE | 2 |
acid acetone | CHEMICAL | 2 |
acute infections | DISEASE | 2 |
acyclovir | CHEMICAL | 2 |
agalactia | DISEASE | 2 |
al 1977 | PERSON | 2 |
al 1981 | PERSON | 2 |
aldehyde | CHEMICAL | 2 |
aminoglycoside | CHEMICAL | 2 |
ammonia | GPE | 2 |
angiotensinogen | ORG | 2 |
animal viruses | TAXON | 2 |
aplastic anemia | DISEASE | 2 |
asthma | DISEASE | 2 |
viruses | TAXON | 2 |
vn | ORG | 2 |
bacterium | TAXON | 2 |
uua codon | CHEMICAL | 2 |
sigma chemical co | ORG | 2 |
glioma | DISEASE | 2 |
sindbis virus | TAXON | 2 |
slovak | GPE | 2 |
sltu | ORG | 2 |
smith | PERSON | 2 |
srinlvas | ORG | 2 |
sticher | PERSON | 2 |
stohlman | PERSON | 2 |
sussman | LOC | 2 |
tgev infected glutaraldehyde | DISEASE | 2 |
tsb | ORG | 2 |
texas | GPE | 2 |
tfirk | ORG | 2 |
tiibingen | CHEMICAL | 2 |
toxicity | DISEASE | 2 |
ty vlp | ORG | 2 |
u s a | CHEMICAL | 2 |
us | GPE | 2 |
bacteremia | DISEASE | 2 |
theiler | ORG | 2 |
benzo a pyrene | CHEMICAL | 2 |
crystalline | CHEMICAL | 2 |
demyelinating disease | DISEASE | 2 |
dermatitis | DISEASE | 2 |
diphtheria | DISEASE | 2 |
dog | TAXON | 2 |
dogs | TAXON | 2 |
dysphagia | ORG | 2 |
dysplasia | GPE | 2 |
dystonias | DISEASE | 2 |
dystonias clostridium | PERSON | 2 |
egg laying hormone | TAXON | 2 |
fungal infection | DISEASE | 2 |
fungi | TAXON | 2 |
gill | ORG | 2 |
gamma globulin | CHEMICAL | 2 |
gastrointestinal disease | DISEASE | 2 |
gastrointestinal infection | DISEASE | 2 |
bias | CHEMICAL | 2 |
genital herpes | DISEASE | 2 |
glii | ORG | 2 |
demyelinating | DISEASE | 2 |
enteroviruses | DISEASE | 2 |
coxsackievirus | TAXON | 2 |
cholera | DISEASE | 2 |
biotinlstreptavidin | PERSON | 2 |
biotin streptavidin | PERSON | 2 |
coronavirus infection | DISEASE | 2 |
bis | ORG | 2 |
blepharospasm | DISEASE | 2 |
blindness | DISEASE | 2 |
busulfan | CHEMICAL | 2 |
chicken eggs | TAXON | 2 |
chloroquine | CHEMICAL | 2 |
bovine coronavirus bcv antigen | TAXON | 2 |
cholesterol | CHEMICAL | 2 |
coli | DISEASE | 2 |
chronic gvhd | DISEASE | 2 |
clsternae | DISEASE | 2 |
coccidia | TAXON | 2 |
coccidiostat | CHEMICAL | 2 |
coronavirus glycoprotein el | DISEASE | 2 |
cord_uid | ORG | 2 |
monensm a na | PERSON | 1 |
moneasin | CHEMICAL | 1 |
mollenhauer hilton | PERSON | 1 |
molecular cloning a laboratory manual membrane | ORG | 1 |
mizzen et al | PERSON | 1 |
mm | PERSON | 1 |
mltochondrla | ORG | 1 |
minimal essential medium | ORG | 1 |
mizzen | CHEMICAL | 1 |
minnesota | GPE | 1 |
mikrobiologie u immunologie | CHEMICAL | 1 |
monheim | CHEMICAL | 1 |
monenstn | PERSON | 1 |
murray 1965 | ORG | 1 |
monoperoxyoxalate | CHEMICAL | 1 |
morr6 d m and kartenbeck j unpubhshed data _ | CHEMICAL | 1 |
mr b n j | CHEMICAL | 1 |
n d f 1986 a | CHEMICAL | 1 |
mr b n j parker | ORG | 1 |
mrs r pearce | PERSON | 1 |
muenchi | DISEASE | 1 |
munich | GPE | 1 |
muscle weakness | DISEASE | 1 |
mycoplasmal infections disease | DISEASE | 1 |
n 2 hydroxyethylpiperazine n zethanesulfonic acid | CHEMICAL | 1 |
n a | CHEMICAL | 1 |
n a gulati | CHEMICAL | 1 |
microsome | PERSON | 1 |
n b l frameshift reporter plasmid pmb38 | CHEMICAL | 1 |
midwest research institute | ORG | 1 |
mel nikova | PERSON | 1 |
microdol x eastman kodak co | ORG | 1 |
microb | ORG | 1 |
massa | PERSON | 1 |
n zethanesulfonic | ORG | 1 |
mature | PERSON | 1 |
max v | PERSON | 1 |
mayeri | PERSON | 1 |
mayeri et al | PERSON | 1 |
maynard olson | PERSON | 1 |
meade | PERSON | 1 |
med mikrobiologie | PERSON | 1 |
med virologie | PERSON | 1 |
medinsky el | PERSON | 1 |
meige | PERSON | 1 |
melancon | PERSON | 1 |
melroy | GPE | 1 |
menschikowski m | CHEMICAL | 1 |
menschikowski m kacian | PERSON | 1 |
mernikova | PERSON | 1 |
met | ORG | 1 |
metabohc | GPE | 1 |
methylene | PERSON | 1 |
methylene chloride | CHEMICAL | 1 |
mewhinney et al | PERSON | 1 |
mfinchen | CHEMICAL | 1 |
mgci2 | CHEMICAL | 1 |
mgso4 | CHEMICAL | 1 |
miami | GPE | 1 |
miami 63theq2neq2 | GPE | 1 |
michael baron | PERSON | 1 |
microfluor dynatech | ORG | 1 |
n nv | PERSON | 1 |
nmethyldlpropylamine damp | CHEMICAL | 1 |
n acetyl glycosaminyl residues 111 | CHEMICAL | 1 |
od660 | CHEMICAL | 1 |
nesmayanova | ORG | 1 |
neubauer | ORG | 1 |
neurohormonal | ORG | 1 |
neutrophilic | ORG | 1 |
newbor | CHEMICAL | 1 |
newcastle disease | DISEASE | 1 |
newton | GPE | 1 |
niemann | PERSON | 1 |
nonsynaptic characteristics of neurotransmission | ORG | 1 |
northern blots | LOC | 1 |
northern blots | LOC | 1 |
nucleotide | ORG | 1 |
nytran | ORG | 1 |
o2 | CHEMICAL | 1 |
ooo | ORG | 1 |
n asparagine hnked oligosacchandes | CHEMICAL | 1 |
occupational | ORG | 1 |
oliver 1977 | PERSON | 1 |
olson m v page g s sentenac a piper f w worthington m weiss | ORG | 1 |
olson et al 1977 | ORG | 1 |
ono et al 189 | PERSON | 1 |
oppenheim | ORG | 1 |
organ | ORG | 1 |
organization of the colicin | ORG | 1 |
orlik eisel | PERSON | 1 |
ortho diagnostics 2 | PERSON | 1 |
other codons decoded by rare | ORG | 1 |
ottawa canada | ORG | 1 |
marnell | PERSON | 1 |
ottawa canada use | ORG | 1 |
neq2 | ORG | 1 |
nembutal | ORG | 1 |
necrotizing enterocolitis necrotizing enterocolitis | DISEASE | 1 |
necrotizing enterocolitis | DISEASE | 1 |
n formyl l methionyl l leucyl l phenylalanine fmlp | CHEMICAL | 1 |
n linked glycosylation | CHEMICAL | 1 |
n linked oligosaccharide | CHEMICAL | 1 |
n linked oligosaccharides | CHEMICAL | 1 |
n terminal met residue taq | CHEMICAL | 1 |
n terminal amino acids | CHEMICAL | 1 |
n2 | PERSON | 1 |
na clare | ORG | 1 |
nb ty | PERSON | 1 |
nec animal | ORG | 1 |
nec ninety | ORG | 1 |
nheterminus | ORG | 1 |
nih | ORG | 1 |
nk hsv fs | LOC | 1 |
ns1 ns2a | PERSON | 1 |
ntp | CHEMICAL | 1 |
nwa | ORG | 1 |
na acetate | CHEMICAL | 1 |
na ci | ORG | 1 |
na h exchange | ORG | 1 |
na k | CHEMICAL | 1 |
nahco | CHEMICAL | 1 |
naoh | ORG | 1 |
nathanson 1979 | ORG | 1 |
naturally occurnng acid ionophores | ORG | 1 |
ncoi | ORG | 1 |
ndel | PERSON | 1 |
necropsy | ORG | 1 |
necrosis | DISEASE | 1 |
martin kräuter | PERSON | 1 |
kartenbeck j | PERSON | 1 |
margareta berg | PERSON | 1 |
khorana h g 1967 | ORG | 1 |
k 1979 | CHEMICAL | 1 |
k e | CHEMICAL | 1 |
k golgi | ORG | 1 |
k contalnlng isotomc | ORG | 1 |
k6ck | PERSON | 1 |
kai | CHEMICAL | 1 |
kadner | PERSON | 1 |
kahn | PERSON | 1 |
kamani | PERSON | 1 |
outcome | ORG | 1 |
kauer | GPE | 1 |
kelemen | PERSON | 1 |
kendall | PERSON | 1 |
kflberg | GPE | 1 |
kimura 1988 | PERSON | 1 |
l 2 3 4 5 6 3h phenylalanine 3h phe amersham corp | CHEMICAL | 1 |
king | ORG | 1 |
klebsiella 29 | PERSON | 1 |
klebsiella salmonella | PERSON | 1 |
klein | PERSON | 1 |
klenk 1980 rabbit | ORG | 1 |
kluftinger | PERSON | 1 |
kodak | ORG | 1 |
kornfeld | PERSON | 1 |
kornfeld 1985 | PERSON | 1 |
koszinowski 1984 | PERSON | 1 |
kovac et al 28 | PERSON | 1 |
kreiner | ORG | 1 |
kubo | PERSON | 1 |
kupfermann 1967 | PERSON | 1 |
