This is a table of named entities, their types, and their frequencies from sentences in your study carrel. Use it to search & browse the list to learn more about your study carrel. Please keep in mind that named-entity extraction is not as accurate as more generic parts-of-speech extraction. Unusual results will appear here.
entity | type | frequency |
---|---|---|
hae | DISEASE | 815 |
asthma | DISEASE | 608 |
inh | CHEMICAL | 500 |
angioedema | ORG | 283 |
viral | TAXON | 278 |
covid | DISEASE | 210 |
crs | ORG | 196 |
virus | TAXON | 190 |
bradykinin | CHEMICAL | 174 |
infection | DISEASE | 156 |
human | TAXON | 150 |
rhinovirus | TAXON | 129 |
viruses | TAXON | 116 |
c1 inh | ORG | 115 |
asthmatic | DISEASE | 92 |
inflammation | DISEASE | 87 |
bacterial | TAXON | 84 |
estrogen | ORG | 82 |
sars | DISEASE | 80 |
danazol | GPE | 75 |
mice | TAXON | 74 |
chronic rhinosinusitis | DISEASE | 67 |
covid 19 | ORG | 66 |
kinin | CHEMICAL | 64 |
bronchiolitis | DISEASE | 64 |
ige | ORG | 63 |
c1 inhibitor | CHEMICAL | 63 |
ap | ORG | 61 |
copd | ORG | 59 |
viral infection | DISEASE | 59 |
xii | ORG | 57 |
oc | ORG | 57 |
hereditary angioedema | DISEASE | 53 |
allergy | DISEASE | 51 |
hrv | ORG | 51 |
syncytial virus | TAXON | 48 |
il | ORG | 48 |
individuals | TAXON | 46 |
hrt | ORG | 46 |
biofilm | GPE | 44 |
atopy | DISEASE | 44 |
sars cov 2 | ORG | 43 |
edema | DISEASE | 43 |
coronavirus | TAXON | 41 |
bacteria | TAXON | 41 |
ifn | ORG | 41 |
allergic | DISEASE | 40 |
ari | ORG | 37 |
cov | CHEMICAL | 36 |
death | DISEASE | 35 |
balf | ORG | 35 |
ace | ORG | 35 |
wheezing | DISEASE | 34 |
no | CHEMICAL | 33 |
angioedema | ORG | 33 |
angiotensin | CHEMICAL | 32 |
ifv | TAXON | 32 |
infections | DISEASE | 32 |
rhinovirus infection | DISEASE | 31 |
rsv infection | DISEASE | 30 |
asthma | GPE | 30 |
viral infections | DISEASE | 29 |
ii | ORG | 29 |
rhinovirus | TAXON | 28 |
atopic asthma | DISEASE | 27 |
os | GPE | 27 |
ace inhibitor | ORG | 27 |
oxygen | CHEMICAL | 26 |
ffp | ORG | 26 |
wuhan | GPE | 25 |
bradykinin | CHEMICAL | 24 |
colds | DISEASE | 24 |
nonallergic angioedema | DISEASE | 23 |
nasal polyps | DISEASE | 23 |
pneumonia | DISEASE | 22 |
fungal | TAXON | 22 |
jacionline | CHEMICAL | 21 |
lrti | ORG | 21 |
igg | ORG | 21 |
ifng | ORG | 21 |
alternaria | TAXON | 20 |
j allergy clin immunol | PERSON | 20 |
pcr | ORG | 20 |
rna | ORG | 20 |
androgens | CHEMICAL | 20 |
atopic | DISEASE | 20 |
critically ill | DISEASE | 20 |
laryngeal edema | DISEASE | 20 |
oedema | DISEASE | 20 |
vivo | GPE | 20 |
respiratory tract infections | DISEASE | 19 |
allergic rhinitis | DISEASE | 19 |
nps | CHEMICAL | 19 |
danazol | GPE | 18 |
hae ii | ORG | 18 |
n | ORG | 18 |
allergic disease | DISEASE | 18 |
animals | TAXON | 18 |
asthma exacerbations | DISEASE | 18 |
hereditary | DISEASE | 18 |
histamine | CHEMICAL | 18 |
methacholine | CHEMICAL | 18 |
primary hypogammaglobulinemia | DISEASE | 18 |
puromycin | CHEMICAL | 18 |
the united states | GPE | 17 |
airway inflammation | DISEASE | 17 |
viral | TAXON | 17 |
tnf | ORG | 17 |
sars cov | ORG | 17 |
app | ORG | 17 |
ci | ORG | 16 |
coronavirus disease | DISEASE | 16 |
aris | DISEASE | 16 |
iii | ORG | 16 |
allergic diseases | DISEASE | 16 |
nitric oxide | CHEMICAL | 16 |
progesterone | CHEMICAL | 16 |
respiratory tract infection | DISEASE | 16 |
swelling | DISEASE | 16 |
us | GPE | 15 |
ards | DISEASE | 15 |
berinert | PERSON | 15 |
china | GPE | 15 |
lrtis | DISEASE | 15 |
moraxella | PERSON | 15 |
abdominal pain | DISEASE | 15 |
allergic asthma | DISEASE | 15 |
corticosteroids | CHEMICAL | 15 |
estrogens | CHEMICAL | 15 |
mouse | TAXON | 15 |
rat | TAXON | 15 |
animal | TAXON | 14 |
aae | ORG | 14 |
dx | ORG | 14 |
pcd | ORG | 14 |
adenovirus | TAXON | 14 |
airflow obstruction | DISEASE | 14 |
tranexamic acid | CHEMICAL | 14 |
deaths | DISEASE | 14 |
fungi | TAXON | 14 |
host | TAXON | 14 |
pain | DISEASE | 14 |
rats | TAXON | 14 |
virus | TAXON | 13 |
ace inhibitors | CHEMICAL | 13 |
hk | GPE | 13 |
hereditary angioedema | DISEASE | 13 |
psoriasis | DISEASE | 13 |
amino acid | CHEMICAL | 13 |
fever | DISEASE | 13 |
infancy | DISEASE | 13 |
biofilms | CHEMICAL | 13 |
airway obstruction | DISEASE | 12 |
bork | PERSON | 12 |
c1 | GPE | 12 |
haemophilus | ORG | 12 |
ibd | ORG | 12 |
lsa | ORG | 12 |
mis | ORG | 12 |
aspirin | CHEMICAL | 12 |
humans | TAXON | 12 |
influenza infection | DISEASE | 12 |
maternal asthma | DISEASE | 12 |
organisms | TAXON | 12 |
yeast | TAXON | 12 |
pco | ORG | 11 |
e1 | CHEMICAL | 11 |
il 13 | ORG | 11 |
influenza | ORG | 11 |
na | CHEMICAL | 11 |
omenn | ORG | 11 |
hypertension | DISEASE | 11 |
antihistamines | CHEMICAL | 11 |
hereditary angioneurotic edema | DISEASE | 11 |
respiratory tract illness | DISEASE | 11 |
lymphopenia | DISEASE | 11 |
endometriosis | DISEASE | 11 |
pbs | ORG | 10 |
c1nh | GPE | 10 |
chronic | ORG | 10 |
dz | ORG | 10 |
gse19187 | ORG | 10 |
omenn syndrome | DISEASE | 10 |
e2 | CHEMICAL | 10 |
xla | ORG | 10 |
asthma symptoms | DISEASE | 10 |
exacerbations | DISEASE | 10 |
neutrophil | GPE | 10 |
airway hyperreactivity | DISEASE | 10 |
rabbit | TAXON | 10 |
human | TAXON | 9 |
ps ap | ORG | 9 |
nasal | PERSON | 9 |
mz | GPE | 9 |
cvid | ORG | 9 |
france | GPE | 9 |
coronavirus | TAXON | 9 |
cid | ORG | 9 |
bm | PERSON | 9 |
rv | ORG | 9 |
plasma | PERSON | 9 |
nucleotide | CHEMICAL | 9 |
adenoviral | TAXON | 9 |
rhinitis | DISEASE | 9 |
chronic obstructive pulmonary disease | DISEASE | 9 |
steroids | CHEMICAL | 9 |
rhinosinusitis | DISEASE | 9 |
www jacionline org | ORG | 9 |
respiratory tract viral infections | DISEASE | 9 |
respiratory infections | DISEASE | 9 |
nanoparticles | GPE | 9 |
leukotriene | CHEMICAL | 9 |
italy | GPE | 8 |
uk | GPE | 8 |
treg | GPE | 8 |
tss | ORG | 8 |
ova | ORG | 8 |
mycobacterium | TAXON | 8 |
mgus | ORG | 8 |
k | CHEMICAL | 8 |
albuterol | CHEMICAL | 8 |
hereditary | PERSON | 8 |
ff | ORG | 8 |
ec | ORG | 8 |
clin | CHEMICAL | 8 |
bronchiolitis | GPE | 8 |
asthmatic | LOC | 8 |
aspergillus | TAXON | 8 |
ace 2 | ORG | 8 |
aeruginosa | DISEASE | 8 |
autoimmunity | DISEASE | 8 |
allergen sensitization | DISEASE | 8 |
respiratory viral infection | DISEASE | 8 |
amino acids | CHEMICAL | 8 |
urticaria | DISEASE | 8 |
steroid | CHEMICAL | 8 |
smoking | CHEMICAL | 8 |
rupture | DISEASE | 8 |
rtpa | ORG | 8 |
rhinoviral infections | DISEASE | 8 |
trauma | DISEASE | 8 |
respiratory syncytial virus infection | DISEASE | 8 |
man | TAXON | 8 |
cough | DISEASE | 8 |
bacterial infection | DISEASE | 8 |
viral respiratory tract infection | DISEASE | 8 |
ascites | DISEASE | 8 |
angiotensin ii | CHEMICAL | 8 |
nucleic acid | CHEMICAL | 8 |
khetsuriani | PERSON | 7 |
rsv infections | DISEASE | 7 |
plunc | ORG | 7 |
nep | ORG | 7 |
mpo | ORG | 7 |
ldh | ORG | 7 |
europe | LOC | 7 |
il 4 | ORG | 7 |
hungary | GPE | 7 |
germany | GPE | 7 |
coronavirus disease | DISEASE | 7 |
bii | ORG | 7 |
streptococcus | GPE | 7 |
sp a | CHEMICAL | 7 |
prevalence | ORG | 7 |
toll | ORG | 7 |
lactoferrin | CHEMICAL | 7 |
allergies | DISEASE | 7 |
thrombocytopenia | GPE | 7 |
serous | DISEASE | 7 |
respiratory distress syndrome | DISEASE | 7 |
murine | TAXON | 7 |
microbiota | TAXON | 7 |
respiratory failure | DISEASE | 7 |
kininogen | PERSON | 7 |
hereditary angioneurotic oedema | DISEASE | 7 |
dyspnea | DISEASE | 7 |
dextran sulfate | ORG | 7 |
hypogammaglobulinemia | DISEASE | 7 |
anomalies | DISEASE | 7 |
nia | GPE | 6 |
igh | ORG | 6 |
innate | ORG | 6 |
lo | PERSON | 6 |
laboratory | ORG | 6 |
pseudomonas | GPE | 6 |
p18 | ORG | 6 |
rt pcr | PERSON | 6 |
rv a | DISEASE | 6 |
hiv | TAXON | 6 |
icss | CHEMICAL | 6 |
dectin | CHEMICAL | 6 |
hcv | PERSON | 6 |
hae attacks | DISEASE | 6 |
estrogen | ORG | 6 |
ed | ORG | 6 |
dyax | LOC | 6 |
determine | PERSON | 6 |
deficiency workshop | PERSON | 6 |
bacteria | TAXON | 6 |
angiotensin | CHEMICAL | 6 |
afrs | ORG | 6 |
sp d | CHEMICAL | 6 |
ruxolitinib | PERSON | 6 |
autoimmune diseases | DISEASE | 6 |
tlr9 | GPE | 6 |
kinins | CHEMICAL | 6 |
viruses | TAXON | 6 |
tyrosine | CHEMICAL | 6 |
toxicity | DISEASE | 6 |
stanozolol | CHEMICAL | 6 |
respiratory infection | DISEASE | 6 |
obesity | DISEASE | 6 |
nonallergic | DISEASE | 6 |
microbiome | TAXON | 6 |
lopinavir ritonavir | CHEMICAL | 6 |
leucine | CHEMICAL | 6 |
sinusitis | DISEASE | 6 |
infectious | DISEASE | 6 |
allergic airway disease | DISEASE | 6 |
wheezing | ORG | 6 |
disorders | DISEASE | 6 |
xi | PERSON | 6 |
airway hyperresponsiveness | DISEASE | 6 |
zinc | CHEMICAL | 6 |
anxiety | DISEASE | 6 |
diarrhea | DISEASE | 6 |
aminocaproic acid | CHEMICAL | 6 |
hae i | DISEASE | 5 |
marco | CHEMICAL | 5 |
hbsag | PERSON | 5 |
hereditary angioneurotic edema | DISEASE | 5 |
il 6 | ORG | 5 |
lbp | ORG | 5 |
lh | ORG | 5 |
rsv | PERSON | 5 |
molecular | ORG | 5 |
vitamin d | PERSON | 5 |
abdominal attacks | DISEASE | 5 |
bacterial infections | DISEASE | 5 |
acute attacks | DISEASE | 5 |
angiotensin i | CHEMICAL | 5 |
