This is a table of named entities, their types, and their frequencies from sentences in your study carrel. Use it to search & browse the list to learn more about your study carrel. Please keep in mind that named-entity extraction is not as accurate as more generic parts-of-speech extraction. Unusual results will appear here.
| entity | type | frequency |
|---|---|---|
| covid | ORG | 362 |
| infection | DISEASE | 210 |
| sars | DISEASE | 205 |
| cov | CHEMICAL | 177 |
| viral | TAXON | 173 |
| covid 19 | ORG | 164 |
| virus | TAXON | 158 |
| sars cov 2 | ORG | 129 |
| pneumonia | DISEASE | 127 |
| viruses | TAXON | 97 |
| hlh | ORG | 95 |
| coronavirus | TAXON | 86 |
| individuals | TAXON | 79 |
| respiratory illness | DISEASE | 77 |
| infections | DISEASE | 73 |
| ppe | ORG | 71 |
| cti | ORG | 68 |
| china | GPE | 64 |
| death | DISEASE | 62 |
| hrv | ORG | 61 |
| human | TAXON | 58 |
| hev | TAXON | 55 |
| hiv | TAXON | 54 |
| lpv | ORG | 54 |
| lbw | ORG | 51 |
| the united states | GPE | 49 |
| ci | ORG | 47 |
| ipc | ORG | 45 |
| rhinovirus | TAXON | 44 |
| ttv | ORG | 44 |
| statin | CHEMICAL | 43 |
| camels | TAXON | 41 |
| wuhan | GPE | 40 |
| hydroxychloroquine | CHEMICAL | 39 |
| oxygen | CHEMICAL | 39 |
| cdc | ORG | 38 |
| crs | ORG | 37 |
| fever | DISEASE | 36 |
| mp | DISEASE | 36 |
| coronavirus | TAXON | 36 |
| bacterial | TAXON | 35 |
| h1n1 | GPE | 34 |
| car | ORG | 33 |
| piv | ORG | 32 |
| deaths | DISEASE | 31 |
| h5n1 | TAXON | 31 |
| syncytial virus | TAXON | 31 |
| statins | CHEMICAL | 29 |
| chloroquine | CHEMICAL | 28 |
| us | GPE | 27 |
| iqr | ORG | 27 |
| coronavirus disease | DISEASE | 26 |
| pcr | ORG | 26 |
| rickettsia | TAXON | 25 |
| mers | DISEASE | 25 |
| sars cov | ORG | 25 |
| bias | CHEMICAL | 25 |
| igg | ORG | 23 |
| rna | ORG | 22 |
| rsv illness | ORG | 21 |
| id | DISEASE | 21 |
| ec | ORG | 21 |
| rickettsia conorii | TAXON | 20 |
| latinx | ORG | 20 |
| ifa | ORG | 20 |
| mf59 | ORG | 19 |
| copd | ORG | 19 |
| influenza | ORG | 19 |
| imv | ORG | 18 |
| np | ORG | 18 |
| mers cov | ORG | 18 |
| sepsis | DISEASE | 18 |
| pui | ORG | 18 |
| tocilizumab | CHEMICAL | 18 |
| south africa | GPE | 18 |
| orchitis | DISEASE | 17 |
| neutropenia | DISEASE | 17 |
| fungal | TAXON | 17 |
| viral | TAXON | 17 |
| asp | ORG | 17 |
| fio | CHEMICAL | 16 |
| epa | ORG | 16 |
| epstein barr | PERSON | 16 |
| the icmje form for disclosure of potential conflicts of interest conflicts | ORG | 16 |
| hubei | TAXON | 16 |
| iga | ORG | 16 |
| cough | DISEASE | 16 |
| ed | ORG | 15 |
| fda | ORG | 15 |
| guangzhou | GPE | 15 |
| coronavirus disease | DISEASE | 15 |
| arf | ORG | 15 |
| fu | ORG | 15 |
| meningitis | DISEASE | 15 |
| influenza | ORG | 15 |
| middle east | LOC | 15 |
| animals | TAXON | 15 |
| hemophagocytic lymphohistiocytosis | DISEASE | 15 |
| respiratory disease | DISEASE | 15 |
| lrti | ORG | 15 |
