This is a table of type adverb and their frequencies. Use it to search & browse the list to learn more about your study carrel.
adverb | frequency |
---|---|
also | 8451 |
however | 5236 |
well | 3853 |
significantly | 2586 |
respectively | 2416 |
therefore | 2097 |
previously | 1760 |
highly | 1660 |
even | 1479 |
often | 1288 |
still | 1219 |
first | 1130 |
furthermore | 1063 |
especially | 1054 |
recently | 1027 |
moreover | 963 |
directly | 869 |
prior | 868 |
currently | 864 |
approximately | 846 |
less | 805 |
particularly | 802 |
finally | 766 |
usually | 748 |
together | 730 |
mainly | 686 |
additionally | 651 |
subsequently | 649 |
now | 642 |
potentially | 624 |
relatively | 616 |
commonly | 612 |
specifically | 594 |
frequently | 587 |
generally | 582 |
later | 580 |
rather | 565 |
statistically | 550 |
widely | 543 |
similarly | 541 |
least | 532 |
rapidly | 495 |
indeed | 493 |
much | 491 |
successfully | 486 |
likely | 473 |
almost | 471 |
alone | 470 |
interestingly | 469 |
yet | 438 |
initially | 428 |
fully | 425 |
hence | 423 |
typically | 420 |
closely | 411 |
newly | 411 |
critically | 410 |
overall | 400 |
worldwide | 391 |
far | 389 |
effectively | 381 |
clinically | 378 |
already | 376 |
clearly | 370 |
minimally | 369 |
mostly | 364 |
just | 361 |
thereby | 348 |
strongly | 339 |
completely | 335 |
long | 333 |
primarily | 329 |
probably | 327 |
largely | 326 |
easily | 324 |
better | 314 |
nevertheless | 311 |
instead | 304 |
always | 300 |
importantly | 297 |
nearly | 296 |
increasingly | 287 |
next | 286 |
immediately | 282 |
briefly | 281 |
early | 277 |
notably | 276 |
slightly | 272 |
simultaneously | 262 |
sometimes | 260 |
otherwise | 257 |
independently | 252 |
possibly | 251 |
encephalitis | 250 |
efficiently | 243 |
namely | 242 |
longer | 242 |
positively | 239 |
genetically | 239 |
extremely | 237 |
naturally | 237 |
negatively | 232 |
daily | 217 |
consequently | 217 |
partially | 216 |
globally | 216 |
regardless | 210 |
predominantly | 208 |
rarely | 202 |
poorly | 201 |
randomly | 200 |
overnight | 199 |
double | 199 |
retrospectively | 198 |
greatly | 195 |
earlier | 195 |
n't | 194 |
twice | 192 |
second | 192 |
orally | 192 |
experimentally | 188 |
ultimately | 185 |
ago | 183 |
quickly | 181 |
broadly | 174 |
back | 174 |
consistently | 168 |
forward | 168 |
eventually | 166 |
extensively | 165 |
routinely | 161 |
single | 159 |
quite | 156 |
continuously | 156 |
commercially | 155 |
apart | 155 |
gradually | 145 |
never | 143 |
accordingly | 143 |
perhaps | 142 |
unfortunately | 141 |
severely | 141 |
accurately | 139 |
online | 138 |
likewise | 136 |
actually | 133 |
separately | 132 |
substantially | 131 |
simply | 131 |
away | 131 |
necessarily | 129 |
normally | 128 |
originally | 127 |
locally | 124 |
herein | 123 |
best | 122 |
markedly | 119 |
prospectively | 117 |
nonetheless | 117 |
readily | 116 |
nt | 116 |
soon | 115 |
annually | 115 |
conversely | 112 |
ns3 | 111 |
dramatically | 110 |
enough | 109 |
meanwhile | 108 |
individually | 107 |
equally | 107 |
around | 106 |
exclusively | 105 |
alternatively | 104 |
historically | 104 |
safely | 103 |
correctly | 103 |
remarkably | 101 |
differentially | 101 |
indirectly | 100 |
home | 99 |
laparoscopically | 97 |
carefully | 96 |
serially | 96 |
technically | 95 |
partly | 95 |
ever | 95 |
actively | 95 |
third | 95 |
surprisingly | 94 |
regularly | 94 |
considerably | 93 |
apparently | 92 |
collectively | 92 |
selectively | 91 |
firstly | 90 |
elsewhere | 90 |
systematically | 89 |
entirely | 89 |
totally | 88 |
sufficiently | 88 |
traditionally | 86 |
essentially | 85 |
somewhat | 83 |
solely | 80 |
mechanically | 80 |
functionally | 80 |
certainly | 80 |
thereafter | 79 |
appropriately | 79 |
properly | 77 |
precisely | 75 |
moderately | 75 |
biologically | 75 |
structurally | 74 |
presumably | 74 |
postoperatively | 74 |
obviously | 74 |
chemically | 74 |
nowadays | 73 |
preferentially | 71 |
besides | 71 |
kindly | 71 |
secondly | 70 |
persistently | 70 |
live | 70 |
dsdna | 70 |
right | 69 |
irrespective | 69 |
outside | 68 |
roughly | 67 |
occasionally | 67 |
shortly | 65 |
adequately | 65 |
slowly | 64 |
merely | 64 |
differently | 64 |
exactly | 63 |
stably | 63 |
intranasally | 62 |
tightly | 62 |
manually | 61 |
intravenously | 61 |
lastly | 59 |
faster | 59 |
upstream | 57 |
strictly | 57 |
immunologically | 56 |
transiently | 56 |
phylogenetically | 56 |
repeatedly | 55 |
progressively | 55 |
explicitly | 55 |
either | 55 |
altogether | 55 |
downstream | 54 |
concurrently | 53 |
sequentially | 53 |
heavily | 53 |
fast | 52 |
sexually | 52 |