acute abdominal attacks | DISEASE | 5 |
budapest | GPE | 5 |
gwas | ORG | 5 |
gm | ORG | 5 |
drosophila | GPE | 5 |
diagnosis | GPE | 5 |
chlamydia | TAXON | 5 |
calif | GPE | 5 |
cslm | ORG | 5 |
ccm | ORG | 5 |
ccg | ORG | 5 |
bhr | ORG | 5 |
autophagy | PERSON | 5 |
ascites | ORG | 5 |
animal | TAXON | 5 |
cardiovascular disease | DISEASE | 5 |
cancer | DISEASE | 5 |
lymphoproliferative disorders | DISEASE | 5 |
ciclesonide | CHEMICAL | 5 |
lung injury | DISEASE | 5 |
cysteine | CHEMICAL | 5 |
virally | TAXON | 5 |
viral respiratory tract infections | DISEASE | 5 |
vasopermeability | DISEASE | 5 |
type i hereditary angioedema | DISEASE | 5 |
sepsis | DISEASE | 5 |
respiratory disease | DISEASE | 5 |
rabbits | TAXON | 5 |
progestin | PERSON | 5 |
primary defect | DISEASE | 5 |
ozone | CHEMICAL | 5 |
oseltamivir | CHEMICAL | 5 |
oestrogen | CHEMICAL | 5 |
nasal polyposis | DISEASE | 5 |
wheezing illnesses | DISEASE | 5 |
influenza a virus infection | DISEASE | 5 |
gaps | DISEASE | 5 |
influenza | ORG | 5 |
emphysema | DISEASE | 5 |
enteroviruses | DISEASE | 5 |
eosinophilia | DISEASE | 5 |
estradiol | GPE | 5 |
des arg 9 bradykinin | CHEMICAL | 5 |
hemophilia | DISEASE | 5 |
human beings | TAXON | 5 |
human rhinovirus | TAXON | 5 |
hyperglycemia | DISEASE | 5 |
infected | DISEASE | 5 |
hepatitis b | DISEASE | 5 |
maternal | PERSON | 4 |
pha | ORG | 4 |
pb | GPE | 4 |
np | ORG | 4 |
nod | ORG | 4 |
milan | GPE | 4 |
mip | ORG | 4 |
mva | TAXON | 4 |
li | CHEMICAL | 4 |
km | PERSON | 4 |
kallikrein | PERSON | 4 |
ptx3 | CHEMICAL | 4 |
incs | CHEMICAL | 4 |
iqr | ORG | 4 |
rhinoviruses | ORG | 4 |
phadiatop | PERSON | 4 |
prevotella | TAXON | 4 |
puromycin | GPE | 4 |
rsv infected | DISEASE | 4 |
rv c infection | DISEASE | 4 |
shbg | ORG | 4 |
slpi | ORG | 4 |
sp | CHEMICAL | 4 |
spearman | PERSON | 4 |
tcr | CHEMICAL | 4 |
tlr | ORG | 4 |
tr | GPE | 4 |
urt | ORG | 4 |
ighd | DISEASE | 4 |
il 5 | ORG | 4 |
flu | ORG | 4 |
ifn b | CHEMICAL | 4 |
epigenetic | LOC | 4 |
acute asthma exacerbations | DISEASE | 4 |
asvs | CHEMICAL | 4 |
aspirin | ORG | 4 |
c1 inhibitor deficiency | CHEMICAL | 4 |
cca | ORG | 4 |
cd8 | GPE | 4 |
cpg | ORG | 4 |
dr | DISEASE | 4 |
dermatophagoides pteronyssinus | TAXON | 4 |
douglas | PERSON | 4 |
dyax corp | ORG | 4 |
ecmo | ORG | 4 |
eta | ORG | 4 |
eritoran | GPE | 4 |
hungarian hae | DISEASE | 4 |
frankfurt | GPE | 4 |
fungal | PERSON | 4 |
gi | ORG | 4 |
gse4302 | CHEMICAL | 4 |
galaxy | PERSON | 4 |
h1n1 | GPE | 4 |
h5n1 | TAXON | 4 |
ha | ORG | 4 |
hae aae | ORG | 4 |
haea | GPE | 4 |
hageman | PERSON | 4 |
hanania | GPE | 4 |
hereditary angioedema | PERSON | 4 |
abdominal edema | DISEASE | 4 |
mhc | ORG | 4 |
acute respiratory syndrome coronavirus 2 sars cov | DISEASE | 4 |
lupus erythematosus | DISEASE | 4 |
mammalian | TAXON | 4 |
microbes | TAXON | 4 |
nafarelin | PERSON | 4 |
neutropenia | DISEASE | 4 |
nucleotides | CHEMICAL | 4 |
omalizumab | CHEMICAL | 4 |
oral contraceptives | CHEMICAL | 4 |
plaque psoriasis | DISEASE | 4 |
primary defects | DISEASE | 4 |
progestins | CHEMICAL | 4 |
psychiatric | DISEASE | 4 |
respiratory allergy | DISEASE | 4 |
respiratory distress | DISEASE | 4 |
respiratory illness | DISEASE | 4 |
respiratory tract illnesses | DISEASE | 4 |
respiratory viral infections | DISEASE | 4 |
rhinovirus colds | DISEASE | 4 |
ruxolitinib | CHEMICAL | 4 |
scd163 | CHEMICAL | 4 |
sheep | TAXON | 4 |
sialic acid | CHEMICAL | 4 |
superoxide | CHEMICAL | 4 |
theophylline | CHEMICAL | 4 |
tissue damage | DISEASE | 4 |
vascular leakage | DISEASE | 4 |
virus infection | DISEASE | 4 |
vitamin d | CHEMICAL | 4 |
vitro | GPE | 4 |
vomiting | DISEASE | 4 |
malignancy | DISEASE | 4 |
agammaglobulinemia | DISEASE | 4 |
loss of smell | DISEASE | 4 |
chronic rhinosinusitis crs | DISEASE | 4 |
hyperinflammation | DISEASE | 4 |
airway microbiota | PERSON | 4 |
ala na | ORG | 4 |
allergic inflammation | DISEASE | 4 |
amyloid a | CHEMICAL | 4 |
angioedema angioedema | DISEASE | 4 |
asthma a | DISEASE | 4 |
atopic dermatitis | DISEASE | 4 |
atopic disease | DISEASE | 4 |
autosomal | DISEASE | 4 |
bronchial asthma | DISEASE | 4 |
bronchial hyperresponsiveness | DISEASE | 4 |
chronic asthma | DISEASE | 4 |
alanine | CHEMICAL | 4 |
comorbidity | DISEASE | 4 |
failure | DISEASE | 4 |
confusion | DISEASE | 4 |
hemolytic | DISEASE | 4 |
goat | TAXON | 4 |
wheeze | DISEASE | 4 |
fungal infection | DISEASE | 4 |
gram | PERSON | 4 |
des arg 9 bradykinin | CHEMICAL | 4 |
coronavirus pneumonia | DISEASE | 4 |
congestive heart failure | DISEASE | 4 |
decongestants | CHEMICAL | 4 |
hepatitis g | DISEASE | 4 |
damp | TAXON | 4 |
murine | TAXON | 3 |
pneumonia | DISEASE | 3 |
perricone | ORG | 3 |
psa | ORG | 3 |
p f | LOC | 3 |
oseltamivir | PERSON | 3 |
nitric | ORG | 3 |
netherlands | GPE | 3 |
ns2 | TAXON | 3 |
n terminal | ORG | 3 |
p17 | GPE | 3 |
lukacs | PERSON | 3 |
multisystem inflammatory syndrome | ORG | 3 |
medicaid | ORG | 3 |
mna | ORG | 3 |
mers | DISEASE | 3 |
mbl | PERSON | 3 |
leukotriene | PERSON | 3 |
leu ap | PERSON | 3 |
lte | CHEMICAL | 3 |
lps | ORG | 3 |
l tris hcl ph 7 4 | CHEMICAL | 3 |
seb | ORG | 3 |
rhinovirus infection | DISEASE | 3 |
xii hageman | PERSON | 3 |
schaller | PERSON | 3 |
st louis | GPE | 3 |
amphotericin b | CHEMICAL | 3 |
amenorrhea | PERSON | 3 |
allergy sensitization | DISEASE | 3 |
allergic sensitization | DISEASE | 3 |
allergic disorders | DISEASE | 3 |
allergic airway inflammation | DISEASE | 3 |
airway infection | DISEASE | 3 |
acute respiratory tract illness | DISEASE | 3 |
acute illness | DISEASE | 3 |
acquired c1 inh | CHEMICAL | 3 |
kinin | ORG | 3 |
williams | PERSON | 3 |
wilcoxon | ORG | 3 |
vitamin c | ORG | 3 |
united states | ORG | 3 |
ultrasound | ORG | 3 |
urti | ORG | 3 |
tim | PERSON | 3 |
taqman | ORG | 3 |
table e1 | GPE | 3 |
trb | ORG | 3 |
syncytial virus | TAXON | 3 |
symptoms | ORG | 3 |
kinins | CHEMICAL | 3 |
hae type ii | DISEASE | 3 |
interferon | ORG | 3 |
individuals | TAXON | 3 |
c1nh | TAXON | 3 |
c1 inhibitor gene | CHEMICAL | 3 |
asthma like symptoms | DISEASE | 3 |
bork et al 86 | ORG | 3 |
biofilm | GPE | 3 |
binkley | PERSON | 3 |
bacterial | GPE | 3 |
bpi | ORG | 3 |
bal | ORG | 3 |
atopic | DISEASE | 3 |
analysis | PERSON | 3 |
allergy | DISEASE | 3 |
allergies | DISEASE | 3 |
allergen | ORG | 3 |
ala ap | PERSON | 3 |
airway | ORG | 3 |
agostoni | PERSON | 3 |
acute | PERSON | 3 |
auroc | ORG | 3 |
als | DISEASE | 3 |
ali | ORG | 3 |
aiha | DISEASE | 3 |
aia | ORG | 3 |
c2 kinin | CHEMICAL | 3 |
cd8 t | ORG | 3 |
cpv | ORG | 3 |
human microbiome | TAXON | 3 |
immune | LOC | 3 |
igm | ORG | 3 |
iga | DISEASE | 3 |
inh hae | CHEMICAL | 3 |
il 17a | PERSON | 3 |
igkv | ORG | 3 |
ighj | ORG | 3 |
ifn l | ORG | 3 |
iesa | ORG | 3 |
human rhinovirus | TAXON | 3 |
helicobacter | PERSON | 3 |
crssnp | DISEASE | 3 |
eoe | ORG | 3 |
edta | ORG | 3 |
dexamethasone | PERSON | 3 |
deaths | DISEASE | 3 |
davis | PERSON | 3 |
damp | PERSON | 3 |
crohn s disease | DISEASE | 3 |
crohn s | PERSON | 3 |
cicardi | GPE | 3 |
candida | GPE | 3 |
asthma attacks | DISEASE | 3 |
c1 inhibitor c1 inh | CHEMICAL | 3 |
atopic predisposition | DISEASE | 3 |
house | ORG | 3 |
osteoporosis | DISEASE | 3 |
omapatrilat | CHEMICAL | 3 |
nontemplate | CHEMICAL | 3 |
nnn | GPE | 3 |
myocardial infarction | DISEASE | 3 |
mycobacterial | TAXON | 3 |
methyltestosterone | CHEMICAL | 3 |
menthol | GPE | 3 |
malignancies | DISEASE | 3 |
malaria | TAXON | 3 |
lung inflammation | DISEASE | 3 |
leukocytosis | DISEASE | 3 |
laryngeal attacks | DISEASE | 3 |
interferon | ORG | 3 |
infectious diseases | DISEASE | 3 |
infectious disease | DISEASE | 3 |
infant infection | DISEASE | 3 |
hypotensive | DISEASE | 3 |
hypotension | DISEASE | 3 |
hypogonadism | DISEASE | 3 |
hypertensive | DISEASE | 3 |
hypersensitivity | DISEASE | 3 |
human metapneumovirus | TAXON | 3 |
pastoris | TAXON | 3 |
pathologies | DISEASE | 3 |
polyposis | DISEASE | 3 |
the hungarian hae center | ORG | 3 |
autoimmune disease | DISEASE | 3 |
zafirlukast | CHEMICAL | 3 |
ygtbuy4k | GPE | 3 |
viral bacterial | TAXON | 3 |
type ii | DISEASE | 3 |
type i hereditary | DISEASE | 3 |
timolol | CHEMICAL | 3 |
thymine | CHEMICAL | 3 |
the upper airways | ORG | 3 |
the national heart lung and blood institute | ORG | 3 |
the food and drug administration | ORG | 3 |
postviral asthma | DISEASE | 3 |
sulfur dioxide | CHEMICAL | 3 |
skin inflammation | DISEASE | 3 |
shock | DISEASE | 3 |
rhinovirus infections | DISEASE | 3 |
rhinovirus rna | TAXON | 3 |
rhinoviral infection | DISEASE | 3 |
respiratory symptoms | DISEASE | 3 |
respiratory diseases | DISEASE | 3 |
pulmonary dysfunction | DISEASE | 3 |
propidium iodide | CHEMICAL | 3 |
human bocavirus | TAXON | 3 |
plants | TAXON | 3 |
host microbial | TAXON | 3 |
cytosine | CHEMICAL | 3 |
creatinine | CHEMICAL | 3 |
creatine | CHEMICAL | 3 |
corticoids | CHEMICAL | 3 |
commensal | TAXON | 3 |
colonic eosinophilia | DISEASE | 3 |
cognitive impairment | DISEASE | 3 |
citrate | CHEMICAL | 3 |
