adverb

This is a table of type adverb and their frequencies. Use it to search & browse the list to learn more about your study carrel.

adverb	frequency
also	8451
however	5236
well	3853
significantly	2586
respectively	2416
therefore	2097
previously	1760
highly	1660
even	1479
often	1288
still	1219
first	1130
furthermore	1063
especially	1054
recently	1027
moreover	963
directly	869
prior	868
currently	864
approximately	846
less	805
particularly	802
finally	766
usually	748
together	730
mainly	686
additionally	651
subsequently	649
now	642
potentially	624
relatively	616
commonly	612
specifically	594
frequently	587
generally	582
later	580
rather	565
statistically	550
widely	543
similarly	541
least	532
rapidly	495
indeed	493
much	491
successfully	486
likely	473
almost	471
alone	470
interestingly	469
yet	438
initially	428
fully	425
hence	423
typically	420
closely	411
newly	411
critically	410
overall	400
worldwide	391
far	389
effectively	381
clinically	378
already	376
clearly	370
minimally	369
mostly	364
just	361
thereby	348
strongly	339
completely	335
long	333
primarily	329
probably	327
largely	326
easily	324
better	314
nevertheless	311
instead	304
always	300
importantly	297
nearly	296
increasingly	287
next	286
immediately	282
briefly	281
early	277
notably	276
slightly	272
simultaneously	262
sometimes	260
otherwise	257
independently	252
possibly	251
encephalitis	250
efficiently	243
namely	242
longer	242
positively	239
genetically	239
extremely	237
naturally	237
negatively	232
daily	217
consequently	217
partially	216
globally	216
regardless	210
predominantly	208
rarely	202
poorly	201
randomly	200
overnight	199
double	199
retrospectively	198
greatly	195
earlier	195
n't	194
twice	192
second	192
orally	192
experimentally	188
ultimately	185
ago	183
quickly	181
broadly	174
back	174
consistently	168
forward	168
eventually	166
extensively	165
routinely	161
single	159
quite	156
continuously	156
commercially	155
apart	155
gradually	145
never	143
accordingly	143
perhaps	142
unfortunately	141
severely	141
accurately	139
online	138
likewise	136
actually	133
separately	132
substantially	131
simply	131
away	131
necessarily	129
normally	128
originally	127
locally	124
herein	123
best	122
markedly	119
prospectively	117
nonetheless	117
readily	116
nt	116
soon	115
annually	115
conversely	112
ns3	111
dramatically	110
enough	109
meanwhile	108
individually	107
equally	107
around	106
exclusively	105
alternatively	104
historically	104
safely	103
correctly	103
remarkably	101
differentially	101
indirectly	100
home	99
laparoscopically	97
carefully	96
serially	96
technically	95
partly	95
ever	95
actively	95
third	95
surprisingly	94
regularly	94
considerably	93
apparently	92
collectively	92
selectively	91
firstly	90
elsewhere	90
systematically	89
entirely	89
totally	88
sufficiently	88
traditionally	86
essentially	85
somewhat	83
solely	80
mechanically	80
functionally	80
certainly	80
thereafter	79
appropriately	79
properly	77
precisely	75
moderately	75
biologically	75
structurally	74
presumably	74
postoperatively	74
obviously	74
chemically	74
nowadays	73
preferentially	71
besides	71
kindly	71
secondly	70
persistently	70
live	70
dsdna	70
right	69
irrespective	69
outside	68
roughly	67
occasionally	67
shortly	65
adequately	65
slowly	64
merely	64
differently	64
exactly	63
stably	63
intranasally	62
tightly	62
manually	61
intravenously	61
lastly	59
faster	59
upstream	57
strictly	57
immunologically	56
transiently	56
phylogenetically	56
repeatedly	55
progressively	55
explicitly	55
either	55
altogether	55
downstream	54