quantitatively | 51 |
publicly | 51 |
constantly | 51 |
though | 50 |
close | 50 |
virtually | 49 |
really | 49 |
evolutionarily | 49 |
urgently | 49 |
spontaneously | 48 |
operatively | 48 |
mildly | 48 |
ideally | 48 |
free | 46 |
economically | 46 |
theoretically | 46 |
thoroughly | 46 |
medically | 45 |
laparoscopy | 45 |
constitutively | 45 |
purely | 44 |
inversely | 43 |
intraperitoneally | 43 |
covalently | 43 |
uniformly | 42 |
spatially | 42 |
uniquely | 41 |
reliably | 40 |
comprehensively | 40 |
intrinsically | 39 |
asymptotically | 39 |
potently | 39 |
versa | 39 |
unexpectedly | 39 |
presently | 38 |
hardly | 38 |
basically | 38 |
afterwards | 38 |
physiologically | 37 |
maybe | 37 |
lower | 37 |
intriguingly | 37 |
freely | 37 |
conservatively | 37 |
chronically | 36 |
deeply | 36 |
geographically | 36 |
seriously | 36 |
sporadically | 36 |
subcutaneously | 36 |
jointly | 36 |
ribavirin | 35 |
physically | 35 |
late | 35 |
internationally | 35 |
visually | 34 |
undoubtedly | 34 |
reasonably | 34 |
drastically | 34 |
closer | 34 |
automatically | 34 |
aside | 34 |
low | 33 |
antigenically | 33 |
weakly | 33 |
x-100 | 32 |
synergistically | 32 |
near | 32 |
interferon | 32 |
ill | 32 |
higher | 32 |
endoscopically | 32 |
empirically | 32 |
dropwise | 32 |
comparatively | 32 |
ahead | 31 |
along | 31 |
arguably | 31 |
inevitably | 31 |
mutually | 31 |
short | 31 |
steadily | 31 |
universally | 31 |
weekly | 31 |
promptly | 31 |
temporarily | 30 |
formally | 30 |
temporally | 29 |
specially | 29 |
passively | 29 |
officially | 29 |
linearly | 29 |
exceptionally | 29 |
enzymatically | 29 |
computationally | 28 |
intramuscularly | 28 |
high | 28 |
acutely | 28 |
last | 28 |
seemingly | 28 |
qualitatively | 28 |
distantly | 27 |
classically | 27 |
half | 27 |
translationally | 27 |
numerically | 26 |
fundamentally | 26 |
surgically | 26 |
truly | 25 |
socially | 25 |
histologically | 25 |
gently | 25 |
definitely | 25 |
course | 25 |
catalytically | 25 |
abroad | 25 |
semi | 24 |
concomitantly | 24 |
periodically | 24 |
strikingly | 24 |
terminally | 24 |
whereas | 23 |
robustly | 23 |
preoperatively | 23 |
preferably | 23 |
overseas | 23 |
internally | 23 |
fortunately | 23 |
fairly | 23 |
conventionally | 23 |
adversely | 23 |
wide | 23 |
b2c | 22 |
cyclophosphamide | 22 |
intraoperatively | 22 |
artificially | 22 |
exponentially | 22 |
deep | 22 |
viral | 22 |
incidentally | 22 |
radiologically | 22 |
thrice | 22 |
voluntarily | 22 |
inside | 22 |
optimally | 21 |
else | 21 |
formerly | 21 |
fourth | 21 |
freshly | 21 |
inherently | 21 |
legally | 21 |
objectively | 21 |
morphologically | 21 |
permanently | 21 |
productively | 21 |
prominently | 21 |
robotically | 21 |
thereof | 21 |
thirdly | 21 |
unsuccessfully | 21 |
unusually | 21 |
und | 20 |
marginally | 20 |
longitudinally | 20 |
infrequently | 20 |
fluorescently | 20 |
densely | 20 |
competitively | 20 |
asymptomatically | 19 |
abundantly | 19 |
electronically | 19 |
dually | 19 |
externally | 19 |
phenotypically | 19 |
singly | 19 |
systemically | 19 |
intimately | 19 |
therapeutically | 19 |
correspondingly | 18 |
invariably | 18 |
alike | 18 |
evenly | 18 |
financially | 18 |
mechanistically | 18 |
morbidly | 18 |
practically | 18 |
suddenly | 18 |
limd1 | 17 |
intentionally | 17 |
incorrectly | 17 |
continually | 17 |
definitively | 16 |
environmentally | 16 |
distinctly | 16 |
prophylactically | 16 |
barely | 16 |
intensively | 16 |
favorably | 16 |
surely | 16 |
laterally | 16 |
perfectly | 16 |
profoundly | 16 |
reportedly | 16 |
rigorously | 16 |
disproportionately | 15 |
anywhere | 15 |
consecutively | 15 |
bilaterally | 15 |
behind | 15 |
massively | 15 |
analytically | 15 |
afterward | 15 |
absolutely | 15 |
firmly | 15 |
eg | 15 |
scientifically | 15 |
horizontally | 15 |
vertically | 15 |
indoors | 15 |
top | 15 |
sooner | 15 |
ubiquitously | 15 |
radically | 15 |
pdna | 15 |
vrnps | 15 |
magnetically | 15 |
noticeably | 14 |
anatomically | 14 |
chiefly | 14 |
doubly | 14 |
forth | 14 |
gratefully | 14 |
hopefully | 14 |
nasally | 14 |
seldom | 14 |
privately | 14 |
reverse | 14 |
somehow | 14 |
timely | 14 |
topically | 14 |
transcriptionally | 14 |
vastly | 14 |
inadequately | 13 |
intuitively | 13 |
lately | 13 |
intra | 13 |
ssdna | 13 |
evidently | 13 |
epidemiologically | 13 |
modestly | 13 |
little | 13 |
therein | 13 |
monthly | 13 |
onwards | 13 |
principally | 13 |
rationally | 13 |
serologically | 13 |
strategically | 13 |
nationally | 13 |
inappropriately | 12 |
cautiously | 12 |
centrally | 12 |
finely | 12 |
grossly | 12 |
hemodynamically | 12 |