| sars cov 1 | ORG | 14 |
| af | ORG | 14 |
| dic | ORG | 14 |
| msf | ORG | 14 |
| u s | GPE | 14 |
| anxiety | DISEASE | 14 |
| febrile | DISEASE | 14 |
| infectious diseases | DISEASE | 14 |
| lopinavir ritonavir | CHEMICAL | 14 |
| rp | ORG | 13 |
| hcw | ORG | 13 |
| hev infection | DISEASE | 13 |
| hiv infected | DISEASE | 13 |
| idv | ORG | 13 |
| vi | ORG | 13 |
| tocilizumab | CHEMICAL | 13 |
| adenovirus | TAXON | 13 |
| humans | TAXON | 13 |
| infectious disease | DISEASE | 13 |
| ribavirin | CHEMICAL | 13 |
| seir | ORG | 12 |
| open forum infectious diseases | ORG | 12 |
| pneumonia | DISEASE | 12 |
| infectious | DISEASE | 12 |
| methylprednisolone | CHEMICAL | 12 |
| ncov | ORG | 12 |
| respiratory infection | DISEASE | 12 |
| who | ORG | 11 |
| all | DISEASE | 11 |
| fri | ORG | 11 |
| nat | ORG | 11 |
| rt pcr | ORG | 11 |
| israel | GPE | 11 |
| corticosteroids | CHEMICAL | 11 |
| nucleic acid | CHEMICAL | 11 |
| oseltamivir | CHEMICAL | 11 |
| respiratory infections | DISEASE | 11 |
| lymphopenia | DISEASE | 11 |
| vomc | ORG | 10 |
| igm | ORG | 10 |
| italy | GPE | 10 |
| rsv infection | DISEASE | 10 |
| sot | ORG | 10 |
| sibu | PERSON | 10 |
| animal | TAXON | 10 |
| app | ORG | 10 |
| depression | DISEASE | 10 |
| influenza like illness | DISEASE | 10 |
| respiratory syndrome | DISEASE | 10 |
| toxicity | DISEASE | 10 |
| acute respiratory illness | DISEASE | 9 |
| aki | DISEASE | 9 |
| cber | ORG | 9 |
| ebola | TAXON | 9 |
| malaysia | GPE | 9 |
| new york | GPE | 9 |
| singapore | GPE | 9 |
| tacrolimus | PERSON | 9 |
| heart failure | DISEASE | 9 |
| cancer | DISEASE | 9 |
| echovirus | TAXON | 9 |
| inflammation | DISEASE | 9 |
| obesity | DISEASE | 9 |
| outbreaks | TAXON | 9 |
| steroids | CHEMICAL | 9 |
| viral rna | TAXON | 9 |
| critically ill | DISEASE | 9 |
| iav | ORG | 8 |
| statins | ORG | 8 |
| saudi arabia | GPE | 8 |
| piv infection | DISEASE | 8 |
| as | ORG | 8 |
| cyclosporine | CHEMICAL | 8 |
| covs | TAXON | 8 |
| chlamydia | TAXON | 8 |
| virus | TAXON | 8 |
| tac | ORG | 8 |
| human coronavirus | TAXON | 8 |
| acute kidney injury | DISEASE | 8 |
| headache | DISEASE | 8 |
| asthma | DISEASE | 8 |
| hypertension | DISEASE | 8 |
| viral infections | DISEASE | 8 |
| respiratory tract infections | DISEASE | 8 |
| dromedary camels | TAXON | 8 |
| cyclophosphamide | CHEMICAL | 8 |
| creatinine | CHEMICAL | 8 |
| cardiovascular disease | DISEASE | 8 |
| human | TAXON | 7 |
| sarawak | GPE | 7 |
| parainfluenza virus | TAXON | 7 |
| mediterranean | LOC | 7 |
| li | CHEMICAL | 7 |
| kapit | GPE | 7 |
| infection | DISEASE | 7 |
| iugr | ORG | 7 |
| chmp | ORG | 7 |
| hepatitis e | DISEASE | 7 |
| djibouti | GPE | 7 |
| clinicaltrials | ORG | 7 |
| california | GPE | 7 |
| tnf | ORG | 7 |
| ad | DISEASE | 7 |
| alb | ORG | 7 |
| sudan | GPE | 7 |
| pao | ORG | 7 |
| wilcoxon | ORG | 7 |
| febrile respiratory illness | DISEASE | 7 |