chronic sinusitis | DISEASE | 3 |
chronic lung disease | DISEASE | 3 |
chicken | TAXON | 3 |
cat | TAXON | 3 |
captopril | CHEMICAL | 3 |
calcium | CHEMICAL | 3 |
budesonide | CHEMICAL | 3 |
bronchospasm | DISEASE | 3 |
bradykinin kallidin | PERSON | 3 |
bovine | TAXON | 3 |
bilirubin | CHEMICAL | 3 |
bias | CHEMICAL | 3 |
bat | TAXON | 3 |
azithromycin | CHEMICAL | 3 |
hirsutism | DISEASE | 3 |
avian | TAXON | 3 |
croup | DISEASE | 3 |
chest tightness | DISEASE | 3 |
gel electrophoresis | ORG | 3 |
erythroderma | ORG | 3 |
hereditary angioedema hae | DISEASE | 3 |
hepatocellular adenoma | DISEASE | 3 |
dectin | CHEMICAL | 3 |
hepatitis | DISEASE | 3 |
heparin | PERSON | 3 |
hemolysis | DISEASE | 3 |
haploinsufficiency | DISEASE | 3 |
granulomas | PERSON | 3 |
gc1qr | ORG | 3 |
fungal biofilm | CHEMICAL | 3 |
ferritin | LOC | 3 |
fish | TAXON | 3 |
erythema | DISEASE | 3 |
enteroviral infections | DISEASE | 3 |
dry | DISEASE | 3 |
dogs | TAXON | 3 |
diseases | DISEASE | 3 |
dexamethasone | CHEMICAL | 3 |
depression | DISEASE | 3 |
depressed | DISEASE | 3 |
dehydration | DISEASE | 3 |
deficit | DISEASE | 3 |
mir | ORG | 2 |
m183 | CHEMICAL | 2 |
mip 1alpha | ORG | 2 |
mfo | ORG | 2 |
md milan | ORG | 2 |
marc | ORG | 2 |
nontemplate | ORG | 2 |
loss | PERSON | 2 |
ligustrum | GPE | 2 |
legionella pneumophila | TAXON | 2 |
marco cicardi md | ORG | 2 |
legionella mycobacterium | TAXON | 2 |
madison wis | PERSON | 2 |
nocardia | GPE | 2 |
medicare | ORG | 2 |
mediterranean | LOC | 2 |
meta | ORG | 2 |
methacholine | CHEMICAL | 2 |
mice | TAXON | 2 |
mycoplasma | ORG | 2 |
n acetylglucosamine | ORG | 2 |
ns1 | ORG | 2 |
new york city | GPE | 2 |
nitric oxide | CHEMICAL | 2 |
nonsevere | ORG | 2 |
lajos kaposi | PERSON | 2 |
lamark | ORG | 2 |
ib | ORG | 2 |
lactoferrin | CHEMICAL | 2 |
lab tek | PERSON | 2 |
north eastern | LOC | 2 |
hubei | GPE | 2 |
hypoandrogenism | ORG | 2 |
icd | ORG | 2 |
ifn i | CHEMICAL | 2 |
ifn g | ORG | 2 |
ighv ighd | PERSON | 2 |
il 22 | ORG | 2 |
il 22r1 | ORG | 2 |
il 8 | ORG | 2 |
itp | ORG | 2 |
idiopathic nonhistaminergic angioedema | DISEASE | 2 |
ige phadiatop | PERSON | 2 |
illumina | GPE | 2 |
ineke bos | PERSON | 2 |
infancy respiratory infection | ORG | 2 |
inherited | ORG | 2 |
ki | PERSON | 2 |
l tris hcl | CHEMICAL | 2 |
ldsc | ORG | 2 |
lfa | ORG | 2 |
lplunc2 | GPE | 2 |
ltc4 | CHEMICAL | 2 |
ltd | DISEASE | 2 |
ltras | CHEMICAL | 2 |
normal | LOC | 2 |
toxic shock syndrome | PERSON | 2 |
oc hrt | CHEMICAL | 2 |
staphylococcus | LOC | 2 |
ribavirin | PERSON | 2 |
rockville md | PERSON | 2 |
sars cov infection | DISEASE | 2 |
spm | ORG | 2 |
sabin | TAXON | 2 |
saltoun | CHEMICAL | 2 |
seattle | GPE | 2 |
sebastien | CHEMICAL | 2 |
selective | ORG | 2 |
semmelweis university | ORG | 2 |
single | ORG | 2 |
sridevi vitali | ORG | 2 |
symptom | ORG | 2 |
ohsumi | GPE | 2 |
tcri | ORG | 2 |
tem | ORG | 2 |
ta | PERSON | 2 |
teasy | GPE | 2 |
technical | ORG | 2 |
theraclone | ORG | 2 |
hochberg | PERSON | 2 |
turner | ORG | 2 |
turner syndrome | DISEASE | 2 |
u c1 inh | CHEMICAL | 2 |
u s | ORG | 2 |
urtis | DISEASE | 2 |
respiratory syncytial virus infection | DISEASE | 2 |
rat | TAXON | 2 |
rag mouse | ORG | 2 |
rv b | DISEASE | 2 |
online repository | PERSON | 2 |
p15 | ORG | 2 |
p22 | ORG | 2 |
pd | DISEASE | 2 |
pk | ORG | 2 |
pnu | ORG | 2 |
pygl | CHEMICAL | 2 |
paxgene | CHEMICAL | 2 |
pichia pastoris | TAXON | 2 |
plunc | PERSON | 2 |
polygenic | ORG | 2 |
prednisolone | ORG | 2 |
prevotella fusobacterium bacteroides | ORG | 2 |
propionibacterium | CHEMICAL | 2 |
prunus | PERSON | 2 |
pseudomonas aeruginosa infection | DISEASE | 2 |
pulmonary edema | DISEASE | 2 |
pürsün | CHEMICAL | 2 |
qiagen valencia calif | PERSON | 2 |
rantes | ORG | 2 |
rbd | DISEASE | 2 |
rsvinduced | ORG | 2 |
rte | ORG | 2 |
rv a rv b | DISEASE | 2 |
rv a infection | DISEASE | 2 |
houston tex singleplex | PERSON | 2 |
civils | DISEASE | 2 |
hitachi | ORG | 2 |
asn 330 | PERSON | 2 |
autoimmune | ORG | 2 |
autoimmune c1 | ORG | 2 |
azithromycin | CHEMICAL | 2 |
b19 | ORG | 2 |
bi | ORG | 2 |
bmd | ORG | 2 |
bachert | CHEMICAL | 2 |
baculovirus | TAXON | 2 |
baricitinib | GPE | 2 |
baxter | ORG | 2 |
baylor college of medicine | ORG | 2 |
behringwerke ag | ORG | 2 |
benjamini | PERSON | 2 |
bock et al 205 | ORG | 2 |
bruton | PERSON | 2 |
btk | PERSON | 2 |
c1 inhibitor gene c1nh | CHEMICAL | 2 |
c1 inhibitor genes | CHEMICAL | 2 |
cd161 | CHEMICAL | 2 |
cd4 | GPE | 2 |
cd4 rte | ORG | 2 |
cd4 cytopenia | DISEASE | 2 |
cd64 | CHEMICAL | 2 |
ckd | ORG | 2 |
copd exacerbations | DISEASE | 2 |
austria | GPE | 2 |
arianna | DISEASE | 2 |
caenorhabditis elegans | TAXON | 2 |
arbidol | PERSON | 2 |
understand | GPE | 2 |
140 | DISEASE | 2 |
aaee | ORG | 2 |
ace 2 4 | ORG | 2 |
acth | ORG | 2 |
adhd | ORG | 2 |
adp | ORG | 2 |
ag | CHEMICAL | 2 |
aln | ORG | 2 |
abs | PERSON | 2 |
accuspin | PERSON | 2 |
acquired angioedema | DISEASE | 2 |
acta paediatrica | LOC | 2 |
adam | PERSON | 2 |
africa | LOC | 2 |
afro caribbean | LOC | 2 |
agrimonia | GPE | 2 |
allergic | LOC | 2 |
alvin e | CHEMICAL | 2 |
aminocaproic | PERSON | 2 |
aminocaproic acid | CHEMICAL | 2 |
anakinra | PERSON | 2 |
angiotensin ii | PERSON | 2 |
antisense | LOC | 2 |
apm | CHEMICAL | 2 |
crt | ORG | 2 |
california | CHEMICAL | 2 |
hirsutism | PERSON | 2 |
fvc | ORG | 2 |
ferritin | GPE | 2 |
ficolins | CHEMICAL | 2 |
frank | PERSON | 2 |
fusobacterium | GPE | 2 |
gs | ORG | 2 |
ga | CHEMICAL | 2 |
glandular | ORG | 2 |
global | PERSON | 2 |
glu meso | CHEMICAL | 2 |
gosepath | PERSON | 2 |
grady | PERSON | 2 |
gram | PERSON | 2 |
graphpad | ORG | 2 |
greece | GPE | 2 |
h5n1 virus | TAXON | 2 |
hae c1 | ORG | 2 |
hae ii fletcher | ORG | 2 |
hrv1 | PERSON | 2 |
hrvinduced aris | DISEASE | 2 |
hrvpredominant | ORG | 2 |
hartert | CHEMICAL | 2 |
heimburger | PERSON | 2 |
helicobacter pylori | DISEASE | 2 |
hepatitis c | ORG | 2 |
hereditary angioneurotic oedema | DISEASE | 2 |
farkas | PERSON | 2 |
evans syndrome | DISEASE | 2 |
canada | GPE | 2 |
escherichia | PERSON | 2 |
challenges | ORG | 2 |
chemical | ORG | 2 |
chemokine | ORG | 2 |
chicago | GPE | 2 |
chronic obstructive pulmonary disease | DISEASE | 2 |
cleistocalyx | PERSON | 2 |
cleistocalyx operculatus | DISEASE | 2 |
comité | CHEMICAL | 2 |
community | ORG | 2 |
coronavirus disease | DISEASE | 2 |
corynebacterium | CHEMICAL | 2 |
covid 19 | ORG | 2 |
dx 88 | ORG | 2 |
decreased | ORG | 2 |
dectin 1 | PERSON | 2 |
denmark | GPE | 2 |
dextran | GPE | 2 |
differential | ORG | 2 |
e12 | ORG | 2 |
emr | ORG | 2 |
eczema | ORG | 2 |
edema | PERSON | 2 |
encephalomyelitis | PERSON | 2 |
eosinophilia | DISEASE | 2 |
eritoran e5564 | PERSON | 2 |
ultrasonography | PERSON | 2 |
respiratory distress syndrome | DISEASE | 2 |
unifrac | ORG | 2 |
myocarditis | DISEASE | 2 |
malaria falciparum | TAXON | 2 |
maxillary sinusitis | DISEASE | 2 |
memory loss | DISEASE | 2 |
methionine | CHEMICAL | 2 |
methylprednisolone | CHEMICAL | 2 |
microcrystalline tyrosine | CHEMICAL | 2 |
montelukast | CHEMICAL | 2 |
multisystem inflammatory syndrome | DISEASE | 2 |
murine hae | TAXON | 2 |
mycobacteria | TAXON | 2 |
mycobacterial infection | DISEASE | 2 |
mycophenolate mofetil | CHEMICAL | 2 |
naproxen | CHEMICAL | 2 |
pipeline | CHEMICAL | 2 |
nasal diseases | DISEASE | 2 |
nasal polyp | DISEASE | 2 |
ncbi | CHEMICAL | 2 |
nedocromil sodium | CHEMICAL | 2 |
neurovirulent poliovirus infection | DISEASE | 2 |
neutrophilic asthma | DISEASE | 2 |
oedema hae | DISEASE | 2 |
olfactory dysfunction | DISEASE | 2 |
paroxysms | DISEASE | 2 |
peptide nucleic acid | CHEMICAL | 2 |
phosphate | CHEMICAL | 2 |
picornavirus | TAXON | 2 |
major depressive disorder | DISEASE | 2 |
macrolides | CHEMICAL | 2 |
lung diseases | DISEASE | 2 |
loss of lung epithelial barrier function | DISEASE | 2 |
hypovolemia | DISEASE | 2 |
ibuprofen | CHEMICAL | 2 |
immune thrombocytopenia | DISEASE | 2 |
immunostimulators | DISEASE | 2 |
infant s ari | DISEASE | 2 |
inflammatory bowel disease | DISEASE | 2 |
inflammatory bowel disease ibd | DISEASE | 2 |
inflammatory diseases | DISEASE | 2 |
inflammatory disorder | DISEASE | 2 |
influenza a | DISEASE | 2 |
influenza infected | DISEASE | 2 |
influenza infections | DISEASE | 2 |
influenza like illness | DISEASE | 2 |
influenza pneumonia | DISEASE | 2 |
inhaler | CHEMICAL | 2 |
inherited angioedema | DISEASE | 2 |
ipratropium | CHEMICAL | 2 |
ipratropium bromide | CHEMICAL | 2 |
ischemic heart disease | DISEASE | 2 |
kinin inactivation | PERSON | 2 |
lactate | CHEMICAL | 2 |
leu enk min mg | PERSON | 2 |
leukotrienes | CHEMICAL | 2 |
ligand | GPE | 2 |
lipopolysaccharide | CHEMICAL | 2 |
picornaviruses | TAXON | 2 |
plasminogen activator | PERSON | 2 |
hydroxylamine | CHEMICAL | 2 |
type ii hereditary angioneurotic edema | DISEASE | 2 |
the european commission | ORG | 2 |
the hae center | ORG | 2 |
the international study of asthma and allergies in children | ORG | 2 |