hereafter | 12 |
humanely | 12 |
intensely | 12 |
uneventfully | 12 |
loosely | 12 |
nearby | 12 |
paradoxically | 12 |
peripherally | 12 |
politically | 12 |
thermally | 12 |
lincrna | 12 |
virally | 12 |
dynamically | 11 |
intracellularly | 11 |
hereby | 11 |
mathematically | 11 |
disulfide | 11 |
cold | 11 |
bronchoscopy | 11 |
maternally | 11 |
open | 11 |
matter | 11 |
molecularly | 11 |
proportionally | 11 |
qpcr | 11 |
secondarily | 11 |
visibly | 11 |
metabolically | 11 |
incompletely | 10 |
crucially | 10 |
dose | 10 |
dsrna | 10 |
equivalently | 10 |
excessively | 10 |
fine | 10 |
hitherto | 10 |
p7 | 10 |
invasively | 10 |
lncrnas | 10 |
predominately | 10 |
regionally | 10 |
sharply | 10 |
shrna | 10 |
tentatively | 10 |
falsely | 9 |
exogenously | 9 |
developmentally | 9 |
graphically | 9 |
identically | 9 |
encouragingly | 9 |
intermittently | 9 |
conveniently | 9 |
contrastingly | 9 |
conceptually | 9 |
aseptically | 9 |
appreciably | 9 |
abnormally | 9 |
implicitly | 9 |
remotely | 9 |
iteratively | 9 |
publically | 9 |
taxonomically | 9 |
successively | 9 |
schematically | 9 |
satisfactorily | 9 |
unequivocally | 9 |
majorly | 9 |
proteolytically | 9 |
prematurely | 9 |
post | 9 |
minus | 9 |
microscopically | 9 |
proactively | 9 |
directionally | 8 |
faithfully | 8 |
extraordinarily | 8 |
extracorporeally | 8 |
exceedingly | 8 |
electrostatically | 8 |
dominantly | 8 |
comparably | 8 |
dependently | 8 |
deliberately | 8 |
blindly | 8 |
badly | 8 |
bacterially | 8 |
improperly | 8 |
full | 8 |
fold | 8 |
inadvertently | 8 |
pathologically | 8 |
within | 8 |
uncommonly | 8 |
synthetically | 8 |
seasonally | 8 |
personally | 8 |
per | 8 |
posteriorly | 8 |
outdoors | 8 |
occupationally | 8 |
notoriously | 8 |
microbiologically | 8 |
latently | 8 |
indefinitely | 8 |
ecologically | 7 |
left | 7 |
illegally | 7 |
flat | 7 |
enormously | 7 |
energetically | 7 |
endogenously | 7 |
electrochemically | 7 |
adaptively | 7 |
domestically | 7 |
conclusively | 7 |
conceivably | 7 |
characteristically | 7 |
causally | 7 |
anteriorly | 7 |
neither | 7 |
nationwide | 7 |
sincerely | 7 |
non | 7 |
synchronously | 7 |
noninvasively | 7 |
yearly | 7 |
usefully | 7 |
upwards | 7 |
unambiguously | 7 |
transanally | 7 |
tenfold | 7 |
vrna | 7 |
straight | 7 |
pdcov | 7 |
reversely | 7 |
reproducibly | 7 |
random | 7 |
putatively | 7 |
digitally | 6 |
endemically | 6 |
ethnically | 6 |
etoposide | 6 |
everywhere | 6 |
flexibly | 6 |
henceforth | 6 |
generously | 6 |
infectious | 6 |
imatinib | 6 |
immunosenescence | 6 |
inductively | 6 |
desperately | 6 |
diffusely | 6 |
aunps | 6 |
custom | 6 |
confidently | 6 |
caudally | 6 |
biochemically | 6 |
backward | 6 |
azathioprine | 6 |
autonomously | 6 |
anyway | 6 |
alternately | 6 |
alarmingly | 6 |
aggressively | 6 |
abdominally | 6 |
intratracheally | 6 |
intradermally | 6 |
curiously | 6 |
intravaginally | 6 |
sparsely | 6 |
macroscopically | 6 |
vigorously | 6 |
variably | 6 |
unknowingly | 6 |
unidirectionally | 6 |
twofold | 6 |
trivially | 6 |
thermodynamically | 6 |
technologically | 6 |
superficially | 6 |
super | 6 |
subclinically | 6 |
ði | 6 |
triple | 6 |
south | 6 |
outward | 6 |
soft | 6 |
oncologically | 6 |
onward | 6 |
openly | 6 |
n=18 | 6 |
oppositely | 6 |
overly | 6 |
provisionally | 6 |
rab1404 | 6 |
reversibly | 6 |
since | 6 |
emotionally | 5 |
epigenetically | 5 |
ethically | 5 |
exemplarily | 5 |
fastest | 5 |
foremost | 5 |
intracranially | 5 |
fugitively | 5 |
gdna | 5 |
hard | 5 |
informally | 5 |
instantly | 5 |
irregularly | 5 |
ectopically | 5 |
emergently | 5 |
abortively | 5 |
deeper | 5 |
coincidently | 5 |
clear | 5 |
circumferentially | 5 |
capsid | 5 |
broad | 5 |
boldly | 5 |
beforehand | 5 |
arrhythmias | 5 |
anytime | 5 |
allosterically | 5 |
agriculturally | 5 |
accidentally | 5 |
justifiably | 5 |
-especially | 5 |
irreversibly | 5 |
fresh | 5 |
kind | 5 |
radioactively | 5 |
literally | 5 |
wt1 | 5 |
willingly | 5 |
verbatim | 5 |
upward | 5 |
tremendously | 5 |
sustainably | 5 |
strail | 5 |
somewhere | 5 |
smoothly | 5 |
seamlessly | 5 |
scarcely | 5 |
realistically | 5 |
radiographically | 5 |
unavoidably | 5 |
purposefully | 5 |
n=5 | 5 |
lowest | 5 |
ptrail | 5 |
luciferase | 5 |
meaningfully | 5 |
mistakenly | 5 |
mock | 5 |
mavs | 5 |
ostensibly | 5 |
preliminarily | 5 |
overwhelmingly | 5 |
pcdna | 5 |
pharmacologically | 5 |
proximally | 5 |
homogeneously | 4 |
glabra | 4 |
genotypically | 4 |
generically | 4 |
fourthly | 4 |
für | 4 |
esp | 4 |
farther | 4 |
extracellularly | 4 |
incrementally | 4 |
inconsistently | 4 |
inward | 4 |
indiscriminately | 4 |