journal of neuroimmunology | ORG | 1 |
jonjic | PERSON | 1 |
jones el al 1985 | PERSON | 1 |
jonas e | DISEASE | 1 |
ingrid sigurdson | PERSON | 1 |
inhalation of the important | ORG | 1 |
injury | DISEASE | 1 |
injury severity | PERSON | 1 |
inst of virology | ORG | 1 |
intracellular | ORG | 1 |
intracnstae | PERSON | 1 |
irradiation | LOC | 1 |
ischemia | PERSON | 1 |
j cell biol doi nan | PERSON | 1 |
j d boeke | PERSON | 1 |
j and fink g r | ORG | 1 |
jhm jhmv | PERSON | 1 |
jhm virus microb | DISEASE | 1 |
jhmv 2 2 v 1 i c on day 0 and irradiated on day 6 p i | CHEMICAL | 1 |
jhmv 2 2 v 1 i p 6 days | CHEMICAL | 1 |
jhmv strain jhmv ds | DISEASE | 1 |
jhmv variant 2 2 v 1 cohol | DISEASE | 1 |
jackson laboratories | ORG | 1 |
james morré | PERSON | 1 |
jankovic | PERSON | 1 |
janssen life sciences | ORG | 1 |
japan | GPE | 1 |
jensen 1988 | PERSON | 1 |
jestin | PERSON | 1 |
jl | PERSON | 1 |
johanna wahlberg | PERSON | 1 |
john o | PERSON | 1 |
johnson | PERSON | 1 |
kyuwa 1990 | ORG | 1 |
l ala l ala l pro l val pnitroanilide | CHEMICAL | 1 |
mannhelm | CHEMICAL | 1 |
ma | ORG | 1 |
liver | LOC | 1 |
liver damage | DISEASE | 1 |
llmd of mice loeb | ORG | 1 |
lodish | GPE | 1 |
lodish 1977 | ORG | 1 |
lodish 1986 zerial | ORG | 1 |
lodish 1988 rothman | ORG | 1 |
louisiana state university | ORG | 1 |
love | GPE | 1 |
loyd d title | PERSON | 1 |
lux scientific corporation | ORG | 1 |
lymphocyte | ORG | 1 |
lynch | DISEASE | 1 |
m9minimal | TAXON | 1 |
ma 104 cell | ORG | 1 |
l0861 | ORG | 1 |
marcus | CHEMICAL | 1 |
mcv | ORG | 1 |
mdtq da | ORG | 1 |
mem | ORG | 1 |
metzler | CHEMICAL | 1 |
mhv ectro | PERSON | 1 |
mof granulocytes | ORG | 1 |
mrm | ORG | 1 |
msl | ORG | 1 |
madin | GPE | 1 |
madison wi | PERSON | 1 |
malloy 1938 acetylcholinesterase | ORG | 1 |
mankovich | DISEASE | 1 |
mannent nwna | ORG | 1 |
lipp | PERSON | 1 |
ligaya | PERSON | 1 |
liao | GPE | 1 |
lewis | PERSON | 1 |
l1 | PERSON | 1 |
l4 ilford ltd | ORG | 1 |
lb | GPE | 1 |
lbmedium | CHEMICAL | 1 |
lcl | ORG | 1 |
leup | ORG | 1 |
llc | ORG | 1 |
ln | GPE | 1 |
la | PERSON | 1 |
la bonnardiere | PERSON | 1 |
laboratory | ORG | 1 |
lactate | CHEMICAL | 1 |
lampert | PERSON | 1 |
lampert 1975 | PERSON | 1 |
lampert et al 1973 | PERSON | 1 |
lapps | PERSON | 1 |
laude 1988 antibody | PERSON | 1 |
laurie 1988 | PERSON | 1 |
lawrence t sanders | PERSON | 1 |
leaf | ORG | 1 |
leaky l | PERSON | 1 |
ledger | PERSON | 1 |
lee et al | PERSON | 1 |
leitz | PERSON | 1 |
leu arg | PERSON | 1 |
leu arg his through the frameshift site figure 38 another | CHEMICAL | 1 |
leu gly his figure 3a | CHEMICAL | 1 |
leucine | CHEMICAL | 1 |
leuko pak leukocyte filter fenwal travenol | ORG | 1 |
ou et | GPE | 1 |
ray | PERSON | 1 |
p26 | ORG | 1 |
sinai | ORG | 1 |
sendai virus infected | DISEASE | 1 |
sendai virus rat cornavirus | TAXON | 1 |
sequenase united states biochemical co | ORG | 1 |
serous | PERSON | 1 |
shanthi | CHEMICAL | 1 |
shaw | PERSON | 1 |
sheep | TAXON | 1 |
sialodacyoadenitis virus infection upper respiratory tract | DISEASE | 1 |
sigma mfinchen frg bacterial | PERSON | 1 |
signal | ORG | 1 |
similarly marsh | PERSON | 1 |
similarly niemann | PERSON | 1 |
similarly sutko | PERSON | 1 |
simonsen laboratories inc gilroy ca rats | ORG | 1 |
sinbis | CHEMICAL | 1 |
southern and northern | LOC | 1 |
sindbis viral | TAXON | 1 |
sindbis virus capsid protein | TAXON | 1 |
sindbis virus glycoprotein e3 | TAXON | 1 |
sindbis virus mutants | TAXON | 1 |
single | ORG | 1 |
slippery | ORG | 1 |
sloan kettering | PERSON | 1 |
smai nick | PERSON | 1 |
smbis | CHEMICAL | 1 |
smer | PERSON | 1 |
sodium | CHEMICAL | 1 |
somatomammotrophs fumagalli | ORG | 1 |
sosa ferrera | PERSON | 1 |
sossin | CHEMICAL | 1 |
sendai virus disease | DISEASE | 1 |
semllkl forest virus | ORG | 1 |
semlikl forest | ORG | 1 |
semlikl | CHEMICAL | 1 |
srp bonatti et al | ORG | 1 |
ssa | CHEMICAL | 1 |
ssv | ORG | 1 |
stopps | DISEASE | 1 |
sv40 | TAXON | 1 |
sac | GPE | 1 |
saccharomyces | TAXON | 1 |
saccharomyces cereotslae | CHEMICAL | 1 |
saccharomyces cerevisiae | TAXON | 1 |
saif | PERSON | 1 |
salmon et al | PERSON | 1 |
salmonella | PERSON | 1 |
saltpeter | LOC | 1 |
sanger et al 1977 computer | ORG | 1 |
scheller | DISEASE | 1 |
scheller 1987 | ORG | 1 |
schering ltd | ORG | 1 |
schlessinger | PERSON | 1 |
schuell inc keene nh | ORG | 1 |
schwarz | GPE | 1 |
science accessories corp southport | ORG | 1 |
sea life supply sand city ca bag | ORG | 1 |
section virology | ORG | 1 |
selecta frigitherm | PERSON | 1 |
selikhova | ORG | 1 |
selikhova 1965 anorexia | ORG | 1 |
semhki forest | ORG | 1 |
semliki | ORG | 1 |
semliki forest virus membrane glycoproteins | TAXON | 1 |
southern blot | ORG | 1 |
spanjaard | DISEASE | 1 |
page | ORG | 1 |
ta 0 | LOC | 1 |
tcidso | CHEMICAL | 1 |
tft | ORG | 1 |
tge bay et al 1953 | LOC | 1 |
tge saif | ORG | 1 |
tgev colostrum | ORG | 1 |
tgev hooyberghs et al 1988 | ORG | 1 |
tgev sendai ndv | ORG | 1 |
tgev infected | DISEASE | 1 |
thomas nowak | PERSON | 1 |
tk mrnas | ORG | 1 |
tlloo | CHEMICAL | 1 |
tsa | CHEMICAL | 1 |
tx | ORG | 1 |
ta | PERSON | 1 |
table 7 missense | ORG | 1 |
spasmodic | PERSON | 1 |
table iii | PERSON | 1 |
taken | GPE | 1 |
tanzer 1 | ORG | 1 |
taq | TAXON | 1 |
tartakoff 1983 | ORG | 1 |
thas | LOC | 1 |
the iowa state university press induction | ORG | 1 |
the journal of cell biology volume | ORG | 1 |
the xho i pvu | PERSON | 1 |
thomas | GPE | 1 |
thomas bohlmann | PERSON | 1 |
thompson | GPE | 1 |
thyberg 76 | ORG | 1 |
induction of interferon alpha | ORG | 1 |
tca precipitable | CHEMICAL | 1 |
tca | ORG | 1 |
tc | GPE | 1 |
tacct tcccgtc | PERSON | 1 |
spontaneous | LOC | 1 |
spray | PERSON | 1 |
spurr | GPE | 1 |
staphylococcus epidermidis | DISEASE | 1 |
statsoft | PERSON | 1 |
steihrn | CHEMICAL | 1 |
stell | PERSON | 1 |
stimulating | LOC | 1 |
storz | PERSON | 1 |
strain abl143 | ORG | 1 |
strains | ORG | 1 |
strauss | PERSON | 1 |
streptococcus | GPE | 1 |
streptomvces | ORG | 1 |
struncated | CHEMICAL | 1 |
subcellular | ORG | 1 |
sucking | PERSON | 1 |
surface | ORG | 1 |
suzumura | GPE | 1 |
suzumura a | PERSON | 1 |
swedish national board for technical development | ORG | 1 |
swedish natural science research council b bu | ORG | 1 |
sweet a | DISEASE | 1 |
swelling | DISEASE | 1 |
switzerland | GPE | 1 |
synchronized | GPE | 1 |
t lymphoma | DISEASE | 1 |
t lytic disease | DISEASE | 1 |
t4 polynucleotide | CHEMICAL | 1 |
soclated | ORG | 1 |
sgatccgctgacactt gcca | PERSON | 1 |
sfv plasmid | TAXON | 1 |
polykaryocytosis | GPE | 1 |
phe amersham corp | ORG | 1 |
phe bag | PERSON | 1 |
philip j | ORG | 1 |
philippsen m olson and g fink | ORG | 1 |
philips electronic instruments inc bag | ORG | 1 |
philips electronic instruments inc mahwah nj micrographs | ORG | 1 |
pigeon | ORG | 1 |
piglet | GPE | 1 |
