This is a table of named entities, their types, and their frequencies from sentences in your study carrel. Use it to search & browse the list to learn more about your study carrel. Please keep in mind that named-entity extraction is not as accurate as more generic parts-of-speech extraction. Unusual results will appear here.
entity | type | frequency |
---|---|---|
mers | DISEASE | 1080 |
saudi arabia | GPE | 1002 |
mers cov | ORG | 807 |
coronavirus | TAXON | 532 |
cryptosporidium | TAXON | 475 |
infection | DISEASE | 429 |
virus | TAXON | 391 |
covid | ORG | 328 |
middle east | LOC | 324 |
human | TAXON | 295 |
arabia | TAXON | 285 |
hajj | PERSON | 248 |
covid 19 | ORG | 215 |
individuals | TAXON | 214 |
camels | TAXON | 183 |
anxiety | DISEASE | 161 |
riyadh | TAXON | 155 |
viral | TAXON | 146 |
viruses | TAXON | 144 |
lbp | ORG | 141 |
mers cov infection | ORG | 132 |
respiratory syndrome coronavirus | DISEASE | 131 |
humans | TAXON | 127 |
camel | TAXON | 127 |
caries | DISEASE | 119 |
dromedary camels | TAXON | 117 |
cov | CHEMICAL | 117 |
gcc | PERSON | 111 |
animals | TAXON | 110 |
coronavirus | TAXON | 104 |
infections | DISEASE | 103 |
mecca | TAXON | 97 |
animal | TAXON | 96 |
pneumonia | DISEASE | 92 |
respiratory syndrome coronavirus mers | DISEASE | 85 |
asp | ORG | 84 |
china | GPE | 83 |
outbreaks | TAXON | 82 |
death | DISEASE | 82 |
deaths | DISEASE | 79 |
makkah | TAXON | 79 |
jeddah | GPE | 75 |
infectious diseases | DISEASE | 74 |
ksa | TAXON | 71 |
rift | TAXON | 68 |
fever | DISEASE | 60 |
adr | ORG | 60 |
middle east | LOC | 59 |
respiratory syndrome | DISEASE | 56 |
depression | DISEASE | 55 |
sars | DISEASE | 54 |
who | ORG | 53 |
cdc | ORG | 49 |
cryptosporidium infection | DISEASE | 49 |
cryptosporidiosis | DISEASE | 47 |
the middle east | LOC | 46 |
south korea | GPE | 43 |
tumors | DISEASE | 42 |
the kingdom of saudi arabia | GPE | 41 |
infectious disease | DISEASE | 41 |
egypt | GPE | 40 |
cough | DISEASE | 39 |
pain | DISEASE | 38 |
spike | ORG | 38 |
riyadh saudi arabia | GPE | 38 |
respiratory syndrome coronavirus infection | DISEASE | 37 |
sa | ORG | 37 |
h1n1 | GPE | 37 |
bats | TAXON | 36 |
najran | GPE | 36 |
parasitic | TAXON | 36 |
nrc | ORG | 35 |
ci | ORG | 35 |
adrs | DISEASE | 35 |
the arabian peninsula | LOC | 34 |
man | TAXON | 34 |
dhf | TAXON | 34 |
france | GPE | 33 |
cryptosporidium oocysts | TAXON | 33 |
coronavirus disease | DISEASE | 32 |
moh | ORG | 32 |
kuwait | GPE | 32 |
gulf | GPE | 32 |
diarrhoea | DISEASE | 31 |
mers cov infections | DISEASE | 31 |
hcw | ORG | 30 |
human metapneumovirus | TAXON | 29 |
umrah | ORG | 29 |
respiratory illness | DISEASE | 27 |
respiratory infections | DISEASE | 27 |
rvf | ORG | 26 |
india | GPE | 26 |
respiratory tract infections | DISEASE | 25 |
wuhan | GPE | 25 |
middle east | LOC | 25 |
qatar | GPE | 24 |
ari | DISEASE | 24 |
human | TAXON | 24 |
the united states | GPE | 24 |
uk | GPE | 24 |
bacteria | TAXON | 24 |
sheep | TAXON | 24 |
infectious | DISEASE | 23 |
sudan | GPE | 22 |
ribavirin | CHEMICAL | 22 |
t2dm | PERSON | 22 |
viral | TAXON | 21 |
rift valley | LOC | 21 |
pilgrims | PERSON | 21 |
pcr | ORG | 21 |
kenya | GPE | 21 |
cc | CHEMICAL | 21 |
mice | TAXON | 21 |
jeddah saudi arabia | GPE | 20 |
africa | LOC | 20 |
covs | TAXON | 20 |
cholera | DISEASE | 20 |
oman | GPE | 20 |
rna | ORG | 20 |
cancer | DISEASE | 20 |
europe | LOC | 19 |
amr | ORG | 19 |
uae | GPE | 19 |
kap | ORG | 19 |
middle east respiratory syndrome | LOC | 19 |
human coronavirus | TAXON | 18 |
bias | CHEMICAL | 18 |
prevalence | ORG | 18 |
jordan | GPE | 18 |
zoonotic infections | DISEASE | 17 |
dogs | TAXON | 17 |
yemen | GPE | 17 |
infection | DISEASE | 17 |
rbd | ORG | 16 |
wnv | TAXON | 16 |
sr | ORG | 16 |
camelids | TAXON | 16 |
newcastle | GPE | 16 |
iran | GPE | 16 |
amino acid | CHEMICAL | 16 |
goats | TAXON | 16 |
critically ill | DISEASE | 16 |
zoonotic diseases | DISEASE | 16 |
hypertension | DISEASE | 16 |
diarrhea | DISEASE | 16 |
foodborne | TAXON | 16 |
dromedaries | TAXON | 16 |
zoonotic disease | DISEASE | 15 |
dengue | DISEASE | 15 |
tumor | DISEASE | 15 |
covid 19 | ORG | 15 |
respiratory syndrome coronavirus mers | DISEASE | 15 |
cattle | TAXON | 15 |
viruses | TAXON | 15 |
diabetes | DISEASE | 15 |
domestic | TAXON | 15 |
dromedary camel | TAXON | 15 |
nodes | CHEMICAL | 15 |
us | GPE | 14 |
cryptosporidiosis | ORG | 14 |
influenza | ORG | 14 |
kingdom | GPE | 14 |
respiratory syndrome mers | DISEASE | 14 |
saudi moh | LOC | 14 |
bacterial | TAXON | 14 |
usa | GPE | 14 |
virus | TAXON | 14 |
mosquitoes | TAXON | 14 |
statin | CHEMICAL | 14 |
diarrhoeal | DISEASE | 14 |
pa | ORG | 13 |
ahfv | PERSON | 13 |
cryptosporidium spp | TAXON | 13 |
giardia | TAXON | 13 |
medina | GPE | 13 |
bat | TAXON | 13 |
taif | TAXON | 13 |
tick | TAXON | 13 |
birds | TAXON | 13 |
nucleotide | CHEMICAL | 13 |
the republic of korea | GPE | 13 |
spss | ORG | 12 |
buraydah | ORG | 12 |
coronavirus disease | DISEASE | 12 |
italy | GPE | 12 |
marseille | GPE | 12 |
the world health organization | ORG | 12 |
respiratory syndrome | DISEASE | 12 |
pms | CHEMICAL | 12 |
west nile | LOC | 12 |
acute respiratory syndrome | DISEASE | 12 |
bronchopneumonia | GPE | 12 |
rabies | TAXON | 12 |
respiratory disease | DISEASE | 12 |
the saudi ministry of health | ORG | 12 |
the united arab emirates | GPE | 12 |
sars cov 2 | ORG | 12 |
england | GPE | 11 |
alkhurma | ORG | 11 |
asia | LOC | 11 |
assiri | CHEMICAL | 11 |
bahrain | GPE | 11 |
camel | GPE | 11 |
canada | GPE | 11 |
ecmo | ORG | 11 |
ethiopia | GPE | 11 |
primary mers | DISEASE | 11 |
syncytial virus | TAXON | 11 |
respiratory syndrome coronavirus | DISEASE | 11 |
mers cov rna | ORG | 11 |
parvum | TAXON | 11 |
hosts | TAXON | 11 |
brucellosis | DISEASE | 11 |
calves | TAXON | 10 |
cancer | DISEASE | 10 |
hais | DISEASE | 10 |
healthcare | ORG | 10 |
korea | GPE | 10 |
mers cov infected | DISEASE | 10 |
mauritania | GPE | 10 |
mela | DISEASE | 10 |
qassim | GPE | 10 |
ribavirin | PERSON | 10 |
cats | TAXON | 10 |
zoonotic infection | DISEASE | 10 |
coronavirus infection | DISEASE | 10 |
coronaviruses | TAXON | 10 |
flavored milk | DISEASE | 10 |
immunocompromised | DISEASE | 10 |
ncov | ORG | 10 |
parasites | TAXON | 10 |
respiratory syndrome mers | DISEASE | 10 |
statins | CHEMICAL | 10 |
hajj specimens | PERSON | 9 |
gulf cooperation council | ORG | 9 |
camelus | GPE | 9 |
cchf | DISEASE | 9 |
abha | TAXON | 9 |
australia | GPE | 9 |
anxiety | ORG | 9 |
animal | TAXON | 9 |
al | CHEMICAL | 9 |
seir | ORG | 9 |
klebsiella | PERSON | 9 |
hydroxychloroquine | CHEMICAL | 9 |
alpacas | TAXON | 9 |
respiratory syndrome coronavirus infections | DISEASE | 9 |
bites | TAXON | 9 |
viral rna | TAXON | 9 |
the ministry of health | ORG | 9 |
the middle east | LOC | 9 |
respiratory syndrome coronavirus mers cov infection | DISEASE | 9 |
host | TAXON | 9 |
febrile cough | DISEASE | 9 |
diseases | DISEASE | 9 |
icd | ORG | 8 |
north africa | GPE | 8 |
n | ORG | 8 |
makkah saudi arabia | GPE | 8 |
mmf | ORG | 8 |
mers infection | DISEASE | 8 |
kingdom of saudi arabia | GPE | 8 |
cryptosporidium infections | DISEASE | 8 |
hrv | ORG | 8 |
h5n1 | TAXON | 8 |
fever | DISEASE | 8 |
escherichia | PERSON | 8 |
alkhurma hemorrhagic fever | DISEASE | 8 |
al qassim | LOC | 8 |
rt pcr | PERSON | 8 |
pain | DISEASE | 8 |
world health organization | ORG | 8 |
sph | ORG | 8 |
malaria | TAXON | 8 |
turkey | GPE | 8 |
viral diseases | DISEASE | 8 |
shortness of breath | DISEASE | 8 |
respiratory syndrome coronavirus disease | DISEASE | 8 |
protozoa | TAXON | 8 |
mosquito | TAXON | 8 |
ruminants | TAXON | 8 |
injuries | DISEASE | 8 |
human coronaviruses | TAXON | 8 |
dengue fever | DISEASE | 8 |
astrocytomas | DISEASE | 8 |
acute kidney injury | DISEASE | 8 |
viral infections | DISEASE | 8 |
influenza | ORG | 8 |
mers pneumonia | DISEASE | 7 |
igg | ORG | 7 |
israel | GPE | 7 |
japan | GPE | 7 |
netherlands | GPE | 7 |
middle east respiratory syndrome coronavirus | LOC | 7 |
middle eastern | LOC | 7 |
nd 4 0 international license it | CHEMICAL | 7 |
humans | TAXON | 7 |
ili | ORG | 7 |
al madinah | PERSON | 7 |
ORG | 7 | |
dhf infection | DISEASE | 7 |
cruz | PERSON | 7 |
crimean | ORG | 7 |
caries | DISEASE | 7 |
camaran | GPE | 7 |
btv | TAXON | 7 |
pbs | ORG | 7 |
al ahsa | PERSON | 7 |
newcastle united | ORG | 7 |
mecca saudi arabia | GPE | 7 |
pneumonia | GPE | 7 |
foodborne outbreaks | TAXON | 7 |
riyadh city | GPE | 7 |
viral infection | DISEASE | 7 |
respiratory failure | DISEASE | 7 |
parasitic infections | DISEASE | 7 |
oseltamivir | CHEMICAL | 7 |
metapneumovirus infection | DISEASE | 7 |
meningioma | GPE | 7 |
low back pain | DISEASE | 7 |
human infection | DISEASE | 7 |
gaps | DISEASE | 7 |
muris | TAXON | 7 |
dromedary | TAXON | 7 |
coronavirus covid | DISEASE | 7 |
chronic disease | DISEASE | 7 |
avian | TAXON | 7 |
the saudi ministry of health | ORG | 7 |
streptococcus | GPE | 7 |
singapore | GPE | 7 |
curlews | TAXON | 7 |
sars cov | ORG | 7 |
mers cov infection | ORG | 6 |
islam | ORG | 6 |
kim | PERSON | 6 |
king fahad medical city | ORG | 6 |
london | GPE | 6 |
mers cov ebola | ORG | 6 |
pakistan | GPE | 6 |
mng | DISEASE | 6 |
magnet | PERSON | 6 |
ornithodoros | TAXON | 6 |