| viral genome | TAXON | 7 |
| acute respiratory syndrome | DISEASE | 7 |
| teno virus | TAXON | 7 |
| shortness of breath | DISEASE | 7 |
| respiratory viral infections | DISEASE | 7 |
| rash | DISEASE | 7 |
| immunocompromised | DISEASE | 7 |
| hypogammaglobulinemia | DISEASE | 7 |
| meningoencephalitis | DISEASE | 7 |
| febrile hrv respiratory illness | DISEASE | 7 |
| dyspnea | DISEASE | 7 |
| diabetes | DISEASE | 7 |
| dexamethasone | CHEMICAL | 7 |
| coronavirus infections | DISEASE | 7 |
| cardiopulmonary disease | DISEASE | 7 |
| bacteria | TAXON | 7 |
| ebola virus | TAXON | 6 |
| acute respiratory syndrome coronavirus 2 sars cov | DISEASE | 6 |
| rhinovirus | TAXON | 6 |
| results | ORG | 6 |
| hydroxychloroquine | CHEMICAL | 6 |
| hong kong | GPE | 6 |
| ha | PERSON | 6 |
| gs | CHEMICAL | 6 |
| appropriate | ORG | 6 |
| ev | ORG | 6 |
| ehr | ORG | 6 |
| ebv dna | TAXON | 6 |
| dd | ORG | 6 |
| cox | PERSON | 6 |
| bal | ORG | 6 |
| adenovirus | TAXON | 6 |
| avian | TAXON | 6 |
| asthenia | GPE | 6 |
| allergy | DISEASE | 6 |
| azithromycin | CHEMICAL | 6 |
| gastrointestinal symptoms | DISEASE | 6 |
| bacterial infections | DISEASE | 6 |
| thrombocytopenia | GPE | 6 |
| smoking | CHEMICAL | 6 |
| respiratory tract infection | DISEASE | 6 |
| respiratory tract illness | DISEASE | 6 |
| nitazoxanide | CHEMICAL | 6 |
| infectious complications | DISEASE | 6 |
| house | TAXON | 6 |
| respiratory syndrome coronavirus | DISEASE | 6 |
| gaps | DISEASE | 6 |
| chronic obstructive pulmonary disease | DISEASE | 6 |
| fludarabine | CHEMICAL | 6 |
| ehrlichiosis | DISEASE | 6 |
| doxycycline | CHEMICAL | 6 |
| diarrhea | DISEASE | 6 |
| comorbid | DISEASE | 6 |
| fungal infections | DISEASE | 6 |
| kapit hospital | ORG | 5 |
| kenya | GPE | 5 |
| mycoplasma | ORG | 5 |
| nepal | GPE | 5 |
| remdesivir | PERSON | 5 |
| ptb | ORG | 5 |
| pao 2 fio 2 | ORG | 5 |
| south korea | GPE | 5 |
| infectious diseases | DISEASE | 5 |
| k | CHEMICAL | 5 |
| csf | ORG | 5 |
| ibv | ORG | 5 |
| human rhinovirus | TAXON | 5 |
| hku1 | TAXON | 5 |
| france | GPE | 5 |
| filmarray | ORG | 5 |
| coronavirus hku1 | TAXON | 5 |
| cov hku1 infection | DISEASE | 5 |
| cancer | DISEASE | 5 |
| ttp | ORG | 5 |
| ari | DISEASE | 5 |
| ards | DISEASE | 5 |
| streptococcus | GPE | 5 |
| nitazoxanide | GPE | 5 |
| thailand | GPE | 5 |
| hemophagocytosis | DISEASE | 5 |
| uk | GPE | 5 |
| vomiting | DISEASE | 5 |
| viremia | DISEASE | 5 |
| vasculitis | DISEASE | 5 |
| respiratory tract disease | DISEASE | 5 |
| organism | TAXON | 5 |
| neutropenic | DISEASE | 5 |
| metabolic disease | DISEASE | 5 |
| leukemia | DISEASE | 5 |
| influenza a | DISEASE | 5 |
| pain | DISEASE | 5 |
| febrile hrv | ORG | 5 |
| bacteremia | DISEASE | 5 |
| united states | GPE | 5 |
| dromedaries | TAXON | 5 |
| wisconsin | GPE | 5 |
| aspartate | CHEMICAL | 5 |
| acyclovir | CHEMICAL | 5 |