concurrently	53
sequentially	53
heavily	53
fast	52
sexually	52
quantitatively	51
publicly	51
constantly	51
though	50
close	50
virtually	49
really	49
evolutionarily	49
urgently	49
spontaneously	48
operatively	48
mildly	48
ideally	48
free	46
economically	46
theoretically	46
thoroughly	46
medically	45
laparoscopy	45
constitutively	45
purely	44
inversely	43
intraperitoneally	43
covalently	43
uniformly	42
spatially	42
uniquely	41
reliably	40
comprehensively	40
intrinsically	39
asymptotically	39
potently	39
versa	39
unexpectedly	39
presently	38
hardly	38
basically	38
afterwards	38
physiologically	37
maybe	37
lower	37
intriguingly	37
freely	37
conservatively	37
chronically	36
deeply	36
geographically	36
seriously	36
sporadically	36
subcutaneously	36
jointly	36
ribavirin	35
physically	35
late	35
internationally	35
visually	34
undoubtedly	34
reasonably	34
drastically	34
closer	34
automatically	34
aside	34
low	33
antigenically	33
weakly	33
x-100	32
synergistically	32
near	32
interferon	32
ill	32
higher	32
endoscopically	32
empirically	32
dropwise	32
comparatively	32
ahead	31
along	31
arguably	31
inevitably	31
mutually	31
short	31
steadily	31
universally	31
weekly	31
promptly	31
temporarily	30
formally	30
temporally	29
specially	29
passively	29
officially	29
linearly	29
exceptionally	29
enzymatically	29
computationally	28
intramuscularly	28
high	28
acutely	28
last	28
seemingly	28
qualitatively	28
distantly	27
classically	27
half	27
translationally	27
numerically	26
fundamentally	26
surgically	26
truly	25
socially	25
histologically	25
gently	25
definitely	25
course	25
catalytically	25
abroad	25
semi	24
concomitantly	24
periodically	24
strikingly	24
terminally	24
whereas	23
robustly	23
preoperatively	23
preferably	23
overseas	23
internally	23
fortunately	23
fairly	23
conventionally	23
adversely	23
wide	23
b2c	22
cyclophosphamide	22
intraoperatively	22
artificially	22
exponentially	22
deep	22
viral	22
incidentally	22
radiologically	22
thrice	22
voluntarily	22
inside	22
optimally	21
else	21
formerly	21
fourth	21
freshly	21
inherently	21
legally	21
objectively	21
morphologically	21
permanently	21
productively	21
prominently	21
robotically	21
thereof	21
thirdly	21
unsuccessfully	21
unusually	21
und	20
marginally	20
longitudinally	20
infrequently	20
fluorescently	20
densely	20
competitively	20
asymptomatically	19
abundantly	19
electronically	19
dually	19
externally	19
phenotypically	19
singly	19
systemically	19
intimately	19
therapeutically	19
correspondingly	18
invariably	18
alike	18
evenly	18
financially	18
mechanistically	18
morbidly	18
practically	18
suddenly	18
limd1	17
intentionally	17
incorrectly	17
continually	17
definitively	16
environmentally	16
distinctly	16
prophylactically	16
barely	16
intensively	16
favorably	16
surely	16
laterally	16
perfectly	16
profoundly	16
reportedly	16
rigorously	16
disproportionately	15
anywhere	15
consecutively	15
bilaterally	15
behind	15
massively	15
analytically	15
afterward	15
absolutely	15
firmly	15
eg	15
scientifically	15
horizontally	15
vertically	15
indoors	15
top	15
sooner	15
ubiquitously	15
radically	15
pdna	15
vrnps	15
magnetically	15
noticeably	14
anatomically	14
chiefly	14
doubly	14
forth	14
gratefully	14
hopefully	14
nasally	14
seldom	14
privately	14
reverse	14
somehow	14
timely	14
topically	14
transcriptionally	14
vastly	14
inadequately	13
intuitively	13
lately	13
intra	13
ssdna	13
evidently	13
epidemiologically	13
modestly	13
little	13
therein	13
monthly	13
onwards	13
principally	13
rationally	13
serologically	13
strategically	13