the us food and drug administration | ORG | 2 |
the university of wisconsin | ORG | 2 |
the world health organization | ORG | 2 |
thymus hypoplasia | DISEASE | 2 |
tna7e9dw | CHEMICAL | 2 |
tumor | DISEASE | 2 |
tumor necrosis | DISEASE | 2 |
type 2 asthma | DISEASE | 2 |
type i hereditary angioneurotic edema | DISEASE | 2 |
venous thromboembolism | DISEASE | 2 |
poliovirus | TAXON | 2 |
viral mrna | TAXON | 2 |
viral proteins | TAXON | 2 |
viral respiratory illnesses | DISEASE | 2 |
viral respiratory infections | DISEASE | 2 |
viral upper respiratory tract infections | DISEASE | 2 |
virions | TAXON | 2 |
virus infections | DISEASE | 2 |
weight gain | DISEASE | 2 |
www jacionline | ORG | 2 |
www ncbi nlm nih | PERSON | 2 |
vii | ORG | 2 |
zanamivir | PERSON | 2 |
the division of geriatrics | ORG | 2 |
the department of virology turku university | ORG | 2 |
the american academy of pediatrics | ORG | 2 |
testosterone | CHEMICAL | 2 |
poly lactic co glycolic acid | CHEMICAL | 2 |
primary hiv infection | DISEASE | 2 |
primary immunodeficiency | DISEASE | 2 |
procalcitonin | CHEMICAL | 2 |
pruritus | DISEASE | 2 |
psoriatic | DISEASE | 2 |
pulmonary tuberculosis | DISEASE | 2 |
respiratory syncytial virus bronchiolitis | DISEASE | 2 |
respiratory syncytial virus infections | DISEASE | 2 |
respiratory syndrome coronavirus 2 sars | DISEASE | 2 |
respiratory virus infections | DISEASE | 2 |
rheumatoid arthritis | DISEASE | 2 |
ribavirin | CHEMICAL | 2 |
rodents | TAXON | 2 |
rosiglitazone | CHEMICAL | 2 |
salbutamol | CHEMICAL | 2 |
sec | ORG | 2 |
seizures | DISEASE | 2 |
sinus disease | DISEASE | 2 |
sinus infections | DISEASE | 2 |
sinus infections pneumonias | DISEASE | 2 |
skin angioedema | DISEASE | 2 |
stroke | DISEASE | 2 |
suffocation | DISEASE | 2 |
sulfasalazine mesalamine | PERSON | 2 |
hyperthermia | DISEASE | 2 |
thymic atrophy | DISEASE | 2 |
human monocytes | TAXON | 2 |
alcohol | CHEMICAL | 2 |
allergic reaction | DISEASE | 2 |
alpha 1 antitrypsin | CHEMICAL | 2 |
aluminum hydroxide | CHEMICAL | 2 |
angioedematous | DISEASE | 2 |
anosmia hyposmia | PERSON | 2 |
arginine | CHEMICAL | 2 |
aspirin acetaminophen | CHEMICAL | 2 |
asthma aia | DISEASE | 2 |
asthmatic airways | DISEASE | 2 |
atropine | CHEMICAL | 2 |
autoimmune cytopenias | DISEASE | 2 |
autoimmune haemolytic anaemia | DISEASE | 2 |
autoimmune hemolytic anemia | DISEASE | 2 |
autoimmune neoplastic | DISEASE | 2 |
bacterial chronic rhinosinusitis | DISEASE | 2 |
barcodes | CHEMICAL | 2 |
bats | TAXON | 2 |
betaxolol | CHEMICAL | 2 |
bloodstream | TAXON | 2 |
breathlessness | DISEASE | 2 |
bronchial hyperreactivity | DISEASE | 2 |
bronchiectasis | DISEASE | 2 |
bronchitis | DISEASE | 2 |
bronchodilators | CHEMICAL | 2 |
cancers | DISEASE | 2 |
allergic angioedema | DISEASE | 2 |
alanine nitroanilide | CHEMICAL | 2 |
carbon | CHEMICAL | 2 |
airways inflammation | DISEASE | 2 |
vibrio | GPE | 2 |
human microbiome | TAXON | 2 |
varga et al | PERSON | 2 |
viral infections | DISEASE | 2 |
vk | GPE | 2 |
xiia kallikrein | PERSON | 2 |
xlf | ORG | 2 |
young syndrome | DISEASE | 2 |
abdominal hae | DISEASE | 2 |
abdominal hae attacks | DISEASE | 2 |
acetaminophen | CHEMICAL | 2 |
acetone | CHEMICAL | 2 |
acquired deficiencies | DISEASE | 2 |
acquired deficiency of c1 esterase inhibitor | DISEASE | 2 |
acute asthma | DISEASE | 2 |
acute bronchiolitis | DISEASE | 2 |
acute infections | DISEASE | 2 |
acute respiratory syndrome | DISEASE | 2 |
acute respiratory tract infections | DISEASE | 2 |
acute viral bronchiolitis | DISEASE | 2 |
acute viral rhinosinusitis | DISEASE | 2 |
airway | GPE | 2 |
airway diseases | DISEASE | 2 |
airway eosinophilia | DISEASE | 2 |
airway neutrophilia | PERSON | 2 |
candidiasis | DISEASE | 2 |
acetylcholine | CHEMICAL | 2 |
carbon dioxide co 2 nitrogen dioxide no | CHEMICAL | 2 |
erythroderma hepatosplenomegaly | PERSON | 2 |
fibrosis | DISEASE | 2 |
flavonoids | CHEMICAL | 2 |
follicle | DISEASE | 2 |
formaldehyde | CHEMICAL | 2 |
fungal dna | TAXON | 2 |
fungal hyphae | TAXON | 2 |
gastroesophageal reflux | DISEASE | 2 |
gastroesophageal reflux disease | DISEASE | 2 |
gluconate | CHEMICAL | 2 |
glutathione | CHEMICAL | 2 |
glycerol | CHEMICAL | 2 |
guanine nucleotide | CHEMICAL | 2 |
headache | DISEASE | 2 |
heart failure | DISEASE | 2 |
heat shock | DISEASE | 2 |
hepatitis a | DISEASE | 2 |
hepatitis c | DISEASE | 2 |
human alveolar | TAXON | 2 |
human bacterial | TAXON | 2 |
human cells | TAXON | 2 |
human disease | DISEASE | 2 |
human genome | TAXON | 2 |
human leukocyte | TAXON | 2 |
cardiogenic shock | DISEASE | 2 |
human herpesvirus | TAXON | 2 |
exertional dyspnea | DISEASE | 2 |
hereditary angioedema hereditary angioedema | DISEASE | 2 |
chronicity | DISEASE | 2 |
contagion | DISEASE | 2 |
chimpanzees | TAXON | 2 |
chronic maxillary sinusitis | DISEASE | 2 |
cerebral edema | DISEASE | 2 |
chronic obstructive pulmonary disease copd | DISEASE | 2 |
chronic sinonasal disease | DISEASE | 2 |
ciliary dyskinesia | DISEASE | 2 |
coinfection | DISEASE | 2 |
colds a | DISEASE | 2 |
commensal organisms | TAXON | 2 |
enteroviruses rhinovirus | TAXON | 2 |
chest pain | DISEASE | 2 |
congestion | DISEASE | 2 |
comorbid | DISEASE | 2 |
coronavirus hcov 229e replication | DISEASE | 2 |
des arg bradykinin | CHEMICAL | 2 |
eczema | DISEASE | 2 |
dysfunction | DISEASE | 2 |
disorder | DISEASE | 2 |
dextran sulphate | PERSON | 2 |
coronavirus rna | TAXON | 2 |
des personnes hcl | CHEMICAL | 2 |
cystic ovaries | DISEASE | 2 |
cysteinyl leukotriene | CHEMICAL | 2 |
cyproterone acetate | CHEMICAL | 2 |
coronaviruses | TAXON | 2 |
n none | PERSON | 1 |
n m | ORG | 1 |
n of these ace | ORG | 1 |
n karádi istván | CHEMICAL | 1 |
n 3 polyunsaturated fatty acids | CHEMICAL | 1 |
n 3 | ORG | 1 |
mycobacterium avium | CHEMICAL | 1 |
mycobacterium abscessus 57 1 mycobacterium avium intracellulare complex | TAXON | 1 |
mycobacteria | TAXON | 1 |
nlr | ORG | 1 |
mutational | ORG | 1 |
mus musculus blattella germanica | TAXON | 1 |
multicenter airway research collaboration | ORG | 1 |
multiallergen | PERSON | 1 |
mullol | CHEMICAL | 1 |
mucociliary | PERSON | 1 |
mr anthony castaldo | PERSON | 1 |
n scpn | ORG | 1 |
mr | GPE | 1 |
morphologic | GPE | 1 |
moretta lorenzo | PERSON | 1 |
n purification | ORG | 1 |
nabs | ORG | 1 |
n acetyl | CHEMICAL | 1 |
nct04293887 | CHEMICAL | 1 |
nkt | ORG | 1 |
nk nkt | ORG | 1 |
monroe j braman | PERSON | 1 |
nk | PERSON | 1 |
nih | ORG | 1 |
ngs galaxy | ORG | 1 |
netosis | ORG | 1 |
net | CHEMICAL | 1 |
nct04354584 | CHEMICAL | 1 |
nbt | CHEMICAL | 1 |
n acetylmuramic | ORG | 1 |
nasa | ORG | 1 |
nais | CHEMICAL | 1 |
nai | CHEMICAL | 1 |
naepp | ORG | 1 |
n terminal truncating rag1 mutations | CHEMICAL | 1 |
n terminal truncated rag1 | CHEMICAL | 1 |
n linked asn 216 asn | CHEMICAL | 1 |
n deficiency | DISEASE | 1 |
n acetylmuramic acid | CHEMICAL | 1 |
moraxella catarrhalis | PERSON | 1 |
methods human nasal mucosa | PERSON | 1 |
molinaro et al 252 | PERSON | 1 |
molinaro | PERSON | 1 |
methods data | ORG | 1 |
metapneumovirus genomes ame | CHEMICAL | 1 |
menten | CHEMICAL | 1 |
mental | ORG | 1 |
membrane | ORG | 1 |
meltzer et al 1 | PERSON | 1 |
mejstrikova ester | CHEMICAL | 1 |
meghan h rosas salazar christian turi kedir n rajan devi rajagopala | CHEMICAL | 1 |
medical | ORG | 1 |
mechanism of mammalian | ORG | 1 |
meaningful | GPE | 1 |
meco lys e | PERSON | 1 |
may gr | PERSON | 1 |
matteo cassano | PERSON | 1 |
matrix m pathogen | ORG | 1 |
matrix m h5n1 | ORG | 1 |
mating | PERSON | 1 |
mathur sameer k | PERSON | 1 |
nor partigen | ORG | 1 |
mathias brahier | PERSON | 1 |
maternal asthma | DISEASE | 1 |
methods ultrasonographic | ORG | 1 |
methyltestosterone | CHEMICAL | 1 |
mette fevang | PERSON | 1 |
microvascular | ORG | 1 |
molecular defects | DISEASE | 1 |
molecular damage | DISEASE | 1 |
modification of experimental rhinovirus | ORG | 1 |
mix | PERSON | 1 |
misdiagnosis | GPE | 1 |
min zhao jianping | PERSON | 1 |
milbank | CHEMICAL | 1 |
milan incidence | PERSON | 1 |
middle east | LOC | 1 |
microparticles | GPE | 1 |
miseq | LOC | 1 |
microbiomes | TAXON | 1 |
michelsen annika | PERSON | 1 |
michelle wright julie weckman | PERSON | 1 |
michelle martinez | PERSON | 1 |
michele ciprandi giorgio | PERSON | 1 |
michaelis menten | PERSON | 1 |
michael j hartwig nico g wolska | PERSON | 1 |
michael j | PERSON | 1 |
michael a | PERSON | 1 |
no2 | CHEMICAL | 1 |
obstructive lung disease | DISEASE | 1 |
np1m1 | PERSON | 1 |
p12 | PERSON | 1 |
overture | CHEMICAL | 1 |
outcomes of covid 19 | ORG | 1 |
osteocalcin | CHEMICAL | 1 |
oso | CHEMICAL | 1 |
organisms | TAXON | 1 |
optimal | ORG | 1 |
ontario | GPE | 1 |
omenn s syndrome | DISEASE | 1 |
omenn s | GPE | 1 |
omapatrilat bristol myers squibb omapatrilat | ORG | 1 |
omalizumab | ORG | 1 |
olli | PERSON | 1 |
olink proteomics | ORG | 1 |
olfactory dysfunction | DISEASE | 1 |
ohkubo kimihiro baraniuk james n | ORG | 1 |
ohio | GPE | 1 |
oefner | ORG | 1 |
obesity | DISEASE | 1 |