| bocavirus | TAXON | 5 |
| cat | TAXON | 5 |
| cirrhosis | DISEASE | 5 |
| coinfection | DISEASE | 5 |
| ii | ORG | 4 |
| list n | ORG | 4 |
| individuals | TAXON | 4 |
| infa | GPE | 4 |
| infections | DISEASE | 4 |
| infectious disease | DISEASE | 4 |
| kapit hospitals | PERSON | 4 |
| mediterranean spotted fever | DISEASE | 4 |
| mip | CHEMICAL | 4 |
| mass general brigham | ORG | 4 |
| maternal | ORG | 4 |
| prevalence | ORG | 4 |
| recovery | ORG | 4 |
| hiv infection | DISEASE | 4 |
| hubei province | GPE | 4 |
| algeria | GPE | 4 |
| guangdong | GPE | 4 |
| gram | PERSON | 4 |
| febrile | DISEASE | 4 |
| ehrlichia | TAXON | 4 |
| eip | ORG | 4 |
| dyspnea | PERSON | 4 |
| duke university | ORG | 4 |
| coronavirus disease | DISEASE | 4 |
| community | DISEASE | 4 |
| blood | ORG | 4 |
| barr virus dna | TAXON | 4 |
| ad vaccine | CHEMICAL | 4 |
| anc | ORG | 4 |
| respiratory syndrome coronavirus 2 sars | DISEASE | 4 |
| rsv | DISEASE | 4 |
| rsv a | ORG | 4 |
| sari | ORG | 4 |
| coronavirus pneumonia | DISEASE | 4 |
| wheezing | DISEASE | 4 |
| steroid | CHEMICAL | 4 |
| respiratory virus infections | DISEASE | 4 |
| respiratory distress syndrome | DISEASE | 4 |
| pancytopenia | DISEASE | 4 |
| nausea | DISEASE | 4 |
| mumps | PERSON | 4 |
| mmhg | ORG | 4 |
| man | TAXON | 4 |
| lung disease | DISEASE | 4 |
| infectious diseases id | DISEASE | 4 |
| fungal disease | DISEASE | 4 |
| fatigue | DISEASE | 4 |
| enterovirus | TAXON | 4 |
| mice | TAXON | 4 |
| chronic diseases | DISEASE | 4 |
| uri | ORG | 4 |
| bacterial infection | DISEASE | 4 |
| sofa | ORG | 4 |
| spc00394 | CHEMICAL | 4 |
| spain | GPE | 4 |
| tat | ORG | 4 |
| tt | ORG | 4 |
| shcrc | ORG | 4 |
| vrti | ORG | 4 |
| vero e6 | ORG | 4 |
| viral rna | TAXON | 4 |
| viruses | TAXON | 4 |
| alanine | CHEMICAL | 4 |
| alcohol | CHEMICAL | 4 |
| mcnemar | PERSON | 3 |
| oc43 | TAXON | 3 |
| new york city | GPE | 3 |
| neonatal | ORG | 3 |
| n95 | ORG | 3 |
| mongolia | GPE | 3 |
| microsoft | ORG | 3 |
| mas | ORG | 3 |
| massachusetts | GPE | 3 |
| mo | PERSON | 3 |
| outcomes | ORG | 3 |
| lassa | TAXON | 3 |
| laboratory | ORG | 3 |
| ltec | ORG | 3 |
| kuala lumpur | GPE | 3 |
| oseltamivir | ORG | 3 |
| vero | ORG | 3 |
| pbpk | GPE | 3 |
| sars cov 2 rt pcr | ORG | 3 |
| kdigo | PERSON | 3 |
| table 1 | ORG | 3 |
| suffolk county | GPE | 3 |
| southeast asia | LOC | 3 |
| sga | CHEMICAL | 3 |
| sas | ORG | 3 |
| sars cov 2 rt | ORG | 3 |
| pneumocystis jirovecii | DISEASE | 3 |
| ribavirin | CHEMICAL | 3 |
| respiratory syndrome coronavirus | DISEASE | 3 |
| rsv infections | DISEASE | 3 |
| rih | ORG | 3 |
| rhdu | ORG | 3 |
| poisson | PERSON | 3 |
| korea | GPE | 3 |
| death | DISEASE | 3 |
| infectious disease | DISEASE | 3 |
| barr virus | TAXON | 3 |
| clinicaltrials | ORG | 3 |
| crp | ORG | 3 |
| cmv dna | TAXON | 3 |
| cmv | DISEASE | 3 |