nationally	13
inappropriately	12
cautiously	12
centrally	12
finely	12
grossly	12
hemodynamically	12
hereafter	12
humanely	12
intensely	12
uneventfully	12
loosely	12
nearby	12
paradoxically	12
peripherally	12
politically	12
thermally	12
lincrna	12
virally	12
dynamically	11
intracellularly	11
hereby	11
mathematically	11
disulfide	11
cold	11
bronchoscopy	11
maternally	11
open	11
matter	11
molecularly	11
proportionally	11
qpcr	11
secondarily	11
visibly	11
metabolically	11
incompletely	10
crucially	10
dose	10
dsrna	10
equivalently	10
excessively	10
fine	10
hitherto	10
p7	10
invasively	10
lncrnas	10
predominately	10
regionally	10
sharply	10
shrna	10
tentatively	10
falsely	9
exogenously	9
developmentally	9
graphically	9
identically	9
encouragingly	9
intermittently	9
conveniently	9
contrastingly	9
conceptually	9
aseptically	9
appreciably	9
abnormally	9
implicitly	9
remotely	9
iteratively	9
publically	9
taxonomically	9
successively	9
schematically	9
satisfactorily	9
unequivocally	9
majorly	9
proteolytically	9
prematurely	9
post	9
minus	9
microscopically	9
proactively	9
directionally	8
faithfully	8
extraordinarily	8
extracorporeally	8
exceedingly	8
electrostatically	8
dominantly	8
comparably	8
dependently	8
deliberately	8
blindly	8
badly	8
bacterially	8
improperly	8
full	8
fold	8
inadvertently	8
pathologically	8
within	8
uncommonly	8
synthetically	8
seasonally	8
personally	8
per	8
posteriorly	8
outdoors	8
occupationally	8
notoriously	8
microbiologically	8
latently	8
indefinitely	8
ecologically	7
left	7
illegally	7
flat	7
enormously	7
energetically	7
endogenously	7
electrochemically	7
adaptively	7
domestically	7
conclusively	7
conceivably	7
characteristically	7
causally	7
anteriorly	7
neither	7
nationwide	7
sincerely	7
non	7
synchronously	7
noninvasively	7
yearly	7
usefully	7
upwards	7
unambiguously	7
transanally	7
tenfold	7
vrna	7
straight	7
pdcov	7
reversely	7
reproducibly	7
random	7
putatively	7
digitally	6
endemically	6
ethnically	6
etoposide	6
everywhere	6
flexibly	6
henceforth	6
generously	6
infectious	6
imatinib	6
immunosenescence	6
inductively	6
desperately	6
diffusely	6
aunps	6
custom	6
confidently	6
caudally	6
biochemically	6
backward	6
azathioprine	6
autonomously	6
anyway	6
alternately	6
alarmingly	6
aggressively	6
abdominally	6
intratracheally	6
intradermally	6
curiously	6
intravaginally	6
sparsely	6
macroscopically	6
vigorously	6
variably	6
unknowingly	6
unidirectionally	6
twofold	6
trivially	6
thermodynamically	6
technologically	6
superficially	6
super	6
subclinically	6
ði	6
triple	6
south	6
outward	6
soft	6
oncologically	6
onward	6
openly	6
n=18	6
oppositely	6
overly	6
provisionally	6
rab1404	6
reversibly	6
since	6
emotionally	5
epigenetically	5
ethically	5
exemplarily	5
fastest	5
foremost	5
intracranially	5
fugitively	5
gdna	5
hard	5
informally	5
instantly	5
irregularly	5
ectopically	5
emergently	5
abortively	5
deeper	5
coincidently	5
clear	5
circumferentially	5
capsid	5
broad	5
boldly	5
beforehand	5
arrhythmias	5
anytime	5
allosterically	5
agriculturally	5
accidentally	5
justifiably	5
-especially	5
irreversibly	5
fresh	5
kind	5
radioactively	5
literally	5
wt1	5
willingly	5
verbatim	5
upward	5
tremendously	5
sustainably	5
strail	5
somewhere	5
smoothly	5
seamlessly	5
scarcely	5
realistically	5
radiographically	5
unavoidably	5
purposefully	5
n=5	5
lowest	5
ptrail	5
luciferase	5
meaningfully	5
mistakenly	5
mock	5
mavs	5
ostensibly	5
preliminarily	5
overwhelmingly	5
pcdna	5
pharmacologically	5
proximally	5
homogeneously	4
glabra	4
genotypically	4
generically	4
fourthly	4