plasma | PERSON | 1 |
plasmid pgem2alphag | ORG | 1 |
plasmids | GPE | 1 |
pnyc | PERSON | 1 |
pol 1989 | PERSON | 1 |
polmar | PERSON | 1 |
positive ha | PERSON | 1 |
sfv pgem2alphagx | PERSON | 1 |
posttraumatic | DISEASE | 1 |
potassium magnesium | CHEMICAL | 1 |
powell | PERSON | 1 |
prrhk | CHEMICAL | 1 |
prrhk african | PERSON | 1 |
pry | LOC | 1 |
prior | ORG | 1 |
processing | ORG | 1 |
promega | GPE | 1 |
proton | PERSON | 1 |
protosorb promega biotec | PERSON | 1 |
pseudomonas aerugo osa coronavirus glycoprotein el | DISEASE | 1 |
pseudomonas aerugblosa | DISEASE | 1 |
pseudomonas aeruginosa amino terminal | DISEASE | 1 |
phe 5 rain pulse | CHEMICAL | 1 |
phe 5 rain | CHEMICAL | 1 |
phe 5 min pulse plus 1 h | CHEMICAL | 1 |
pharmacia freiburg frg | PERSON | 1 |
pbl human | ORG | 1 |
pge | CHEMICAL | 1 |
pge 1 | ORG | 1 |
phllle | ORG | 1 |
porcine cells i5i | ORG | 1 |
ppkm sows | ORG | 1 |
ppo | CHEMICAL | 1 |
pr8 influenza | ORG | 1 |
ps772 | CHEMICAL | 1 |
pvm rcv sda | ORG | 1 |
pvm serum antibody | TAXON | 1 |
pwm | ORG | 1 |
pain | DISEASE | 1 |
paramecmm | ORG | 1 |
paramectum | ORG | 1 |
particular | ORG | 1 |
path tox xybion corp animals | ORG | 1 |
pathology | ORG | 1 |
paton 1989 | ORG | 1 |
payne h | PERSON | 1 |
peach mj | PERSON | 1 |
pen 1988 | PERSON | 1 |
pensaert er af | PERSON | 1 |
peptidyl | PERSON | 1 |
perkin elmer mpf 44a | PERSON | 1 |
peter philippsen | PERSON | 1 |
peyer | ORG | 1 |
ph d | CHEMICAL | 1 |
pharmacia | PERSON | 1 |
pseudomonas aeruginosa cytotoxicity | ORG | 1 |
pseudomonas aeruginosa for | ORG | 1 |
pseudomonas aeruginosa infection | DISEASE | 1 |
results cancer res mycoplasmal | PERSON | 1 |
retroviruses in mobile genetic elements molecular | ORG | 1 |
reviews | PERSON | 1 |
rhizobium | GPE | 1 |
rhizobium meliloti | DISEASE | 1 |
ribosomal | PERSON | 1 |
rice | PERSON | 1 |
richter c b title infectious diseases | DISEASE | 1 |
roa | PERSON | 1 |
robblns 51 | ORG | 1 |
rochester minnesota | ORG | 1 |
rodriguez 1988 | PERSON | 1 |
rome 1983 grifliths | ORG | 1 |
rosenkranz alfred | PERSON | 1 |
ross | PERSON | 1 |
ross river | LOC | 1 |
roth | PERSON | 1 |
rubin | PERSON | 1 |
s cerevisiae | TAXON | 1 |
sa | CHEMICAL | 1 |
sds page | PERSON | 1 |
sds page gel | PERSON | 1 |
sds page samples | ORG | 1 |
sds urea | CHEMICAL | 1 |
sds urea polyacrylamide | CHEMICAL | 1 |
se | DISEASE | 1 |
sfv garoff | PERSON | 1 |
sfv cdna | TAXON | 1 |
sfv dhfr | TAXON | 1 |
sfv l | PERSON | 1 |
retroviridae | ORG | 1 |
respiratory infections | DISEASE | 1 |
pullman wa davis | PERSON | 1 |
resch k brandl | PERSON | 1 |
purified p29 | ORG | 1 |
pyelonephritis | DISEASE | 1 |
pyramimonas | GPE | 1 |
quantitation | PERSON | 1 |
quantitation of proteins | ORG | 1 |
ram s | ORG | 1 |
rf2 scolnick | ORG | 1 |
rm | GPE | 1 |
rna dog | PERSON | 1 |
rpmi | ORG | 1 |
raabe et al 1988 | PERSON | 1 |
rabbit reticulocyte | TAXON | 1 |
rabinowitz 1982 | ORG | 1 |
raine 1984 | CHEMICAL | 1 |
raine 1984 martin | PERSON | 1 |
rajbhandary u l chang | PERSON | 1 |
randerath | PERSON | 1 |
randerath k 1979 | ORG | 1 |
rat | TAXON | 1 |
rat coronavirus | PERSON | 1 |
rauhut | ORG | 1 |
recognition | ORG | 1 |
reed muenchi | PERSON | 1 |
ref 17 | PERSON | 1 |
reichert jung vienna | PERSON | 1 |
reo3 m ad m pulmonis | PERSON | 1 |
reovirus | GPE | 1 |
reovirus type 3 | TAXON | 1 |
reovirus types 1 | TAXON | 1 |
influenza ainew jersey | GPE | 1 |
biomed instruments inc fullerton ca | ORG | 1 |
induction of interferon | ORG | 1 |
cooh | ORG | 1 |
cf | ORG | 1 |
ch 8057 | CHEMICAL | 1 |
cl immunoassay | ORG | 1 |
cli | DISEASE | 1 |
cmh | ORG | 1 |
cmh coronavirus anticorps | ORG | 1 |
cmp | ORG | 1 |
cmp sialic acid | CHEMICAL | 1 |
cmv disease | DISEASE | 1 |
cmv negative blood products | DISEASE | 1 |
cmv seronegative | DISEASE | 1 |
cmv seronegative blood products | DISEASE | 1 |
cmv seropositive blood products | DISEASE | 1 |
cns disease | DISEASE | 1 |
cuu agg | ORG | 1 |
cetus | ORG | 1 |
cuu codon | CHEMICAL | 1 |
cuu codon | CHEMICAL | 1 |
ca 2 tins | ORG | 1 |
caci2 | CHEMICAL | 1 |
caciz | ORG | 1 |
cameron et al | PERSON | 1 |
candida infections | DISEASE | 1 |
canine distemper | ORG | 1 |
canto | ORG | 1 |
caro | PERSON | 1 |
caskey 1969 | PERSON | 1 |
castle | ORG | 1 |
cells | ORG | 1 |
cellular | ORG | 1 |
cel f cbalf | ORG | 1 |
cel | CHEMICAL | 1 |
cd8 mab | ORG | 1 |
cd16 leu 1 lb nk | CHEMICAL | 1 |
biolumat lb | PERSON | 1 |
bioluminescence | ORG | 1 |
tiel virology | ORG | 1 |
biomedical research complications of viral and mycoplasmal infections | ORG | 1 |
biorad | PERSON | 1 |
birnboim | GPE | 1 |
blalock 1983 | ORG | 1 |
blomberg 1979 | ORG | 1 |
blood | ORG | 1 |
blumenthal | PERSON | 1 |
boedtker h | ORG | 1 |
boehringer mannhelm | ORG | 1 |
boehrlnger | PERSON | 1 |
boeke | PERSON | 1 |
bone | ORG | 1 |
bonekamp | ORG | 1 |
bonitz | PERSON | 1 |
bos et al | PERSON | 1 |
bovine coronavirus hemagglutinin | PERSON | 1 |
bovine viral | TAXON | 1 |
brain s | LOC | 1 |
breast milk iga | DISEASE | 1 |
brian | PERSON | 1 |
briefly | PERSON | 1 |
brierley | PERSON | 1 |
burgess | LOC | 1 |
burke et al 1982 | PERSON | 1 |
catg | GPE | 1 |
cbv igm | ORG | 1 |
ceredig et al | GPE | 1 |
cetus corporation | ORG | 1 |
inactivation | ORG | 1 |
dcv kelly 1985 | ORG | 1 |
coxsackievirus b 2 | TAXON | 1 |
csc1 etbr | CHEMICAL | 1 |
curea_balf statistical | ORG | 1 |
curea_plasma | CHEMICAL | 1 |
cyanide | PERSON | 1 |
cytomegalovirus hcmv infections | DISEASE | 1 |
cytotoxic | GPE | 1 |
d 5300 bonn 1 a | CHEMICAL | 1 |
d 6300 | CHEMICAL | 1 |
d beckert r köstler e | CHEMICAL | 1 |
d boeke personal communication a | CHEMICAL | 1 |
d rowe loyd d title | CHEMICAL | 1 |
d xyloside | CHEMICAL | 1 |
dbt | ORG | 1 |
dcv dense | ORG | 1 |
chang | PERSON | 1 |
ddh20 | DISEASE | 1 |
dnpo | CHEMICAL | 1 |
dnase | ORG | 1 |
dth | ORG | 1 |
dakin | PERSON | 1 |
dako copenhagen denmark diethylpyrocarbonate | ORG | 1 |
dales discussion | ORG | 1 |
dalziel | PERSON | 1 |
dandy mckenzie | PERSON | 1 |
danny huylebroeck | PERSON | 1 |
darby | GPE | 1 |
davidson et al 1988 | PERSON | 1 |
dawley | PERSON | 1 |
delta | LOC | 1 |
coxsackie b viruses | ORG | 1 |
coulton | GPE | 1 |
coulson a r | ORG | 1 |
corynebacteria interstitial pneumonia | DISEASE | 1 |
charley b lavenant l | PERSON | 1 |
charley b lavenant l title characterization | CHEMICAL | 1 |
chemilumineseenee | CHEMICAL | 1 |
chemiprobe kit orgenics | PERSON | 1 |
cheng el al 1985 | PERSON | 1 |
cheng el al 1988 | PERSON | 1 |
children s hospital | ORG | 1 |
chirgwin et al 9 | ORG | 1 |
christensen 1979 | ORG | 1 |
chung et al | PERSON | 1 |
cigan | PERSON | 1 |
ciliary loss | DISEASE | 1 |
ciliastasis loss of cilia distension | DISEASE | 1 |
cindy fabricius segal wen quiang wei | PERSON | 1 |
clay adams 7180 | PERSON | 1 |
clin microbiol | PERSON | 1 |