| chf congestive heart failure copd chronic obstructive pulmonary disease | DISEASE | 3 |
| cd19 | ORG | 3 |
| bamc | ORG | 3 |
| cockcroft | DISEASE | 3 |
| army | ORG | 3 |
| anxiety | DISEASE | 3 |
| antibiotic | LOC | 3 |
| animal | TAXON | 3 |
| arti | PERSON | 3 |
| aids | DISEASE | 3 |
| cov 229e | ORG | 3 |
| coronavirus covid | DISEASE | 3 |
| ili | ORG | 3 |
| hev rna | TAXON | 3 |
| il | GPE | 3 |
| human coronavirus | TAXON | 3 |
| healthcare | ORG | 3 |
| hrv illness | DISEASE | 3 |
| hku1 infections | DISEASE | 3 |
| hivuninfected | ORG | 3 |
| hais | DISEASE | 3 |
| coronavirus infected pneumonia | DISEASE | 3 |
| fever | DISEASE | 3 |
| fl | ORG | 3 |
| fas | DISEASE | 3 |
| ehrlichia chaffeensis | TAXON | 3 |
| duke nus | ORG | 3 |
| world health organization | ORG | 3 |
| GPE | 3 | |
| art | ORG | 3 |
| acute respiratory syndrome sars | DISEASE | 3 |
| nonsevere disease | DISEASE | 3 |
| septic shock | DISEASE | 3 |
| rhinovirus infection | DISEASE | 3 |
| rhinovirus enterovirus | TAXON | 3 |
| rheumatoid arthritis | DISEASE | 3 |
| respiratory viral coinfection | DISEASE | 3 |
| respiratory syndrome coronavirus infection | DISEASE | 3 |
| respiratory syncytial virus infections | DISEASE | 3 |
| respiratory syncytial virus infection | DISEASE | 3 |
| respiratory syncytial virus rt | DISEASE | 3 |
| procalcitonin | CHEMICAL | 3 |
| prematurity | DISEASE | 3 |
| pharyngitis | DISEASE | 3 |
| panic | DISEASE | 3 |
| organisms | TAXON | 3 |
| obstructive pulmonary disease | DISEASE | 3 |
| sprays | CHEMICAL | 3 |
| swine | TAXON | 3 |
| tacrolimus | CHEMICAL | 3 |
| tick | TAXON | 3 |
| angiotensin | CHEMICAL | 3 |
| weight gain | DISEASE | 3 |
| voriconazole | CHEMICAL | 3 |
| virus infection | DISEASE | 3 |
| viral pneumonia | DISEASE | 3 |
| viral infection | DISEASE | 3 |
| the world health organization | ORG | 3 |
| the icmje form for disclosure of potential conflicts of interest | ORG | 3 |
| the united kingdom | GPE | 3 |
| the us food and drug administration | ORG | 3 |
| the u s government | ORG | 3 |
| the national institutes of health | ORG | 3 |
| the national institute of allergy and infectious diseases | ORG | 3 |
| the infectious diseases society of america | ORG | 3 |
| nucleotide | CHEMICAL | 3 |
| tacrolimus toxicity | CHEMICAL | 3 |
| myalgia | DISEASE | 3 |
| cytopenias | DISEASE | 3 |
| hemophagocytic lymphohistiocytosis hemophagocytic lymphohistiocytosis | DISEASE | 3 |
| ferritin | GPE | 3 |
| febrile illness | DISEASE | 3 |
| etoposide | CHEMICAL | 3 |
| enteroviruses | DISEASE | 3 |
| dry cough | DISEASE | 3 |
| coronavirus hku1 | TAXON | 3 |
| hepatitis c | DISEASE | 3 |
| comorbidity | DISEASE | 3 |
| coagulopathy | DISEASE | 3 |
| chloroquine phosphate | CHEMICAL | 3 |
| bpm | ORG | 3 |
| multi organ failure | DISEASE | 3 |
| bilirubin | CHEMICAL | 3 |
| hepatitis | DISEASE | 3 |
| encephalitis | DISEASE | 3 |
| hepatitis e | DISEASE | 3 |