für	4
esp	4
farther	4
extracellularly	4
incrementally	4
inconsistently	4
inward	4
indiscriminately	4
inferiorly	4
interchangeably	4
intraabdominally	4
intrapleurally	4
kinetically	4
lightly	4
mentally	4
methodologically	4
entfernt	4
errs	4
broader	4
elegantly	4
contrarily	4
aka	4
albeit	4
anecdotally	4
arbitrarily	4
arna	4
audio	4
basally	4
clockwise	4
commensally	4
cooperatively	4
electrically	4
counter	4
crgd	4
culturally	4
narrowly	4
distally	4
distinctively	4
downward	4
dual	4
electively	4
morally	4
decisively	4
neutrally	4
sterically	4
submucosally	4
succinctly	4
suitably	4
swiftly	4
thematically	4
unilaterally	4
unlikely	4
unnecessarily	4
unstably	4
unsurprisingly	4
vitally	4
votu	4
vs	4
whatsoever	4
wholly	4
wildly	4
worse	4
worst	4
wrongly	4
μl	4
noncovalently	4
subjectively	4
whole	4
spectrophotometrically	4
pretty	4
north	4
sort	4
ns2a	4
nsp15	4
operationally	4
plasmon	4
prbcs	4
predictably	4
prenatally	4
outwards	4
professionally	4
retrogradely	4
silently	4
prohibitively	4
salicylanilide	4
round	4
religiously	4
recombinantly	4
radially	4
sixfold	4
hadv	3
forensically	3
gp64	3
geometrically	3
halfway	3
g1f	3
forever	3
exhaustively	3
federally	3
extraperitoneally	3
erroneously	3
ergonomically	3
hemianopia	3
enterically	3
harder	3
insufficiently	3
highest	3
insofar	3
easy	3
ironically	3
inwards	3
intracorporeally	3
intracerebrally	3
interactively	3
insignificantly	3
holistically	3
infinitely	3
incredibly	3
immunochemically	3
höher	3
hydrophobically	3
hugely	3
effortlessly	3
be5028	3
east	3
categorically	3
20-fold	3
abruptly	3
amply	3
antivirally	3
anymore	3
apicoplast	3
apl	3
astrocyte	3
asymmetrically	3
avidly	3
knowingly	3
bidirectionally	3
biopsy	3
bottom	3
cfdna	3
doubt	3
chromosomally	3
chronologically	3
coincidentally	3
colorimetrically	3
comfortably	3
commensurately	3
compactly	3
concretely	3
congenitally	3
convincingly	3
cumulatively	3
delicately	3
descriptively	3
diversely	3
isotropically	3
consciously	3
lesser	3
statically	3
tight	3
symmetrically	3
symbiotically	3
susceptible	3
supposedly	3
subgroup	3
sometime	3
securely	3
snornas	3
slower	3
slow	3
singularly	3
similarily	3
shorter	3
ubiquitin	3
unanimously	3
undeniably	3
upright	3
usp14	3
utterly	3
v2.0	3
variously	3
vehemently	3
vice	3
vividly	3
vp0	3
wider	3
woefully	3
worryingly	3
Δ10aa	3
lethally	3
serendipitously	3
m	3
recursively	3
opposite	3
limitedly	3
logically	3
logistically	3
mass	3
maximally	3
medicinally	3
meticulously	3
monomerically	3
narratively	3
neurologically	3
nodosa	3
nucleotide	3
nutritionally	3
oft	3
monstrously	3
optically	3
precipitously	3
overtly	3
racially	3
quietly	3
purposely	3
proportionately	3
prime	3
reciprocally	3
pp65	3
patient	3
paclitaxel	3
rectally	3
perpendicularly	3
popularly	3
forcibly	2
fluorometrically	2
fluorochrome	2
firsthand	2
l506	2
fescv	2
fecally	2
favourably	2
famously	2
exquisitely	2
expeditiously	2
expectedly	2
expansively	2
filo-	2
dimensionally	2
existentially	2
excitingly	2
evermore	2
etiologically	2
equivocally	2
equitably	2
endonucleolytically	2
eif2α	2
efficaciously	2
doubtless	2
doubtably	2
docetaxel	2
disproportionally	2
discretely	2
direct	2
foul	2
ie	2
frankly	2
il-1β	2
dicer1	2
ip-2016	2
intragastric	2
integrally	2
insidiously	2
innately	2
inflamm	2
inferior	2
inexpensively	2
industrially	2
inducibly	2
impressively	2
immensely	2
illicitly	2
il)-2	2
genuinely	2
igg+	2
identical	2
i15l	2
hyper	2
hun4	2
hpiv-4	2
honestly	2
homeostatically	2
histopathologically	2
hierarchically	2
heterotopia	2
heretofore	2
haemodynamically	2
glaringly	2
different	2