riyadh province | GPE | 6 |
salmonella spp | TAXON | 6 |
human infection | DISEASE | 6 |
infectious diseases | DISEASE | 6 |
brazil | GPE | 6 |
gad | ORG | 6 |
eastern mediterranean | LOC | 6 |
dubai | GPE | 6 |
depression | DISEASE | 6 |
dengue | DISEASE | 6 |
dammam | GPE | 6 |
coronavirus disease | DISEASE | 6 |
camelus dromedarius | TAXON | 6 |
cvi | ORG | 6 |
cchfv | TAXON | 6 |
animals | TAXON | 6 |
aaf | PERSON | 6 |
statins | PERSON | 6 |
spain | GPE | 6 |
camels camelus dromedarius | TAXON | 6 |
syria | GPE | 6 |
influenza a | DISEASE | 6 |
zoonotic viral diseases | DISEASE | 6 |
the kingdom of saudi arabia | GPE | 6 |
sepsis | DISEASE | 6 |
rhesus macaques | TAXON | 6 |
respiratory syndrome corona virus mers | DISEASE | 6 |
respiratory symptoms | DISEASE | 6 |
respiratory distress syndrome | DISEASE | 6 |
rabies virus | TAXON | 6 |
plants | TAXON | 6 |
obesity | DISEASE | 6 |
nucleotides | CHEMICAL | 6 |
mouse | TAXON | 6 |
meleagridis | TAXON | 6 |
respiratory infection | DISEASE | 6 |
hemorrhagic fever | DISEASE | 6 |
bronchial asthma | DISEASE | 6 |
viral rna | TAXON | 6 |
gliomas | DISEASE | 6 |
united arab emirates | GPE | 6 |
waterborne | TAXON | 6 |
alcohol | CHEMICAL | 6 |
ORG | 6 | |
bronchiolitis | GPE | 6 |
diabetes mellitus | DISEASE | 6 |
farms | TAXON | 6 |
foxes | TAXON | 6 |
jeddah makkah | TAXON | 5 |
larsen 1978 | ORG | 5 |
hong kong | GPE | 5 |
johne s disease | DISEASE | 5 |
k | CHEMICAL | 5 |
khalafalla | PERSON | 5 |
kumbh mela | PERSON | 5 |
kuwaiti | ORG | 5 |
malaysia | GPE | 5 |
likert | ORG | 5 |
mph | ORG | 5 |
madinah | ORG | 5 |
makkah city | GPE | 5 |
manchester city | LOC | 5 |
mcgill tukey | PERSON | 5 |
mexico | GPE | 5 |
hcov emc | PERSON | 5 |
mina | GPE | 5 |
hesn | ORG | 5 |
atlanta | GPE | 5 |
had | DISEASE | 5 |
gastrointestinal infections | DISEASE | 5 |
oie | ORG | 5 |
anova | ORG | 5 |
al hanawi | PERSON | 5 |
al tawfiq | PERSON | 5 |
alhamoudi | GPE | 5 |
arabi | CHEMICAL | 5 |
arafat | PERSON | 5 |
brucellosis | GPE | 5 |
cfr | ORG | 5 |
clos | CHEMICAL | 5 |
cmlv | GPE | 5 |
covid19 | ORG | 5 |
coronavirus covid | DISEASE | 5 |
cryptosporidium parvum | TAXON | 5 |
dhf virus | TAXON | 5 |
dumat aljundal | LOC | 5 |
gmw | ORG | 5 |
nni | ORG | 5 |
human rhinovirus | TAXON | 5 |
respiratory syndrome coronavirus | DISEASE | 5 |
gastroenteritis | DISEASE | 5 |
glucose | CHEMICAL | 5 |
human infections | DISEASE | 5 |
infected | DISEASE | 5 |
leukopenia | GPE | 5 |
musculoskeletal disorders | DISEASE | 5 |
nasal carriage | DISEASE | 5 |
oxygen | CHEMICAL | 5 |
parasite | TAXON | 5 |
protozoan parasites | TAXON | 5 |
respiratory diseases | DISEASE | 5 |
respiratory syndrome mers coronavirus | DISEASE | 5 |
the united kingdom | GPE | 5 |
the world health organization who | ORG | 5 |
ticks | TAXON | 5 |
virus infection | DISEASE | 5 |
weight loss | DISEASE | 5 |
results | PERSON | 5 |
gastrointestinal symptoms | DISEASE | 5 |
thrombocytopenia | GPE | 5 |
febrile | DISEASE | 5 |
back pain | DISEASE | 5 |
salmonella | PERSON | 5 |
domestic animals | TAXON | 5 |
serologic | ORG | 5 |
uganda | GPE | 5 |
acute respiratory syndrome coronavirus 2 sars cov | DISEASE | 5 |
adverse drug reactions | DISEASE | 5 |
ambiguity | DISEASE | 5 |
arboviruses | TAXON | 5 |
trypanosoma evansi | TAXON | 5 |
breast milk | DISEASE | 5 |
dexamethasone | CHEMICAL | 5 |
chronic kidney disease | DISEASE | 5 |
coronavirus mers | DISEASE | 5 |
cryptosporidial | TAXON | 5 |
diarrhoeal diseases | DISEASE | 5 |
death anxiety | DISEASE | 5 |
camel products | TAXON | 5 |
madjid | GPE | 4 |
mgs | CHEMICAL | 4 |
lack | PERSON | 4 |
los | DISEASE | 4 |
kruskal wallis | LOC | 4 |
king abdullah international medical research center | ORG | 4 |
iraq | GPE | 4 |
kaaden 2002 | PERSON | 4 |
jizan | LOC | 4 |
iqr | ORG | 4 |
ii | ORG | 4 |
ifn | ORG | 4 |
id | DISEASE | 4 |
marseille france | PERSON | 4 |
ibm | ORG | 4 |
makkah saudi | GPE | 4 |
philippines | GPE | 4 |
microsoft | ORG | 4 |
morocco | GPE | 4 |
mycobacterium | PERSON | 4 |
nri | ORG | 4 |
neisseria | GPE | 4 |
nepal | GPE | 4 |
pprv | ORG | 4 |
premier league | ORG | 4 |
rs | PERSON | 4 |
rv | ORG | 4 |
respiratory distress syndrome | DISEASE | 4 |
rift valley fever | LOC | 4 |
riyadh kingdom | GPE | 4 |
sas | ORG | 4 |
hiv | TAXON | 4 |
hajj pilgrims | PERSON | 4 |
chan | PERSON | 4 |
ghazal | PERSON | 4 |
crimean congo | ORG | 4 |
saudi vision | ORG | 4 |
ag | ORG | 4 |
alanazi | PERSON | 4 |
alenazi thamer | PERSON | 4 |
arabia ksa | TAXON | 4 |
asiri | ORG | 4 |
bmc | ORG | 4 |
bvdv | TAXON | 4 |
bacteria | TAXON | 4 |
bashtawi | ORG | 4 |
bats camels | TAXON | 4 |
bioedit | ORG | 4 |
brucella | TAXON | 4 |
cholera | GPE | 4 |
crimean congo hemorrhagic fever | DISEASE | 4 |
germany | GPE | 4 |
cryptosporidium contamination | DISEASE | 4 |
den | CHEMICAL | 4 |
dfa | ORG | 4 |
dexamethasone | PERSON | 4 |
diarrhea | PERSON | 4 |
dietary | PERSON | 4 |
diptera culicidae | PERSON | 4 |
east africa | GPE | 4 |
epidemic | DISEASE | 4 |
epidemiological | ORG | 4 |
ethics | ORG | 4 |
flaviviridae | TAXON | 4 |
foodborne | TAXON | 4 |
ganges | PERSON | 4 |
sd | DISEASE | 4 |
russia | GPE | 4 |
social | ORG | 4 |
musculoskeletal pain | DISEASE | 4 |
poisoning | DISEASE | 4 |
parasitic infection | DISEASE | 4 |
overweight | DISEASE | 4 |
organisms | TAXON | 4 |
oocysts | TAXON | 4 |
myalgia | DISEASE | 4 |
multi organ failure | DISEASE | 4 |
influenza a h1n1 | DISEASE | 4 |
middle east | LOC | 4 |
metapneumovirus infections | DISEASE | 4 |
meningitis | DISEASE | 4 |
melitensis | TAXON | 4 |
medulloblastoma | DISEASE | 4 |
mammals | TAXON | 4 |
primary mers cov infections | DISEASE | 4 |
protozoan | TAXON | 4 |
respiratory syndrome coronavirus pneumonia | DISEASE | 4 |
respiratory viruses | TAXON | 4 |
rhinovirus | TAXON | 4 |
swine | TAXON | 4 |
the centers for disease control and prevention | ORG | 4 |
the institutional review board | ORG | 4 |
the mers cov | ORG | 4 |
the mean absolute percentage error mape | ORG | 4 |
the premier league | ORG | 4 |
the saudi commission for health specialties | ORG | 4 |
viral disease | DISEASE | 4 |
viral zoonotic diseases | DISEASE | 4 |
virus disease | DISEASE | 4 |
vivo | GPE | 4 |
wildlife | TAXON | 4 |
influenza like illness | DISEASE | 4 |
smoking | CHEMICAL | 4 |
hmpv infections | DISEASE | 4 |
avian influenza | PERSON | 4 |
gastrointestinal diseases | DISEASE | 4 |
somalia | GPE | 4 |
south africa | GPE | 4 |
south asia | LOC | 4 |
stryjewski | ORG | 4 |
the world health organization who | ORG | 4 |
toxocara canis | TAXON | 4 |
united kingdom | GPE | 4 |
wadi addawasir | PERSON | 4 |
acute febrile illness | DISEASE | 4 |
acute respiratory distress syndrome | DISEASE | 4 |
acute respiratory syndrome sars | DISEASE | 4 |
amino acids | CHEMICAL | 4 |
astrocytoma | DISEASE | 4 |
tuberculosis | DISEASE | 4 |
camels cattle | TAXON | 4 |
desert | TAXON | 4 |
foodborne diseases | DISEASE | 4 |
cancers | DISEASE | 4 |
fluoride | CHEMICAL | 4 |
febrile illness | DISEASE | 4 |
failure | DISEASE | 4 |
dog | TAXON | 4 |
dromedary camel herd | TAXON | 4 |
coronavirus infected pneumonia | DISEASE | 4 |
cord_uid | ORG | 4 |
congestive heart failure | DISEASE | 4 |
ciprofloxacin | CHEMICAL | 4 |
chronic diseases | DISEASE | 4 |
chlorine | CHEMICAL | 4 |
mva | TAXON | 3 |
lebanon | GPE | 3 |
mohsa | ORG | 3 |
moe | ORG | 3 |
marsh 2003 | PERSON | 3 |
mers covs | ORG | 3 |
mers cov mers cov | ORG | 3 |
lopinavir ritonavir | CHEMICAL | 3 |
levene | GPE | 3 |
lessons | ORG | 3 |
infect dis doi | PERSON | 3 |
lama glama | PERSON | 3 |
knowledge | ORG | 3 |
kerala | GPE | 3 |
karbala | GPE | 3 |
ksa cov 19 model | ORG | 3 |
individuals | TAXON | 3 |
igm | ORG | 3 |
molecular | GPE | 3 |
il usa | ORG | 3 |
mecca hajj | PERSON | 3 |
respiratory syndrome coronavirus mers cov infection | DISEASE | 3 |
muslims | CHEMICAL | 3 |
mycobacterium avium | TAXON | 3 |
hospital | PERSON | 3 |
saudi arabia knowledge | GPE | 3 |
saharan africa | GPE | 3 |
rift valley | LOC | 3 |
review | ORG | 3 |
respiratory tract infection | DISEASE | 3 |
respiratory syndrome coronavirus infection | DISEASE | 3 |
rabies | TAXON | 3 |
rvf disease | DISEASE | 3 |
results | ORG | 3 |
python | ORG | 3 |
prophet | PERSON | 3 |
poisson | GPE | 3 |
pipistrellus bat coronavirus | TAXON | 3 |
pi batcov | PERSON | 3 |
pcr rflp | ORG | 3 |
oc43 | ORG | 3 |
nasal | PERSON | 3 |
n a | CHEMICAL | 3 |
hydroxychloroquine | CHEMICAL | 3 |
alkhurma virus | TAXON | 3 |
hpiv | TAXON | 3 |
bunyaviridae | TAXON | 3 |
bmi | ORG | 3 |
bbc | ORG | 3 |
arabic | DISEASE | 3 |
arabia viral | TAXON | 3 |
anopheles | TAXON | 3 |
americas | TAXON | 3 |
alnattah 2018 | PERSON | 3 |
alnattah | CHEMICAL | 3 |
saudi arabia prevalence | GPE | 3 |
alharbi | CHEMICAL | 3 |
albaha | CHEMICAL | 3 |
al taif | PERSON | 3 |
al ahsa saudi arabia | PERSON | 3 |
akhter | PERSON | 3 |
afghanistan | GPE | 3 |
asr | ORG | 3 |
alri | ORG | 3 |
adv | ORG | 3 |
acpe | DISEASE | 3 |
belgium | GPE | 3 |
cairo | GPE | 3 |
haly | ORG | 3 |
california | GPE | 3 |
hai | ORG | 3 |
h3n2 virus | TAXON | 3 |
golgi | GPE | 3 |
genomic | ORG | 3 |
fda | ORG | 3 |
fao | CHEMICAL | 3 |
emerg infect dis | PERSON | 3 |
el | CHEMICAL | 3 |
eastern | ORG | 3 |
emc | ORG | 3 |