ouh ntprobnp | ORG | 1 |
otu | ORG | 1 |
omim | ORG | 1 |
p f ratio | ORG | 1 |
p13 | PERSON | 1 |
nps 130 | CHEMICAL | 1 |
p41 | ORG | 1 |
ps ap igg | ORG | 1 |
marco davis | PERSON | 1 |
ps ap ala ap | ORG | 1 |
ps ap 1 | ORG | 1 |
ps ap | ORG | 1 |
prv | ORG | 1 |
primit | DISEASE | 1 |
poct | ORG | 1 |
pmid gobal initiative for asthma | ORG | 1 |
plga | ORG | 1 |
piv | ORG | 1 |
pid | ORG | 1 |
pcd a defect | DISEASE | 1 |
pc20 | CHEMICAL | 1 |
pbs sections | ORG | 1 |
pbd codes 3bve | CHEMICAL | 1 |
pbd | ORG | 1 |
pb collectively | ORG | 1 |
pb bm | ORG | 1 |
par | ORG | 1 |
pamp pathogen | ORG | 1 |
oc43 229e | ORG | 1 |
németh Éva nielsen erik | DISEASE | 1 |
nuclisens | ORG | 1 |
novex experimental technology san diego | ORG | 1 |
neu5ac | ORG | 1 |
netherlands cohen | PERSON | 1 |
natural killer | ORG | 1 |
national heart lung and blood institute national institute of health national asthma education and prevention program expert panel report | ORG | 1 |
national heart lung and blood institute | ORG | 1 |
national health and nutrition examination survey | ORG | 1 |
national | ORG | 1 |
nataraj | GPE | 1 |
nasal mucosa | PERSON | 1 |
nasal microbiomes | PERSON | 1 |
nanshan | GPE | 1 |
naldi paolo | PERSON | 1 |
nagy | PERSON | 1 |
nacl | CHEMICAL | 1 |
number | ORG | 1 |
nt probnp | ORG | 1 |
ns2 proteins | TAXON | 1 |
nps allergy | CHEMICAL | 1 |
nps soyka | CHEMICAL | 1 |
nps fungi | CHEMICAL | 1 |
nps a | CHEMICAL | 1 |
neurologic disorders | DISEASE | 1 |
neutrophil | GPE | 1 |
new city | GPE | 1 |
nonatopic | PERSON | 1 |
novavax f | LOC | 1 |
norway | GPE | 1 |
northern italy | LOC | 1 |
north west south east | LOC | 1 |
norman | PERSON | 1 |
nontuberculous mycobacteria | PERSON | 1 |
nonpathogenic | ORG | 1 |
noninvasive | ORG | 1 |
nonetheless hae | PERSON | 1 |
nonallergic | ORG | 1 |
new york | GPE | 1 |
nonadherent | ORG | 1 |
nogawa | ORG | 1 |
nocardia species | TAXON | 1 |
nicoletta nickoloff | PERSON | 1 |
nicola a | ORG | 1 |
nicht mehr allein | PERSON | 1 |
nicht | CHEMICAL | 1 |
nicholas kunkel steven l | PERSON | 1 |
new zealand | GPE | 1 |
mario stebbing justin | PERSON | 1 |
kallikrein kinin | PERSON | 1 |
marco cicardi md milan | ORG | 1 |
jalava kaisu Österback | ORG | 1 |
jonathan t krishnan venkatesh chang ching yun engle sarah m casalini giacomo | PERSON | 1 |
jonathan m piedra pedro | PERSON | 1 |
jolla calif | CHEMICAL | 1 |
johnston | GPE | 1 |
johns hopkins | ORG | 1 |
john jakenfelds | PERSON | 1 |
joe w rogers | PERSON | 1 |
jochen schmitz | PERSON | 1 |
jian li | PERSON | 1 |
jerini j nuijens | PERSON | 1 |
jerini | PERSON | 1 |
jenum synne jørgensen | PERSON | 1 |
jean yves hugli | PERSON | 1 |
jason t | DISEASE | 1 |
jason | PERSON | 1 |
jartti tuomas | PERSON | 1 |
japan | GPE | 1 |
janus | LOC | 1 |
janssen | PERSON | 1 |
janson | PERSON | 1 |
jang | GPE | 1 |
joseph et al | PERSON | 1 |
journal | ORG | 1 |
journal of immunology pathological | ORG | 1 |
kevin | GPE | 1 |
kitzinger | PERSON | 1 |
kitsioulis nikolaos | PERSON | 1 |
kirkegaard perry laboratories | PERSON | 1 |
kirkegaard perry | PERSON | 1 |
kininase | PERSON | 1 |
kimura hiroki | PERSON | 1 |
kidneys | PERSON | 1 |
khetsuriani et al 1 | ORG | 1 |
key | PERSON | 1 |
kecia n gebretsadik | LOC | 1 |
jukes cantor | ORG | 1 |
karen binkley | PERSON | 1 |
kaplan allen | PERSON | 1 |
ps ap the ps ap | ORG | 1 |
kaisu Österback riikka ruuskanen olli title recurrent | CHEMICAL | 1 |
kainulainen leena | PERSON | 1 |
kd | ORG | 1 |
k williams | PERSON | 1 |
k sumino | ORG | 1 |
jungang xie | PERSON | 1 |
jan h nuijens | PERSON | 1 |
jacques j m van | PERSON | 1 |
klebsiella pneumonia infection 152 | CHEMICAL | 1 |
jh | PERSON | 1 |
independent of the type | ORG | 1 |
incubations | ORG | 1 |
inc chicago | PERSON | 1 |
inactivation | ORG | 1 |
imperial college | ORG | 1 |
immunopathology federation community | DISEASE | 1 |
immunological genome project | ORG | 1 |
immunologic | ORG | 1 |
immuno vienna | PERSON | 1 |
immunogenetics | ORG | 1 |
illumina miseq | ORG | 1 |
illumina hiseq | ORG | 1 |
ill functional | PERSON | 1 |
ignorance | ORG | 1 |
igm abs | ORG | 1 |
ige total | ORG | 1 |
ige rast | ORG | 1 |
ig tcr | ORG | 1 |
identification of ap | ORG | 1 |
ideal | ORG | 1 |
icatibant jerini berlin | PERSON | 1 |
ineffectiveness of recombinant | ORG | 1 |
infancy | GPE | 1 |
influenza a | ORG | 1 |
ipratropium bromide | CHEMICAL | 1 |
jak2 | CHEMICAL | 1 |
jaci journal club | ORG | 1 |
j konrad robert j de bono | PERSON | 1 |
j allergy clin | PERSON | 1 |
ixekizumab | ORG | 1 |
italy a | DISEASE | 1 |
istván nagy | PERSON | 1 |
isolation | ORG | 1 |
irwin rose | PERSON | 1 |
invitrogen carlsbad | PERSON | 1 |
influenza a virus infection | DISEASE | 1 |
intracellular | ORG | 1 |
international union of immunological societies primary | ORG | 1 |
international study of asthma and allergies | ORG | 1 |
interleukin | ORG | 1 |
intensive care unit | ORG | 1 |
institutional review board of tongji hospital | ORG | 1 |
inmaculada | PERSON | 1 |
inheritance | GPE | 1 |
ingvild | CHEMICAL | 1 |
klebsiella | PERSON | 1 |
koa kimata jason | PERSON | 1 |
marburg germany | PERSON | 1 |
lifespan | ORG | 1 |
m1 np | ORG | 1 |
lysozyme lysozyme | ORG | 1 |
lysosomes | PERSON | 1 |
lymphopenia | DISEASE | 1 |
luong | PERSON | 1 |
lung cd4 | PERSON | 1 |
lung | PERSON | 1 |
luminex | ORG | 1 |
losekoot | DISEASE | 1 |
lorenza title hereditary | DISEASE | 1 |
lopez | PERSON | 1 |
longterm | PERSON | 1 |
longhurst | ORG | 1 |
longevity | DISEASE | 1 |
longer | PERSON | 1 |
london | GPE | 1 |
lombardy | GPE | 1 |
local immune response during | ORG | 1 |
liver damage | DISEASE | 1 |
lipoxygenase | PERSON | 1 |
lipopolysaccharide | CHEMICAL | 1 |
m202 | CHEMICAL | 1 |
m2e | ORG | 1 |
masp | ORG | 1 |
mis c | ORG | 1 |
mann whitney u | PERSON | 1 |
malagoli | CHEMICAL | 1 |
mainz germany | PERSON | 1 |
maggi | GPE | 1 |
madrid | GPE | 1 |
mva viral vector | TAXON | 1 |
mo bio powersoil dna isolation kit mo bio laboratories | ORG | 1 |
mlkl | CHEMICAL | 1 |
mis c discussion | ORG | 1 |
mfos | DISEASE | 1 |
mc rotterdam | CHEMICAL | 1 |
mfo neuroendocrine | ORG | 1 |
mf59 | CHEMICAL | 1 |
methods mother | ORG | 1 |
mers cov | ORG | 1 |
men1 | DISEASE | 1 |
mek1 | CHEMICAL | 1 |
mega4 | GPE | 1 |
md toronto canada | ORG | 1 |
md milan italy | ORG | 1 |
linda g nordøy | PERSON | 1 |
life sciences roche | ORG | 1 |
kollár | ORG | 1 |
lidia | GPE | 1 |
lte 4 | ORG | 1 |
ltc 4 | ORG | 1 |
lsa patients | ORG | 1 |
lpsbinding | ORG | 1 |
llc | ORG | 1 |
ll 37 | ORG | 1 |
ll | GPE | 1 |
lig4 syndrome rs | DISEASE | 1 |
ldh nt prob | ORG | 1 |
ld | PERSON | 1 |
l tris hcl ph 7 4 lactoferrin | CHEMICAL | 1 |
l glutamic acid | CHEMICAL | 1 |
l alanyl 4 methoxy 2 naphthylamide l ala | CHEMICAL | 1 |
l patient | ORG | 1 |
l l | ORG | 1 |
l ala ap | CHEMICAL | 1 |
kusnierz beata kalwak krzysztof pituch | PERSON | 1 |
krzysztof pituch noworolska anna kondratenko irina van montfrans joris | DISEASE | 1 |
krysko olga song woo jung bachert claus | PERSON | 1 |
krysko n zhang | PERSON | 1 |
kristoffer s ullum | PERSON | 1 |
lts | CHEMICAL | 1 |
la | GPE | 1 |
la jolla calif | CHEMICAL | 1 |
les contamines france | ORG | 1 |
liang liming | ORG | 1 |
li xiaochen | PERSON | 1 |
li hailan liu huaping | PERSON | 1 |
levi et al 346a | ORG | 1 |
levi department of internal medicine academic medical | ORG | 1 |
leveraging | PERSON | 1 |
leukotriene c4 | PERSON | 1 |
letter precautions | ORG | 1 |
letter | DISEASE | 1 |
lee pui y platt craig | PERSON | 1 |
lack | PERSON | 1 |
layer | PERSON | 1 |
lausanne university hospital chuv | ORG | 1 |
laurence bouillet md | PERSON | 1 |
laura cattaneo | PERSON | 1 |
laura camargo | PERSON | 1 |
latent | LOC | 1 |
lasagni claudia | DISEASE | 1 |
laryngeal symptoms laryngeal edema | DISEASE | 1 |
lai | PERSON | 1 |
ps ap release | PERSON | 1 |
rv a and rv c | ORG | 1 |
paeruginosa s | ORG | 1 |
stempel | DISEASE | 1 |
states | GPE | 1 |
state | ORG | 1 |
staphylococcus epidermidis | DISEASE | 1 |
stanozolol stanozolol | PERSON | 1 |
stanozolol | CHEMICAL | 1 |
stade | ORG | 1 |
st giles | PERSON | 1 |
squibb princeton nj | ORG | 1 |
spyridon kitsioulis nikolaos a | DISEASE | 1 |
sputum | PERSON | 1 |
speirs | ORG | 1 |
specific novel immunoassay journal | ORG | 1 |
spain | GPE | 1 |
soyka | PERSON | 1 |
sopron | PERSON | 1 |
sonntag | PERSON | 1 |
solyar | CHEMICAL | 1 |
soluble ps ap | ORG | 1 |
society of america | ORG | 1 |
smokers | ORG | 1 |
smell loss | DISEASE | 1 |
steel | ORG | 1 |
stephenson | PERSON | 1 |
palermo | GPE | 1 |
stone 6 | ORG | 1 |
t cell lymphopenia | DISEASE | 1 |
t cell leukemias | DISEASE | 1 |
sørensen | CHEMICAL | 1 |
switzerland drammen hospital | ORG | 1 |
switzerland | GPE | 1 |
svabic vlahovic m | PERSON | 1 |
susan nayfield md | PERSON | 1 |
surgical | ORG | 1 |
surface | ORG | 1 |
suptavumab | DISEASE | 1 |
suppressor | ORG | 1 |
supportive | ORG | 1 |
superantigens | ORG | 1 |
sun | ORG | 1 |