inferiorly | 4 |
interchangeably | 4 |
intraabdominally | 4 |
intrapleurally | 4 |
kinetically | 4 |
lightly | 4 |
mentally | 4 |
methodologically | 4 |
entfernt | 4 |
errs | 4 |
broader | 4 |
elegantly | 4 |
contrarily | 4 |
aka | 4 |
albeit | 4 |
anecdotally | 4 |
arbitrarily | 4 |
arna | 4 |
audio | 4 |
basally | 4 |
clockwise | 4 |
commensally | 4 |
cooperatively | 4 |
electrically | 4 |
counter | 4 |
crgd | 4 |
culturally | 4 |
narrowly | 4 |
distally | 4 |
distinctively | 4 |
downward | 4 |
dual | 4 |
electively | 4 |
morally | 4 |
decisively | 4 |
neutrally | 4 |
sterically | 4 |
submucosally | 4 |
succinctly | 4 |
suitably | 4 |
swiftly | 4 |
thematically | 4 |
unilaterally | 4 |
unlikely | 4 |
unnecessarily | 4 |
unstably | 4 |
unsurprisingly | 4 |
vitally | 4 |
votu | 4 |
vs | 4 |
whatsoever | 4 |
wholly | 4 |
wildly | 4 |
worse | 4 |
worst | 4 |
wrongly | 4 |
μl | 4 |
noncovalently | 4 |
subjectively | 4 |
whole | 4 |
spectrophotometrically | 4 |
pretty | 4 |
north | 4 |
sort | 4 |
ns2a | 4 |
nsp15 | 4 |
operationally | 4 |
plasmon | 4 |
prbcs | 4 |
predictably | 4 |
prenatally | 4 |
outwards | 4 |
professionally | 4 |
retrogradely | 4 |
silently | 4 |
prohibitively | 4 |
salicylanilide | 4 |
round | 4 |
religiously | 4 |
recombinantly | 4 |
radially | 4 |
sixfold | 4 |
hadv | 3 |
forensically | 3 |
gp64 | 3 |
geometrically | 3 |
halfway | 3 |
g1f | 3 |
forever | 3 |
exhaustively | 3 |
federally | 3 |
extraperitoneally | 3 |
erroneously | 3 |
ergonomically | 3 |
hemianopia | 3 |
enterically | 3 |
harder | 3 |
insufficiently | 3 |
highest | 3 |
insofar | 3 |
easy | 3 |
ironically | 3 |
inwards | 3 |
intracorporeally | 3 |
intracerebrally | 3 |
interactively | 3 |
insignificantly | 3 |
holistically | 3 |
infinitely | 3 |
incredibly | 3 |
immunochemically | 3 |
höher | 3 |
hydrophobically | 3 |
hugely | 3 |
effortlessly | 3 |
be5028 | 3 |
east | 3 |
categorically | 3 |
20-fold | 3 |
abruptly | 3 |
amply | 3 |
antivirally | 3 |
anymore | 3 |
apicoplast | 3 |
apl | 3 |
astrocyte | 3 |
asymmetrically | 3 |
avidly | 3 |
knowingly | 3 |
bidirectionally | 3 |
biopsy | 3 |
bottom | 3 |
cfdna | 3 |
doubt | 3 |
chromosomally | 3 |
chronologically | 3 |
coincidentally | 3 |
colorimetrically | 3 |
comfortably | 3 |
commensurately | 3 |
compactly | 3 |
concretely | 3 |
congenitally | 3 |
convincingly | 3 |
cumulatively | 3 |
delicately | 3 |
descriptively | 3 |
diversely | 3 |
isotropically | 3 |
consciously | 3 |
lesser | 3 |
statically | 3 |
tight | 3 |
symmetrically | 3 |
symbiotically | 3 |
susceptible | 3 |
supposedly | 3 |
subgroup | 3 |
sometime | 3 |
securely | 3 |
snornas | 3 |
slower | 3 |
slow | 3 |
singularly | 3 |
similarily | 3 |
shorter | 3 |
ubiquitin | 3 |
unanimously | 3 |
undeniably | 3 |
upright | 3 |
usp14 | 3 |
utterly | 3 |
v2.0 | 3 |
variously | 3 |
vehemently | 3 |
vice | 3 |
vividly | 3 |
vp0 | 3 |
wider | 3 |
woefully | 3 |
worryingly | 3 |
Δ10aa | 3 |
lethally | 3 |
serendipitously | 3 |
m | 3 |
recursively | 3 |
opposite | 3 |
limitedly | 3 |
logically | 3 |
logistically | 3 |
mass | 3 |
maximally | 3 |
medicinally | 3 |
meticulously | 3 |
monomerically | 3 |
narratively | 3 |
neurologically | 3 |
nodosa | 3 |
nucleotide | 3 |
nutritionally | 3 |
oft | 3 |
monstrously | 3 |
optically | 3 |
precipitously | 3 |
overtly | 3 |
racially | 3 |
quietly | 3 |
purposely | 3 |
proportionately | 3 |
prime | 3 |
reciprocally | 3 |
pp65 | 3 |
patient | 3 |
paclitaxel | 3 |
rectally | 3 |
perpendicularly | 3 |
popularly | 3 |
forcibly | 2 |
fluorometrically | 2 |
fluorochrome | 2 |
firsthand | 2 |
l506 | 2 |
fescv | 2 |
fecally | 2 |
favourably | 2 |
famously | 2 |
exquisitely | 2 |
expeditiously | 2 |
expectedly | 2 |
expansively | 2 |
filo- | 2 |
dimensionally | 2 |
existentially | 2 |
excitingly | 2 |
evermore | 2 |
etiologically | 2 |
equivocally | 2 |
equitably | 2 |
endonucleolytically | 2 |
eif2α | 2 |
efficaciously | 2 |
doubtless | 2 |
doubtably | 2 |
docetaxel | 2 |
disproportionally | 2 |
discretely | 2 |
direct | 2 |
foul | 2 |
ie | 2 |
frankly | 2 |
il-1β | 2 |
dicer1 | 2 |
ip-2016 | 2 |
intragastric | 2 |
integrally | 2 |
insidiously | 2 |
innately | 2 |
inflamm | 2 |
inferior | 2 |
inexpensively | 2 |
industrially | 2 |
inducibly | 2 |
impressively | 2 |
immensely | 2 |
illicitly | 2 |
il)-2 | 2 |
genuinely | 2 |
igg+ | 2 |
identical | 2 |
i15l | 2 |
hyper | 2 |
hun4 | 2 |
hpiv-4 | 2 |
honestly | 2 |
homeostatically | 2 |
histopathologically | 2 |
hierarchically | 2 |
heterotopia | 2 |
heretofore | 2 |
haemodynamically | 2 |
glaringly | 2 |
different | 2 |
beneficially | 2 |
diagnostically | 2 |
bacha | 2 |
autoradiographically | 2 |