beneficially	2
diagnostically	2
bacha	2
autoradiographically	2
autocatalytically	2
au@pnipam	2
aswell	2
assays	2
asexually	2
aptly	2
apds2	2
anyhow	2
antiviral	2
antibiotic	2
antenatally	2
anonymously	2
anew	2
amphisome	2
allyl	2
agarose	2
aerobically	2
adoptively	2
additively	2
across	2
ab120722	2
24/7	2
2-fold	2
-where	2
-were	2
-tag	2
-protein	2
-hq	2
averagely	2
basolaterally	2
demographically	2
beyond	2
defibrotide	2
dbpia	2
dangerously	2
crystallographically	2
cranially	2
cosmetically	2
contrary	2
contralaterally	2
contemporarily	2
conditionally	2
concordantly	2
concisely	2
complex	2
collaboratively	2
coevolve	2
clonally	2
cd205	2
casually	2
candidly	2
calorimetrically	2
calmly	2
ca	2
c3ar	2
bx795	2
boas3.3	2
bluntly	2
biweekly	2
biosphere	2
bioinformatically	2
ita09	2
perinatally	2
leftward	2
threefold	2
th	2
teilweise	2
tangentially	2
succefully	2
subtly	2
subliminally	2
sterile	2
stepwise	2
stat5	2
spread	2
speedily	2
spectacularly	2
southwest	2
someday	2
snuggly	2
smorf	2
site(s	2
sensitively	2
scrupulously	2
safe	2
s1b	2
richly	2
resultantly	2
relevantly	2
relentlessly	2
regrettably	2
regioselectively	2
recurrently	2
reassuringly	2
thankfully	2
tisagenlecleucel	2
rampantly	2
topologically	2
leukemias	2
≥18	2
±sd	2
®	2
zoonotically	2
youngest	2
wrong	2
wirelessly	2
warmer	2
vp4	2
virologically	2
versus	2
vaguely	2
vaginally	2
upside	2
upper	2
unterteilen	2
unrealistically	2
unprecedentedly	2
unintentionally	2
understandably	2
underneath	2
unacceptably	2
ultrasonically	2
ubiquitination	2
transplacentally	2
transparently	2
transcardially	2
totalis	2
ready	2
willfully	2
quicker	2
nucleatum	2
nominally	2
no2or	2
nm	2
nlrp3/	2
neurosurgically	2
neuraminidase	2
neurally	2
neuac	2
necrosectomy	2
nc028752	2
nalidixic	2
nairovirus	2
n=26	2
multi	2
monotonically	2
mininally	2
microbially	2
metagenomically	2
mers	2
map	2
magnetic	2
m336	2
luminometrically	2
lue234	2
loop	2
longest	2
light	2
purposively	2
liberally	2
nowhere	2
luckily	2
nucleoside	2
phewas	2
protectively	2
nucleus	2
psmpuw	2
promisingly	2
profile	2
proficiently	2
procedurally	2
presumptively	2
prebiotically	2
poignantly	2
pneumatically	2
plus	2
photochemically	2
phosphoinositide	2
programmatically	2
pharmaceutically	2
oronasally	2
perioperatively	2
oligodendrocyte	2
odd	2
ordinarily	2
organically	2
opportunistically	2
orthotopically	2
painfully	2
paternally	2
pcdna3.1-mers	2
n’t	2
peacefully	2
fewer	1
fastidiosa	1
fatally	1
feasibleespecially	1
feasibly	1
final	1
filmy	1
finaly	1
fj376620	1
fk506	1
flagellin	1
f(x	1
exponential	1
extrinsically	1
extragenically	1
extra	1
exteremely	1
expressly	1
explosively	1
exosome	1
ev-117	1
eu240454-eu240456	1
esophagectomywere	1
fluent	1
erstmalig	1
ergaster	1
float	1
g3-were	1
fluorescein	1
fluoroscopically	1
großzellig	1
epidemically	1
green	1
greater	1
gravitationally	1
gravely	1
good	1
gm066706	1
glycosidically	1
gii-1-were	1
getv	1
generic	1
gastric	1
gahv-2	1
fzcuu4ma	1
futhermore	1
funisitis	1
fro	1
foxo3	1
fortuitously	1
fortnightly	1
forsythoside	1
formoterol	1
forcefully	1
focused	1
equidistantly	1
doi.org/10.1016/j.antiviral.2018.04.016	1
epha5	1
doubtlessly	1
dlbcl	1
divergently	1
distal	1
dissimilarly	1
disproven	1
discrete	1
discontinuously	1
disastrously	1
disappointingly	1
direly	1
diplomatically	1
diligently	1
diffusive	1
difficultly	1
didactically	1
diametrically	1
diagnosedonly	1
dhx15	1
deviceideally	1
detrimentally	1
deterministically	1
destructively	1
dendritically	1
demonstrably	1
h143	1
dlco	1
downhill	1
eosinophilia	1
duly	1
enzymatic	1