eb | CHEMICAL | 3 |
dental | ORG | 3 |
death | DISEASE | 3 |
culex | TAXON | 3 |
cross | ORG | 3 |
cox | PERSON | 3 |
coronaviridae | ORG | 3 |
chlamydia | TAXON | 3 |
challenges | ORG | 3 |
saudi arabia lack | GPE | 3 |
intestinal parasitic infections | DISEASE | 3 |
saudi ministry of hajj | ORG | 3 |
meat | TAXON | 3 |
respiratory distress | DISEASE | 3 |
renal failure | DISEASE | 3 |
rabbits | TAXON | 3 |
pox | DISEASE | 3 |
nucleic acid | CHEMICAL | 3 |
nonhuman | TAXON | 3 |
nanoparticles | CHEMICAL | 3 |
mouthwash | CHEMICAL | 3 |
mosquito bites | TAXON | 3 |
lung infection | DISEASE | 3 |
flaviviruses | TAXON | 3 |
lopinavir | CHEMICAL | 3 |
llama lama | TAXON | 3 |
journal | ORG | 3 |
interstitial pneumonia | DISEASE | 3 |
infectious and parasitic diseases | DISEASE | 3 |
humidity | DISEASE | 3 |
human rabies | TAXON | 3 |
human human | TAXON | 3 |
house | TAXON | 3 |
respiratory syncytial virus infection | DISEASE | 3 |
respiratory syndrome coronavirus mers | DISEASE | 3 |
respiratory syndrome coronavirus mers cov infections | DISEASE | 3 |
respiratory syndrome coronavirus illness | DISEASE | 3 |
sharikhealth | ORG | 3 |
zoonotic viral disease | DISEASE | 3 |
wheezing | DISEASE | 3 |
vomiting | DISEASE | 3 |
vitamin d | CHEMICAL | 3 |
virus sequences | TAXON | 3 |
virus hcov | TAXON | 3 |
viral respiratory infections | DISEASE | 3 |
viral genome | TAXON | 3 |
ventricular tachycardia | ORG | 3 |
the national neurologic institute | ORG | 3 |
the middle east respiratory syndrome coronavirus | LOC | 3 |
the kingdom | GPE | 3 |
the eastern mediterranean region | LOC | 3 |
sheep goats | TAXON | 3 |
septic | DISEASE | 3 |
sec | ORG | 3 |
respiratory viral infections | DISEASE | 3 |
respiratory tract infection | DISEASE | 3 |
fluke dicrocoelium dendriticum | TAXON | 3 |
the saudi ministry of health moh | ORG | 3 |
flavivirus | TAXON | 3 |
trypanosoma | LOC | 3 |
al 2014 | PERSON | 3 |
acute respiratory infection | DISEASE | 3 |
abortion | DISEASE | 3 |
wickham | ORG | 3 |
western saudi arabia | GPE | 3 |
vero | ORG | 3 |
usd | ORG | 3 |
tumors | DISEASE | 3 |
tumor | DISEASE | 3 |
time | ORG | 3 |
al 2018 | PERSON | 3 |
thompkins | PERSON | 3 |
the world health organization | ORG | 3 |
the new york times | ORG | 3 |
taenia | TAXON | 3 |
syrian | TAXON | 3 |
sweden | GPE | 3 |
springer nature | PERSON | 3 |
fever cough | DISEASE | 3 |
sindbis | TAXON | 3 |
al 2015 | PERSON | 3 |
the mers cov | ORG | 3 |
animal contact | TAXON | 3 |
coronaviruses 229e | TAXON | 3 |
feral dogs | TAXON | 3 |
fatalities | DISEASE | 3 |
falcons | TAXON | 3 |
equids | TAXON | 3 |
fed | ORG | 3 |
enzootic | TAXON | 3 |
encephalitis | DISEASE | 3 |
diarrheal diseases | DISEASE | 3 |
dromedary camels antibodies | TAXON | 3 |
coronavirus antibodies | TAXON | 3 |
confusion | DISEASE | 3 |
colistin | CHEMICAL | 3 |
chronic heart disease | DISEASE | 3 |
camel coronavirus | TAXON | 3 |
bluetongue virus | TAXON | 3 |
bein sports | ORG | 3 |
azithromycin | CHEMICAL | 3 |
anthroponotic | DISEASE | 3 |
kulldorff | ORG | 2 |
khalafalla abdelmalik | PERSON | 2 |
korea centers for disease and prevention | ORG | 2 |
king khalid university | ORG | 2 |
king faisal university | ORG | 2 |
kharma | PERSON | 2 |
khan | PERSON | 2 |
kor knih | ORG | 2 |
kasem | GPE | 2 |
karnataka | PERSON | 2 |
kaplan meier km | PERSON | 2 |
kt225476 | ORG | 2 |
ksa cov | ORG | 2 |
lambert | GPE | 2 |
kfmrc kau | PERSON | 2 |
jazan province | GPE | 2 |
lms | DISEASE | 2 |
lourdes | PERSON | 2 |
leece | GPE | 2 |
lemeshow | PERSON | 2 |
mers cov illness | ORG | 2 |
jd | ORG | 2 |
mers coronavirus community | ORG | 2 |
mers cov disease | DISEASE | 2 |
mers cov summary | ORG | 2 |
mers cov direct | ORG | 2 |
megax | ORG | 2 |
mcq | ORG | 2 |
map | ORG | 2 |
lung | PERSON | 2 |
lopinavir ritonavir | CHEMICAL | 2 |
lopinavir | PERSON | 2 |
logistic | PERSON | 2 |
llamas | GPE | 2 |
libya | GPE | 2 |
jazan | LOC | 2 |
hubei | GPE | 2 |
ismail | PERSON | 2 |
interim | ORG | 2 |
houhou | GPE | 2 |
hosmer | PERSON | 2 |
hijaz | GPE | 2 |
hemorrhagic fever | DISEASE | 2 |
hajjee | ORG | 2 |
hajj the who | PERSON | 2 |
hajj pilgrimage | ORG | 2 |
hajj these | PERSON | 2 |
hajj pattern | PERSON | 2 |
hajj health | PERSON | 2 |
hafr al batin | GPE | 2 |
hr2 | PERSON | 2 |
hr1 | ORG | 2 |
mers coronavirus mers cov | DISEASE | 2 |
hcq | ORG | 2 |
human metapneumovirus hmpv | TAXON | 2 |
hunter deziel evans | ORG | 2 |
hyalomma | TAXON | 2 |
imperial | ORG | 2 |
interhuman | TAXON | 2 |
interferon | ORG | 2 |
infectious disease | DISEASE | 2 |
infections | DISEASE | 2 |
indonesia | GPE | 2 |
incidence | ORG | 2 |
iggs | TAXON | 2 |
ib | ORG | 2 |
iga | ORG | 2 |
ibrahim asiri | PERSON | 2 |
imagen | ORG | 2 |
iid | ORG | 2 |
iii | ORG | 2 |
ifn 1b | ORG | 2 |
mers diagnosis of mers | PERSON | 2 |
new zealand | GPE | 2 |
mers coronavirus infection | DISEASE | 2 |
nufc | ORG | 2 |
nurses | PERSON | 2 |
noticeable | ORG | 2 |
northern | LOC | 2 |
north america | LOC | 2 |
north africa europe asia | LOC | 2 |
prevalence of cryptosporidium | ORG | 2 |
north | LOC | 2 |
nile fever | DISEASE | 2 |
nika | ORG | 2 |
nidovirales | GPE | 2 |
new york | GPE | 2 |
najran university | ORG | 2 |
naif k | ORG | 2 |
nagappen | PERSON | 2 |
nwcs | TAXON | 2 |
obo aa | CHEMICAL | 2 |
orf1ab | ORG | 2 |
organizational | ORG | 2 |
parasitic | TAXON | 2 |
gulf corporation council | ORG | 2 |
pre hajj | PERSON | 2 |
phocine | GPE | 2 |
peru | GPE | 2 |
paris | GPE | 2 |
paratuberculosis | TAXON | 2 |
parasites vectors | TAXON | 2 |
orthomyxoviridae | TAXON | 2 |
pakpattan | GPE | 2 |
ppe | CHEMICAL | 2 |
pbl | ORG | 2 |
oxoid ltd | ORG | 2 |
outcomes | ORG | 2 |
outbreaks | TAXON | 2 |
nwc | ORG | 2 |
npc | ORG | 2 |
mers infected | DISEASE | 2 |
nl63 | TAXON | 2 |
memish ziad | PERSON | 2 |
melioidosis | DISEASE | 2 |
mekkah | GPE | 2 |
med doi | PERSON | 2 |
maziarz | GPE | 2 |
manzo | GPE | 2 |
mann whitney | PERSON | 2 |
manila | GPE | 2 |
makkah region | TAXON | 2 |
makkah jeddah | LOC | 2 |
magal | CHEMICAL | 2 |
maddina | PERSON | 2 |
mzn | ORG | 2 |
ms | ORG | 2 |
mg | ORG | 2 |
meningioma | GPE | 2 |
meningococcal | PERSON | 2 |
metropolis hastings | PERSON | 2 |
mumbai | GPE | 2 |
nhs | ORG | 2 |
nbj | PERSON | 2 |
na | ORG | 2 |
n95 | ORG | 2 |
mycophenolate mofetil | CHEMICAL | 2 |
mutaz | DISEASE | 2 |
multiagency | PERSON | 2 |
middle east respiratory syndrome coronavirus infection | LOC | 2 |
morbillivirus | TAXON | 2 |
mohammedan | GPE | 2 |
ministry of health 2015 | ORG | 2 |
ministry of health | ORG | 2 |
ministry of agriculture | ORG | 2 |
middle east respiratory syndrome coronavirus mers | DISEASE | 2 |
h1n1 infection | DISEASE | 2 |
alborzi | CHEMICAL | 2 |
groups | ORG | 2 |
alzahrani | PERSON | 2 |
aseer | ORG | 2 |
asaad | PERSON | 2 |
armonk ny | PERSON | 2 |
arabian peninsula | LOC | 2 |
arabian gulf | LOC | 2 |
arabia localities | TAXON | 2 |
arabia zam | TAXON | 2 |
arabia rabies | TAXON | 2 |
arabia human | TAXON | 2 |
arabia genomic | TAXON | 2 |
arab gulf | LOC | 2 |
appendix | GPE | 2 |
anopheles aedes | TAXON | 2 |
ankara | GPE | 2 |
analysis | LOC | 2 |
ashura | GPE | 2 |
avian | TAXON | 2 |
balb | ORG | 2 |
burkholderia mallei | PERSON | 2 |
copd | ORG | 2 |
cns | ORG | 2 |
clo | CHEMICAL | 2 |
cchfv ahfv denv | TAXON | 2 |
cb | ORG | 2 |
butana | GPE | 2 |
bordetella | TAXON | 2 |
bt | ORG | 2 |
bonferroni | PERSON | 2 |
blackboard | ORG | 2 |
bera | GPE | 2 |
bats | TAXON | 2 |
baraz et al 2015 | PERSON | 2 |
bangladesh | GPE | 2 |
amghar moussem | DISEASE | 2 |
altona | PERSON | 2 |
cam jed | PERSON | 2 |
altamimi asmaa | PERSON | 2 |
aedes aegypti | TAXON | 2 |
aedes | TAXON | 2 |
adney et al 23 | PERSON | 2 |
adney | CHEMICAL | 2 |
adnan 2004 | PERSON | 2 |
adenosine | ORG | 2 |
abu dhabi | GPE | 2 |
abdul aziz international airport | PERSON | 2 |
auc | ORG | 2 |
afa | ORG | 2 |
aab | ORG | 2 |
a00298 | ORG | 2 |
104 | ORG | 2 |
1 4904 | CHEMICAL | 2 |
pythia | PERSON | 2 |
aedes vexans | TAXON | 2 |
afif | PERSON | 2 |
agostini | PERSON | 2 |
alhazmi amani | PERSON | 2 |
alsufyani | CHEMICAL | 2 |
alshammari | PERSON | 2 |
alquwez et al | GPE | 2 |
alkhumra | CHEMICAL | 2 |
alkharj alhinakiyah | ORG | 2 |
alisporivir | CHEMICAL | 2 |
algeria | GPE | 2 |
ahmed | PERSON | 2 |
alenazi | CHEMICAL | 2 |
aldilm | GPE | 2 |
alahsa | PERSON | 2 |
al hasa | LOC | 2 |
al ahsa province | GPE | 2 |
airplanes | CHEMICAL | 2 |
covid 19 saudi arabia | ORG | 2 |
camelpox | ORG | 2 |
greece | GPE | 2 |
dromedary bluetongue | ORG | 2 |
falsey | PERSON | 2 |
fagbo | DISEASE | 2 |
facebook twitter | PERSON | 2 |
examples | PERSON | 2 |
elhazmi | GPE | 2 |
el mamy | GPE | 2 |
education | ORG | 2 |
eastern saudi arabia | GPE | 2 |
eastern africa | LOC | 2 |
east respiratory syndrome coronavirus mers | DISEASE | 2 |
east respiratory syndrome coronavirus | DISEASE | 2 |
east | LOC | 2 |
emr | ORG | 2 |
electronic supplementary material | PERSON | 2 |
e coli | TAXON | 2 |
females | ORG | 2 |
finland | GPE | 2 |
front public health | ORG | 2 |
giardia lamblia | TAXON | 2 |
ORG | 2 | |
gompertz | PERSON | 2 |
globally | PERSON | 2 |
global | ORG | 2 |
gliomas | PERSON | 2 |
glioma | GPE | 2 |
ghazi kayali | PERSON | 2 |
ga usa | ORG | 2 |
ghana | GPE | 2 |