autocatalytically | 2 |
au@pnipam | 2 |
aswell | 2 |
assays | 2 |
asexually | 2 |
aptly | 2 |
apds2 | 2 |
anyhow | 2 |
antiviral | 2 |
antibiotic | 2 |
antenatally | 2 |
anonymously | 2 |
anew | 2 |
amphisome | 2 |
allyl | 2 |
agarose | 2 |
aerobically | 2 |
adoptively | 2 |
additively | 2 |
across | 2 |
ab120722 | 2 |
24/7 | 2 |
2-fold | 2 |
-where | 2 |
-were | 2 |
-tag | 2 |
-protein | 2 |
-hq | 2 |
averagely | 2 |
basolaterally | 2 |
demographically | 2 |
beyond | 2 |
defibrotide | 2 |
dbpia | 2 |
dangerously | 2 |
crystallographically | 2 |
cranially | 2 |
cosmetically | 2 |
contrary | 2 |
contralaterally | 2 |
contemporarily | 2 |
conditionally | 2 |
concordantly | 2 |
concisely | 2 |
complex | 2 |
collaboratively | 2 |
coevolve | 2 |
clonally | 2 |
cd205 | 2 |
casually | 2 |
candidly | 2 |
calorimetrically | 2 |
calmly | 2 |
ca | 2 |
c3ar | 2 |
bx795 | 2 |
boas3.3 | 2 |
bluntly | 2 |
biweekly | 2 |
biosphere | 2 |
bioinformatically | 2 |
ita09 | 2 |
perinatally | 2 |
leftward | 2 |
threefold | 2 |
th | 2 |
teilweise | 2 |
tangentially | 2 |
succefully | 2 |
subtly | 2 |
subliminally | 2 |
sterile | 2 |
stepwise | 2 |
stat5 | 2 |
spread | 2 |
speedily | 2 |
spectacularly | 2 |
southwest | 2 |
someday | 2 |
snuggly | 2 |
smorf | 2 |
site(s | 2 |
sensitively | 2 |
scrupulously | 2 |
safe | 2 |
s1b | 2 |
richly | 2 |
resultantly | 2 |
relevantly | 2 |
relentlessly | 2 |
regrettably | 2 |
regioselectively | 2 |
recurrently | 2 |
reassuringly | 2 |
thankfully | 2 |
tisagenlecleucel | 2 |
rampantly | 2 |
topologically | 2 |
leukemias | 2 |
≥18 | 2 |
±sd | 2 |
® | 2 |
zoonotically | 2 |
youngest | 2 |
wrong | 2 |
wirelessly | 2 |
warmer | 2 |
vp4 | 2 |
virologically | 2 |
versus | 2 |
vaguely | 2 |
vaginally | 2 |
upside | 2 |
upper | 2 |
unterteilen | 2 |
unrealistically | 2 |
unprecedentedly | 2 |
unintentionally | 2 |
understandably | 2 |
underneath | 2 |
unacceptably | 2 |
ultrasonically | 2 |
ubiquitination | 2 |
transplacentally | 2 |
transparently | 2 |
transcardially | 2 |
totalis | 2 |
ready | 2 |
willfully | 2 |
quicker | 2 |
nucleatum | 2 |
nominally | 2 |
no2or | 2 |
nm | 2 |
nlrp3/ | 2 |
neurosurgically | 2 |
neuraminidase | 2 |
neurally | 2 |
neuac | 2 |
necrosectomy | 2 |
nc028752 | 2 |
nalidixic | 2 |
nairovirus | 2 |
n=26 | 2 |
multi | 2 |
monotonically | 2 |
mininally | 2 |
microbially | 2 |
metagenomically | 2 |
mers | 2 |
map | 2 |
magnetic | 2 |
m336 | 2 |
luminometrically | 2 |
lue234 | 2 |
loop | 2 |
longest | 2 |
light | 2 |
purposively | 2 |
liberally | 2 |
nowhere | 2 |
luckily | 2 |
nucleoside | 2 |
phewas | 2 |
protectively | 2 |
nucleus | 2 |
psmpuw | 2 |
promisingly | 2 |
profile | 2 |
proficiently | 2 |
procedurally | 2 |
presumptively | 2 |
prebiotically | 2 |
poignantly | 2 |
pneumatically | 2 |
plus | 2 |
photochemically | 2 |
phosphoinositide | 2 |
programmatically | 2 |
pharmaceutically | 2 |
oronasally | 2 |
perioperatively | 2 |
oligodendrocyte | 2 |
odd | 2 |
ordinarily | 2 |
organically | 2 |
opportunistically | 2 |
orthotopically | 2 |
painfully | 2 |
paternally | 2 |
pcdna3.1-mers | 2 |
n’t | 2 |
peacefully | 2 |
fewer | 1 |
fastidiosa | 1 |
fatally | 1 |
feasibleespecially | 1 |
feasibly | 1 |
final | 1 |
filmy | 1 |
finaly | 1 |
fj376620 | 1 |
fk506 | 1 |
flagellin | 1 |
f(x | 1 |
exponential | 1 |
extrinsically | 1 |
extragenically | 1 |
extra | 1 |
exteremely | 1 |
expressly | 1 |
explosively | 1 |
exosome | 1 |
ev-117 | 1 |
eu240454-eu240456 | 1 |
esophagectomywere | 1 |
fluent | 1 |
erstmalig | 1 |
ergaster | 1 |
float | 1 |
g3-were | 1 |
fluorescein | 1 |
fluoroscopically | 1 |
großzellig | 1 |
epidemically | 1 |
green | 1 |
greater | 1 |
gravitationally | 1 |
gravely | 1 |
good | 1 |
gm066706 | 1 |
glycosidically | 1 |
gii-1-were | 1 |
getv | 1 |
generic | 1 |
gastric | 1 |
gahv-2 | 1 |
fzcuu4ma | 1 |
futhermore | 1 |
funisitis | 1 |
fro | 1 |
foxo3 | 1 |
fortuitously | 1 |
fortnightly | 1 |
forsythoside | 1 |
formoterol | 1 |
forcefully | 1 |
focused | 1 |
equidistantly | 1 |
doi.org/10.1016/j.antiviral.2018.04.016 | 1 |
epha5 | 1 |
doubtlessly | 1 |
dlbcl | 1 |
divergently | 1 |
distal | 1 |
dissimilarly | 1 |
disproven | 1 |
discrete | 1 |
discontinuously | 1 |
disastrously | 1 |
disappointingly | 1 |
direly | 1 |
diplomatically | 1 |
diligently | 1 |
diffusive | 1 |
difficultly | 1 |
didactically | 1 |
diametrically | 1 |
diagnosedonly | 1 |
dhx15 | 1 |
deviceideally | 1 |
detrimentally | 1 |
deterministically | 1 |
destructively | 1 |
dendritically | 1 |
demonstrably | 1 |
h143 | 1 |
dlco | 1 |
downhill | 1 |
eosinophilia | 1 |
duly | 1 |
enzymatic | 1 |
entstehen | 1 |
entstand | 1 |