entstehen	1
entstand	1
enterally	1
endoscopist(directly	1
endlessly	1
enantiomerically	1
eminently	1
embryonically	1
emblematically	1
em	1
elevtively	1
electrophysiologically	1
electrocatalytically	1
elaborately	1
einher	1
eines	1
einer	1
educationally	1
ecofriendly	1
ebcu3ywq	1
ear	1
eagerly	1
e564.a	1
e3l	1
h-2k	1
inconveniently	1
h5ha	1
intermittenly	1
interleukin-6	1
interleukin-1beta	1
interleukin-1-and	1
interfere	1
intellectually	1
intcp	1
instinctively	1
instantaneously	1
inos	1
inmediately	1
inland	1
ingly	1
influenzavirusa	1
infiltriert	1
inextricably	1
inevitablely	1
inefficiently	1
ineffectively	1
indistinctly	1
indisputably	1
deferentially	1
incoherently	1
inarguably	1
imperfectly	1
imperatively	1
interleukin-8	1
intermolecularly	1
habitually	1
intracardially	1
knesl	1
klrc1	1
klrb1	1
kf17	1
keenly	1
jx292005	1
justly	1
judiciously	1
jak)/stat	1
j.antiviral.2018.04.016	1
itamis	1
isotopically	1
irtually	1
irrespectively	1
irbcs	1
irbc	1
iq5	1
ionically	1
intravascularly	1
intrathoracically	1
intraoperatvely	1
intranodally	1
intrahepatically	1
intracortically	1
intracerebally	1
impairment	1
immunophenotypically	1
immunologic	1
immunohistochemically	1
horrifically	1
hochrepetitiver	1
hlapartially	1
hku15	1
histrap	1
histomorphologically	1
histochemically	1
hey-1	1
hev	1
heuristic	1
heterogeneously	1
hereof	1
hereinafter	1
hemodinamically	1
heavy	1
heamodyanemically	1
hdivig	1
hcmv	1
hcdna	1
hbmecs	1
hastily	1
harshly	1
harmoniously	1
happily	1
handly	1
hotly	1
hourly	1
hrhpv	1
i:-were	1
immunogenically	1
immunogenetically	1
immunoassay	1
immitis	1
imagej	1
illegitimately	1
ifn)a	1
id#428729	1
icΔ5aa	1
icantly	1
ia/2016	1
hσ	1
hsp90	1
hypothetically	1
hyperoside	1
hydrothermally	1
hydrophobic	1
hydrophilic	1
hydrolytically	1
humorously	1
https://orcid.org/0000-0002-7141-1785	1
https://orcid.org/0000-0002-3703-5026	1
https://doi.org/10.1016/j.cmi.2018.10.016	1
htrail	1
del(7q	1
butdespecially	1
deductively	1
allogenen	1
alhydrogel	1
alere	1
alaninal	1
airsacculitis	1
ai099100	1
agalliou	1
ag85b	1
aft	1
afore	1
affirmatively	1
af6b7e03cb374a3d20ac5fc3477bcc9b772bc7ff	1
aerugenosa	1
aek6mvdw	1
adv	1
adquiere	1
admittedly	1
administratively	1
adjustably	1
adipose	1
adherent	1
adept	1
actualymore	1
activitely	1
acsf	1
acoustically	1
allegedly	1
alloimmune	1
accidently	1
alone.6	1
architecturally	1
approximatelly	1
apparentely	1
apically	1
antriorly	1
antithetically	1
antiparallel	1
antigenomic	1
anticonvulsant	1
anticlockwise	1
anterogradely	1
antagonistically	1
anoxically	1
angesprochen	1
andrographolide	1
andonly	1
anastrazole	1
analogously	1
anaerobically	1
amperometrically	1
aminoacid	1
amino-3-oxetanecarboxylic	1
ambitiously	1
amazingly	1
alongside	1
acetaminophen	1
acceptably	1
decreasingly	1
-untereinheit	1
-strand	1
-so	1
-role	1
-particularly	1
-part	1
-oropharyngeal	1
-o	1
-mollisacacidin	1
-mainly	1
-k99	1
-i	1
-hiv	1
-high	1
-guide	1
-gu	1
-g3	1
-fallstudien	1
-early	1
-dually	1
-daily	1
-biotin	1
-before	1
-approximately	1
-2016	1
-2005	1
-ttc	1
-www	1
ac	1
.fortunately	1
absolute	1
absichtliche	1
abomasel	1
aberrantly	1
a711aeec6e1007c2896cf9680b9057e615b28cfd	1
a549	1
a21040	1
7·4-times	1
6iex	1
6dgi	1
6/2016	1
6-	1
572/638	1
50x	1
5-day	1
3′-terminally	1
3rd	1
3prp	1
3/43	1
1north	1
1e.	1
1bbl	1
105/236	1
10-fold	1
//doi	1
arg337	1
arkdpi	1
articulately	1
consurrently	1
consequentially	1
conscientiously	1
conformationally	1
concerningly	1
conatantly	1
completelly	1
complementarily	1
competently	1
colloquially	1
colically	1
coherently	1
coarser	1
clínicas	1