georgia | GPE | 2 |
gender | PERSON | 2 |
genbank | ORG | 2 |
gs | CHEMICAL | 2 |
gms | ORG | 2 |
duraffour | ORG | 2 |
djibouti | GPE | 2 |
cauchemez | GPE | 2 |
disney | ORG | 2 |
coronavirus mers cov | ORG | 2 |
coronavirus disease 2019 | ORG | 2 |
coronavirus covid 19 | ORG | 2 |
coronavirus covid 19 | ORG | 2 |
coronavirus covid | CHEMICAL | 2 |
convalescent | DISEASE | 2 |
control | ORG | 2 |
comparative | ORG | 2 |
cov infections | DISEASE | 2 |
cov interim | ORG | 2 |
chloroquine | ORG | 2 |
chicago | GPE | 2 |
chad | DISEASE | 2 |
central saudi arabia | GPE | 2 |
centers for disease control and prevention | ORG | 2 |
corticosteroid | GPE | 2 |
crimean hemorrhagic fever | DISEASE | 2 |
critically ill | DISEASE | 2 |
defi | LOC | 2 |
diagnosis | GPE | 2 |
diabetes mellitus | DISEASE | 2 |
diabetes | DISEASE | 2 |
did | ORG | 2 |
detection of cryptosporidium | ORG | 2 |
dengue fever | DISEASE | 2 |
dm | ORG | 2 |
cronbach | ORG | 2 |
culex tritaeniorhynchus | TAXON | 2 |
cryptosporidium parasite | TAXON | 2 |
cryptosporidium meleagridis | TAXON | 2 |
cryptosporidium genotypes | TAXON | 2 |
cryptosporidium dna | TAXON | 2 |
cryptosporidium cryptosporidium | ORG | 2 |
prince sultan university | ORG | 2 |
masjid | CHEMICAL | 2 |
qassim region | GPE | 2 |
malignant tumors | DISEASE | 2 |
lactate | CHEMICAL | 2 |
interferon | CHEMICAL | 2 |
insomnia | DISEASE | 2 |
influenza virus infection | DISEASE | 2 |
influenza and respiratory syncytial virus | DISEASE | 2 |
infection symptoms disease | DISEASE | 2 |
immune deficiency p 0 0001 | DISEASE | 2 |
hypoxemia | DISEASE | 2 |
hyperesthesia | GPE | 2 |
human respiratory syncytial virus | TAXON | 2 |
human respiratory disease | DISEASE | 2 |
human metapneumovirus | TAXON | 2 |
human disease | DISEASE | 2 |
human coronavirus nl63 | DISEASE | 2 |
human animal | TAXON | 2 |
lopinavir ritonavir | CHEMICAL | 2 |
mallei | TAXON | 2 |
coronavirus ncov infection | DISEASE | 2 |
mammalian | TAXON | 2 |
panic | DISEASE | 2 |
opacities | DISEASE | 2 |
neurological disease | DISEASE | 2 |
neurologic signs | DISEASE | 2 |
neoplasms | DISEASE | 2 |
natural hosts | TAXON | 2 |
myocardial infarction | DISEASE | 2 |
mycophenolic acid | CHEMICAL | 2 |
multiple organ failure | DISEASE | 2 |
multicollinearity | DISEASE | 2 |
mosquito vectors | TAXON | 2 |
micafungin | PERSON | 2 |
meningiomas | DISEASE | 2 |
measles virus | TAXON | 2 |
marmosets | TAXON | 2 |
herds | TAXON | 2 |
hepatitis | DISEASE | 2 |
hemoptysis | DISEASE | 2 |
helminths | TAXON | 2 |
dyspnea | DISEASE | 2 |
dry | DISEASE | 2 |
dromedary camels human | TAXON | 2 |
dromedary camels camelus dromedarius | TAXON | 2 |
donkeys | TAXON | 2 |
domestic cats | TAXON | 2 |
dogs cats rodents | TAXON | 2 |
diarrhoeal disease | DISEASE | 2 |
deserts | TAXON | 2 |
dermatophilosis | TAXON | 2 |
depressive | DISEASE | 2 |
dengue shock syndrome | DISEASE | 2 |
critically ill mers cov | DISEASE | 2 |
cows | TAXON | 2 |
cortisol | GPE | 2 |
eastern province | GPE | 2 |
ed | PERSON | 2 |
enteric cryptosporidiosis | DISEASE | 2 |
gastrointestinal infections | DISEASE | 2 |
healthcare | ORG | 2 |
headache | DISEASE | 2 |
habitats | TAXON | 2 |
gure | DISEASE | 2 |
glioblastoma | DISEASE | 2 |
gel | ORG | 2 |
g mers cov | ORG | 2 |
equines | TAXON | 2 |
forest disease | DISEASE | 2 |
ferritin | GPE | 2 |
feces | TAXON | 2 |
febrile acute respiratory illness | DISEASE | 2 |
fatigue | DISEASE | 2 |
eu | ORG | 2 |
parasitic contamination | DISEASE | 2 |
parasitic disease | DISEASE | 2 |
parasitic diseases | DISEASE | 2 |
the middle east respiratory syndrome mers | LOC | 2 |
unprovoked | DISEASE | 2 |
un | ORG | 2 |
u v | PERSON | 2 |
tuberculosis | DISEASE | 2 |
traumatic | DISEASE | 2 |
trauma | DISEASE | 2 |
tick paralysis | DISEASE | 2 |
throat swab specimens | PERSON | 2 |
throat swab | PERSON | 2 |
the institutional review board of | ORG | 2 |
the united states 11 | GPE | 2 |
the saudi ministry of health 4 | ORG | 2 |
the saudi arabian ministry of health | ORG | 2 |
the red sea | LOC | 2 |
the ministry of health moh | ORG | 2 |
upe | ORG | 2 |
urinary tract infections | DISEASE | 2 |
viral bacterial | TAXON | 2 |
virus genomes | TAXON | 2 |
zoonotic | TAXON | 2 |
qattan | CHEMICAL | 2 |
xogzl1lv | CHEMICAL | 2 |
www mbio ncsu edu | ORG | 2 |
worm | TAXON | 2 |
visas | DISEASE | 2 |
virus h3n2 | TAXON | 2 |
viral diarrhea | DISEASE | 2 |
virus ahfv | TAXON | 2 |
viremia | DISEASE | 2 |
viral respiratory infection | DISEASE | 2 |
viral proteins | TAXON | 2 |
viral polyproteins pp1a | TAXON | 2 |
viral host | TAXON | 2 |
the ministry of health moh | ORG | 2 |
the malay peninsula | LOC | 2 |
parasitic protozoa | TAXON | 2 |
the institutional review board of the bioethics committee | ORG | 2 |
respiratory syndrome coronavirus infections mers | DISEASE | 2 |
respiratory syndrome coronavirus middle east respiratory syndrome coronavirus infections | DISEASE | 2 |
respiratory syndrome coronavirus middle east respiratory syndrome | DISEASE | 2 |
respiratory syndrome coronavirus mers cov mers | DISEASE | 2 |
respiratory syndrome coronavirus a | DISEASE | 2 |
respiratory syndrome coronavirus mers cov infection | DISEASE | 2 |
respiratory cryptosporidiosis | DISEASE | 2 |
pseudoparticle virus | ORG | 2 |
protozoal viral | TAXON | 2 |
primary dentition | DISEASE | 2 |
primary mers infections | DISEASE | 2 |
primary mers cov infection | DISEASE | 2 |
ppnt | ORG | 2 |
pox lesions | DISEASE | 2 |
plaque | DISEASE | 2 |
respiratory tract disease | DISEASE | 2 |
sample1390 hu jed | PERSON | 2 |
sheep cattle | TAXON | 2 |
the council of health services | ORG | 2 |
the ihr emergency committee | ORG | 2 |
the horn of africa | LOC | 2 |
the holy masjid | ORG | 2 |
the health and human sciences ethics committee | ORG | 2 |
the general directorate of health affairs | ORG | 2 |
the creative commons attribution cc | ORG | 2 |
the college of medicine of | ORG | 2 |
shock | DISEASE | 2 |
the arabian gulf | LOC | 2 |
stress anxiety | DISEASE | 2 |
stampedes | CHEMICAL | 2 |
sore | DISEASE | 2 |
social behaviors | DISEASE | 2 |
silvestrol | CHEMICAL | 2 |
coronavirus pandemic covid | DISEASE | 2 |
the king khalid university research ethics committee consent | ORG | 2 |
coronavirus infections | DISEASE | 2 |
seattle | GPE | 2 |
strengths | LOC | 2 |
statin | CHEMICAL | 2 |
stampedes | CHEMICAL | 2 |
sri lanka | GPE | 2 |
sports injuries | DISEASE | 2 |
south america | LOC | 2 |
sochi | CHEMICAL | 2 |
snell r | ORG | 2 |
single | ORG | 2 |
silvestrol | PERSON | 2 |
shiga | GPE | 2 |
shammari | PERSON | 2 |
severe acute respiratory syndrome sars | ORG | 2 |
serology | PERSON | 2 |
seoul | GPE | 2 |
surra | ORG | 2 |
syndromic | DISEASE | 2 |
systematic | LOC | 2 |
tick | TAXON | 2 |
ORG | 2 | |
tropheryma whipplei | TAXON | 2 |
tropheryma | ORG | 2 |
tracker | CHEMICAL | 2 |
toxocara | GPE | 2 |
toronto | GPE | 2 |
therefore sa | ORG | 2 |
tiv | ORG | 2 |
the saudi cancer registry | ORG | 2 |
the kingdom of sa | GPE | 2 |
the gold standard | ORG | 2 |
thailand | GPE | 2 |
tanzania | GPE | 2 |
taibah university | ORG | 2 |
senegal | GPE | 2 |
schwertman owens | PERSON | 2 |
u k | ORG | 2 |
saudi ministry of health | ORG | 2 |
riyadh_kkuh | ORG | 2 |
riyadh s | GPE | 2 |
riyadh regional laboratory | ORG | 2 |
riyadh region | TAXON | 2 |
riyadh cryptosporidium | TAXON | 2 |
richard masters | PERSON | 2 |
respiratory infections | DISEASE | 2 |
respiratory syndrome coronavirus | DISEASE | 2 |
respiratory syndrome mers coronavirus | DISEASE | 2 |
respiratory syndrome coronavirus 2 sars | DISEASE | 2 |
republic of korea | GPE | 2 |
rvfv | TAXON | 2 |
rdp | ORG | 2 |
coronavirus hcov emc infections | DISEASE | 2 |
rvf virus | TAXON | 2 |
rotavirus | ORG | 2 |
roy | PERSON | 2 |
saars | CHEMICAL | 2 |
saudi arabia hospital | ORG | 2 |
saudi arabia risk | GPE | 2 |
saudi arabia recovery | GPE | 2 |
saudi arabia rabies | GPE | 2 |
saudi arabia odds | GPE | 2 |
saudi arabia molecular | GPE | 2 |
saudi arabia infection | GPE | 2 |
saudi arabia epidemiological | GPE | 2 |
sars cov mers cov | ORG | 2 |
saudi arabia 1 | GPE | 2 |
sanche | ORG | 2 |
sabarimala | GPE | 2 |
satscan | CHEMICAL | 2 |
sti | ORG | 2 |
sas institute | ORG | 2 |
ty batcov | CHEMICAL | 2 |
smoh | PERSON | 2 |
uae wernery | ORG | 2 |
camel calves | TAXON | 2 |
brain cancer | DISEASE | 2 |
bovine viral | TAXON | 2 |
bovine cryptosporidium | TAXON | 2 |
bovine | CHEMICAL | 2 |
bocavirus | TAXON | 2 |
betacoronavirus 2c emc 2012 | CHEMICAL | 2 |
baumannii | TAXON | 2 |
bat coronaviruses | TAXON | 2 |
bactrianus | TAXON | 2 |
bacterium | TAXON | 2 |
baboons | TAXON | 2 |
avian coronaviruses | TAXON | 2 |
aspartate | CHEMICAL | 2 |
arthropods | TAXON | 2 |
arid | GPE | 2 |
buffaloes | TAXON | 2 |
camelids nwc sac | TAXON | 2 |
app | ORG | 2 |
caprine | TAXON | 2 |
coronavirus 2019 ncov infections | DISEASE | 2 |
coronavirus antibody | TAXON | 2 |
ukraine | GPE | 2 |
coronavirus 2019 ncov infection | DISEASE | 2 |
corona virus disease | DISEASE | 2 |
communicable disease | DISEASE | 2 |
colistin meropenem | PERSON | 2 |
coagulopathy | DISEASE | 2 |
chronic disease p 0 0001 | DISEASE | 2 |
chronic cardiac disease | DISEASE | 2 |
chlamydia | GPE | 2 |
cats dogs | TAXON | 2 |