enterally | 1 |
endoscopist(directly | 1 |
endlessly | 1 |
enantiomerically | 1 |
eminently | 1 |
embryonically | 1 |
emblematically | 1 |
em | 1 |
elevtively | 1 |
electrophysiologically | 1 |
electrocatalytically | 1 |
elaborately | 1 |
einher | 1 |
eines | 1 |
einer | 1 |
educationally | 1 |
ecofriendly | 1 |
ebcu3ywq | 1 |
ear | 1 |
eagerly | 1 |
e564.a | 1 |
e3l | 1 |
h-2k | 1 |
inconveniently | 1 |
h5ha | 1 |
intermittenly | 1 |
interleukin-6 | 1 |
interleukin-1beta | 1 |
interleukin-1-and | 1 |
interfere | 1 |
intellectually | 1 |
intcp | 1 |
instinctively | 1 |
instantaneously | 1 |
inos | 1 |
inmediately | 1 |
inland | 1 |
ingly | 1 |
influenzavirusa | 1 |
infiltriert | 1 |
inextricably | 1 |
inevitablely | 1 |
inefficiently | 1 |
ineffectively | 1 |
indistinctly | 1 |
indisputably | 1 |
deferentially | 1 |
incoherently | 1 |
inarguably | 1 |
imperfectly | 1 |
imperatively | 1 |
interleukin-8 | 1 |
intermolecularly | 1 |
habitually | 1 |
intracardially | 1 |
knesl | 1 |
klrc1 | 1 |
klrb1 | 1 |
kf17 | 1 |
keenly | 1 |
jx292005 | 1 |
justly | 1 |
judiciously | 1 |
jak)/stat | 1 |
j.antiviral.2018.04.016 | 1 |
itamis | 1 |
isotopically | 1 |
irtually | 1 |
irrespectively | 1 |
irbcs | 1 |
irbc | 1 |
iq5 | 1 |
ionically | 1 |
intravascularly | 1 |
intrathoracically | 1 |
intraoperatvely | 1 |
intranodally | 1 |
intrahepatically | 1 |
intracortically | 1 |
intracerebally | 1 |
impairment | 1 |
immunophenotypically | 1 |
immunologic | 1 |
immunohistochemically | 1 |
horrifically | 1 |
hochrepetitiver | 1 |
hlapartially | 1 |
hku15 | 1 |
histrap | 1 |
histomorphologically | 1 |
histochemically | 1 |
hey-1 | 1 |
hev | 1 |
heuristic | 1 |
heterogeneously | 1 |
hereof | 1 |
hereinafter | 1 |
hemodinamically | 1 |
heavy | 1 |
heamodyanemically | 1 |
hdivig | 1 |
hcmv | 1 |
hcdna | 1 |
hbmecs | 1 |
hastily | 1 |
harshly | 1 |
harmoniously | 1 |
happily | 1 |
handly | 1 |
hotly | 1 |
hourly | 1 |
hrhpv | 1 |
i:-were | 1 |
immunogenically | 1 |
immunogenetically | 1 |
immunoassay | 1 |
immitis | 1 |
imagej | 1 |
illegitimately | 1 |
ifn)a | 1 |
id#428729 | 1 |
icΔ5aa | 1 |
icantly | 1 |
ia/2016 | 1 |
hσ | 1 |
hsp90 | 1 |
hypothetically | 1 |
hyperoside | 1 |
hydrothermally | 1 |
hydrophobic | 1 |
hydrophilic | 1 |
hydrolytically | 1 |
humorously | 1 |
https://orcid.org/0000-0002-7141-1785 | 1 |
https://orcid.org/0000-0002-3703-5026 | 1 |
https://doi.org/10.1016/j.cmi.2018.10.016 | 1 |
htrail | 1 |
del(7q | 1 |
butdespecially | 1 |
deductively | 1 |
allogenen | 1 |
alhydrogel | 1 |
alere | 1 |
alaninal | 1 |
airsacculitis | 1 |
ai099100 | 1 |
agalliou | 1 |
ag85b | 1 |
aft | 1 |
afore | 1 |
affirmatively | 1 |
af6b7e03cb374a3d20ac5fc3477bcc9b772bc7ff | 1 |
aerugenosa | 1 |
aek6mvdw | 1 |
adv | 1 |
adquiere | 1 |
admittedly | 1 |
administratively | 1 |
adjustably | 1 |
adipose | 1 |
adherent | 1 |
adept | 1 |
actualymore | 1 |
activitely | 1 |
acsf | 1 |
acoustically | 1 |
allegedly | 1 |
alloimmune | 1 |
accidently | 1 |
alone.6 | 1 |
architecturally | 1 |
approximatelly | 1 |
apparentely | 1 |
apically | 1 |
antriorly | 1 |
antithetically | 1 |
antiparallel | 1 |
antigenomic | 1 |
anticonvulsant | 1 |
anticlockwise | 1 |
anterogradely | 1 |
antagonistically | 1 |
anoxically | 1 |
angesprochen | 1 |
andrographolide | 1 |
andonly | 1 |
anastrazole | 1 |
analogously | 1 |
anaerobically | 1 |
amperometrically | 1 |
aminoacid | 1 |
amino-3-oxetanecarboxylic | 1 |
ambitiously | 1 |
amazingly | 1 |
alongside | 1 |
acetaminophen | 1 |
acceptably | 1 |
decreasingly | 1 |
-untereinheit | 1 |
-strand | 1 |
-so | 1 |
-role | 1 |
-particularly | 1 |
-part | 1 |
-oropharyngeal | 1 |
-o | 1 |
-mollisacacidin | 1 |
-mainly | 1 |
-k99 | 1 |
-i | 1 |
-hiv | 1 |
-high | 1 |
-guide | 1 |
-gu | 1 |
-g3 | 1 |
-fallstudien | 1 |
-early | 1 |
-dually | 1 |
-daily | 1 |
-biotin | 1 |
-before | 1 |
-approximately | 1 |
-2016 | 1 |
-2005 | 1 |
-ttc | 1 |
-www | 1 |
ac | 1 |
.fortunately | 1 |
absolute | 1 |
absichtliche | 1 |
abomasel | 1 |
aberrantly | 1 |
a711aeec6e1007c2896cf9680b9057e615b28cfd | 1 |
a549 | 1 |
a21040 | 1 |
7·4-times | 1 |
6iex | 1 |
6dgi | 1 |
6/2016 | 1 |
6- | 1 |
572/638 | 1 |
50x | 1 |
5-day | 1 |
3′-terminally | 1 |
3rd | 1 |
3prp | 1 |
3/43 | 1 |
1north | 1 |
1e. | 1 |
1bbl | 1 |
105/236 | 1 |
10-fold | 1 |
//doi | 1 |
arg337 | 1 |
arkdpi | 1 |
articulately | 1 |
consurrently | 1 |
consequentially | 1 |
conscientiously | 1 |
conformationally | 1 |
concerningly | 1 |
conatantly | 1 |
completelly | 1 |
complementarily | 1 |
competently | 1 |
colloquially | 1 |
colically | 1 |
coherently | 1 |
coarser | 1 |
clínicas | 1 |
clustalw | 1 |
cleanly | 1 |
cisplatin | 1 |