sulfolobus | GPE | 1 |
substrate | ORG | 1 |
studies | ORG | 1 |
structure | ORG | 1 |
stroke dementia | DISEASE | 1 |
stroke | PERSON | 1 |
straeten | CHEMICAL | 1 |
small | PERSON | 1 |
sixtyfour percent | ORG | 1 |
sino french new city branch | LOC | 1 |
siniorakis eftychios arvanitakis | DISEASE | 1 |
sepsis | ORG | 1 |
selective cox | ORG | 1 |
seegene inc seoul korea | GPE | 1 |
seckel syndrome | DISEASE | 1 |
season | PERSON | 1 |
scotland | GPE | 1 |
scores | ORG | 1 |
san diego calif | GPE | 1 |
san diego | GPE | 1 |
samter triad | DISEASE | 1 |
sally randolph adrienne g mcdonald douglas | PERSON | 1 |
saccharomyces cerevisiae | TAXON | 1 |
saccharomyces | CHEMICAL | 1 |
sabrina grace rachael f maher | PERSON | 1 |
syto | CHEMICAL | 1 |
ssca | CHEMICAL | 1 |
spms | CHEMICAL | 1 |
sp d conglutinin | CHEMICAL | 1 |
socs1 | ORG | 1 |
socs | PERSON | 1 |
sle | DISEASE | 1 |
sera | PERSON | 1 |
serpin | ORG | 1 |
serum | GPE | 1 |
sigma chemical co | ORG | 1 |
sinaniotis athanasios | DISEASE | 1 |
simone | CHEMICAL | 1 |
similarly ala na | ORG | 1 |
similarly zhang et al 38 | PERSON | 1 |
silhouettes | CHEMICAL | 1 |
signal transducer | ORG | 1 |
sigmodon hispidus | TAXON | 1 |
sigmodon | ORG | 1 |
sigma st louis mo | PERSON | 1 |
sidney s braman | PERSON | 1 |
serum c1 | ORG | 1 |
shortness of breath | DISEASE | 1 |
shortness | ORG | 1 |
short | PERSON | 1 |
shih wen huang | PERSON | 1 |
shewanella oneidensis 124 | CHEMICAL | 1 |
shewanella oneidensis | TAXON | 1 |
shewanella | ORG | 1 |
sheldon l | PERSON | 1 |
sfakianaki | CHEMICAL | 1 |
t cell memory agonist inhalant allergens | DISEASE | 1 |
tcag | ORG | 1 |
tcr delta | LOC | 1 |
the vanderbilt university institutional review board | ORG | 1 |
tosi 153 | GPE | 1 |
topical | ORG | 1 |
tooth disease | DISEASE | 1 |
tonsillectomy | GPE | 1 |
tongji hospital huazhong university of science and 160 technology | ORG | 1 |
tongji hospital | ORG | 1 |
tongji | GPE | 1 |
tonby kristian | PERSON | 1 |
tom | PERSON | 1 |
tocilizumab | CHEMICAL | 1 |
tobias ruuskanen | PERSON | 1 |
titanium | ORG | 1 |
tina v das suman | PERSON | 1 |
time | ORG | 1 |
thromboembolic | ORG | 1 |
thr | PERSON | 1 |
thomas ngai | PERSON | 1 |
thomas marquart | PERSON | 1 |
theophylline toxicity | CHEMICAL | 1 |
theophylline | CHEMICAL | 1 |
the zoladex endometriosis study group bone | ORG | 1 |
tranexamic | ORG | 1 |
transfus apheresis | PERSON | 1 |
transmission | GPE | 1 |
trypanosoma cruzi infection | DISEASE | 1 |
ivig 2 gm kg | ORG | 1 |
turner s syndrome hereditary angioedema | DISEASE | 1 |
turku university hospital finland | ORG | 1 |
tuomas waris | CHEMICAL | 1 |
tumor necrosis factor | ORG | 1 |
tumor necrosis | DISEASE | 1 |
tucson children s respiratory study | ORG | 1 |
tucson arizona | GPE | 1 |
tucker jennifer shahab muhammad jaffee katy f visness cynthia m gern james e bloomberg gordon | PERSON | 1 |
trypanosoma cruzi | TAXON | 1 |
transplacental | ORG | 1 |
trypanosoma | LOC | 1 |
truedsson lennart | PERSON | 1 |
trivalent | ORG | 1 |
tris | PERSON | 1 |
tricophyton | PERSON | 1 |
trichostatin a | CHEMICAL | 1 |
tremor | DISEASE | 1 |
transwell | ORG | 1 |
transverse | PERSON | 1 |
the washington university human research protection office | ORG | 1 |
the urban environment | ORG | 1 |
tem e7 | ORG | 1 |
the tennessee children s respiratory initiative | ORG | 1 |
the cardiovascular health study | ORG | 1 |
the calgary biofilm assay | ORG | 1 |
tennessee | GPE | 1 |
ted pella | PERSON | 1 |
tecumseh | ORG | 1 |
tec | PERSON | 1 |
taken | GPE | 1 |
table xv | PERSON | 1 |
table vi tissue | ORG | 1 |
table vi mutations | ORG | 1 |
table vi | ORG | 1 |
table ix | ORG | 1 |
table iv | LOC | 1 |
table ii | PERSON | 1 |
table e3 | ORG | 1 |
table 1 | LOC | 1 |
trb gene | TAXON | 1 |
tr v d j | PERSON | 1 |
tm | ORG | 1 |
tggagagccggcctcca | CHEMICAL | 1 |
tgatgggaagtagtagtgtaaagttggt | ORG | 1 |
the cardiovascular health study research group | ORG | 1 |
the census bureau | ORG | 1 |
the chinese academy of medical sciences | ORG | 1 |
the national center for health statistics | ORG | 1 |
the st george s respiratory questionnaire patient | ORG | 1 |
the spanish group | ORG | 1 |
the seeplex respiratory virus detection | ORG | 1 |
the sa r | ORG | 1 |
the r foundation | ORG | 1 |
the normative aging study peak | ORG | 1 |
the normative aging study | ORG | 1 |
the netherlands | GPE | 1 |
the national institute on aging | ORG | 1 |
the national ambulatory medical care survey | ORG | 1 |
the complement laboratory | ORG | 1 |
the molecular biology laboratory | ORG | 1 |
the lung health study | ORG | 1 |
the institutional review board of vanderbilt 126 | ORG | 1 |
the hungarian hae patients association | ORG | 1 |
the hungarian complement laboratory | ORG | 1 |
the group health medical associates respiratory | ORG | 1 |
the fitness arthritis and seniors trial fast creating | ORG | 1 |
the epidemiology and natural history of asthma | ORG | 1 |
the cracow study rate | ORG | 1 |
sir | DISEASE | 1 |
sem | ORG | 1 |
seek | ORG | 1 |
pomegranate punica | LOC | 1 |
pseudomonas aeruginosa klebsiella | DISEASE | 1 |
pseudomonas aeruginosa | TAXON | 1 |
proteus mirabilis enterobacter | DISEASE | 1 |
proteus mirabilis | PERSON | 1 |
protein simple california usa | ORG | 1 |
proportional | ORG | 1 |
promoter | PERSON | 1 |
prol | ORG | 1 |
proinflammatory | LOC | 1 |
progesterone | CHEMICAL | 1 |
princeton healthcare | ORG | 1 |
princeton | ORG | 1 |
primary immunodeficiency diseases | DISEASE | 1 |
price | GPE | 1 |
prevotella intermedia | CHEMICAL | 1 |
presumably | ORG | 1 |
prescott woodruff | PERSON | 1 |
prekallikrein | PERSON | 1 |
predominant | PERSON | 1 |
postsurgical | ORG | 1 |
post | ORG | 1 |
pseudomonas aeruginosa biofilms | DISEASE | 1 |
pseudomonas infected cystic fibrosis | DISEASE | 1 |
psoriasis | DISEASE | 1 |
quincke | PERSON | 1 |
roc | GPE | 1 |
rneasy plus mini kit | PERSON | 1 |
rnaeasy | ORG | 1 |
results | ORG | 1 |
rems | DISEASE | 1 |
rantes expression of rantes | ORG | 1 |
rag pre bi | ORG | 1 |
rag artemis | ORG | 1 |
r foundation for statistical | ORG | 1 |
quality of life and management of living resources establishing | ORG | 1 |
psti | ORG | 1 |
quality of life and management of living resources | ORG | 1 |
qiagen hilden | PERSON | 1 |
qiagen | ORG | 1 |
qt | GPE | 1 |
qiime | PERSON | 1 |
purity | LOC | 1 |
punica | GPE | 1 |
pulmonary vascular endothelialitis thrombosis | DISEASE | 1 |
pulmonary 197 infections | DISEASE | 1 |
ponikau | PERSON | 1 |
polytron | ORG | 1 |
rsv a | PERSON | 1 |
pneumacult ex plus stemcell technologies | ORG | 1 |
peprotech rocky hill nj usa | ORG | 1 |
peninsula laboratories belmont calif | GPE | 1 |
peninsula | LOC | 1 |
pella redding calif | CHEMICAL | 1 |
pearson figure 2 | ORG | 1 |
pearson | GPE | 1 |
paul falsey ann | PERSON | 1 |
patterson | PERSON | 1 |
patricia woodward kimberly liu zhouwen miller | PERSON | 1 |
pathways | PERSON | 1 |
pathscan | CHEMICAL | 1 |
pasteur institut | PERSON | 1 |
pascal barbry ph d | PERSON | 1 |
paroxysmal | ORG | 1 |
parkinson disease | DISEASE | 1 |
park il | PERSON | 1 |
paris | GPE | 1 |
paralytic poliomyelitis | DISEASE | 1 |
parainfluenza viruses | TAXON | 1 |
papadopoulos nikolaos | PERSON | 1 |
paolo gisondi stefano | PERSON | 1 |
peripheral edema | DISEASE | 1 |
perricone et al | PERSON | 1 |
persistence | PERSON | 1 |
phylogenetic | ORG | 1 |
pneumacult | ORG | 1 |
pleconaril | CHEMICAL | 1 |
plasma c1 inh | ORG | 1 |
piscataway | GPE | 1 |
pidotimod | PERSON | 1 |
picornaviridae | GPE | 1 |
pichia c1 inh | ORG | 1 |
pichia | ORG | 1 |
piacenza turin | PERSON | 1 |
pharming group nv | ORG | 1 |
perth australia | LOC | 1 |
pharmacologic | ORG | 1 |
pharmacia lkb | PERSON | 1 |
pharma | GPE | 1 |
phadiatop phadiatop | PERSON | 1 |
phadia kalamazoo mich | PERSON | 1 |
ph d and prescott woodruff 389 m d | CHEMICAL | 1 |
pets | LOC | 1 |
peter xepapadaki paraskevi | PERSON | 1 |
peter | PERSON | 1 |
rpmi | ORG | 1 |
rsv ari | ORG | 1 |
secure ibd | CHEMICAL | 1 |
respiratory virus infections | DISEASE | 1 |
ronit | CHEMICAL | 1 |
ronald schunk | PERSON | 1 |
rome | GPE | 1 |
roles | PERSON | 1 |
rochester | GPE | 1 |
robert merida marco hersh louis b kaliner | PERSON | 1 |
rivas magali | PERSON | 1 |
risk | PERSON | 1 |
richard jean | PERSON | 1 |
rhodes greece | PERSON | 1 |
rhode island hospital providence | ORG | 1 |
rhinovirus upper respiratory infection | DISEASE | 1 |
rhinovirus and respiratory syncytial virus | DISEASE | 1 |
rhinosinusitis and nasal polyps | DISEASE | 1 |
rhinogen | ORG | 1 |
rhino probe | ORG | 1 |
rg | LOC | 1 |
reynoutria | ORG | 1 |
revolutionary | GPE | 1 |
retrospective | ORG | 1 |
reticuloendotheliosis | PERSON | 1 |
rozzo giulia damiani | ORG | 1 |
ruhr similar | ORG | 1 |
rusicke | DISEASE | 1 |
sars coronavirus | DISEASE | 1 |
seb cross | ORG | 1 |
sds | ORG | 1 |
scpn deficiency | DISEASE | 1 |
scpn | DISEASE | 1 |
scid omenn | ORG | 1 |
scid | ORG | 1 |