| hyperglycemia | DISEASE | 3 |
| mold infection | DISEASE | 3 |
| middle east | LOC | 3 |
| malignancy | DISEASE | 3 |
| malaria | DISEASE | 3 |
| influenza virus infection | DISEASE | 3 |
| infected | DISEASE | 3 |
| hypoalbuminemia | DISEASE | 3 |
| influenza infection | DISEASE | 3 |
| human rhinovirus | TAXON | 3 |
| human metapneumovirus | TAXON | 3 |
| human immunodeficiency virus hiv | DISEASE | 3 |
| human adenovirus | TAXON | 3 |
| hosts | TAXON | 3 |
| hernia | GPE | 3 |
| mulhouse | GPE | 2 |
| nct02608502 | CHEMICAL | 2 |
| multivariable | ORG | 2 |
| mumps | PERSON | 2 |
| mycobacteria bacterial | TAXON | 2 |
| mycobacterium | TAXON | 2 |
| nct01034254 | PERSON | 2 |
| nct01766921 | CHEMICAL | 2 |
| nct01776541 | DISEASE | 2 |
| nph | ORG | 2 |
| nct02612922 | PERSON | 2 |
| nct04252664 | ORG | 2 |
| nct04288713 | ORG | 2 |
| nhs | ORG | 2 |
| nk | ORG | 2 |
| npv | ORG | 2 |
| nppv | CHEMICAL | 2 |
| minnesota | GPE | 2 |
| mozambique | GPE | 2 |
| ldh | ORG | 2 |
| mediterranean spotted fever | ORG | 2 |
| luminex | PERSON | 2 |
| nassau county | GPE | 2 |
| jerusalem | GPE | 2 |
| kaletra | ORG | 2 |
| l s m | GPE | 2 |
| ll | ORG | 2 |
| lancet | ORG | 2 |
| liza | TAXON | 2 |
| lopinavir | PERSON | 2 |
| lymphopenia | PERSON | 2 |
| medical practice and quality committee of the american college of physicians | ORG | 2 |
| mac | ORG | 2 |
| magpix | ORG | 2 |
| map | ORG | 2 |
| mc | PERSON | 2 |
| mers cov infection | DISEASE | 2 |
| mers coronavirus infection | ORG | 2 |
| mph | CHEMICAL | 2 |
| msg | CHEMICAL | 2 |
| nasopharyngeal | ORG | 2 |
| swine | TAXON | 2 |
| needless | ORG | 2 |
| soweto | GPE | 2 |
| spss | ORG | 2 |
| synct | ORG | 2 |
| safdar | CHEMICAL | 2 |
| sarawak community | ORG | 2 |
| sepsis | DISEASE | 2 |
| severe acute respiratory syndrome coronavirus | ORG | 2 |
| sibu hospital | ORG | 2 |
| skin | PERSON | 2 |
| superscript | GPE | 2 |
| spc00384 | CHEMICAL | 2 |
| jo | ORG | 2 |
| switzerland | GPE | 2 |
| symptoms | ORG | 2 |
| tgf | ORG | 2 |
| tmh | ORG | 2 |
| ttv infection | DISEASE | 2 |
| tennessee | GPE | 2 |
| the university of wisconsin institutional review board | ORG | 2 |
| spc00687 | PERSON | 2 |
| spc000394 | PERSON | 2 |
| nelfinavir | CHEMICAL | 2 |
| qi | GPE | 2 |
| new york state | GPE | 2 |
| north west province | GPE | 2 |
| obesity | ORG | 2 |
| ppe infection | ORG | 2 |
| ptld | DISEASE | 2 |
| pao 2 | ORG | 2 |
| placental | TAXON | 2 |
| pubmed medline | ORG | 2 |
| rct | ORG | 2 |
| sars mers | DISEASE | 2 |
| rsv b infection | DISEASE | 2 |
| respiratory pathogen panel | ORG | 2 |
| respiratory syndrome | DISEASE | 2 |
| respiratory syncytial virus infection | DISEASE | 2 |
| riyadh | TAXON | 2 |
| rosuvastatin | PERSON | 2 |
| sars cov 2 rna | ORG | 2 |
| sars cov infection | DISEASE | 2 |
| jeddah | GPE | 2 |
| escherichia | ORG | 2 |
| interventions | GPE | 2 |