circumpherentially | 1 |
chromatographically | 1 |
chromatin | 1 |
chemicals(paa | 1 |
cheaply | 1 |
chaotically | 1 |
central | 1 |
center | 1 |
cd45-sap/200 | 1 |
constructively | 1 |
contemporaneously | 1 |
artifactually | 1 |
contiguously | 1 |
decost | 1 |
damn | 1 |
dactylitis | 1 |
d71e | 1 |
cytometric | 1 |
cytoadhere | 1 |
cxcl)-8 | 1 |
customarily | 1 |
currentc | 1 |
curatively | 1 |
curative | 1 |
cttccttccggatcacgtgttcat3 | 1 |
crudely | 1 |
cross | 1 |
credibly | 1 |
creatively | 1 |
countriesespecially | 1 |
counterintuitively | 1 |
cord-290861 | 1 |
cord-003596 | 1 |
copiously | 1 |
coordinately | 1 |
convergently | 1 |
controversially | 1 |
continuous | 1 |
cd3e | 1 |
cd117 | 1 |
cccdna | 1 |
card1 | 1 |
beautifully | 1 |
bdna | 1 |
baseline | 1 |
barefoot | 1 |
bacsc | 1 |
b3-amervac | 1 |
b220 | 1 |
azedarach | 1 |
azadirachtin | 1 |
avws | 1 |
avct12 | 1 |
autophagosome | 1 |
authoritatively | 1 |
authentically | 1 |
aunr | 1 |
auftreten | 1 |
aufgrund | 1 |
atg9b. | 1 |
atg5 | 1 |
asynchronously | 1 |
asthenopia | 1 |
aslo | 1 |
asic3 | 1 |
ascendingly | 1 |
aryl-3-oxo-1-thia-4-azaspiro | 1 |
becomingly | 1 |
behaviorally | 1 |
behaviourally | 1 |
blind | 1 |
cantly | 1 |
cally | 1 |
by~2-fold | 1 |
kritischer | 1 |
bronchoscopically | 1 |
boundedly | 1 |
bother | 1 |
borne | 1 |
boas2.2 | 1 |
blood- | 1 |
bloc1s6 | 1 |
blastn | 1 |
belatedly | 1 |
blast+ | 1 |
bitterly | 1 |
biosynthetically | 1 |
biomedically | 1 |
biofab | 1 |
bigclam | 1 |
biennially | 1 |
bibliographically | 1 |
beside | 1 |
berkeley/1/1968 | 1 |
benignly | 1 |
knockin | 1 |
métodos | 1 |
kt021232 | 1 |
straightaway | 1 |
stnfri | 1 |
stiffly | 1 |
sternlabtau | 1 |
stereotypically | 1 |
staystm | 1 |
starkly | 1 |
squarely | 1 |
square | 1 |
sprechen | 1 |
speculatively | 1 |
spectroscopically | 1 |
spectrally | 1 |
spectral | 1 |
southeast | 1 |
soundly | 1 |
sophisticatedly | 1 |
sonographically | 1 |
somatotopy | 1 |
solubly | 1 |
soluble | 1 |
solidly | 1 |
snugly | 1 |
smooth | 1 |
smallrna | 1 |
sitespecifically | 1 |
stoichiometrically | 1 |
straightforwardly | 1 |
sind | 1 |
straightly | 1 |
tertiary | 1 |
tere | 1 |
ten | 1 |
teleta | 1 |
telemetrically | 1 |
technical | 1 |
t98g | 1 |
t26-t27 | 1 |
synonymously | 1 |
symptomatically | 1 |
sympathectomy | 1 |
sweetly | 1 |
suspiciously | 1 |
susceptibly | 1 |
susceptibleinfectious | 1 |
supinely | 1 |
superspreader-2 | 1 |
sultopride | 1 |
sucessfully | 1 |
substantively | 1 |
subfamily | 1 |
stubbornly | 1 |
stringently | 1 |
stridently | 1 |
strength.4 | 1 |
singlehandedly | 1 |
similarlly | 1 |
quintessentially | 1 |
rightly | 1 |
rifampin | 1 |
rhil-12 | 1 |
rhetorically | 1 |
retrospectivily | 1 |
retrogastrically | 1 |
retroactively | 1 |
retech.rec.1396.349 | 1 |
restrictively | 1 |
resolutely | 1 |
reputedly | 1 |
repetitively | 1 |
repeatly | 1 |
renally | 1 |
remote | 1 |
regretfully | 1 |
red | 1 |
reassembly | 1 |
re- | 1 |
rarelly | 1 |
rapidely | 1 |
raft | 1 |
radiometrically | 1 |
rab11a | 1 |
r511was | 1 |
r01ai033144 | 1 |
rightfully | 1 |
rmb25 | 1 |
signify | 1 |
rnase | 1 |
signfiicantly | 1 |
siginificantly | 1 |
sideways | 1 |
sicker | 1 |
shortest | 1 |
severally | 1 |
sessile | 1 |
serotypically | 1 |
ser1345 | 1 |
seperately | 1 |
sentimentally | 1 |
sensibly | 1 |
semiquantitatively | 1 |
selfassembly | 1 |
secov | 1 |
scfv | 1 |
scarily | 1 |
saliently | 1 |
sadly | 1 |
s1049023x19005144 | 1 |
s1-ctd | 1 |
rurally | 1 |
rs8099917 | 1 |
rrt | 1 |
roomimmediately | 1 |
tfr1-out | 1 |
thereunder | 1 |
thick | 1 |
warmly | 1 |
vris/100 | 1 |
vp35-vp40 | 1 |
vndv | 1 |
vmia | 1 |
viously | 1 |
viably | 1 |
vexingly | 1 |
verses | 1 |
verdachtsdiagnose | 1 |
verbally | 1 |
ventrally | 1 |
varyingly | 1 |
vanishingly | 1 |
valproate | 1 |
vaccineda | 1 |
v1.16.1 | 1 |
usp13 | 1 |
urrently | 1 |
upto | 1 |
upstairs | 1 |
unwillingly | 1 |
unreasonably | 1 |
unquestionably | 1 |
unprofessionally | 1 |
unpredictably | 1 |
vvacv | 1 |
way | 1 |
thicker | 1 |
week'because | 1 |
没收 | 1 |
山西 | 1 |
≥iiib | 1 |
≥4 | 1 |
∼100-fold | 1 |
−0.2 | 1 |
‡freely | 1 |
ϵÞ | 1 |
μct | 1 |
αenv | 1 |
αb | 1 |
ðtÞ. | 1 |
µm | 1 |
zrob20 | 1 |
yu6mw601 | 1 |
yhroughly | 1 |
wrongfully | 1 |
with2episodes,53%were | 1 |
wisely | 1 |
wise | 1 |
wich | 1 |
whereafter | 1 |
wet | 1 |
westward | 1 |
west | 1 |
univocally | 1 |
uninterruptedly | 1 |
unintendedly | 1 |
unfavourably | 1 |
transrectally | 1 |
transmecoscopically | 1 |
translocationally | 1 |
transgenically | 1 |
transcriptase | 1 |
transcervically | 1 |
transabdominally | 1 |
tpox | 1 |
toxicologically | 1 |
total | 1 |
topographically | 1 |