clostridium difficile | DISEASE | 1 |
clusters | ORG | 1 |
codon | PERSON | 1 |
cold spring harbor | ORG | 1 |
complications of viral and mycoplasmal infections | ORG | 1 |
concept | PERSON | 1 |
concise | ORG | 1 |
control | ORG | 1 |
control of | ORG | 1 |
coomassie | PERSON | 1 |
coronavirus | TAXON | 1 |
coronavirus anticorps | TAXON | 1 |
corynebacteria interstitial | ORG | 1 |
biology | ORG | 1 |
bernadette roberts | PERSON | 1 |
bergan | GPE | 1 |
adenovirus | TAXON | 1 |
agga | ORG | 1 |
aitexas | CHEMICAL | 1 |
ap | ORG | 1 |
ara a acyclovir | CHEMICAL | 1 |
ards mof | ORG | 1 |
aberdeen md | PERSON | 1 |
abstract porcine | PERSON | 1 |
acm | ORG | 1 |
acc | PERSON | 1 |
acid acetone | CHEMICAL | 1 |
acridinium | GPE | 1 |
acridinium esters | CHEMICAL | 1 |
acute necrotizing enterocolitis | DISEASE | 1 |
adams et al 1987 | PERSON | 1 |
aerosol | GPE | 1 |
ben bassat | PERSON | 1 |
african green monkey kidney ma 104 | CHEMICAL | 1 |
ag | CHEMICAL | 1 |
ag na | PERSON | 1 |
akademie carl | PERSON | 1 |
alan p kendal | PERSON | 1 |
albertini | PERSON | 1 |
aldrich chemical co | ORG | 1 |
allantoic | PERSON | 1 |
allergic contact dermatitis | DISEASE | 1 |
alonso | CHEMICAL | 1 |
alpha | GPE | 1 |
alprostadil | CHEMICAL | 1 |
alprostadil schwarz pharma ag | ORG | 1 |
alterations | ORG | 1 |
ag d | CHEMICAL | 1 |
ada whitehead | PERSON | 1 |
ada gerlach | PERSON | 1 |
ad of 2 13 jtm range 1 | DISEASE | 1 |
1 acetic acid | CHEMICAL | 1 |
10 m monensin sigma chemical co | ORG | 1 |
11 80039 3 sha | CHEMICAL | 1 |
14c glucosamine | CHEMICAL | 1 |
1979 | DISEASE | 1 |
2 4 mrad | CHEMICAL | 1 |
2 b monensin | CHEMICAL | 1 |
3 nucleotide | CHEMICAL | 1 |
325740 | CHEMICAL | 1 |
34116 4675 | CHEMICAL | 1 |
35s_ methionine | CHEMICAL | 1 |
3h leu 3h phe | CHEMICAL | 1 |
3h phe bag cell | CHEMICAL | 1 |
3h phe grains | CHEMICAL | 1 |
4 b 9710 | CHEMICAL | 1 |
4 b fig 5 | CHEMICAL | 1 |
4656 cord_uid n4h295e5 | CHEMICAL | 1 |
5 1 ture | CHEMICAL | 1 |
5 x denhardt s reagent 1 0 sds | CHEMICAL | 1 |
6phosphate | CHEMICAL | 1 |
8 uracil | CHEMICAL | 1 |
8674 | DISEASE | 1 |
a bauernfeind | PERSON | 1 |
a fleming | PERSON | 1 |
a59 virus | TAXON | 1 |
aac | ORG | 1 |
able | GPE | 1 |
acth | ORG | 1 |
ad | DISEASE | 1 |
amersham | ORG | 1 |
amersham braunschweig frg rabbit | ORG | 1 |
amersham buchler | PERSON | 1 |
autotoxicity | ORG | 1 |
azobisformamide ii thermal decomposition kinetics | ORG | 1 |
b predicted | ORG | 1 |
bcv monolayers of hrt 18 | ORG | 1 |
bcv glycoproteins | TAXON | 1 |
bcv infected | DISEASE | 1 |
bcv proteins | TAXON | 1 |
bcv virions | TAXON | 1 |
bcvinfected | ORG | 1 |
bmft | ORG | 1 |
bmlf1 upstream control region | ORG | 1 |
bmt | ORG | 1 |
bnlf i ma | ORG | 1 |
bplinactivated | ORG | 1 |
bachem | ORG | 1 |
bachmann | ORG | 1 |
bakteriologie | GPE | 1 |
bamlil | PERSON | 1 |
bar harbor | ORG | 1 |
barn hi | PERSON | 1 |
barrel1 | GPE | 1 |
bartalena | PERSON | 1 |
bauer 1987 | ORG | 1 |
bechtold et al 1988 | PERSON | 1 |
beckman | PERSON | 1 |
beckman instruments inc palo alto ca | ORG | 1 |
beerse belgium | ORG | 1 |
behringwerke ag | ORG | 1 |
belcourt michael f farabaugh | PERSON | 1 |
beltsville md | GPE | 1 |
azobisformamide ii | CHEMICAL | 1 |
ausubel fm | GPE | 1 |
amersham corp | ORG | 1 |
att20 | CHEMICAL | 1 |
amicon | ORG | 1 |
aminoterminal | ORG | 1 |
an fcdependent | PERSON | 1 |
analysis | PERSON | 1 |
anderson | PERSON | 1 |
angiotensinogen newbor aqe | LOC | 1 |
ann proc equine medacane | PERSON | 1 |
anorexia | DISEASE | 1 |
anti hbc | PERSON | 1 |
anti hbs | PERSON | 1 |
antigens | PERSON | 1 |
antitoxin | GPE | 1 |
aota | ORG | 1 |
aplysia constitutive | ORG | 1 |
aplysia egg | TAXON | 1 |
aplysia bag cells | TAXON | 1 |
aplysia californica cellular | TAXON | 1 |
aplysia egg laying hormone | TAXON | 1 |
aplysia neurosecretory peptides | TAXON | 1 |
apparatus | ORG | 1 |
arch microbiol | ORG | 1 |
arlington heights il | GPE | 1 |
arlington heights il northern | GPE | 1 |
asn 2 | ORG | 1 |
asn leu thr | PERSON | 1 |
asn leu athr | PERSON | 1 |
asn13 | DISEASE | 1 |
asn60 | CHEMICAL | 1 |
assembly of the semliki forest | ORG | 1 |
demyelination | DISEASE | 1 |
derbyshire | ORG | 1 |
des | CHEMICAL | 1 |
hplc azodicarbonamide methods | ORG | 1 |
hbe | ORG | 1 |
hbs | CHEMICAL | 1 |
hci ph 7 41 150 | CHEMICAL | 1 |
hcmv infections | DISEASE | 1 |
he | CHEMICAL | 1 |
hel | ORG | 1 |
henk | CHEMICAL | 1 |
hiv 1 frameshift | TAXON | 1 |
hiv and hbv dna | DISEASE | 1 |
hiv antibody | TAXON | 1 |
hiv infected | DISEASE | 1 |
hiv infections | DISEASE | 1 |
hla dr | ORG | 1 |
hmpa toxicity | CHEMICAL | 1 |
hplc bechtold el al | PERSON | 1 |
gielkens | GPE | 1 |
hplc bechtold el al 1989 biurea | PERSON | 1 |
hrp | ORG | 1 |
hsv 2 infection | DISEASE | 1 |
hsv l | ORG | 1 |
hsv l infections | DISEASE | 1 |
hsv lesions | DISEASE | 1 |
hznz | ORG | 1 |
hahn | PERSON | 1 |
hank | GPE | 1 |
hantaan s segment cdna | TAXON | 1 |
hantaan virus nucleocapsid polypeptides | TAXON | 1 |
hasilik | GPE | 1 |
hayashi | PERSON | 1 |
hazleton | ORG | 1 |
h42a | PERSON | 1 |
h3n2 | ORG | 1 |
h20 monoperoxyoxalate | PERSON | 1 |
h1000 hazleton | PERSON | 1 |
gilmore | PERSON | 1 |
glabe | PERSON | 1 |
gladstone | ORG | 1 |
gly codon | CHEMICAL | 1 |
gnffiths | PERSON | 1 |
goigi | ORG | 1 |
goigl | PERSON | 1 |
goln | ORG | 1 |
golgj | GPE | 1 |
golgi partial | ORG | 1 |
golgt | GPE | 1 |
golgt apparatus clsternae | DISEASE | 1 |
graft | ORG | 1 |
graham pittar | PERSON | 1 |
grange farm | ORG | 1 |
granules | PERSON | 1 |
greiner co | PERSON | 1 |
griffiths | PERSON | 1 |
griggs | PERSON | 1 |
grindley n d f 1986 | PERSON | 1 |
gritliths | PERSON | 1 |
guarente | PERSON | 1 |
guarente l yocum | PERSON | 1 |
gunnar | ORG | 1 |
h e | CHEMICAL | 1 |
h nlemann | ORG | 1 |
h sa aczframeshift | ORG | 1 |
h trendlenberg m | PERSON | 1 |
h xu | PERSON | 1 |
hela | PERSON | 1 |
health sciences | ORG | 1 |
hedm | PERSON | 1 |
ibr outbreaks | TAXON | 1 |
ifn 4 800 _ 3 000 u | CHEMICAL | 1 |
ifn beta | CHEMICAL | 1 |
ifn ce qui sugg6re | CHEMICAL | 1 |
ifn interferon ipc ifnqt | CHEMICAL | 1 |
ifn0c | ORG | 1 |
ifn0c synthesis | ORG | 1 |
ifna charley | CHEMICAL | 1 |
ifnα | CHEMICAL | 1 |
ii de plus | ORG | 1 |
ii description | ORG | 1 |
il 2 | ORG | 1 |
introduction peripheral | ORG | 1 |
ioo | ORG | 1 |
iosynthesis of | ORG | 1 |
ipc goblet al 1988 | PERSON | 1 |
idiopathic | PERSON | 1 |
idiopathic spasmodic torticollis | DISEASE | 1 |
ig | ORG | 1 |
iga dr eibl dr eibl | DISEASE | 1 |
iga igg | LOC | 1 |
iga igg review | ORG | 1 |
igm iga | ORG | 1 |
ikemura | ORG | 1 |
ilo | ORG | 1 |
ill | PERSON | 1 |
immobi | PERSON | 1 |
immuno ag | ORG | 1 |
immunoblotting contradictory | ORG | 1 |
importance | GPE | 1 |
ifa | ORG | 1 |
hyphal | ORG | 1 |
heller | PERSON | 1 |
hybridization of rna | ORG | 1 |