carious lesions | DISEASE | 2 |
cardiovascular diseases | DISEASE | 2 |
captive falcons | TAXON | 2 |
arboviral | TAXON | 2 |
catarrhal enteritis | DISEASE | 2 |
wsj | ORG | 2 |
wernery | ORG | 2 |
zika | GPE | 2 |
zarqa | GPE | 2 |
zalm | GPE | 2 |
united states | GPE | 2 |
world health organization oral | ORG | 2 |
wistar | GPE | 2 |
wang et al 2020 | PERSON | 2 |
abdominal pain | DISEASE | 2 |
wto | ORG | 2 |
wnv infection | DISEASE | 2 |
viral respiratory infections | DISEASE | 2 |
vicugna pacos | CHEMICAL | 2 |
varv | PERSON | 2 |
university f | ORG | 2 |
a syndromic surveillance system | ORG | 2 |
wuhan city | GPE | 2 |
univariate | ORG | 2 |
adenovirus vector | TAXON | 2 |
anopheline mosquitoes | TAXON | 2 |
animal products | TAXON | 2 |
anemia | DISEASE | 2 |
amoxicillin metronidazole | ORG | 2 |
abortus | TAXON | 2 |
amino acid sequence | CHEMICAL | 2 |
al 2013 bukhari | PERSON | 2 |
amoxicillin | CHEMICAL | 2 |
acute respiratory disease | DISEASE | 2 |
acute respiratory tract infections | DISEASE | 2 |
acute respiratory illness | DISEASE | 2 |
acute respiratory infections | DISEASE | 2 |
anxiety disorder | DISEASE | 2 |
adenovirus | TAXON | 2 |
levene s | ORG | 1 |
li | CHEMICAL | 1 |
lightmix kit roche applied science basel | ORG | 1 |
leukemia | DISEASE | 1 |
lesson | PERSON | 1 |
leisure department | ORG | 1 |
leisure | ORG | 1 |
leila | GPE | 1 |
leicester city | GPE | 1 |
lege dini water | LOC | 1 |
li et al 7 | PERSON | 1 |
mb ckmb | ORG | 1 |
learning management systems lms | ORG | 1 |
laura wright | PERSON | 1 |
latin america | LOC | 1 |
lately alkhurma | PERSON | 1 |
lastly | ORG | 1 |
larsen | PERSON | 1 |
large rift valley fever | LOC | 1 |
lancet doi | ORG | 1 |
lancet | ORG | 1 |
likelihood | GPE | 1 |
lambert et al | PERSON | 1 |
lama pacos international | ORG | 1 |
lama pacos | TAXON | 1 |
ligue issues | PERSON | 1 |
lys c | PERSON | 1 |
lilla | GPE | 1 |
lyssavirus | PERSON | 1 |
mam | CHEMICAL | 1 |
laboratory | GPE | 1 |
mb nh | ORG | 1 |
mah | ORG | 1 |
maa | ORG | 1 |
ma an mo halw | ORG | 1 |
ma an halw | ORG | 1 |
ma an | ORG | 1 |
m watson john t gerber susan | PERSON | 1 |
m f | PERSON | 1 |
m bertin | PERSON | 1 |
luxembourg luxembourg throat | PERSON | 1 |
liu | PERSON | 1 |
lung infection | DISEASE | 1 |
luminex | ORG | 1 |
lumbar | LOC | 1 |
lu xiaoyan | PERSON | 1 |
lu | PERSON | 1 |
low uptake | PERSON | 1 |
lourdes france | PERSON | 1 |
lopinavir ritonavir lopinavir ritonavir | CHEMICAL | 1 |
loizides f schmidt b the author | CHEMICAL | 1 |
livshiz riven et al 2014 | PERSON | 1 |
liverpool | PERSON | 1 |
laila mohamed ghoneim | PERSON | 1 |
king abdulaziz university hospital | ORG | 1 |
lmwh | ORG | 1 |
lms pgr uh | ORG | 1 |
king abdullah international medical research center kaimrc | ORG | 1 |
king abdulaziz university therefore | ORG | 1 |
king abdulaziz university hospital pattern | ORG | 1 |
king abdulaziz university hospital kauh | ORG | 1 |
king abdulaziz university | ORG | 1 |
king abdulaziz city | GPE | 1 |
king abdulaziz | PERSON | 1 |
kimura | ORG | 1 |
khan et al | PERSON | 1 |
khan anas | PERSON | 1 |
khamis | PERSON | 1 |
khalid musaad | PERSON | 1 |
khalid borsais | PERSON | 1 |
khaled alotair hadil | PERSON | 1 |
khalafalla ai | ORG | 1 |
khairy gabr | PERSON | 1 |
key pair | ORG | 1 |
kerry | PERSON | 1 |
kenya djibouti | PERSON | 1 |
kennedy | PERSON | 1 |
kayali ghazi title middle east respiratory syndrome coronavirus | CHEMICAL | 1 |
kayali ghazi | ORG | 1 |
mega | ORG | 1 |
kato katz | PERSON | 1 |
kate allen | PERSON | 1 |
king abulaziz medical city riyadh | ORG | 1 |
king khalid university hospital | ORG | 1 |
king saud | ORG | 1 |
kritz | PERSON | 1 |
llc mk2 | GPE | 1 |
ldh | ORG | 1 |
kyasanur forest | ORG | 1 |
kyasanur | GPE | 1 |
kuwait usefulness | ORG | 1 |
kuwait oman | GPE | 1 |
kuwait intestinal | GPE | 1 |
kuwait infectious | ORG | 1 |
kuwait environmental | ORG | 1 |
kumbh mela 2013 | PERSON | 1 |
krzywinski | PERSON | 1 |
kossyvakis et al 2015 | PERSON | 1 |
king saud university | ORG | 1 |
korea middle east | ORG | 1 |
korea hospital | ORG | 1 |
kolmogorov smirnov | PERSON | 1 |
kolkata | PERSON | 1 |
knowledge management research practice | ORG | 1 |
kisangani democratic republic of congo 114 | GPE | 1 |
kiribati | GPE | 1 |
kinyoun s | ORG | 1 |
kingdom of saudi arabia knowledge | GPE | 1 |
kingdom of saudi arabia integrated vector management strategic framework | GPE | 1 |
king saud university college of dentistry kingdom | ORG | 1 |
md fs smr | ORG | 1 |
mg medicine | ORG | 1 |
mena | ORG | 1 |
mahmoud aly et al | PERSON | 1 |
magnet recognition program | ORG | 1 |
madinah kingdom | GPE | 1 |
madeenah | PERSON | 1 |
madagascar rift valley | LOC | 1 |
madagascar entomological | ORG | 1 |
madagascar | GPE | 1 |
mop | ORG | 1 |
moh call 937 service center for inquires | ORG | 1 |
mng ha mng | DISEASE | 1 |
mn403101 mn403102 | CHEMICAL | 1 |
mn403101 | GPE | 1 |
mmf none | PERSON | 1 |
mh am fa | ORG | 1 |
methods data | ORG | 1 |
merscoronavirus mers cov | ORG | 1 |
mers pneumonia cov infection | DISEASE | 1 |
mers cov | PERSON | 1 |
mers coronaviruses nl63 229e | DISEASE | 1 |
mers coronavirus infected | DISEASE | 1 |
mers coronavirus mers cov the virus the host | DISEASE | 1 |
mers coronavirus mers | DISEASE | 1 |
mers coronavirus infection | DISEASE | 1 |
mers study | ORG | 1 |
mers nct02845843 arabi et al 2018a | ORG | 1 |
mers lack | PERSON | 1 |
mahakumbh mela | PERSON | 1 |
mahmoud m shehata mokhtar | PERSON | 1 |
mer cov | ORG | 1 |
majali | CHEMICAL | 1 |
mass gathering | GPE | 1 |
karbala city | GPE | 1 |
masjids | ORG | 1 |
marzooq m al eknah | PERSON | 1 |
martin luther king | PERSON | 1 |
marseille real | PERSON | 1 |
marseille close | PERSON | 1 |
marital | ORG | 1 |
mann whitney u | PERSON | 1 |
mann whitney signed | PERSON | 1 |
manefield | PERSON | 1 |
manchester united a | ORG | 1 |
managing mers cov | ORG | 1 |
mammalian | TAXON | 1 |
malaysia public | ORG | 1 |
malawi community | ORG | 1 |
malaria | DISEASE | 1 |
makkah sa | GPE | 1 |
makkah province | GPE | 1 |
makkah medina | GPE | 1 |
makkah kingdom | GPE | 1 |
makkah influenza | PERSON | 1 |
makkah al mukarramah | GPE | 1 |
makka al mukarramah region | GPE | 1 |
makerere university teaching hospitals indian community | ORG | 1 |
mers hajj journey | PERSON | 1 |
mers gossner et al 2016 | ORG | 1 |
mers cov task force committee | ORG | 1 |
mers cov seropositivity | ORG | 1 |
mers cov fact sheet | ORG | 1 |
mers cov examples | ORG | 1 |
mers cov evidence | ORG | 1 |
mers cov epidemiology | ORG | 1 |
mers cov epidemiological | ORG | 1 |
mers cov camel | ORG | 1 |
mers cov azhar et al 2014 | ORG | 1 |
mers cov audiovisuals | ORG | 1 |
mers cov assays | ORG | 1 |
mers cov announcement of the coronavirus study group transmission | ORG | 1 |
mers cov analysis | ORG | 1 |
mers cov alkhurma | ORG | 1 |
mers cov accessory orfs | ORG | 1 |
mers cov a systematic review | ORG | 1 |
mers cov 8 | ORG | 1 |
mers cov 6 classification | ORG | 1 |
mers cov 6 bats | ORG | 1 |
mers cov 59 | ORG | 1 |
mers cov 56 | ORG | 1 |
mers cov 46 | ORG | 1 |
mers cov 22nd | ORG | 1 |
mers cov 22 | ORG | 1 |
mers cov 12 | ORG | 1 |
mers cov 10 | ORG | 1 |
mers cov | ORG | 1 |
mers cov isolation | ORG | 1 |
mers cov middle east | ORG | 1 |
mers cov n2 | ORG | 1 |
mers cov who world health organization investigation of cases | ORG | 1 |
mers cov information | ORG | 1 |
mers cov influenza | ORG | 1 |
mers cov infection cluster | DISEASE | 1 |
mers cov infection scepticism | DISEASE | 1 |
mers cov infection pneumonia | DISEASE | 1 |
mers cov infection mers | DISEASE | 1 |
mers cov infection a | DISEASE | 1 |
mers cov e thailand disease outbreak news | ORG | 1 |
mers cov dynamics | ORG | 1 |
mers cov cluster | DISEASE | 1 |
mers cov clades | ORG | 1 |
mers cov travel | ORG | 1 |
mers cov phylogenetically mers cov | ORG | 1 |
mers cov spike | ORG | 1 |
mers cov special | ORG | 1 |
mers cov situation | ORG | 1 |
mers cov signs | ORG | 1 |
mers cov saudi arabia | ORG | 1 |
mers cov s1 enzyme | ORG | 1 |
mers cov s | ORG | 1 |
mers cov ribavirin | ORG | 1 |
mers cov republic of korea | GPE | 1 |
mers cov progress | ORG | 1 |
mers cov presence of middle east | ORG | 1 |
karl mccartny | PERSON | 1 |
human coronaviruses 229e nl63 | TAXON | 1 |
karanis panagiotis title cryptosporidium and cryptosporidiosis | ORG | 1 |
hepatitis c | DISEASE | 1 |
human dromedary camel | TAXON | 1 |
mateq | CHEMICAL | 1 |
human coronavirus | TAXON | 1 |
human animal | TAXON | 1 |
huichol | PERSON | 1 |
hui 2016 | PERSON | 1 |
hufuf kfu hku | PERSON | 1 |
hufuf | PERSON | 1 |
hubbs 10 | ORG | 1 |
hrazi | CHEMICAL | 1 |
hotel dieu de france | ORG | 1 |
hospital outbreak | ORG | 1 |
hosni mubarak | PERSON | 1 |
homogeneous | PERSON | 1 |
home h | ORG | 1 |
home | PERSON | 1 |
holstein | PERSON | 1 |
holmes 2015 | PERSON | 1 |
hofuf al ahsa | PERSON | 1 |
hoang van thuan gautret philippe | PERSON | 1 |
hinduism modern | ORG | 1 |
hinduism | DISEASE | 1 |
hillsborough | GPE | 1 |
high contagiousness and rapid spread of severe acute respiratory syndrome | ORG | 1 |
higgins | PERSON | 1 |
human infections | DISEASE | 1 |
human metapneumovirus identification | ORG | 1 |
humans middle east | LOC | 1 |