tolerably | 1 |
toghter | 1 |
tobe | 1 |
tnfr-1 | 1 |
tnf-/ifn | 1 |
tistically | 1 |
tirelessly | 1 |
tipically | 1 |
tighter | 1 |
throughly | 1 |
thrombocytopenia | 1 |
thoughtfully | 1 |
thoracoscopically | 1 |
thioredoxin | 1 |
transvaginally | 1 |
transversally | 1 |
transversely | 1 |
umvi0veu | 1 |
unfairly | 1 |
undoubtably | 1 |
undetectably | 1 |
underground | 1 |
unconventionally | 1 |
unconditionally | 1 |
unclearly | 1 |
uncharacteristically | 1 |
uncertainly | 1 |
unbelievably | 1 |
unapologetically | 1 |
ul1tr000058 | 1 |
treacherously | 1 |
ubv.7.2 | 1 |
ubiquitiously | 1 |
u-550 | 1 |
tyro3 | 1 |
twoyearly | 1 |
tu2xrt9x | 1 |
ts | 1 |
trust"-unilaterally | 1 |
trimeric | 1 |
trim79α | 1 |
trim25–rig | 1 |
qv | 1 |
quick | 1 |
ku-55933 | 1 |
nearcomplete | 1 |
nct01875653 | 1 |
nchrt | 1 |
nc8 | 1 |
nbðr | 1 |
natively | 1 |
national | 1 |
nasopharyngeal | 1 |
nasogastric | 1 |
narrow | 1 |
nanotag | 1 |
nanoscopy | 1 |
nanorod | 1 |
nanomaterial | 1 |
nanoassembly | 1 |
n=95 | 1 |
n=87 | 1 |
n=79 | 1 |
n=46 | 1 |
n=41 | 1 |
n=28 | 1 |
n.a.not | 1 |
multimeric | 1 |
multifocally | 1 |
mucosa | 1 |
mucormycosisessentially | 1 |
nct02 | 1 |
nearer | 1 |
mortalitywere | 1 |
nearest | 1 |
nr-50327 | 1 |
nr-50065 | 1 |
np_058197.2 | 1 |
nowdays | 1 |
notionally | 1 |
northwards | 1 |
normatively | 1 |
nonuniformly | 1 |
nontherapeutically | 1 |
nonspecifically | 1 |
nonperinatally | 1 |
nonmedically | 1 |
nonlinearly | 1 |
nongenetically | 1 |
noncompetitively | 1 |
noncatalytically | 1 |
nl63 | 1 |
nimbly | 1 |
nics(1 | 1 |
nicely | 1 |
new | 1 |
neurosurgerywere | 1 |
neurophysiologically | 1 |
neuronally | 1 |
negligibly | 1 |
mowj6wyl | 1 |
morever | 1 |
questionably | 1 |
mac3formely | 1 |
m0ox841z | 1 |
lys574 | 1 |
ly6g | 1 |
luminescently | 1 |
lucketally | 1 |
lso | 1 |
lr-0,52 | 1 |
lpin1β | 1 |
lowly | 1 |
locoregionally | 1 |
lmra | 1 |
lipin2 | 1 |
linguistically | 1 |
lincrnas | 1 |
lilrb2-like | 1 |
lilrb1 | 1 |
let-7a-1 | 1 |
lentiviral | 1 |
legitimately | 1 |
lead | 1 |
latter | 1 |
laporoscopically | 1 |
laporocopically | 1 |
labouriously | 1 |
können | 1 |
m338-were | 1 |
maliciously | 1 |
monotherapy | 1 |
managerially | 1 |
momentarily | 1 |
modularly | 1 |
mockingly | 1 |
mmachine | 1 |
mlst8 | 1 |
mixedly | 1 |
mirdeep2 | 1 |
miraculously | 1 |
minimal | 1 |
mindy-1 | 1 |
midway | 1 |
microcapillary | 1 |
mh766894)-was | 1 |
mh159777-mh159804 | 1 |
mg | 1 |
metrically | 1 |
mengye | 1 |
memorably | 1 |
medially | 1 |
measurably | 1 |
meantime | 1 |
mcgeer | 1 |
maximal | 1 |
materially | 1 |
mandatorily | 1 |
ns4a | 1 |
nsp14-nsp10 | 1 |
nuancedly | 1 |
presciently | 1 |
preperitoneally | 1 |
predominantely | 1 |
precariously | 1 |
prebiologically | 1 |
pragmatically | 1 |
powerfully | 1 |
potty | 1 |
posttranslationally | 1 |
possibily | 1 |
polysome | 1 |
polyclonally | 1 |
poly--1,6-maltotriose | 1 |
pnl4 | 1 |
plasmonically | 1 |
planktonically | 1 |
plainly | 1 |
pkcsm | 1 |
phytochemically | 1 |
phyllosphere | 1 |
photometrically | 1 |
pertain | 1 |
perpetually | 1 |
perpendicular | 1 |
peroralendoscopy | 1 |
peroperatively | 1 |
preponderantly | 1 |
preterminally | 1 |
nuclease | 1 |
prevalently | 1 |
quently | 1 |
quantificationally | 1 |
pyrocarbonate | 1 |
purportedly | 1 |
puppyprotech | 1 |
punctually | 1 |
ptc-200 | 1 |
psychometrically | 1 |
psychologically | 1 |
provocatively | 1 |
proteasomally | 1 |
protease | 1 |
propofol | 1 |
proper | 1 |
promiscuously | 1 |
prognostically | 1 |
procurementwere | 1 |
probabilistically | 1 |
priorly | 1 |
priori | 1 |
primitively | 1 |
primase | 1 |
primairly | 1 |
prifle | 1 |
preventatively | 1 |
permeable | 1 |
perm/ | 1 |
perk | 1 |
perivascullarly | 1 |
outwardly | 1 |
osquito | 1 |
orthogonally | 1 |
org/10.1016 | 1 |
orf4b | 1 |
orbitally | 1 |
optgpsampler | 1 |
operationalise | 1 |
once,9%were | 1 |
omentum | 1 |
oligodeoxynucleotide | 1 |
oligochitosan | 1 |
oftentimes | 1 |
ofcourse | 1 |
obsessively | 1 |
observably | 1 |
obliquely | 1 |
obligately | 1 |
o2e5na78 | 1 |
numerous | 1 |
nuhrd92z | 1 |
nucleos(t)ide | 1 |
nucleoprotein | 1 |
nucleocapsid | 1 |
nucleases | 1 |
ovalbumin | 1 |
oxidative | 1 |
oxidatively | 1 |
participantsindependently | 1 |
perivascularly | 1 |
peritoneally | 1 |
perinuclearly | 1 |
perennially | 1 |
perceptually | 1 |
peculiarly | 1 |
pe)- | 1 |
pbrm1 | 1 |
paticularly | 1 |
past | 1 |
particular | 1 |
parenterally | 1 |
oxyclozanide | 1 |
p=0.34 | 1 |
p=0.232 | 1 |
p=0.034 | 1 |
p=0.027 | 1 |
p=0.016 | 1 |
p<1 | 1 |
p62 | 1 |
p58ipk | 1 |
p1beta_rev2016 | 1 |
p16ink4a | 1 |
oxypaeoniflorin | 1 |
-0.36057544 | 1 |