hemorrhagic gastroenteritis | DISEASE | 1 |
hemsley | ORG | 1 |
henk w g | PERSON | 1 |
henschen 1975 hybridization | ORG | 1 |
hepatitis b hbv | ORG | 1 |
herpes | PERSON | 1 |
herpes simplex virus type | TAXON | 1 |
herpes simplex virus type l | DISEASE | 1 |
herpes simplex | DISEASE | 1 |
herpes simplex virus hsv | TAXON | 1 |
herpes simplex glycoprotelns | DISEASE | 1 |
herpes simplex virus hsv l | DISEASE | 1 |
herpes viruses | TAXON | 1 |
herweh | ORG | 1 |
hind iii | PERSON | 1 |
hirano | ORG | 1 |
histological | ORG | 1 |
hoft | DISEASE | 1 |
holmes 1982 viral | ORG | 1 |
holmes 1985 white | PERSON | 1 |
hong kong | GPE | 1 |
horses | TAXON | 1 |
human immunodeficiency virus hiv | DISEASE | 1 |
human immunodeficiency viruses human t lymphotropic viruses | DISEASE | 1 |
human lymphocytes | TAXON | 1 |
human papillomaviruses hpv | DISEASE | 1 |
hungarian congress of experimental surgery abteilung | ORG | 1 |
hyclone laboratories inc logan | ORG | 1 |
hybridisation | ORG | 1 |
gifford | ORG | 1 |
german red cross bloodtransfusion centers | ORG | 1 |
detection of antibodies against cytomegalovirus hcmv | ORG | 1 |
edidin 1988 | PERSON | 1 |
eae hickey | ORG | 1 |
ebv | TAXON | 1 |
ebv latent membrane protein | TAXON | 1 |
ecg | ORG | 1 |
egfdependent | ORG | 1 |
eia ria | ORG | 1 |
elf | ORG | 1 |
elisa fleming | ORG | 1 |
ev | ORG | 1 |
earle s | PERSON | 1 |
eastern | ORG | 1 |
ebola viruses | TAXON | 1 |
ecori | PERSON | 1 |
ecori ndel | ORG | 1 |
egg | TAXON | 1 |
gerald fink | PERSON | 1 |
egg ah influenza | PERSON | 1 |
ehrlieh | LOC | 1 |
eibl dr eibl | PERSON | 1 |
eibl martha m wolf hermann m fürnkranz heinz | PERSON | 1 |
elisa | ORG | 1 |
elisabeth servin | PERSON | 1 |
emr | ORG | 1 |
engelrnan | GPE | 1 |
england | GPE | 1 |
ennis 1987 hughes | PERSON | 1 |
environ health perspect | ORG | 1 |
epon araldite | ORG | 1 |
equine encephalitis | PERSON | 1 |
ernst bause | PERSON | 1 |
e coli serotype | TAXON | 1 |
e coli peptide | TAXON | 1 |
e coli frameshift sites | TAXON | 1 |
e coli frame | TAXON | 1 |
determinations of methemoglobin | ORG | 1 |
developmental | ORG | 1 |
dianne markham lorraine | CHEMICAL | 1 |
dianne markham lorraine davies | PERSON | 1 |
diethylpyrocarbonate | CHEMICAL | 1 |
digoxigenin | PERSON | 1 |
discussion a | ORG | 1 |
disruption of the | ORG | 1 |
dnly 1979 | CHEMICAL | 1 |
donahue | PERSON | 1 |
donahue t f farabaugh | PERSON | 1 |
dorset suffolk | ORG | 1 |
dr w davis | ORG | 1 |
drs | PERSON | 1 |
drum | PERSON | 1 |
dupont de nemours nen | ORG | 1 |
duck hepatitis virus | TAXON | 1 |
ductal squamous metaplasia | DISEASE | 1 |
dufour 1982 | PERSON | 1 |
dulbecco s | LOC | 1 |
dunn | PERSON | 1 |
dunnett | PERSON | 1 |
dupont | ORG | 1 |
dupont f r g | ORG | 1 |
dvh20 | CHEMICAL | 1 |
dysbasia | GPE | 1 |
dysbasia lordotica progressiva | DISEASE | 1 |
e coli klebsiella | CHEMICAL | 1 |
e coli antibodies | TAXON | 1 |
escherichla | GPE | 1 |
escherichm coli k | CHEMICAL | 1 |
escherlchia | PERSON | 1 |
frederick md | PERSON | 1 |
freund s | LOC | 1 |
friend | PERSON | 1 |
friend munne leukemia | DISEASE | 1 |
functional asplenia | PERSON | 1 |
fundam | PERSON | 1 |
fundam appl | PERSON | 1 |
g 1 and g 2 | ORG | 1 |
g c | ORG | 1 |
g kielweln | PERSON | 1 |
ga | ORG | 1 |
gallo cyci | ORG | 1 |
gca bedford ma | PERSON | 1 |
gdvii | GPE | 1 |
gdvii mice | TAXON | 1 |
gm | ORG | 1 |
gm 29480 | CHEMICAL | 1 |
gp np | ORG | 1 |
gp np m l | ORG | 1 |
gsh | CHEMICAL | 1 |
gttatcct cgagcatccgtagtgtggcctctgcgttgttttcatagcagca aggtacacacgggggc | ORG | 1 |
gal | PERSON | 1 |
gal galnac | PERSON | 1 |
galactosidase assay | PERSON | 1 |
gammacell | PERSON | 1 |
garfinkel d j boeke | PERSON | 1 |
garoffet al | GPE | 1 |
genbank | ORG | 1 |
genofit geneva | GPE | 1 |
gentamicin | PERSON | 1 |
fresenius j anal chem | ORG | 1 |
frederick cancer research | ORG | 1 |
essen | PERSON | 1 |
frankfurt | GPE | 1 |
essen pre | PERSON | 1 |
eurobio paris pbmc | ORG | 1 |
europe | LOC | 1 |
evehne | ORG | 1 |
evelyn | GPE | 1 |
examples | ORG | 1 |
experimental | ORG | 1 |
expression of semliki forest | ORG | 1 |
expression of acz | ORG | 1 |
fccp | ORG | 1 |
fda | ORG | 1 |
fi3rnkranz | CHEMICAL | 1 |
fabricius segal | DISEASE | 1 |
fantazier | ORG | 1 |
fantazier 1974 subchronic toxicity | CHEMICAL | 1 |
farabaugh 1985 mellor | CHEMICAL | 1 |
farquhar 1966 | PERSON | 1 |
fepa | CHEMICAL | 1 |
ferris | PERSON | 1 |
fhckinger | DISEASE | 1 |
fhue | ORG | 1 |
ficoll | ORG | 1 |
financial difficulties | DISEASE | 1 |
fitzgerald bocarsky | PERSON | 1 |
fitzgerald bocarsly | PERSON | 1 |
flbronectin | CHEMICAL | 1 |
fm schleicher | ORG | 1 |
fox | ORG | 1 |
frameshift | ORG | 1 |
thylakold swelling | DISEASE | 1 |
epsilon e | CHEMICAL | 1 |
tinoco | PERSON | 1 |
necrotizing enterocotitis | DISEASE | 1 |
myelin basic infectious center assays | ORG | 1 |
myelinating disease | DISEASE | 1 |
myeloma | DISEASE | 1 |
myxo | CHEMICAL | 1 |
nasal adenomas | DISEASE | 1 |
nasal cavity infections | DISEASE | 1 |
nasal tumors rhinitis | DISEASE | 1 |
neck deformity | DISEASE | 1 |
necrotic | DISEASE | 1 |
necrotizing | DISEASE | 1 |
necrotizing enterocolitis a | DISEASE | 1 |
necrotizing enterocolitis gentamicin | DISEASE | 1 |
necrotizing enterocolitis ischemia | DISEASE | 1 |
necrotizing enterocolitis necrotizing enterocolitis nec | DISEASE | 1 |
neoplasia | DISEASE | 1 |
nonstructural coding genom region | TAXON | 1 |
neoplasms | DISEASE | 1 |
neurocndocrine | CHEMICAL | 1 |
neurological diseases | DISEASE | 1 |
neuroparalytic | DISEASE | 1 |
neuropeptides excludes | CHEMICAL | 1 |
neuroviruimpact | CHEMICAL | 1 |
neutropenia | DISEASE | 1 |
nickel | CHEMICAL | 1 |
nickel chloride | CHEMICAL | 1 |
nigericin | CHEMICAL | 1 |
nitocellulose | DISEASE | 1 |
nitrous oxide | CHEMICAL | 1 |
non t non b cd4 | PERSON | 1 |
nonbacterial viral infections | DISEASE | 1 |
mycostatin ml pbsa | PERSON | 1 |
mycostatin | CHEMICAL | 1 |
mycoplasmosis | DISEASE | 1 |
mycoplasmal damage | DISEASE | 1 |
monensin fac | ORG | 1 |
monensin mediates | PERSON | 1 |
monensin mhlbmon fhckinger | ORG | 1 |
monensin poisomng | ORG | 1 |
monensin poisoned | CHEMICAL | 1 |
monensin toxicity | CHEMICAL | 1 |
monensln lack | PERSON | 1 |
monensm | PERSON | 1 |
monensm stein | PERSON | 1 |
monensxn | PERSON | 1 |
mouse fibroblasts | TAXON | 1 |
mouse thymocytes | TAXON | 1 |
mouse thymocytes monensin | TAXON | 1 |
mouth diesease virus | TAXON | 1 |
mucosal edema | DISEASE | 1 |
mucosal injury | DISEASE | 1 |
multi organ failure | DISEASE | 1 |
multiple sclerosis | DISEASE | 1 |
murine microbial | TAXON | 1 |
murine viral | TAXON | 1 |
murine virus | TAXON | 1 |
muscle contractions | DISEASE | 1 |
muscle weakness | DISEASE | 1 |
muscular dystrophy | DISEASE | 1 |
muscular overactivity | DISEASE | 1 |
muscular paralysis | DISEASE | 1 |