clustalw	1
cleanly	1
cisplatin	1
circumpherentially	1
chromatographically	1
chromatin	1
chemicals(paa	1
cheaply	1
chaotically	1
central	1
center	1
cd45-sap/200	1
constructively	1
contemporaneously	1
artifactually	1
contiguously	1
decost	1
damn	1
dactylitis	1
d71e	1
cytometric	1
cytoadhere	1
cxcl)-8	1
customarily	1
currentc	1
curatively	1
curative	1
cttccttccggatcacgtgttcat3	1
crudely	1
cross	1
credibly	1
creatively	1
countriesespecially	1
counterintuitively	1
cord-290861	1
cord-003596	1
copiously	1
coordinately	1
convergently	1
controversially	1
continuous	1
cd3e	1
cd117	1
cccdna	1
card1	1
beautifully	1
bdna	1
baseline	1
barefoot	1
bacsc	1
b3-amervac	1
b220	1
azedarach	1
azadirachtin	1
avws	1
avct12	1
autophagosome	1
authoritatively	1
authentically	1
aunr	1
auftreten	1
aufgrund	1
atg9b.	1
atg5	1
asynchronously	1
asthenopia	1
aslo	1
asic3	1
ascendingly	1
aryl-3-oxo-1-thia-4-azaspiro	1
becomingly	1
behaviorally	1
behaviourally	1
blind	1
cantly	1
cally	1
by~2-fold	1
kritischer	1
bronchoscopically	1
boundedly	1
bother	1
borne	1
boas2.2	1
blood-	1
bloc1s6	1
blastn	1
belatedly	1
blast+	1
bitterly	1
biosynthetically	1
biomedically	1
biofab	1
bigclam	1
biennially	1
bibliographically	1
beside	1
berkeley/1/1968	1
benignly	1
knockin	1
métodos	1
kt021232	1
straightaway	1
stnfri	1
stiffly	1
sternlabtau	1
stereotypically	1
staystm	1
starkly	1
squarely	1
square	1
sprechen	1
speculatively	1
spectroscopically	1
spectrally	1
spectral	1
southeast	1
soundly	1
sophisticatedly	1
sonographically	1
somatotopy	1
solubly	1
soluble	1
solidly	1
snugly	1
smooth	1
smallrna	1
sitespecifically	1
stoichiometrically	1
straightforwardly	1
sind	1
straightly	1
tertiary	1
tere	1
ten	1
teleta	1
telemetrically	1
technical	1
t98g	1
t26-t27	1
synonymously	1
symptomatically	1
sympathectomy	1
sweetly	1
suspiciously	1
susceptibly	1
susceptibleinfectious	1
supinely	1
superspreader-2	1
sultopride	1
sucessfully	1
substantively	1
subfamily	1
stubbornly	1
stringently	1
stridently	1
strength.4	1
singlehandedly	1
similarlly	1
quintessentially	1
rightly	1
rifampin	1
rhil-12	1
rhetorically	1
retrospectivily	1
retrogastrically	1
retroactively	1
retech.rec.1396.349	1
restrictively	1
resolutely	1
reputedly	1
repetitively	1
repeatly	1
renally	1
remote	1
regretfully	1
red	1
reassembly	1
re-	1
rarelly	1
rapidely	1
raft	1
radiometrically	1
rab11a	1
r511was	1
r01ai033144	1
rightfully	1
rmb25	1
signify	1
rnase	1
signfiicantly	1
siginificantly	1
sideways	1
sicker	1
shortest	1
severally	1
sessile	1
serotypically	1
ser1345	1
seperately	1
sentimentally	1
sensibly	1
semiquantitatively	1
selfassembly	1
secov	1
scfv	1
scarily	1
saliently	1
sadly	1
s1049023x19005144	1
s1-ctd	1
rurally	1
rs8099917	1
rrt	1
roomimmediately	1
tfr1-out	1
thereunder	1
thick	1
warmly	1
vris/100	1
vp35-vp40	1
vndv	1
vmia	1
viously	1
viably	1
vexingly	1
verses	1
verdachtsdiagnose	1
verbally	1
ventrally	1
varyingly	1
vanishingly	1
valproate	1
vaccineda	1
v1.16.1	1
usp13	1
urrently	1
upto	1
upstairs	1
unwillingly	1
unreasonably	1
unquestionably	1
unprofessionally	1
unpredictably	1
vvacv	1
way	1
thicker	1
week'because	1
没收	1
山西	1
≥iiib	1
≥4	1
∼100-fold	1
−0.2	1
‡freely	1
ϵÞ	1
μct	1
αenv	1
αb	1
ðtÞ.	1
µm	1
zrob20	1
yu6mw601	1
yhroughly	1
wrongfully	1
with2episodes,53%were	1
wisely	1
wise	1
wich	1
whereafter	1
wet	1
westward	1
west	1
univocally	1
uninterruptedly	1
unintendedly	1
unfavourably	1
transrectally	1
transmecoscopically	1
translocationally	1
transgenically	1
transcriptase	1
transcervically	1
transabdominally	1
tpox	1
toxicologically	1
total	1
topographically	1