| cov hku1 infections | DISEASE | 2 |
| ceftriaxone | ORG | 2 |
| centers for disease control and prevention | ORG | 2 |
| challenges | ORG | 2 |
| characteristics | ORG | 2 |
| chart | ORG | 2 |
| chlamydophila | TAXON | 2 |
| chloroquine | CHEMICAL | 2 |
| cov hku1 disease | DISEASE | 2 |
| coagulopathy | PERSON | 2 |
| dexamethasone | CHEMICAL | 2 |
| cockcroft gault | ORG | 2 |
| colorado | GPE | 2 |
| corticosteroid | GPE | 2 |
| cov | ORG | 2 |
| cov hku1 | PERSON | 2 |
| creatinine | CHEMICAL | 2 |
| cunninghamella | TAXON | 2 |
| cyclosporinebased | ORG | 2 |
| crrt | ORG | 2 |
| cpe | ORG | 2 |
| covid 19 symptoms | DISEASE | 2 |
| cmv mismatch | DISEASE | 2 |
| u l | ORG | 2 |
| ag | CHEMICAL | 2 |
| alc | ORG | 2 |
| ancova | ORG | 2 |
| abbott laboratories inc | ORG | 2 |
| acute | LOC | 2 |
| adenovirus vaccine | TAXON | 2 |
| africa | LOC | 2 |
| anthrax | ORG | 2 |
| arabia | TAXON | 2 |
| aspergillus | TAXON | 2 |
| asymptomatic | ORG | 2 |
| australia | GPE | 2 |
| b cell acute lymphoblastic leukemia | DISEASE | 2 |
| bhq | ORG | 2 |
| bronx | GPE | 2 |
| chf | DISEASE | 2 |
| deaths | PERSON | 2 |
| diagnosis | GPE | 2 |
| infectious diseases | ORG | 2 |
| health | ORG | 2 |
| h3n2 | ORG | 2 |
| h5n1 virus | TAXON | 2 |
| hcg | ORG | 2 |
| hev assembly | TAXON | 2 |
| hiv serostatus respiratory viral coinfection | DISEASE | 2 |
| hivinfected | ORG | 2 |
| hmpv | TAXON | 2 |
| hus | ORG | 2 |
| health care workers | ORG | 2 |
| diarrhea | PERSON | 2 |
| hepatitis e virus infection | DISEASE | 2 |
| human coronaviruses | TAXON | 2 |
| hyalomma | TAXON | 2 |
| hypercytokinemia | PERSON | 2 |
| irb | ORG | 2 |
| isf | ORG | 2 |
| iceland | GPE | 2 |
| igg igm | ORG | 2 |
| h1n2 h3n2 | TAXON | 2 |
| guangdong province | GPE | 2 |
| gothenburg | GPE | 2 |
| georgia | GPE | 2 |
| disulfiram | PERSON | 2 |
| duke | ORG | 2 |
| ecmo | ORG | 2 |
| eids | TAXON | 2 |
| ebola virus disease | DISEASE | 2 |
| elizabeth | PERSON | 2 |
| epstein barr virus infection | DISEASE | 2 |
| fellows | ORG | 2 |
| florida | GPE | 2 |
| food and drug administration | ORG | 2 |
| frank | CHEMICAL | 2 |
| fungal infections | DISEASE | 2 |
| ga | ORG | 2 |
| gs 5734 | ORG | 2 |
| genbank | ORG | 2 |
| genmark | PERSON | 2 |
| genomic | ORG | 2 |
| time | ORG | 2 |
| piv type 2 infection | DISEASE | 2 |
| u s children community | ORG | 2 |
| opacities | DISEASE | 2 |
| myalgias | DISEASE | 2 |
| necrotic | DISEASE | 2 |
| nonhuman primate | TAXON | 2 |
| noninfectious | DISEASE | 2 |
| nonvaccine | CHEMICAL | 2 |
| norovirus | TAXON | 2 |
| nosocomial infections | DISEASE | 2 |
| nucleotides | CHEMICAL | 2 |
| opacity | DISEASE | 2 |
| multiorgan | GPE | 2 |
| parainfluenza virus | TAXON | 2 |
| pathogen | ORG | 2 |
| pigs | TAXON | 2 |
| pipeline | CHEMICAL | 2 |
| prednisone | CHEMICAL | 2 |
| pregnancy and adverse birth | DISEASE | 2 |
| renal disease | DISEASE | 2 |