ifa | ORG | 1 |
iran | GPE | 1 |
ipcd | ORG | 1 |
il usa categorical | ORG | 1 |
ii adult | ORG | 1 |
ihr | ORG | 1 |
ifv | ORG | 1 |
ifn β1a | ORG | 1 |
ifn beta1a | CHEMICAL | 1 |
ifn mmf | ORG | 1 |
ifn 1b mmf | CHEMICAL | 1 |
iflb | ORG | 1 |
ictv | ORG | 1 |
humidity | ORG | 1 |
icmje | ORG | 1 |
ich | DISEASE | 1 |
ibm Ò spss | ORG | 1 |
ibm statistical package for the social sciences | ORG | 1 |
ibm corp new york ny usa hcw | ORG | 1 |
ibm corp | ORG | 1 |
iav | ORG | 1 |
hypertension | DISEASE | 1 |
hydroxychloroquine therapy and mortality in hospitalized patients | ORG | 1 |
hyalomma ticks | TAXON | 1 |
hyalomma dromedarii | DISEASE | 1 |
hezam | CHEMICAL | 1 |
hens n a | ORG | 1 |
iv | ORG | 1 |
hemida | GPE | 1 |
hajj travellers | PERSON | 1 |
hajj throat swab | PERSON | 1 |
hajj specimens nasal | PERSON | 1 |
hajj seasons | PERSON | 1 |
hajj season funding | PERSON | 1 |
hajj season | PERSON | 1 |
hajj rituals finally | PERSON | 1 |
hajj nasal swab specimens | PERSON | 1 |
hajj viral | PERSON | 1 |
hajj therefore | PERSON | 1 |
hajj the | PERSON | 1 |
hajj table 3 | PERSON | 1 |
hajj surprisingly | PERSON | 1 |
hajj spatio | PERSON | 1 |
hajj since | PERSON | 1 |
hajj seasons | PERSON | 1 |
hajj saudi arabia | PERSON | 1 |
hajj respiratory | PERSON | 1 |
hajj reimagining | PERSON | 1 |
hajj public | ORG | 1 |
hajj prescribing | PERSON | 1 |
hajj potential | PERSON | 1 |
hajj pilgrimage decisive | ORG | 1 |
hajj pilgrimage | PERSON | 1 |
hajj patterns | PERSON | 1 |
hajra hagar | PERSON | 1 |
hakami | CHEMICAL | 1 |
hala alawagi mohammad al jedai ahmed | PERSON | 1 |
health | ORG | 1 |
hellenic | GPE | 1 |
heilongjiang | GPE | 1 |
heila alharbi sulaiman | PERSON | 1 |
heila | CHEMICAL | 1 |
heba | CHEMICAL | 1 |
healthy swimming program | ORG | 1 |
health products information portal a world health organization | ORG | 1 |
health science | ORG | 1 |
health protection agency | ORG | 1 |
health kingdom of saudi arabia scientific advisory board infection | GPE | 1 |
health affairs directorate | ORG | 1 |
hazazi | CHEMICAL | 1 |
hamilton county | GPE | 1 |
hawai | ORG | 1 |
hatiz cengiz | PERSON | 1 |
hatim al mutairi | PERSON | 1 |
hashem | ORG | 1 |
hasanain | GPE | 1 |
hasan rami alshahrani dayel | PERSON | 1 |
harper collins publishers existential | ORG | 1 |
haque et al | PERSON | 1 |
haque | DISEASE | 1 |
hani almagrabi reem | PERSON | 1 |
hammadi | CHEMICAL | 1 |
isirv antiviral group | ORG | 1 |
ibn saud | PERSON | 1 |
karami | GPE | 1 |
jeddah directorate departments | ORG | 1 |
jordan meningioma | DISEASE | 1 |
jordan united arab emirates | GPE | 1 |
jordan serological | ORG | 1 |
jordan qatar | PERSON | 1 |
jordan kuwait | PERSON | 1 |
jordan geographic | ORG | 1 |
jordan epidemiology | PERSON | 1 |
jordan bahrain | PERSON | 1 |
jordan acute | PERSON | 1 |
joint commission international jci | ORG | 1 |
john kerry | PERSON | 1 |
john hopkins university s interactive | ORG | 1 |
john hall | PERSON | 1 |
jimma zone hospitals patient safety curriculum guide multi professional edition world health organization geneva world health organization who systematic | ORG | 1 |
jiangsu | GPE | 1 |
jerusalem | GPE | 1 |
jeddah s king abdulaziz international airport | PERSON | 1 |
jeddah taif | PERSON | 1 |
jeddah saudi arabia prevalence | GPE | 1 |
jeddah saudi arabia intestinal | GPE | 1 |
jeddah sa | ORG | 1 |
jeddah province of saudi arabia mosquito | GPE | 1 |
jeddah ministry of health saudi arabia | ORG | 1 |
jeddah mecca | GPE | 1 |
jeddah kingdom of saudi arabia | GPE | 1 |
joseph alabdulaziz | PERSON | 1 |
joshi | PERSON | 1 |
journal of | ORG | 1 |
ksa cov 19 | ORG | 1 |
karachi | PERSON | 1 |
kamel al dossari | PERSON | 1 |
kadasah chirwa | PERSON | 1 |
kaczmarczyk | ORG | 1 |
kaaden | PERSON | 1 |
kaaba | GPE | 1 |
ky706247 | CHEMICAL | 1 |
ksa riyadh | TAXON | 1 |
ksa mng ha | ORG | 1 |
ksa descriptive statistics frequencies | ORG | 1 |
ksa data | ORG | 1 |
kr912196 | CHEMICAL | 1 |
journal of cancer epidemiology | ORG | 1 |
kkuh | CHEMICAL | 1 |
kfmc | PERSON | 1 |
kcdcp | ORG | 1 |
k n p and r | CHEMICAL | 1 |
k akt | ORG | 1 |
k a | CHEMICAL | 1 |
jupyter notebooks | DISEASE | 1 |
jupyter notebook | DISEASE | 1 |
jupiter purifi | ORG | 1 |
jup et al | PERSON | 1 |
journal of travel medicine | ORG | 1 |
jeddah kingdom | GPE | 1 |
jeddah city | GPE | 1 |
ibrahim abraham | PERSON | 1 |
jazan university | ORG | 1 |
influenza like illness | DISEASE | 1 |
influenza research | ORG | 1 |
influenza a pandemic h1n1 2009 virus infection | GPE | 1 |
influenza a | ORG | 1 |
infectious diseases of humans dynamics | ORG | 1 |
infectious diseases | ORG | 1 |
infectious disease surveillance animal | GPE | 1 |
infectious disease | DISEASE | 1 |
infection control and pharmaceutical care | ORG | 1 |
infection control department | ORG | 1 |
ineff | ORG | 1 |
indonesia nepal | ORG | 1 |
india gwida | GPE | 1 |
india aceh | GPE | 1 |
incorrect | GPE | 1 |
incheon | ORG | 1 |
inc chicago il usa factors | ORG | 1 |
imported leafy greens | DISEASE | 1 |
importance | GPE | 1 |
impact of covid | ORG | 1 |
igg ab | ORG | 1 |
ig g samples | ORG | 1 |
identification of a | ORG | 1 |
identification of giardia | ORG | 1 |
ibrahim alqurashi mis abrar alqurashi | PERSON | 1 |
institute of medicine of the national academy of sciences | ORG | 1 |
intensive care unit | ORG | 1 |
interestingly the observed association | ORG | 1 |
isolation of mers | ORG | 1 |
jazan region | GPE | 1 |
jamboree wsj | PERSON | 1 |
jamaraat | ORG | 1 |
jamal khashoggi | PERSON | 1 |
jci | ORG | 1 |
j epidemiol glob health | ORG | 1 |
ivan et al | PERSON | 1 |
item | ORG | 1 |
italy middle east | LOC | 1 |
italy identification | ORG | 1 |
istanbul | GPE | 1 |
isolation of | ORG | 1 |
international concern | ORG | 1 |
isolation | ORG | 1 |
islam umrah | ORG | 1 |
ishmael | PERSON | 1 |
isam al jalii | PERSON | 1 |
iran influenza other respir viruses detection | ORG | 1 |
iowa | GPE | 1 |
investigations and implications for the prevention of human to human transmission contact investigation for imported case of middle east respiratory syndrome hospital | ORG | 1 |
intestinal parasitic diseases | DISEASE | 1 |
interventional | ORG | 1 |
international hajj | ORG | 1 |
international diabetes federation guideline development group | ORG | 1 |
mass gatherings | ORG | 1 |
nazarene | CHEMICAL | 1 |
mattioli | GPE | 1 |
python language | DISEASE | 1 |
python keywords regression investment football forecasting | ORG | 1 |
python 73 | ORG | 1 |
punjab | GPE | 1 |
public perceptions and commitment to social distancing staying | ORG | 1 |
public investment fund pif sovereign wealth fund saudi arabia swfi newcastle united | ORG | 1 |
public health | ORG | 1 |
pubmed | PERSON | 1 |
psychometric | PERSON | 1 |
psittaciformes birds cryptosporidium cuniculus | TAXON | 1 |
protozoan parasites | TAXON | 1 |
protozoan | PERSON | 1 |
protocols | ORG | 1 |
protests | CHEMICAL | 1 |
proportion of adult community | ORG | 1 |
promoting | PERSON | 1 |
professionals | DISEASE | 1 |
prof saleh bahashwan | PERSON | 1 |
procopius justinian | PERSON | 1 |
procopius | CHEMICAL | 1 |
proc int | PERSON | 1 |
problem | LOC | 1 |
pring akerblom p rapid | ORG | 1 |
primary infections | DISEASE | 1 |
prevalence of diabetes management | ORG | 1 |
prev med doi | PERSON | 1 |
python language | DISEASE | 1 |
q6 | ORG | 1 |
mauritania morocco | PERSON | 1 |
q6 healthcare | ORG | 1 |
rsvs | PERSON | 1 |
rsv mono infections | DISEASE | 1 |
rsv infections | DISEASE | 1 |
rsv infection | DISEASE | 1 |
rsv a | PERSON | 1 |
roc | GPE | 1 |
rna mers cov | ORG | 1 |
rbd alterations | DISEASE | 1 |
queensland australia | ORG | 1 |
quantitative pcr | ORG | 1 |
quantitative methods authority for statistics | ORG | 1 |
qatar molecular | ORG | 1 |
qatar climate change | ORG | 1 |
qatar an | ORG | 1 |
qatar air sea | ORG | 1 |
qassim province | GPE | 1 |
qassim the cooperation council for the arab states | ORG | 1 |
qassim saudi arabia assessment | ORG | 1 |
qassim sa | ORG | 1 |
qasseem | ORG | 1 |
qaseem riyadh tabouk | PERSON | 1 |
qaddoumi | PERSON | 1 |
qiagen hilden | PERSON | 1 |
qaa rs | PERSON | 1 |
q6 t8 lack | PERSON | 1 |
pretoria university of pretoria outdoor particulate matter pm | ORG | 1 |
predicting the epidemiological outbreak of | ORG | 1 |
predeparture vaccination rabies cdc health information for international travel balantidium | ORG | 1 |
prb 6 carboxyfluorescein fam ttgcaaattggcttgcccccact 6 carboxy n n n n tetramethylrhodamine tamra | CHEMICAL | 1 |
person | PERSON | 1 |
persian gulf | LOC | 1 |
persia | GPE | 1 |
perivascular | ORG | 1 |
peninsula | LOC | 1 |
peng et al | PERSON | 1 |
peng | PERSON | 1 |
peirlinck | PERSON | 1 |
pearson | PERSON | 1 |
payne | PERSON | 1 |
parents | ORG | 1 |
parasitic diseases culicoide | DISEASE | 1 |
parasite | TAXON | 1 |
paramyxoviridae morbillivirus | ORG | 1 |
paralympic games | ORG | 1 |
paraguay | ORG | 1 |
papio hamadryas baboon | TAXON | 1 |
pandemic a h1n1 2009 influenza virus detection | DISEASE | 1 |
panagiotis | DISEASE | 1 |
pamela das | PERSON | 1 |
pallas 1777 | PERSON | 1 |
palestine | GPE | 1 |
pakistan climate | ORG | 1 |
pains | CHEMICAL | 1 |
painful memories reliability | ORG | 1 |