myasthenia gravis | DISEASE | 1 |
mycoplasma membranes | ORG | 1 |
mycoplasmal chronic respiratory disease | DISEASE | 1 |
noninfectious | DISEASE | 1 |
nonsuppurative bronchiolitis | DISEASE | 1 |
illness anorexia | DISEASE | 1 |
penicillin | CHEMICAL | 1 |
phsrv | CHEMICAL | 1 |
pksvr | CHEMICAL | 1 |
pmb36 | ORG | 1 |
pnoup liao et al 1987 replacement of the bamhi | PERSON | 1 |
prn653a b c h niemann a | CHEMICAL | 1 |
prang | ORG | 1 |
psp18 | ORG | 1 |
pancytopenia | DISEASE | 1 |
panencephalitis | DISEASE | 1 |
papillomavirus infection | DISEASE | 1 |
paramyxovirus | TAXON | 1 |
paramyxoviruses | TAXON | 1 |
pathological injuries | DISEASE | 1 |
patientswitha disease | DISEASE | 1 |
penicillin ml | PERSON | 1 |
nrea | CHEMICAL | 1 |
pentobarbital | CHEMICAL | 1 |
pentobarbital nembutal | CHEMICAL | 1 |
peplomer | DISEASE | 1 |
peptapeptide | CHEMICAL | 1 |
peribronchial lymphocytic infiltration | DISEASE | 1 |
peripheral skin lesions neurological illness | DISEASE | 1 |
peritonitis | DISEASE | 1 |
permanent injury | DISEASE | 1 |
pertussis tetanus | DISEASE | 1 |
perylene | CHEMICAL | 1 |
pestivirus | TAXON | 1 |
phenole | CHEMICAL | 1 |
phenylalanine codon | CHEMICAL | 1 |
phenylalanine codons | CHEMICAL | 1 |
ph7 | CHEMICAL | 1 |
ph ile carboxy terminal or 3h phe amino | CHEMICAL | 1 |
pgem2dhfrx | ORG | 1 |
pgem2alphag | ORG | 1 |
nucleic acid | CHEMICAL | 1 |
nucleic acids | CHEMICAL | 1 |
numan | TAXON | 1 |
o m culbertson | PERSON | 1 |
obese | DISEASE | 1 |
observaal 1982 | ORG | 1 |
ofaplysia | GPE | 1 |
ofprohormone | CHEMICAL | 1 |
ohgosacchandes n hnked | CHEMICAL | 1 |
oligo nucleotide | CHEMICAL | 1 |
oligodeoxynucleotide | CHEMICAL | 1 |
oligosaccharyl | CHEMICAL | 1 |
ollgosacchande | GPE | 1 |
opportunistic viral infections | DISEASE | 1 |
oral ig iga | CHEMICAL | 1 |
oral iga | CHEMICAL | 1 |
oromandibular dystonias | DISEASE | 1 |
orpol reading frame | CHEMICAL | 1 |
otitis | DISEASE | 1 |
ovaries thymus thyroid gland trachea and urinary bladder | DISEASE | 1 |
overload | DISEASE | 1 |
oviduct esophagus heart small intestine duodenum jejunum ileum large intestine cecum colon rectum both kidneys larynx liver lung 4 lobes lymph nodes bronchial mandibular mediastinal mesenteric mammary glands nose | DISEASE | 1 |
oxalate fluorescer | CHEMICAL | 1 |
oxalic acid carbodiimide fluorescer h202 | CHEMICAL | 1 |
oxalic acid fluorescer | CHEMICAL | 1 |
oxyhemoglobin methemoglobin | PERSON | 1 |
oxytocin oxytocin | CHEMICAL | 1 |
pbd h | ORG | 1 |
pcp62globin | PERSON | 1 |
monensin whale | ORG | 1 |
monensin swelling | CHEMICAL | 1 |
monensin fig 9 | CHEMICAL | 1 |
iodide | CHEMICAL | 1 |
inteffacial behavior | DISEASE | 1 |
intercalary clsternae | DISEASE | 1 |
interf6ron ont | ORG | 1 |
interferon ifn | CHEMICAL | 1 |
interferon alpha | CHEMICAL | 1 |
interferon alpha ifna | CHEMICAL | 1 |
interferon alpha and gamma | CHEMICAL | 1 |
interleukin 2 | ORG | 1 |
interstitial pneumonias | DISEASE | 1 |
intestinal coronavirus infection | DISEASE | 1 |
intestinal disease | DISEASE | 1 |
intestinal infection | DISEASE | 1 |
intestinal mucosa colonization | DISEASE | 1 |
involuntary spasms | DISEASE | 1 |
iodine | CHEMICAL | 1 |
monensin a | CHEMICAL | 1 |
ionophoric | CHEMICAL | 1 |
irritability | DISEASE | 1 |
ischemia | DISEASE | 1 |
isoleucine | CHEMICAL | 1 |
isoleucine 3h ile | CHEMICAL | 1 |
isopropanol | CHEMICAL | 1 |
j 1326 5377 | CHEMICAL | 1 |
jerking | DISEASE | 1 |
jerking movements | DISEASE | 1 |
jerking of the right shoulder | DISEASE | 1 |
journal | ORG | 1 |
kanamycin gentamicin | CHEMICAL | 1 |
kidneys larynx | PERSON | 1 |
la msa3 | PERSON | 1 |
innocuity | DISEASE | 1 |
injuries | DISEASE | 1 |
initiator met | CHEMICAL | 1 |
influenza virus infection | DISEASE | 1 |
immune deficiencies | DISEASE | 1 |
immune deficiency | DISEASE | 1 |
immune pig lymphocytes | TAXON | 1 |
immunocompromised | DISEASE | 1 |
immunological disorders | DISEASE | 1 |
immunoreaetivity | DISEASE | 1 |
impairment of the t helper cell function | DISEASE | 1 |
inborn iggsubclass deficiency syndrome | DISEASE | 1 |
increase in hepatic angiotensinogen | DISEASE | 1 |
increases in liver angiotensinogen | DISEASE | 1 |
infancy a review | DISEASE | 1 |
infancy uber eine eigenartige krampfkrankheit | DISEASE | 1 |
infantile diarrhea | DISEASE | 1 |
infected | DISEASE | 1 |
infected burkitt lymphoma | DISEASE | 1 |
infection hiv | DISEASE | 1 |
infection of the gastrointestinal mucosa | DISEASE | 1 |
infectious bovine rhinotracheitis ibr | DISEASE | 1 |
infectious coronavirus | DISEASE | 1 |
infectious disease | DISEASE | 1 |
infectious inflammatory disease | DISEASE | 1 |
infectious pustular vulvovaginitis | DISEASE | 1 |
inflammation edema | DISEASE | 1 |
inflammatory hypercellularity | DISEASE | 1 |
inflammatory rheumatic diseases | DISEASE | 1 |
influenza b | DISEASE | 1 |
influenza b virus protein and vice versa | CHEMICAL | 1 |
influenza n1 | ORG | 1 |
influenza infected | DISEASE | 1 |
labeled sugar nucleotides | CHEMICAL | 1 |
laryngitis | DISEASE | 1 |
laterocollis retrocollis | PERSON | 1 |
mastitis milk pseudomonas aeruginosa | DISEASE | 1 |
matochondrial swelling | DISEASE | 1 |
mdustrty | TAXON | 1 |
meat | TAXON | 1 |
medium infected | DISEASE | 1 |
medulloblastoma | DISEASE | 1 |
melanoma | DISEASE | 1 |
mem garoff | PERSON | 1 |
membrane energetlcs | PERSON | 1 |
mercaptan | CHEMICAL | 1 |
mercaptoethanol | CHEMICAL | 1 |
mercaptoethanol cscl | CHEMICAL | 1 |
metabolic acidosis | DISEASE | 1 |
methlonine | CHEMICAL | 1 |
methylene blue | CHEMICAL | 1 |
mgencin | CHEMICAL | 1 |
mice mice | TAXON | 1 |
mice mice | TAXON | 1 |
mice terminal body | TAXON | 1 |
mice virus canine distemper virus semliki forest virus | TAXON | 1 |
microbial infection | DISEASE | 1 |
milk | DISEASE | 1 |
min apgar | PERSON | 1 |
mitochondrial swelling | DISEASE | 1 |
mitochondrial vacuolation | DISEASE | 1 |
mltochondnal damage | DISEASE | 1 |
mltochondrial swelling | DISEASE | 1 |
mltochondrlal lesions | DISEASE | 1 |
momensin | CHEMICAL | 1 |
monensin 150 | CHEMICAL | 1 |
materials infected | DISEASE | 1 |
mammalian retroviral proteins codon | TAXON | 1 |
leucocidin | CHEMICAL | 1 |
mammalian retroviral | TAXON | 1 |
leucyl | CHEMICAL | 1 |
leukocyte membrane | PERSON | 1 |
ligand | GPE | 1 |
lipopolysac | ORG | 1 |
liver and kidney rna | DISEASE | 1 |
liver enzymes necrotizing enterocolitis | DISEASE | 1 |
liver kidney and striated muscle generalized necrosis | DISEASE | 1 |
lmmunoglobulin m molecules | PERSON | 1 |
locahzlng | CHEMICAL | 1 |
longissimus lumborum muscle | DISEASE | 1 |
loss of tissue antioxidative | DISEASE | 1 |
low infection | DISEASE | 1 |
luminal | CHEMICAL | 1 |
luminol acridine phenanthridine | CHEMICAL | 1 |
lung 212 liver 209 | DISEASE | 1 |
lung cancer | DISEASE | 1 |
lymphohematopoietic malignancy | DISEASE | 1 |