sas institute inc cary nc | ORG | 1 |
sas 9 2 | ORG | 1 |
sars coronavirus sars cov | DISEASE | 1 |
sars transcriptomic characteristics | ORG | 1 |
s liu | PERSON | 1 |
sars cov mers | DISEASE | 1 |
sars cov 2 rna | ORG | 1 |
sars cov 1 | ORG | 1 |
sars cov 2 | ORG | 1 |
sag | CHEMICAL | 1 |
sa | CHEMICAL | 1 |
s100a8 s100a9 | PERSON | 1 |
s aureus sequences | TAXON | 1 |
s aureus biofilm | CHEMICAL | 1 |
results | PERSON | 1 |
respiratory tract viral infections | DISEASE | 1 |
rsv aris | DISEASE | 1 |
respiratory tract infection | DISEASE | 1 |
rabbits | TAXON | 1 |
rv infections | DISEASE | 1 |
rv infection | DISEASE | 1 |
rv c infections | DISEASE | 1 |
rv c 2 | ORG | 1 |
rv c | ORG | 1 |
ru | ORG | 1 |
rti | ORG | 1 |
rt | PERSON | 1 |
rsvpredominant | ORG | 1 |
rsvon | ORG | 1 |
rsv infected epithelial | DISEASE | 1 |
rsv disease | DISEASE | 1 |
rsv bronchiolitis | DISEASE | 1 |
rsv rhinoviruses | PERSON | 1 |
rsv rna | ORG | 1 |
rsv one | ORG | 1 |
rsv mothers | ORG | 1 |
rsv l | ORG | 1 |
rsv ig ri 002 | ORG | 1 |
rsv f | GPE | 1 |
radonjic hoesli | PERSON | 1 |
rag | GPE | 1 |
rag2 | GPE | 1 |
renin | PERSON | 1 |
respiratory syncytial virus rsv and rhinovirus infections | DISEASE | 1 |
respiratory arrest | DISEASE | 1 |
respiratory syncytial virus infection | DISEASE | 1 |
respiratory failure | DISEASE | 1 |
respiratory | PERSON | 1 |
research electronic data capture easy | ORG | 1 |
reply hereditary | PERSON | 1 |
replicon rna | PERSON | 1 |
renz harald | PERSON | 1 |
reliability | ORG | 1 |
raif s chou janet | PERSON | 1 |
regarding ruxolitinib | PERSON | 1 |
reg | PERSON | 1 |
reduced asthma symptoms | DISEASE | 1 |
recombinant c1 inh | ORG | 1 |
recombinant | ORG | 1 |
recognition | ORG | 1 |
rationale | ORG | 1 |
rare | ORG | 1 |
ramanathan et al | PERSON | 1 |
icatibant | PERSON | 1 |
b cell malignancies | DISEASE | 1 |
iu | GPE | 1 |
c1 inhibitor dysfunction | CHEMICAL | 1 |
c1 inhibitor concentrate a | CHEMICAL | 1 |
c1 inhibitor concentrate | CHEMICAL | 1 |
c1 inhibitor recombinant c1 inhibitor p5 | CHEMICAL | 1 |
c1 inhibitor n none r rare 1 attack | CHEMICAL | 1 |
c1 inhibitor ma alanine | CHEMICAL | 1 |
c1 inhibitor c1 inhibitor gene sequence | CHEMICAL | 1 |
c1 inhibitor | ORG | 1 |
c1 inh deficiency | CHEMICAL | 1 |
c1 inh deficiencies | CHEMICAL | 1 |
c1 inh deficien | CHEMICAL | 1 |
c1 inh c1r | CHEMICAL | 1 |
c1 inh bradykinin | CHEMICAL | 1 |
c1 inh 1 2 and c1 inh 2 2 | CHEMICAL | 1 |
c1 c1 inhibitor | CHEMICAL | 1 |
c bachert | ORG | 1 |
c 1 | ORG | 1 |
burrows wheeler | PERSON | 1 |
burg mirjam | ORG | 1 |
budapest workshop | ORG | 1 |
brunello wüthrich | PERSON | 1 |
broughton | GPE | 1 |
c1 inhibitor deficiency c1 inhibitor | CHEMICAL | 1 |
c1 inhibitor functional | CHEMICAL | 1 |
istat istituto nazionale di statistica | ORG | 1 |
c1 inhibitor gene a dysfunctional c1 inhibitor | CHEMICAL | 1 |
cd64 cd16 | CHEMICAL | 1 |
cd4 treg | ORG | 1 |
cd196 | CHEMICAL | 1 |
cd16 | CHEMICAL | 1 |
cd10 | ORG | 1 |
cc | CHEMICAL | 1 |
ca usa | ORG | 1 |
c3a | CHEMICAL | 1 |
c3 concentrations of c1q | ORG | 1 |
c2b | ORG | 1 |
c1r | CHEMICAL | 1 |
c1 inhibitor sequence | CHEMICAL | 1 |
c1 inhibitor primary | CHEMICAL | 1 |
c1 inhibitor hinge region mutations | CHEMICAL | 1 |
c1 inhibitor gene of a patient with type i hereditary angioneurotic edema nonsense mutations affect c1 inhibitor | CHEMICAL | 1 |
c1 inhibitor gene of | CHEMICAL | 1 |
c1 inhibitor gene in a case of | CHEMICAL | 1 |
c1 inhibitor gene causes type i hereditary angio oedema c1 inhibitor gene nucleotide | CHEMICAL | 1 |
c1 inhibitor gene altering protein synthesis | CHEMICAL | 1 |
c1 inhibitor gene recombinational biases | CHEMICAL | 1 |
c1 inhibitor gene dysfunctional c1 inhibitor ta | CHEMICAL | 1 |
bronchoprovocation | GPE | 1 |
bronchoalveolar | ORG | 1 |
brengel pesce karen lina | PERSON | 1 |
box | PERSON | 1 |
berinert p methods berinert | ORG | 1 |
berichrom c1 inhibitor | ORG | 1 |
berhane | CHEMICAL | 1 |
berg ronan m g bay | PERSON | 1 |
benschop robert j ottaviani | PERSON | 1 |
benjamini hochberg | PERSON | 1 |
beckman coulter | PERSON | 1 |
beckman | PERSON | 1 |
baylor college of medicine of rv | ORG | 1 |
basil eldadah md | PERSON | 1 |
baricitinib 184 | ORG | 1 |
bardin | GPE | 1 |
bardazzi massimo gasperini | ORG | 1 |
bamhi bglii ecori | PERSON | 1 |
background physicians | ORG | 1 |
background aminopeptidases | ORG | 1 |
baclight | ORG | 1 |
bv | ORG | 1 |
bpi recent | ORG | 1 |
bpe pbs | ORG | 1 |
boc | CHEMICAL | 1 |
berinert p ursula rauch | PERSON | 1 |
berlin | GPE | 1 |
bern | LOC | 1 |
biota medimmune | LOC | 1 |
bousquet | GPE | 1 |
boston | GPE | 1 |
bos et al | PERSON | 1 |
bos | PERSON | 1 |
bork et al 277 | ORG | 1 |
bo yang zhenyu zhang | PERSON | 1 |
blood institute asthma | ORG | 1 |
blocked | PERSON | 1 |
bladder | ORG | 1 |
biondvax | ORG | 1 |
bestatin | ORG | 1 |
biomerieux boxtel | PERSON | 1 |
biofire filmarray pneumonia plus panel | ORG | 1 |
binkley unpublished | ORG | 1 |
bin cao et al | PERSON | 1 |
bianca sierra | ORG | 1 |
bettina fischer | PERSON | 1 |
bethesda national institutes of health | ORG | 1 |
bethesda national heart lung | ORG | 1 |
bethesda american society of health system pharmacists drugdexÒ | ORG | 1 |
cd68 | ORG | 1 |
cd8 t cell lymphopenia 111 | DISEASE | 1 |
cdr3 | PERSON | 1 |
calif single | ORG | 1 |
charcot | DISEASE | 1 |
channappavanar | ORG | 1 |
chalfont | GPE | 1 |
cepheid smart cycler ii | ORG | 1 |
centocor boeheringer ingelheim glaxosmithkline | ORG | 1 |
cell neurosci | PERSON | 1 |
cazzaniga | CHEMICAL | 1 |
carron | PERSON | 1 |
carol saltoun | PERSON | 1 |
carlsbad calif | PERSON | 1 |
carlos a | PERSON | 1 |
cardiovascular disease | DISEASE | 1 |
cardiovascular health study research group | ORG | 1 |
cardiovascular health study correlates | ORG | 1 |
cardiorespiratory | PERSON | 1 |
cardiac injury | DISEASE | 1 |
carbon | CHEMICAL | 1 |
caparr os wanderley w synthetic influenza | ORG | 1 |
candida species | TAXON | 1 |
candida albicans | TAXON | 1 |
cancer | DISEASE | 1 |
charcot marie tooth | PERSON | 1 |
charite berlin | PERSON | 1 |
chemotherapy | PERSON | 1 |
chronic infections | DISEASE | 1 |
civitanova marche recent | ORG | 1 |
citrobacter rodentium | DISEASE | 1 |
cincinnati children s hospital medical center | ORG | 1 |
cincinnati | GPE | 1 |
cigarette | ORG | 1 |
cicardi 7 | PERSON | 1 |
chrystal mcdonald | PERSON | 1 |
chronic sinonasal disease | DISEASE | 1 |
chronic rhinosinusitis | DISEASE | 1 |
chronic human immunodeficiency virus infection | DISEASE | 1 |
chi | PERSON | 1 |
christophe | ORG | 1 |
christian de duve | ORG | 1 |
christian turi kedir | PERSON | 1 |
chitosan | ORG | 1 |
chinese national health 165 committee | ORG | 1 |
china sars cov 2 | ORG | 1 |
china epidemiological | ORG | 1 |
china climate | ORG | 1 |
childhood | GPE | 1 |
cambridge | GPE | 1 |
caldwell | PERSON | 1 |
ci confidence | PERSON | 1 |
calbiochem | ORG | 1 |
cpmp | ORG | 1 |
covid19 | GPE | 1 |
covid cluster | DISEASE | 1 |
covid net | DISEASE | 1 |
covid 2 | ORG | 1 |
covid 19 simultaneous | ORG | 1 |
covid 19 referring | ORG | 1 |
covid 19 data | ORG | 1 |
covid 19 conclusions patients | ORG | 1 |
covid 19 3 | ORG | 1 |
covid 19 20 | ORG | 1 |
covid 19 1 2 3 | ORG | 1 |
cos 1 | GPE | 1 |
cos | ORG | 1 |
copd congestive heart failure paroxysmal arrhythmias pulmonary emboli | DISEASE | 1 |
cobas | ORG | 1 |
coast | ORG | 1 |
cmv infection n terminal rag1 | DISEASE | 1 |
clc | ORG | 1 |
cid table ii | ORG | 1 |
cid p15 p16 | ORG | 1 |
crp | ORG | 1 |
crp dynamics | ORG | 1 |
crs antimicrobial | ORG | 1 |
crssnp crswnp afrs | DISEASE | 1 |
caenorhabditis elegans divergent | ORG | 1 |
ca | CHEMICAL | 1 |
cx3cr11 | PERSON | 1 |
cvid 34 | ORG | 1 |
cvd ii | ORG | 1 |
cv | ORG | 1 |
ct abnormalities | DISEASE | 1 |
ct | GPE | 1 |
crswnp and sphenoid sinus and turbinate epithelial | DISEASE | 1 |
crs exacerbations | DISEASE | 1 |
crs biofilm | ORG | 1 |
crs disease | DISEASE | 1 |
crs to date genetic association | ORG | 1 |
crs studies | ORG | 1 |
crs ramanathan et al 3 | PERSON | 1 |
crs psaltis | DISEASE | 1 |
crs lee et al 146 | PERSON | 1 |
crs healy | DISEASE | 1 |
crs e1 | CHEMICAL | 1 |
crs clinical | ORG | 1 |
bno | ORG | 1 |
bm p13 p14 p15 p16 | ORG | 1 |
benelux | GPE | 1 |
ace 2 provides | CHEMICAL | 1 |
ap | ORG | 1 |
aids | DISEASE | 1 |
ai072726 | CHEMICAL | 1 |
aggtcggagtcaaccgatttggtcgtattg | ORG | 1 |
aggtaatacagccaaatc | ORG | 1 |
ag7404 | CHEMICAL | 1 |
ag7088 | CHEMICAL | 1 |
ace inhibitors angioedema | CHEMICAL | 1 |
ace inhibitors 235 236 237 | CHEMICAL | 1 |
ace inhibitors 136 | CHEMICAL | 1 |
ace inhibitorinduced angioedema | DISEASE | 1 |
ace inhibitorassociated angioedema | CHEMICAL | 1 |
ace inhibitor enalapril | CHEMICAL | 1 |
ace inhibitor captopril figs | CHEMICAL | 1 |
ace inhibitor captopril | CHEMICAL | 1 |
ace inhibitor angioedema angiotensin ii | CHEMICAL | 1 |
ace inhibitor reply hereditary angioedema | CHEMICAL | 1 |
ace app | LOC | 1 |