tolerably	1
toghter	1
tobe	1
tnfr-1	1
tnf-/ifn	1
tistically	1
tirelessly	1
tipically	1
tighter	1
throughly	1
thrombocytopenia	1
thoughtfully	1
thoracoscopically	1
thioredoxin	1
transvaginally	1
transversally	1
transversely	1
umvi0veu	1
unfairly	1
undoubtably	1
undetectably	1
underground	1
unconventionally	1
unconditionally	1
unclearly	1
uncharacteristically	1
uncertainly	1
unbelievably	1
unapologetically	1
ul1tr000058	1
treacherously	1
ubv.7.2	1
ubiquitiously	1
u-550	1
tyro3	1
twoyearly	1
tu2xrt9x	1
ts	1
trust"-unilaterally	1
trimeric	1
trim79α	1
trim25–rig	1
qv	1
quick	1
ku-55933	1
nearcomplete	1
nct01875653	1
nchrt	1
nc8	1
nbðr	1
natively	1
national	1
nasopharyngeal	1
nasogastric	1
narrow	1
nanotag	1
nanoscopy	1
nanorod	1
nanomaterial	1
nanoassembly	1
n=95	1
n=87	1
n=79	1
n=46	1
n=41	1
n=28	1
n.a.not	1
multimeric	1
multifocally	1
mucosa	1
mucormycosisessentially	1
nct02	1
nearer	1
mortalitywere	1
nearest	1
nr-50327	1
nr-50065	1
np_058197.2	1
nowdays	1
notionally	1
northwards	1
normatively	1
nonuniformly	1
nontherapeutically	1
nonspecifically	1
nonperinatally	1
nonmedically	1
nonlinearly	1
nongenetically	1
noncompetitively	1
noncatalytically	1
nl63	1
nimbly	1
nics(1	1
nicely	1
new	1
neurosurgerywere	1
neurophysiologically	1
neuronally	1
negligibly	1
mowj6wyl	1
morever	1
questionably	1
mac3formely	1
m0ox841z	1
lys574	1
ly6g	1
luminescently	1
lucketally	1
lso	1
lr-0,52	1
lpin1β	1
lowly	1
locoregionally	1
lmra	1
lipin2	1
linguistically	1
lincrnas	1
lilrb2-like	1
lilrb1	1
let-7a-1	1
lentiviral	1
legitimately	1
lead	1
latter	1
laporoscopically	1
laporocopically	1
labouriously	1
können	1
m338-were	1
maliciously	1
monotherapy	1
managerially	1
momentarily	1
modularly	1
mockingly	1
mmachine	1
mlst8	1
mixedly	1
mirdeep2	1
miraculously	1
minimal	1
mindy-1	1
midway	1
microcapillary	1
mh766894)-was	1
mh159777-mh159804	1
mg	1
metrically	1
mengye	1
memorably	1
medially	1
measurably	1
meantime	1
mcgeer	1
maximal	1
materially	1
mandatorily	1
ns4a	1
nsp14-nsp10	1
nuancedly	1
presciently	1
preperitoneally	1
predominantely	1
precariously	1
prebiologically	1
pragmatically	1
powerfully	1
potty	1
posttranslationally	1
possibily	1
polysome	1
polyclonally	1
poly--1,6-maltotriose	1
pnl4	1
plasmonically	1
planktonically	1
plainly	1
pkcsm	1
phytochemically	1
phyllosphere	1
photometrically	1
pertain	1
perpetually	1
perpendicular	1
peroralendoscopy	1
peroperatively	1
preponderantly	1
preterminally	1
nuclease	1
prevalently	1
quently	1
quantificationally	1
pyrocarbonate	1
purportedly	1
puppyprotech	1
punctually	1
ptc-200	1
psychometrically	1
psychologically	1
provocatively	1
proteasomally	1
protease	1
propofol	1
proper	1
promiscuously	1
prognostically	1
procurementwere	1
probabilistically	1
priorly	1
priori	1
primitively	1
primase	1
primairly	1
prifle	1
preventatively	1
permeable	1
perm/	1
perk	1
perivascullarly	1
outwardly	1
osquito	1
orthogonally	1
org/10.1016	1
orf4b	1
orbitally	1
optgpsampler	1
operationalise	1
once,9%were	1
omentum	1
oligodeoxynucleotide	1
oligochitosan	1
oftentimes	1
ofcourse	1
obsessively	1
observably	1
obliquely	1
obligately	1
o2e5na78	1
numerous	1
nuhrd92z	1
nucleos(t)ide	1
nucleoprotein	1
nucleocapsid	1
nucleases	1
ovalbumin	1
oxidative	1
oxidatively	1
participantsindependently	1
perivascularly	1
peritoneally	1
perinuclearly	1
perennially	1
perceptually	1
peculiarly	1
pe)-	1
pbrm1	1
paticularly	1
past	1
particular	1
parenterally	1
oxyclozanide	1
p=0.34	1
p=0.232	1
p=0.034	1
p=0.027	1
p=0.016	1
p<1	1
p62	1
p58ipk	1
p1beta_rev2016	1
p16ink4a	1
oxypaeoniflorin	1
-0.36057544	1