peru estimating | ORG | 1 |
peru police | ORG | 1 |
peter prieto gonzález pablo | PERSON | 1 |
policymakers | ORG | 1 |
prasites cryptosporidium | DISEASE | 1 |
practitioners smoothing | ORG | 1 |
practice kap study | ORG | 1 |
poxviridae phylogenetic | ORG | 1 |
post mers cov | ORG | 1 |
post | ORG | 1 |
possible avian influenza | ORG | 1 |
positive | ORG | 1 |
positioning and power in academic publishing players agents and agendas | ORG | 1 |
portugal | GPE | 1 |
pool filter | PERSON | 1 |
poland | GPE | 1 |
pharmaceutical care department | ORG | 1 |
pogorzelska maziarz | PERSON | 1 |
pogorzelska | GPE | 1 |
pneumoviridae | ORG | 1 |
platinum taq polymerase | ORG | 1 |
plasma sdaia | PERSON | 1 |
piracy | DISEASE | 1 |
pipistrellus bat | TAXON | 1 |
pierre | DISEASE | 1 |
physical fitness | ORG | 1 |
philippe gautret philippe | PERSON | 1 |
philippe gautret | PERSON | 1 |
rsvs human | ORG | 1 |
rt | ORG | 1 |
rti | ORG | 1 |
rhodococcus | LOC | 1 |
robert ahmed qanta | PERSON | 1 |
riyadh region saudi arabia a | TAXON | 1 |
riyadh region saudi arabia | TAXON | 1 |
riyadh tabuk | PERSON | 1 |
riyadh saudi nursing board saudi commission for health specialties legal | ORG | 1 |
riyadh saudi arabia prevalence | GPE | 1 |
riyadh regional lab | ORG | 1 |
riyadh qassim hail | ORG | 1 |
riyadh province | GPE | 1 |
riyadh mecca | GPE | 1 |
riyadh kingdom of saudi arabia institutional review board | GPE | 1 |
riyadh kingdom of saudi arabia complete | GPE | 1 |
riyadh immunity | GPE | 1 |
riyadh children | ORG | 1 |
riyadh al hajjar | GPE | 1 |
riyadh 95 | GPE | 1 |
riyadh 9 | LOC | 1 |
rivera | GPE | 1 |
ritonavir | CHEMICAL | 1 |
risk | PERSON | 1 |
rimini italy | LOC | 1 |
riga latvia | GPE | 1 |
riga | GPE | 1 |
rift valley province rift valley | LOC | 1 |
richards | PERSON | 1 |
roberts et al 2010 | PERSON | 1 |
rockfeller | PERSON | 1 |
roderick mallete | PERSON | 1 |
s aureus 7 5 | TAXON | 1 |
hajj mecca | PERSON | 1 |
saars cov | ORG | 1 |
sa uae | GPE | 1 |
sa qatar uae kuwait | GPE | 1 |
s14 | PERSON | 1 |
s13 introducing | PERSON | 1 |
s12 | ORG | 1 |
s11 prior | ORG | 1 |
s11 completing | ORG | 1 |
s10 | ORG | 1 |
s pneumoniae 7 | TAXON | 1 |
s althomali omar w binsaleh | PERSON | 1 |
roger et al 2000 | PERSON | 1 |
rufaida al asalmiya | PERSON | 1 |
rudolf virchow one | PERSON | 1 |
rudolf virchow 1821 | PERSON | 1 |
royal embassy | ORG | 1 |
rotterdam the netherlands | PERSON | 1 |
rotterdam | PERSON | 1 |
rotavirus disease | DISEASE | 1 |
rome | GPE | 1 |
rolison | GPE | 1 |
roh | PERSON | 1 |
roger et al 2000 roger et al 2001 | PERSON | 1 |
rhodococcus equi infection | DISEASE | 1 |
rhabdoviridae rabies virus | TAXON | 1 |
rtepcr | CHEMICAL | 1 |
rhabdoviridae rabies | ORG | 1 |
renndromedaren fallbereicht melioidosis | PERSON | 1 |
remarks | PERSON | 1 |
related injury | DISEASE | 1 |
regional office | ORG | 1 |
regie b almazan joseph | CHEMICAL | 1 |
red sea | LOC | 1 |
recombination detection programme | ORG | 1 |
recombination detection program | ORG | 1 |
recent progress | PERSON | 1 |
reasons for healthcare workers | ORG | 1 |
rasha a althumiri nora | PERSON | 1 |
raosoft | PERSON | 1 |
rahman saeed | PERSON | 1 |
ragi hanan al qudairy johara al mutairy | PERSON | 1 |
raghib el | PERSON | 1 |
rae | PERSON | 1 |
rabbits | TAXON | 1 |
rvfv dhfv | PERSON | 1 |
rvf zoonotic | ORG | 1 |
rvf virus infection | DISEASE | 1 |
rvf viral disease | DISEASE | 1 |
rvf infections | DISEASE | 1 |
rvf infection | DISEASE | 1 |
rvf epizootics | ORG | 1 |
rvf west nile | ORG | 1 |
res clin pract | PERSON | 1 |
res int | PERSON | 1 |
researchgate | CHEMICAL | 1 |
respiratory syndrome coronavirus mers | DISEASE | 1 |
rev finding | PERSON | 1 |
reuters | ORG | 1 |
retrospective | ORG | 1 |
responses | ORG | 1 |
respiratory tract infections | DISEASE | 1 |
respiratory syndrome coronavirus infection | DISEASE | 1 |
respiratory syndrome coronavirus mers | DISEASE | 1 |
respiratory diseases | DISEASE | 1 |
respiratory cryptosporidiosis | DISEASE | 1 |
respiratory and renal failure | DISEASE | 1 |
respiratory viruses | GPE | 1 |
respiratory syndrome sars | DISEASE | 1 |
resource use associated | ORG | 1 |
respiratory syndrome mers pneumonia | DISEASE | 1 |
respiratory syndrome mers cov | DISEASE | 1 |
respiratory syndrome coronavirus infections | DISEASE | 1 |
respiratory syndrome coronavirus sars | DISEASE | 1 |
respiratory syndrome coronavirus middle east respiratory syndrome coronavirus mers | DISEASE | 1 |
respiratory syndrome coronavirus mers cov infections | DISEASE | 1 |
respiratory syndrome coronavirus critically | DISEASE | 1 |
respiratory syndrome coronavirus 2 | DISEASE | 1 |
respiratory infections aris | DISEASE | 1 |
respiratory illness | DISEASE | 1 |
respiratory coronavirus mers | DISEASE | 1 |
pac dengue fever | ORG | 1 |
prnt | ORG | 1 |
pprconfirmed | ORG | 1 |
mina mecca | GPE | 1 |
molecular evolutionary genetics analysis | ORG | 1 |
molecular evolutionary | PERSON | 1 |
mohsen alsufyani abdulaziz alforihidi mohammed a eidah almalki | PERSON | 1 |
mohieldin | CHEMICAL | 1 |
mohammed mutaz algarni homoud | PERSON | 1 |
mohammed mutaz | PERSON | 1 |
mohammed k angawi khadijah | PERSON | 1 |
mohammed k al hanawi | PERSON | 1 |
mohammad s | GPE | 1 |
mohamed 1996 | PERSON | 1 |
modified vaccinia | LOC | 1 |
modelling cryptosporidium | ORG | 1 |
mobile | GPE | 1 |
mitchell | PERSON | 1 |
miswak | PERSON | 1 |
minnesota infectious | GPE | 1 |
ministry of municipal and rural affairs | ORG | 1 |
ministry of interior change | ORG | 1 |
ministry of health saudi arabia prevalence | ORG | 1 |
ministry of health saudi arabia | ORG | 1 |
ministry of health riyadh saudi arabia zam college of medicine alfaisal university | ORG | 1 |
ministry of health protocol for patients suspected | ORG | 1 |
ministry of health moh | ORG | 1 |
ministry of health moh | ORG | 1 |
ministry of health 2015 health | ORG | 1 |
mongolia | GPE | 1 |
mononegavirales | TAXON | 1 |
monte carlo | PERSON | 1 |
munazza jawed | PERSON | 1 |
mycoplasma | ORG | 1 |
mycophenolate | ORG | 1 |
mycobacterium tuberculosis | CHEMICAL | 1 |
muzdaliff | PERSON | 1 |
mutaz mohammed | PERSON | 1 |
mutaz assiri | CHEMICAL | 1 |
musculoskeletal pain | DISEASE | 1 |
musaad aljuaid sayer title | CHEMICAL | 1 |
musa altwairgi abdullah al dandan sadeq | PERSON | 1 |
musa | PERSON | 1 |
murphy | ORG | 1 |
multivariable | ORG | 1 |
morinda | GPE | 1 |
multidisciplinarity interdisciplinarity | CHEMICAL | 1 |
multidiscip healthc | PERSON | 1 |
muhammad | PERSON | 1 |
ms erin strotheide | LOC | 1 |
mr yahya alqurashi | PERSON | 1 |
mr ahmad haidar al hrazi | PERSON | 1 |
moussem | GPE | 1 |
mount arafat | GPE | 1 |
mosquitoes mosquito | PERSON | 1 |
mosquito vectors | TAXON | 1 |
mosadeghrad | ORG | 1 |
mina saudi arabia | GPE | 1 |
miller | PERSON | 1 |
mörl | CHEMICAL | 1 |
milk flavoured milk | DISEASE | 1 |
mental | ORG | 1 |
medline | ORG | 1 |
mediterranean basin | CHEMICAL | 1 |
mediterranean | LOC | 1 |
medinah city | GPE | 1 |
medina s international | LOC | 1 |
medically | PERSON | 1 |
media center cross | ORG | 1 |
med virol | PERSON | 1 |
med med sci | PERSON | 1 |
med mal | PERSON | 1 |
mecca riyadh | TAXON | 1 |
mecca jeddah | TAXON | 1 |
mecca hajj bin saeed aa carriage | PERSON | 1 |
mecca guests | ORG | 1 |
meat | PERSON | 1 |
measles virus | TAXON | 1 |
measles | ORG | 1 |
mesh | ORG | 1 |
mcnemar s | PERSON | 1 |
mclaughlin | PERSON | 1 |
mccloskey | PERSON | 1 |
mayo clinic implementing | ORG | 1 |
mayo clinic foundation | ORG | 1 |
mauritania peste | ORG | 1 |
meshal | CHEMICAL | 1 |
meta | ORG | 1 |
metapneumovirus | ORG | 1 |
middle brucellosis | GPE | 1 |
mild | ORG | 1 |
mike ashley | PERSON | 1 |
migratory bird characteristics of patients | ORG | 1 |
migrant | ORG | 1 |
middle east respiratory syndrome mers cov | LOC | 1 |
middle east respiratory syndrome effects | LOC | 1 |
middle east respiratory syndrome corticosteroid therapy | LOC | 1 |
middle east respiratory syndrome coronavirus middle east | LOC | 1 |
middle east respiratory syndrome coronavirus international investigation team family | LOC | 1 |
middle east respiratory syndrome coronavirus infection comparative | LOC | 1 |
middle east respiratory syndrome corona virus | LOC | 1 |
microsoft teams universities | ORG | 1 |
methicillin | CHEMICAL | 1 |
microsoft excel | PERSON | 1 |
microsoft corp redmond wa usa | ORG | 1 |
microbes | PERSON | 1 |
micro | LOC | 1 |
mickey | ORG | 1 |
mice | TAXON | 1 |
mgcl 2 solution invitrogen 1 g of | CHEMICAL | 1 |
mexico epidemiological | GPE | 1 |
metropole amoy | CHEMICAL | 1 |
methods epidemiological | ORG | 1 |
methods | PERSON | 1 |
mycoplasma pneumoniae | TAXON | 1 |
n 1191 | CHEMICAL | 1 |
ppr | ORG | 1 |
nooh randa | PERSON | 1 |
ohio | GPE | 1 |
office international des epizooties | ORG | 1 |
odocoileus | ORG | 1 |
occurrence | PERSON | 1 |
occupational musculoskeletal disorders | DISEASE | 1 |
occidental culex | TAXON | 1 |
occasionally | PERSON | 1 |
objectives considering | ORG | 1 |
obesity | DISEASE | 1 |
obama | PERSON | 1 |
owc emerging | ORG | 1 |
owc | ORG | 1 |
orf | ORG | 1 |
ols | ORG | 1 |
o n a data files gni per capita atlas | ORG | 1 |
nurse education | ORG | 1 |
nurs | CHEMICAL | 1 |
nura al | GPE | 1 |