ace a | CHEMICAL | 1 |
ace 256 | CHEMICAL | 1 |
ace 2 removes c terminal 107 | CHEMICAL | 1 |
arb | CHEMICAL | 1 |
arb simple | ORG | 1 |
ards myeloid | DISEASE | 1 |
activator of transcription stat 1 | ORG | 1 |
agencourt | GPE | 1 |
ag antigen initial | PERSON | 1 |
affected | ORG | 1 |
aerobic | LOC | 1 |
advantages disadvantages examples | ORG | 1 |
advances | TAXON | 1 |
administration of estrogens | ORG | 1 |
adalimumab injection | ORG | 1 |
adalimumab | CHEMICAL | 1 |
acquired c1 inh deficiency | DISEASE | 1 |
ards acute respiratory distress syndrome | DISEASE | 1 |
acepramin pannon | PERSON | 1 |
accessed | PERSON | 1 |
abdominal pain | DISEASE | 1 |
abdominal edema | DISEASE | 1 |
aaron ciechanover | PERSON | 1 |
ats | ORG | 1 |
atg | ORG | 1 |
asv | ORG | 1 |
ari studies | ORG | 1 |
ace 2 removes c terminal | CHEMICAL | 1 |
ace 2 limits | CHEMICAL | 1 |
agostoni angelo | PERSON | 1 |
ace 2 in | CHEMICAL | 1 |
303135 | CHEMICAL | 1 |
3 medium 4 6 | CHEMICAL | 1 |
3 4 4 r foundation | CHEMICAL | 1 |
27511 | DISEASE | 1 |
229e nl63 rhinovirus human metapneumovirus | TAXON | 1 |
2 nucleic acid | CHEMICAL | 1 |
2 oseltamivir | PERSON | 1 |
2 b 2 scid | CHEMICAL | 1 |
1979 | DISEASE | 1 |
17b estradiol | CHEMICAL | 1 |
17a ethyltestosterone danazol | CHEMICAL | 1 |
16s | PERSON | 1 |
133 autoantibodies | ORG | 1 |
123 124 | CHEMICAL | 1 |
106624 outcome | PERSON | 1 |
104 safety | ORG | 1 |
104 | ORG | 1 |
10159 | DISEASE | 1 |
1 rhinovirus | GPE | 1 |
1 c1 inh 1 2 c1 inh | CHEMICAL | 1 |
1 c1 inh | CHEMICAL | 1 |
304549 | DISEASE | 1 |
334801 | DISEASE | 1 |
34mb | CHEMICAL | 1 |
80a6afbc0844e60bf3ba2d1507ad03b169bafc01 | DISEASE | 1 |
ace 2 expressions | CHEMICAL | 1 |
ace 2 q 2 3 | CHEMICAL | 1 |
accept | CHEMICAL | 1 |
abi prism 3130 | CHEMICAL | 1 |
abi | ORG | 1 |
aae patients | ORG | 1 |
aae low c4 | ORG | 1 |
a efficacy | ORG | 1 |
832d6ccc34d0735b43f05c149fbbe95aedd0ec56 | CHEMICAL | 1 |
7a11eb64020481c37525cc86cf9f3bd0d79e7516 | CHEMICAL | 1 |
374 antifibrinolytics | ORG | 1 |
6cc78e15d0e2292fb53d9ca7e8b07c6780285b6d | CHEMICAL | 1 |
68e870957c5db86def82e24723dd7d71dca890e1 | DISEASE | 1 |
519delt | DISEASE | 1 |
50020 pmbl | DISEASE | 1 |
5 203 leukotriene | CHEMICAL | 1 |
5 1 cough | CHEMICAL | 1 |
4 2 upper respiratory tract infections colds 1 3 wheezing illnesses | CHEMICAL | 1 |
3a1780bc9deb8da0e5c6cdb0fc44edc080d02023 | CHEMICAL | 1 |
3bve | ORG | 1 |
agilent technologies data | ORG | 1 |
ahlström magnus g burgdorf | ORG | 1 |
bd biosciences | LOC | 1 |
anthony j | PERSON | 1 |
association of hereditary angioedema | ORG | 1 |
assisting | PERSON | 1 |
asn 216 asn 231 | ORG | 1 |
asia | LOC | 1 |
arthritis | DISEASE | 1 |
artemis | LOC | 1 |
arlington tex | PERSON | 1 |
arg9 | ORG | 1 |
arg249his | CHEMICAL | 1 |
arg | ORG | 1 |
applied biosystems | ORG | 1 |
applicability of the asthma opinion survey | ORG | 1 |
applica | GPE | 1 |
appendix | GPE | 1 |
ap 2 | ORG | 1 |
antonios | DISEASE | 1 |
antonio costanzo | PERSON | 1 |
antivirals | TAXON | 1 |
antileukoprotease | ORG | 1 |
antihistamine decongestants | CHEMICAL | 1 |
antigenic c1 inh | ORG | 1 |
association of respiratory allergy | ORG | 1 |
association of rhinovirus | ORG | 1 |
associations | ORG | 1 |
attacks of hae | PERSON | 1 |
balf ctla 4 | ORG | 1 |
b lymphoproliferative diseases | DISEASE | 1 |
type ii hereditary angioneurotic edema | DISEASE | 1 |
b h barendregt | ORG | 1 |
b genome wide association study gwas | ORG | 1 |
aventis behring gmbh | ORG | 1 |
aventis behring | ORG | 1 |
autoantibody | GPE | 1 |
aukrust | CHEMICAL | 1 |
atopic disease | DISEASE | 1 |
asthma a syndrome | DISEASE | 1 |
atopic dermatitis | DISEASE | 1 |
atlantic | LOC | 1 |
asymptomatic | PERSON | 1 |
astragalin | GPE | 1 |
astrazeneca g r bloomberg | ORG | 1 |
asthma exacerbations | DISEASE | 1 |
asthma following rsv exposure study inspire | ORG | 1 |
asthma european academy of allergology and clinical immunology | ORG | 1 |
asthma epidemiology | ORG | 1 |
antibiotic | LOC | 1 |
anne m holter jan | PERSON | 1 |
aims aaee | PERSON | 1 |
anna louise | PERSON | 1 |
alvin davis iii | PERSON | 1 |
alu | PERSON | 1 |
alternaria species | TAXON | 1 |
alterations | ORG | 1 |
aloka co ltd tokyo | ORG | 1 |
aloka | ORG | 1 |
allergy asthma | DISEASE | 1 |
allergic respiratory disease | DISEASE | 1 |
allergic angioedema | DISEASE | 1 |
allergic airway inflammation | DISEASE | 1 |
allergic airway | LOC | 1 |
allergic rhinitis | DISEASE | 1 |
allergic disease | DISEASE | 1 |
alexandre | GPE | 1 |
alcian blue | CHEMICAL | 1 |
albrecht erik | PERSON | 1 |
alanine | CHEMICAL | 1 |
ala443 val | ORG | 1 |
ala443 | GPE | 1 |
airway obstruction | DISEASE | 1 |
airway epithelial cells | ORG | 1 |
alvin e davis iii | PERSON | 1 |
alvin schmaier | PERSON | 1 |
american academy of dermatology | ORG | 1 |
ang 2 il | PERSON | 1 |
ann charlotte | PERSON | 1 |
ankara | GPE | 1 |
animal parvovirus | TAXON | 1 |
angiotensin converting | PERSON | 1 |
angiooedema | PERSON | 1 |
angioneurotic | PERSON | 1 |
angelo | PERSON | 1 |
ang ii ang ii | PERSON | 1 |
ang ii | PERSON | 1 |
ang | PERSON | 1 |
american thoracic society | ORG | 1 |
anesthesia | GPE | 1 |
androgens | ORG | 1 |
andrew et al | PERSON | 1 |
andrew p van dongen | PERSON | 1 |
andrea m | PERSON | 1 |
anabela nirula | DISEASE | 1 |
amsterdam | PERSON | 1 |
amphotericin b | CHEMICAL | 1 |
amicon danvers | PERSON | 1 |
clearing | GPE | 1 |
cleavage | PERSON | 1 |
clinicaltrials | ORG | 1 |
gregori | PERSON | 1 |
hae phase ii | ORG | 1 |
hae patients | ORG | 1 |
hae mutation | ORG | 1 |
hae i frank | DISEASE | 1 |
hae hereditary | PERSON | 1 |
hae finally | ORG | 1 |
hae fig 31 | ORG | 1 |
hae diseases | PERSON | 1 |
hae creating | PERSON | 1 |
hae c1 inh | ORG | 1 |
hae background | ORG | 1 |
hae association | ORG | 1 |
hae a | DISEASE | 1 |
hae 355 | DISEASE | 1 |
ha stalks | CHEMICAL | 1 |
h5n1 viruses | TAXON | 1 |
h3n2 | TAXON | 1 |
h1n1 s oiv | PERSON | 1 |
h 20023159 | CHEMICAL | 1 |
gynecologic | ORG | 1 |
gvhd | ORG | 1 |
hae prompt | PERSON | 1 |
hae results | PERSON | 1 |
hae typical | ORG | 1 |
hk of | ORG | 1 |
halvorsen bente müller | PERSON | 1 |
hack et al | GPE | 1 |
hack amsterdam | PERSON | 1 |
hack | ORG | 1 |
hrvinduced | ORG | 1 |
hrv infections | DISEASE | 1 |
hrt warin | PERSON | 1 |
hpv | ORG | 1 |
hla dr | ORG | 1 |
hiv protease inhibitors | TAXON | 1 |
hae vereinigung | PERSON | 1 |
hiv infection tim 3 | TAXON | 1 |
hiv 15 hepatitis b | DISEASE | 1 |
hfwho | ORG | 1 |
hcl | CHEMICAL | 1 |
hcl | ORG | 1 |
hc | ORG | 1 |
hav | ORG | 1 |
hae of reproductive age | DISEASE | 1 |
hae infected | DISEASE | 1 |
gregori silvia | PERSON | 1 |
greater | ORG | 1 |
handbook | PERSON | 1 |
graphpad prism | ORG | 1 |
gal9 | ORG | 1 |
gait | PERSON | 1 |
gwas finally | ORG | 1 |
gro | ORG | 1 |
gpc n114 | ORG | 1 |
gmp | CHEMICAL | 1 |
gm103712 | CHEMICAL | 1 |
gina | ORG | 1 |
gi symptoms | DISEASE | 1 |
gggaaagagccacc ctctcctg 39 | ORG | 1 |
gerd | DISEASE | 1 |
ga | ORG | 1 |
g viral | ORG | 1 |
g bay jakob t | CHEMICAL | 1 |
fungi | TAXON | 1 |
fungal biofilm | CHEMICAL | 1 |
fullerton calif | PERSON | 1 |
frédéric | CHEMICAL | 1 |
frozen | ORG | 1 |
front | GPE | 1 |
frequent de | LOC | 1 |
gallo | PERSON | 1 |
gastrointestinal | ORG | 1 |
gaymard | CHEMICAL | 1 |
george h bivi | PERSON | 1 |
grady caroline | PERSON | 1 |
gordon | PERSON | 1 |
godfrey | ORG | 1 |
global initiative | ORG | 1 |
gln 576 | CHEMICAL | 1 |
giovanni facheris paola | ORG | 1 |
gertjan | DISEASE | 1 |
german asthma genetics group report | ORG | 1 |
george jakenfelds john juers mathias kalmár | PERSON | 1 |
george giacomelli | PERSON | 1 |
gelardi | ORG | 1 |
george gauthier | PERSON | 1 |
george füst | PERSON | 1 |
georg dewald | PERSON | 1 |
genmab | ORG | 1 |
geneva world health organization wheezing | ORG | 1 |
genetic | ORG | 1 |
gene knockdown | PERSON | 1 |
genbank | ORG | 1 |
gelfand | GPE | 1 |
hamilos daniel l | ORG | 1 |
hansen et al | PERSON | 1 |
fredrik bekken gry kloumann | PERSON | 1 |
ibd inflammatory bowel disease | DISEASE | 1 |
ii assessment of c1 | ORG | 1 |
igkj | ORG | 1 |
ighv | ORG | 1 |
ig mutations | ORG | 1 |
ifv specific t cell | TAXON | 1 |
ifv rhinovirus | TAXON | 1 |
ifv infection | DISEASE | 1 |
ifv infected | DISEASE | 1 |
ifv envelope | TAXON | 1 |
ifv a and ifv b rsv piv3 | ORG | 1 |
ifn γ | CHEMICAL | 1 |
ifn l2 fig 1 b | CHEMICAL | 1 |
ifn l1 | ORG | 1 |
ifn l contributes | ORG | 1 |
ifn gamma | CHEMICAL | 1 |
ifn g memory | ORG | 1 |
ifn g action indeed | ORG | 1 |
ifn g il | ORG | 1 |
ifn beta | CHEMICAL | 1 |
ifn b 100 u | CHEMICAL | 1 |
ifn a ifn b and ifn l | CHEMICAL | 1 |
ii b | CHEMICAL | 1 |
ii interferon ifn | CHEMICAL | 1 |
iii karen binkley md frcpc | ORG | 1 |
il 6 and ifn g | ORG | 1 |
iqr interquartile | ORG | 1 |
ip2 rt | ORG | 1 |
ip2 | CHEMICAL | 1 |
ip | ORG | 1 |
inspire | ORG | 1 |
inh hypercatabolism | CHEMICAL | 1 |
inh hae ii | CHEMICAL | 1 |
inf γ il | PERSON | 1 |
imgt | ORG | 1 |