lymphoid hyperplasia | DISEASE | 1 |
lymphopenia | DISEASE | 1 |
lymphoplasmacytic | DISEASE | 1 |
lyso | CHEMICAL | 1 |
lysosomal methylarmne | PERSON | 1 |
m rat | PERSON | 1 |
mitochondrla | GPE | 1 |
mm na | PERSON | 1 |
mm tris hc1 | PERSON | 1 |
macroscopic injury | DISEASE | 1 |
macrosomes | TAXON | 1 |
mammalian mitochondrial | TAXON | 1 |
pheochromocytoma | DISEASE | 1 |
picornavirus | TAXON | 1 |
picornaviruses | TAXON | 1 |
u peptidyl | ORG | 1 |
trapezii | CHEMICAL | 1 |
tremor | DISEASE | 1 |
triiodothyronine | CHEMICAL | 1 |
triphenylphosphine | CHEMICAL | 1 |
tritiated amino acids | CHEMICAL | 1 |
tritiated thymidine | CHEMICAL | 1 |
trlfluoromethoxyphenylhydazone fccp | CHEMICAL | 1 |
trypan blue | CHEMICAL | 1 |
trypsin fig 3a | CHEMICAL | 1 |
trypsin fig 4b | CHEMICAL | 1 |
trypsin one viral antigen | CHEMICAL | 1 |
trypsin inhibitor | CHEMICAL | 1 |
tumours | DISEASE | 1 |
u | PERSON | 1 |
undissociated | CHEMICAL | 1 |
the institute for medical virology | ORG | 1 |
urethane | CHEMICAL | 1 |
uridine triphosphate | CHEMICAL | 1 |
urn glass | PERSON | 1 |
van duin 1988 | PERSON | 1 |
van nieuwstadt | PERSON | 1 |
verruciformis | DISEASE | 1 |
verruciformis syndrome | DISEASE | 1 |
vesicle acxdlflatlon | PERSON | 1 |
villous atrophy gastroenteritis | DISEASE | 1 |
violent twisting movements of the neck | DISEASE | 1 |
viral rna | TAXON | 1 |
viral t cells | TAXON | 1 |
viral capsid proteins | TAXON | 1 |
viral coat | TAXON | 1 |
transmissible gastroenteritis dendritic cells | TAXON | 1 |
transferrln | ORG | 1 |
trans membrane exchange | ORG | 1 |
tracheitis | DISEASE | 1 |
the national institutes of environmental health sciences | ORG | 1 |
the national tbxicology program ntp | ORG | 1 |
the national toxicology program | ORG | 1 |
the public health service | ORG | 1 |
the shine dalgarno | LOC | 1 |
the smith kettlewell eye research institute | ORG | 1 |
the swedish medical research council | ORG | 1 |
the tgn | ORG | 1 |
the tgn campbell | ORG | 1 |
the u s department of energy s office of health and environmental research contract | ORG | 1 |
the united states department of agriculture | ORG | 1 |
the university clinics | ORG | 1 |
the university of iowa animal care and use committee | ORG | 1 |
the virology department | ORG | 1 |
the immunologic properties induction | ORG | 1 |
the monensm medlated exchange | ORG | 1 |
the mucosa exudate | ORG | 1 |
the public health service | ORG | 1 |
the upper airways | ORG | 1 |
the viral glycoproteins adsorption of zinc | ORG | 1 |
thenew england journal of medicine | ORG | 1 |
thioglycolate | CHEMICAL | 1 |
thyroxin | CHEMICAL | 1 |
thyroxine sodium | CHEMICAL | 1 |
tissue damage | DISEASE | 1 |
tive | DISEASE | 1 |
toluidine blue | CHEMICAL | 1 |
torticollis v | PERSON | 1 |
toxm | DISEASE | 1 |
viral diarrhea | DISEASE | 1 |
viral envelope | TAXON | 1 |
viral gastroenteritis | DISEASE | 1 |
viruses bacterial products | TAXON | 1 |
viruses mycoplasmas bacteria | TAXON | 1 |
virustasis | DISEASE | 1 |
vitamin b12 | CHEMICAL | 1 |
volume pretitrated | DISEASE | 1 |
vomiting watery diarrhoea dehydration | DISEASE | 1 |
von heijne | PERSON | 1 |
weight gain depression | DISEASE | 1 |
wellcontrolled | DISEASE | 1 |
wheezing | DISEASE | 1 |
white 96well microtiter | DISEASE | 1 |
white muscle | DISEASE | 1 |
wtro monensln | PERSON | 1 |
xanthine xanthine | CHEMICAL | 1 |
xanthine xanthine oxidase | PERSON | 1 |
xenon | CHEMICAL | 1 |
xk4yuibj | CHEMICAL | 1 |
xri24v40 | CHEMICAL | 1 |
y equa | PERSON | 1 |
yeast saccharomyces cerevisiae | TAXON | 1 |
yeast wilson | DISEASE | 1 |
yeast chromosomes | TAXON | 1 |
yeast mitochondrial gene | TAXON | 1 |
yeast phenylalanine trna genes | TAXON | 1 |
yeast promoter | TAXON | 1 |
yeast retrotransposon ty | TAXON | 1 |
yeast trna | TAXON | 1 |
yeast trnas | TAXON | 1 |
zo | PERSON | 1 |
zymosan sigma cl | PERSON | 1 |
viruses human t lymphotropic viruses | TAXON | 1 |
viruses restriction endonuclease | TAXON | 1 |
viral interstitial pneumonia | DISEASE | 1 |
viruses mycoplasma | TAXON | 1 |
viral membrane | TAXON | 1 |
viral membranes | TAXON | 1 |
viral nucleic acids | CHEMICAL | 1 |
viral nucleocapsids | TAXON | 1 |
viral pneumonia | DISEASE | 1 |
viral polyprotein | TAXON | 1 |
viral rickettsial chlamydial mycoplasmal reagents | TAXON | 1 |
virions | TAXON | 1 |
virus dna | TAXON | 1 |
virus e1 | CHEMICAL | 1 |
virus e2 protein | TAXON | 1 |
virus mmtv | TAXON | 1 |
virus ndv sendai virus | TAXON | 1 |
virus rat coronavirus | TAXON | 1 |
virus sfv | TAXON | 1 |
virus t cell | TAXON | 1 |
virus genome | TAXON | 1 |
virus glycoprotein | TAXON | 1 |
virus infected | DISEASE | 1 |
virus inmice | TAXON | 1 |
virus lymphocyte | TAXON | 1 |
virus membrane | TAXON | 1 |
virus membrane glycoproteins g 1 | TAXON | 1 |
virus mouse | TAXON | 1 |
virus nuclear capsids | TAXON | 1 |
virus particles virus | TAXON | 1 |
virus structural polyprotein | TAXON | 1 |
virus vaccines | TAXON | 1 |
viruses mhv | TAXON | 1 |
the national institute of en | ORG | 1 |
the inhalation toxicology research institute | ORG | 1 |
picryl | PERSON | 1 |
reoften | CHEMICAL | 1 |
purulent inflammation | DISEASE | 1 |
pyrene | CHEMICAL | 1 |
pyrene b | CHEMICAL | 1 |
pyruvate | CHEMICAL | 1 |
rabbit hepatocytes | TAXON | 1 |
rabies virus | TAXON | 1 |
rat astrocytes | TAXON | 1 |
rat fibroblasts | TAXON | 1 |
rats cytomegalovirus cmv | TAXON | 1 |
rats mice | TAXON | 1 |
reduction in myelin staining | DISEASE | 1 |
reduction of root mass | DISEASE | 1 |
renal toxicity | DISEASE | 1 |
renin angiotensinogen | PERSON | 1 |
repetitive movements | DISEASE | 1 |
the hinc ii | LOC | 1 |
respiratory coronavirus | DISEASE | 1 |
respiratory disease syndrome | DISEASE | 1 |
respiratory infections | DISEASE | 1 |
respiratory symptomatology | DISEASE | 1 |
respiratory syncytial virus infection | DISEASE | 1 |
respiratory tract infection | DISEASE | 1 |
resultant lung tumors | DISEASE | 1 |
retroviral genes | TAXON | 1 |
retrovirus frameshift | TAXON | 1 |
rhinitis otitis | DISEASE | 1 |
rhinitis tracheobronchitis bronchiolitis | DISEASE | 1 |
rhinovirus infection | DISEASE | 1 |
rhinovirus infections | DISEASE | 1 |
ribonucleic acids a | CHEMICAL | 1 |
purines | CHEMICAL | 1 |
purelyfocaldystonia | DISEASE | 1 |
pulmonary carcinogenesis | DISEASE | 1 |
pseudomembranous mucosal necrosis | DISEASE | 1 |
picryl chloride | CHEMICAL | 1 |
piglet diarrhoea | DISEASE | 1 |
piglet infected | DISEASE | 1 |
pituitary tumour | DISEASE | 1 |
plasmid pmb38 | CHEMICAL | 1 |
pnmaquine | CHEMICAL | 1 |
poliovirus coxsackie virus rotavirus | TAXON | 1 |
poliovirus p1 | TAXON | 1 |
polynuclear aromatic hydrocarbon pah benzo | CHEMICAL | 1 |
polyomavirus | TAXON | 1 |
polypeptlde | CHEMICAL | 1 |
ponies cattle pigs | TAXON | 1 |
porcine respiratory coronavirus | TAXON | 1 |