nucleotide | ORG | 1 |
nosocomial infections | DISEASE | 1 |
northern italy | LOC | 1 |
north effective | ORG | 1 |
north america disseminated rhodococcus equi infection | DISEASE | 1 |
north america disseminated rhodococcus | LOC | 1 |
north america asia | LOC | 1 |
old world | ORG | 1 |
olympiad | CHEMICAL | 1 |
oman canary islands | GPE | 1 |
orthopoxvirus | TAXON | 1 |
picos | ORG | 1 |
pcrpositive | ORG | 1 |
pcr assays review article gastrointestinal | ORG | 1 |
pcr enteropathogenic | ORG | 1 |
pa daily | ORG | 1 |
pa taulaniemi | ORG | 1 |
oxygen | ORG | 1 |
oxford university | ORG | 1 |
oversee slaughter | PERSON | 1 |
overlapping | PERSON | 1 |
overall | PERSON | 1 |
ortega | PERSON | 1 |
oman qatar | GPE | 1 |
ornithodoros savignyi ticks mers | DISEASE | 1 |
organization of the saudi | ORG | 1 |
oral health prev dent prevalence | ORG | 1 |
oracle | PERSON | 1 |
omrani | ORG | 1 |
omran city | CHEMICAL | 1 |
omrah | PERSON | 1 |
omar alsehli | PERSON | 1 |
omar | PERSON | 1 |
omani | ORG | 1 |
oman qatar sa | ORG | 1 |
nord | PERSON | 1 |
nonneoplastic | ORG | 1 |
n 1191 the largest sample | CHEMICAL | 1 |
nonhuman | TAXON | 1 |
najran province | GPE | 1 |
najran had | CHEMICAL | 1 |
najran al shehri et al 2005 | PERSON | 1 |
najran 103 104 ahfv | CHEMICAL | 1 |
nada | DISEASE | 1 |
nvivo | ORG | 1 |
nu | ORG | 1 |
nl63 229e | ORG | 1 |
nih | ORG | 1 |
ndrd | DISEASE | 1 |
nd | GPE | 1 |
nct02845843 chan | PERSON | 1 |
nct02845843 | CHEMICAL | 1 |
ncsi | ORG | 1 |
ncaaa | DISEASE | 1 |
nc nd | ORG | 1 |
nar | ORG | 1 |
n s tumors | CHEMICAL | 1 |
n n n n | ORG | 1 |
n helmy hoda z abudawood yasmin alqurashi | CHEMICAL | 1 |
n an es | ORG | 1 |
n a and w k | ORG | 1 |
n 446 | CHEMICAL | 1 |
n 214 statistical | ORG | 1 |
n 214 | CHEMICAL | 1 |
naming the coronavirus disease | DISEASE | 1 |
nasopharyngeal | ORG | 1 |
national center for biotechnology information | ORG | 1 |
newly | ORG | 1 |
nomenclature of viruses ninth report | ORG | 1 |
nitazoxanide | CHEMICAL | 1 |
nile virus infection | DISEASE | 1 |
nile encephalitis | DISEASE | 1 |
nile river | LOC | 1 |
nikon ds | LOC | 1 |
nikon corp tokyo japan | ORG | 1 |
niger somalia | PERSON | 1 |
niger chad | PERSON | 1 |
nicosia cyprus | GPE | 1 |
newport | ORG | 1 |
newcastle united fc | ORG | 1 |
national centers for environmental information weathermetrics functions | ORG | 1 |
new york city usa | GPE | 1 |
new jersey department of health | ORG | 1 |
neuromuscular | ORG | 1 |
neurogenesis | GPE | 1 |
networkx | ORG | 1 |
network | ORG | 1 |
neisseria meningitidis nasopharyngeal carriage | DISEASE | 1 |
neisseria meningitidis bordetella pertussis | DISEASE | 1 |
neisseria meningitides | DISEASE | 1 |
negri | ORG | 1 |
natural burkholderia mallei infection | DISEASE | 1 |
hajj middle east | LOC | 1 |
alsharef ali abraheem erdman dean watson john t gerber susan | PERSON | 1 |
hajj lack | PERSON | 1 |
asymptomatic mers cov | ORG | 1 |
associations | ORG | 1 |
association of categorical | ORG | 1 |
association of higher mers cov virus load with | ORG | 1 |
association | ORG | 1 |
assiri abdullah m midgley | PERSON | 1 |
asiatic | LOC | 1 |
asia europe north america | LOC | 1 |
asia europe africa | LOC | 1 |
asia europe | LOC | 1 |
asia bahrain | LOC | 1 |
asia africa europe | LOC | 1 |
ashraf alaifan | PERSON | 1 |
aseer central hospital | ORG | 1 |
arthropoda | PERSON | 1 |
arsenal | ORG | 1 |
argentina | GPE | 1 |
argene | CHEMICAL | 1 |
archive number severe | ORG | 1 |
archive number 20120920 | ORG | 1 |
arar | ORG | 1 |
arabian camels camelus dromedarius | TAXON | 1 |
arabian camels | TAXON | 1 |
arabian oryx oryx | TAXON | 1 |
arabia respiratory | TAXON | 1 |
arabia records 2 | TAXON | 1 |
asymptomatic | PERSON | 1 |
asymptomatic mers cov infection | ORG | 1 |
hajj human | PERSON | 1 |
asymptomatic middle east | PERSON | 1 |
babiker ahmed waled am title | PERSON | 1 |
bvdv bt | ORG | 1 |
bv bv | ORG | 1 |
btvinfected | ORG | 1 |
bsn | ORG | 1 |
biveriti | ORG | 1 |
bal | GPE | 1 |
ba | ORG | 1 |
azzam alghamdi | PERSON | 1 |
azur insee | PERSON | 1 |
azur | PERSON | 1 |
azlan | GPE | 1 |
azhar | PERSON | 1 |
azaibi alsharef | CHEMICAL | 1 |
ayed abdullah chandramoorthy harish | PERSON | 1 |
away | ORG | 1 |
awaji 14 | ORG | 1 |
awad acharari f genetic | PERSON | 1 |
authors | GPE | 1 |
authority for statistics | ORG | 1 |
austro asiatic | LOC | 1 |
australia the nursing midwifery council | ORG | 1 |
australia parasites vectors subtyping cryptosporidium | ORG | 1 |
australia mellor et al 2008 | ORG | 1 |
athletes | GPE | 1 |
arabia pets | TAXON | 1 |
arabia human | TAXON | 1 |
arabia hosts | TAXON | 1 |
arabia camel | TAXON | 1 |
anthropogenic | ORG | 1 |
anopheles vectors | TAXON | 1 |
anopheles mosquito diptera culicidae | TAXON | 1 |
angus macneil | PERSON | 1 |
anderson | PERSON | 1 |
anas | TAXON | 1 |
amnesty international | ORG | 1 |
amnesty | ORG | 1 |
ammar soliman | ORG | 1 |
amman | GPE | 1 |
aminoacid | CHEMICAL | 1 |
amino acid | CHEMICAL | 1 |
americas africa | GPE | 1 |
american public health association | ORG | 1 |
america | GPE | 1 |
alzahrani et al 2020 baloch et al 2020 mccloskey | ORG | 1 |
alzahrani abdullah g salameh iyad | ORG | 1 |
alyami mohammad h naser abdallah y orabi mohamed | PERSON | 1 |
aly | PERSON | 1 |
alwafi hassan | PERSON | 1 |
alumran arwa title role | PERSON | 1 |
alumran | CHEMICAL | 1 |
altwairgi | CHEMICAL | 1 |
altuwaijri fahad | ORG | 1 |
althumiri | CHEMICAL | 1 |
antibody ab elisa molecular | ORG | 1 |
antimicrobial | ORG | 1 |
anxiety prevalence | PERSON | 1 |
arabia cryptosporidium | TAXON | 1 |
arabia wnv | TAXON | 1 |
arabia vector bionomics | ORG | 1 |
arabia vector | TAXON | 1 |
arabia s arabia | TAXON | 1 |
arabia parasites | TAXON | 1 |
arabia ornithodoros | TAXON | 1 |
arabia mosquito vector | TAXON | 1 |
arabia mosquito fauna diptera culicidae | TAXON | 1 |
arabia molecular | TAXON | 1 |
arabia jeddah makkah | TAXON | 1 |
arabia interhuman | TAXON | 1 |
arabia coronavirus genome | TAXON | 1 |
apicomplexa | TAXON | 1 |
arabia coronavirus | TAXON | 1 |
arabia bacteria | TAXON | 1 |
arabi et al 2018b | PERSON | 1 |
arabi et al | PERSON | 1 |
arabi et | PERSON | 1 |
arabi yaseen | CHEMICAL | 1 |
aqaba | PERSON | 1 |
applied biosystems 3130xl genetic analyzer thermo fisher scientific grand island ny usa | ORG | 1 |
apple green | CHEMICAL | 1 |
apple | ORG | 1 |
appendix 1 | ORG | 1 |
background saudi arabia | GPE | 1 |
backwash | CHEMICAL | 1 |
bactrian | TAXON | 1 |
brucellosis johne | PERSON | 1 |
conclusions | ORG | 1 |
ci 11 19 | ORG | 1 |
cgg | ORG | 1 |
cdc sources of infection risk factors prasites cryptosporidium | ORG | 1 |
cdc financial | ORG | 1 |
cd26 | PERSON | 1 |
ccr5 | ORG | 1 |
cchf virus cchfv | TAXON | 1 |
cchf rift valley | LOC | 1 |
cbahi | CHEMICAL | 1 |
c parvum spp | TAXON | 1 |
c w | ORG | 1 |
butt et al 2016 transmission | ORG | 1 |
bushra alahmadi | CHEMICAL | 1 |
burkina faso initial | ORG | 1 |
burkholderia pseudomallei | DISEASE | 1 |
burkholderia | GPE | 1 |
burden | ORG | 1 |
buraydah kt806006 | CHEMICAL | 1 |
buraydah alahsa | CHEMICAL | 1 |
bunyaviridae phlebovirus | PERSON | 1 |
bulgaria | GPE | 1 |
bukhari | ORG | 1 |
bruijnesteijn van coppenraet et al | PERSON | 1 |
brug | PERSON | 1 |
conv | ORG | 1 |
cop | CHEMICAL | 1 |
corist | DISEASE | 1 |
crp | ORG | 1 |
california rift | CHEMICAL | 1 |
california meyer | ORG | 1 |
california 2007 | CHEMICAL | 1 |
cairo university | ORG | 1 |
cairo rift valley | LOC | 1 |
cy | CHEMICAL | 1 |
cxr | ORG | 1 |
cvds | DISEASE | 1 |
cvd | ORG | 1 |
ctx m | ORG | 1 |
ct | PERSON | 1 |
covid 19 n 1513 | ORG | 1 |
covid 19 4 5 correlation | ORG | 1 |
covid 19 and 80 | ORG | 1 |
covid 19 united states epidemic | ORG | 1 |
covid 19 saudi arabia announces first case of coronavirus explaining | ORG | 1 |
covid 19 report 4 | ORG | 1 |
covid 19 outbreak | ORG | 1 |
covid 19 notes | ORG | 1 |
covid 19 ecdc 2020c | ORG | 1 |
covid 19 coronavirus disease | DISEASE | 1 |
covid 19 coronavirus doctor dies of heart | DISEASE | 1 |
covid 19 characteristics | ORG | 1 |
covid 19 covid 19 | ORG | 1 |
brucellosis enterotoxemia | DISEASE | 1 |
brucella infections | DISEASE | 1 |
bactrian camels | TAXON | 1 |
brucella abortus | TAXON | 1 |
benkouiten samir charrel | ORG | 1 |
benkouiten | CHEMICAL | 1 |
beijing | GPE | 1 |
beigel et al 2018 | ORG | 1 |
beigel et al | GPE | 1 |
behaviours of healthcare workers | ORG | 1 |
behaviours of healthcare workers | ORG | 1 |
behavioural | ORG | 1 |
begel | GPE | 1 |
bazaid | CHEMICAL | 1 |
baxby 1974 | PERSON | 1 |
baxby | PERSON | 1 |
bat | PERSON | 1 |
bastien | PERSON | 1 |
basic books a | ORG | 1 |
bashawry yara alshakweer wafaa al harbi | PERSON | 1 |
baseer | GPE | 1 |
bartlett | PERSON | 1 |
bangkok | GPE | 1 |
balantidium coli | CHEMICAL | 1 |
balantidiasis | GPE | 1 |
bahrain saudi arabia | GPE | 1 |
bahrain melioidosis | GPE | 1 |
badreldin hisham | PERSON | 1 |
badawi et al | ORG | 1 |
berger | GPE | 1 |
bermingham | GPE | 1 |
berrou ilhem | CHEMICAL | 1 |
borana ethiopia | GPE | 1 |
brouqui | CHEMICAL | 1 |
brosio | GPE | 1 |
bronchiolitis | DISEASE | 1 |
breast milk substitutes 9 | DISEASE | 1 |
breast milk | DISEASE | 1 |
breast cancer | DISEASE | 1 |