porcine respiratory coronavirus prcv | TAXON | 1 |
porphyrin | CHEMICAL | 1 |
posturing | DISEASE | 1 |
potassium | CHEMICAL | 1 |
potassium ferrocyanide | CHEMICAL | 1 |
premature infants necrotizing enterocolitis | DISEASE | 1 |
prematurity | DISEASE | 1 |
preterm infants gastrointestinal infection | DISEASE | 1 |
progesterone pms | CHEMICAL | 1 |
prokaryotes | TAXON | 1 |
prophormone | CHEMICAL | 1 |
propionate | CHEMICAL | 1 |
prostaglandin e | CHEMICAL | 1 |
proteolytic digest | LOC | 1 |
proton pump | PERSON | 1 |
protonophore carbonylcyanlde | CHEMICAL | 1 |
rmcroflora | PERSON | 1 |
rnonensin | CHEMICAL | 1 |
rodent coronaviruses mouse | TAXON | 1 |
striated muscle | DISEASE | 1 |
striated muscle spleen lung hver and kidney also | DISEASE | 1 |
striated muscle spleen lung liver and kidney | DISEASE | 1 |
subclass deficiency | DISEASE | 1 |
succinate | CHEMICAL | 1 |
sucrose acetone | CHEMICAL | 1 |
sulfaudes | CHEMICAL | 1 |
superinfection | DISEASE | 1 |
surfactants sodium dodecylsulfate | CHEMICAL | 1 |
swine leukocyte | TAXON | 1 |
swine leukocytes ia | TAXON | 1 |
swine lymphocytes | TAXON | 1 |
syncytial and coronavirus | TAXON | 1 |
syncytial virus | TAXON | 1 |
systemic disease | DISEASE | 1 |
systemic lupus erythematosus | DISEASE | 1 |
trnalga | CHEMICAL | 1 |
trnalga anticodon | CHEMICAL | 1 |
trnafze | PERSON | 1 |
talc | CHEMICAL | 1 |
tetraiodothyronine | CHEMICAL | 1 |
thank drs alan | CHEMICAL | 1 |
the american association for the accreditation of laboratory animal care | ORG | 1 |
the atomic energy of canada | ORG | 1 |
the city of | GPE | 1 |
the clsternae furthermore | ORG | 1 |
the deutsche forschungsgemeinschaft sfb 249 | ORG | 1 |
the el glycoprotein processing of the semliki forest | ORG | 1 |
the gobierno aut6nomo de canarias research project | ORG | 1 |
the hsrv ltr glycoprotein iv | ORG | 1 |
striated muscle or liver | DISEASE | 1 |
streptomycin | CHEMICAL | 1 |
rodent red blood cells | TAXON | 1 |
strabismus | DISEASE | 1 |
sahnomysin | CHEMICAL | 1 |
sarcoma | DISEASE | 1 |
sarcomas | DISEASE | 1 |
sepsis | DISEASE | 1 |
sepsis perforation | DISEASE | 1 |
septicemic | DISEASE | 1 |
serotonm lustamme | ORG | 1 |
sha 271f802f8014eedd431550a38eb9e9b69a3b11f4 | CHEMICAL | 1 |
sheep animals | TAXON | 1 |
simian retrovirus type 1 srv l a | TAXON | 1 |
simian sarcoma | DISEASE | 1 |
simian sarcoma virus ssv | TAXON | 1 |
sinopulmonary infections | DISEASE | 1 |
sleep pain | DISEASE | 1 |
sodium acetate | CHEMICAL | 1 |
sodium bisulfite | CHEMICAL | 1 |
sodium potassium chlorine calcium phosphorus | CHEMICAL | 1 |
sodium thiosulfate | CHEMICAL | 1 |
spasmodic | DISEASE | 1 |
spasmodic movement disorders | DISEASE | 1 |
spasms | DISEASE | 1 |
spectra | ORG | 1 |
spermidine | CHEMICAL | 1 |
splenius capitis | DISEASE | 1 |
squamous metaplasia | DISEASE | 1 |
squamous metaplasia a | DISEASE | 1 |
stomach abdominal girth bloating | DISEASE | 1 |
stomatitis | DISEASE | 1 |
stomatltxs | PERSON | 1 |
immune defects | DISEASE | 1 |
idiopathic | DISEASE | 1 |
tins | CHEMICAL | 1 |
anti hbs | PERSON | 1 |
ammonia cyanide | CHEMICAL | 1 |
ammonia nitrogen | CHEMICAL | 1 |
ampicillin resistant colonies | ORG | 1 |
anaphylactic | DISEASE | 1 |
anephric | DISEASE | 1 |
angiotensin i | CHEMICAL | 1 |
angiotensin i1 | PERSON | 1 |
angiotensin aldosterone | CHEMICAL | 1 |
animals monensin | TAXON | 1 |
animals viruses | TAXON | 1 |
anorexia diarrhea depression | DISEASE | 1 |
anorexia pyrexia | LOC | 1 |
anorexia pyrexia diarrhoea | DISEASE | 1 |
anti hbc caspari | PERSON | 1 |
anticodon | ORG | 1 |
ascites tumor | DISEASE | 1 |
antihepatitis | DISEASE | 1 |
antihepatitis virus | TAXON | 1 |
apathogenic bacteria | TAXON | 1 |
apnea bradycardia | DISEASE | 1 |
apparatus swelling | DISEASE | 1 |
appendicular | DISEASE | 1 |
appendicular muscle 224 | DISEASE | 1 |
aprotic solvents oxalic acid esters | CHEMICAL | 1 |
aqueous perturbants | CHEMICAL | 1 |
arginine codon | CHEMICAL | 1 |
arginine vasopressin | CHEMICAL | 1 |
arsenate | CHEMICAL | 1 |
arth pneumonia | DISEASE | 1 |
artificial sea | LOC | 1 |
aminotriazole | CHEMICAL | 1 |
amino terminal peptides | CHEMICAL | 1 |
amino terminal peptide k | CHEMICAL | 1 |
amino terminal final product peptides l | CHEMICAL | 1 |
agalactia data | ORG | 1 |
agitation | DISEASE | 1 |
airway injury | DISEASE | 1 |
airway irritation | DISEASE | 1 |
airway sensitization | DISEASE | 1 |
al 1971 results | PERSON | 1 |
al 1978 | ORG | 1 |
al 1984 hammerberg | PERSON | 1 |
al 1986 | PERSON | 1 |
al 1987 | PERSON | 1 |
al 1988 wilson | PERSON | 1 |
al et al 1982 | PERSON | 1 |
albumin transferrln | PERSON | 1 |
alcohol | CHEMICAL | 1 |
alkali oxalate | CHEMICAL | 1 |
alkylamine linker arms | CHEMICAL | 1 |
allergic | DISEASE | 1 |
allergic encephalomyelitis | DISEASE | 1 |
alpha 2 interferon intranasal interferon alpha z | CHEMICAL | 1 |
alpha 2 interferon against | CHEMICAL | 1 |
alpha interferon positive self | CHEMICAL | 1 |
alveolitis | DISEASE | 1 |
amines chloroquine | CHEMICAL | 1 |
amino | CHEMICAL | 1 |
amino acids leucine | CHEMICAL | 1 |
amino and carboxy terminal associated grains | CHEMICAL | 1 |
amino terminal phe final peptides fig 1 fisher | CHEMICAL | 1 |
amino terminal amino acid | CHEMICAL | 1 |
amino terminal bag cell peptides | CHEMICAL | 1 |
ascites | DISEASE | 1 |
asialoglycoprotein | PERSON | 1 |
i l l | ORG | 1 |
burn | DISEASE | 1 |
bovine cells | TAXON | 1 |
bovine coronavirus nucleocapsid | TAXON | 1 |
bovine leukemia | CHEMICAL | 1 |
bovine leukemia virus | TAXON | 1 |
bovine rhinotracheitis ibr | TAXON | 1 |
bowel perforation | DISEASE | 1 |
bp | ORG | 1 |
breast cancer | DISEASE | 1 |
bronchiectasis | DISEASE | 1 |
bronchiolar epithelial necrosis | DISEASE | 1 |
bronchitis | DISEASE | 1 |
bronchitis bronchiolitis | DISEASE | 1 |
bronchopneumonia | GPE | 1 |
bronchopneumonia squamous metaplasia | DISEASE | 1 |
calcium overload | CHEMICAL | 1 |
aspartate | CHEMICAL | 1 |
calcium oxalate | CHEMICAL | 1 |
calf | TAXON | 1 |
cancer | DISEASE | 1 |
caract | DISEASE | 1 |
carbohydrates e g diphenylanthracene brillant sulfoflavine rhodamine | CHEMICAL | 1 |
carbon | CHEMICAL | 1 |
carbon monoxide | CHEMICAL | 1 |
carbonyl iron | CHEMICAL | 1 |
carboxy terminal | CHEMICAL | 1 |
carboxy terminal p polypeptides | CHEMICAL | 1 |
carboxy terminal envelope glycoprotein e1 of semliki forest virus preparation | CHEMICAL | 1 |
carboxy terminal final product peptides | CHEMICAL | 1 |
carboxy terminal peptide immunoreactive small | CHEMICAL | 1 |
carboxy toamino terminal | CHEMICAL | 1 |
bovine e | CHEMICAL | 1 |
botulism | DISEASE | 1 |
botulinum a toxin | CHEMICAL | 1 |
blood urea nitrogen | CHEMICAL | 1 |
asphyxia | DISEASE | 1 |
asplenia | DISEASE | 1 |
assays chloramphenicol | PERSON | 1 |
autoimmune demyelination | DISEASE | 1 |
autoimmune diseases | DISEASE | 1 |