| resp | ORG | 2 |
| multiorgan failure | DISEASE | 2 |
| multi organ dysfunction syndrome | DISEASE | 2 |
| hypoxemic | DISEASE | 2 |
| kidney disease | DISEASE | 2 |
| increase liver test abnormalities | DISEASE | 2 |
| infectious events | DISEASE | 2 |
| inflammatory organ injury | DISEASE | 2 |
| influenza b | DISEASE | 2 |
| influenza coinfection | DISEASE | 2 |
| influenza like illnesses | DISEASE | 2 |
| intravascular coagulation | DISEASE | 2 |
| j0i9ozsz | CHEMICAL | 2 |
| kidney dysfunction | DISEASE | 2 |
| mm | PERSON | 2 |
| leukopenia | DISEASE | 2 |
| lopinavir | CHEMICAL | 2 |
| lung disease renal disease | DISEASE | 2 |
| lung disease renal disease asthma | DISEASE | 2 |
| lung injury | DISEASE | 2 |
| lymphoma | DISEASE | 2 |
| malignancies | DISEASE | 2 |
| min max b 0 | PERSON | 2 |
| respiratory distress | DISEASE | 2 |
| respiratory illnesses | DISEASE | 2 |
| respiratory syndrome mers | DISEASE | 2 |
| vasculitic | DISEASE | 2 |
| the society for healthcare epidemiology of america | ORG | 2 |
| the society of infectious diseases pharmacists | ORG | 2 |
| trimethoprim sulfamethoxazole | CHEMICAL | 2 |
| tuberculosis | DISEASE | 2 |
| typhus | DISEASE | 2 |
| urinary tract infections | DISEASE | 2 |
| vaccine | CHEMICAL | 2 |
| valganciclovir | CHEMICAL | 2 |
| vessel vasculitis | DISEASE | 2 |
| respiratory syndrome coronavirus 2 sars | DISEASE | 2 |
| viral bacterial | TAXON | 2 |
| viral diseases | DISEASE | 2 |
| viral illness | DISEASE | 2 |
| virus disease | DISEASE | 2 |
| visceral leishmaniasis | DISEASE | 2 |
| voriconazole tacrolimus | PERSON | 2 |
| urti | ORG | 2 |
| zip | CHEMICAL | 2 |
| the national health commission of the people s republic of china | ORG | 2 |
| the genmark dx esensor | ORG | 2 |
| the filmarray respiratory panel | ORG | 2 |
| the epa list n | ORG | 2 |
| respiratory syndrome coronavirus mers | DISEASE | 2 |
| respiratory virus | TAXON | 2 |
| rhesus | TAXON | 2 |
| rhinovirus febrile illness | DISEASE | 2 |
| rhinovirus illness | DISEASE | 2 |
| rhinovirus infections | DISEASE | 2 |
| ribonucleic acid | CHEMICAL | 2 |
| rickettsiosis | DISEASE | 2 |
| seizure | DISEASE | 2 |
| sore | DISEASE | 2 |
| sore throat | PERSON | 2 |
| swelling | DISEASE | 2 |
| syncytial virus human metapneumovirus | TAXON | 2 |
| template | CHEMICAL | 2 |
| the centers for disease control and prevention | ORG | 2 |
| the department of defense | ORG | 2 |
| the department of pathology and genomic medicine | ORG | 2 |
| illness | DISEASE | 2 |
| tumor necrosis | DISEASE | 2 |
| hypotension | DISEASE | 2 |
| bacterial fungal | TAXON | 2 |
| agitation | DISEASE | 2 |
| airborne infection | DISEASE | 2 |
| allergic | DISEASE | 2 |
| anakinra | CHEMICAL | 2 |
| antiphospholipid | DISEASE | 2 |
| atopic | DISEASE | 2 |
| avoidance behaviors | DISEASE | 2 |
| bacteremias | DISEASE | 2 |
| bocavirus n 2 | TAXON | 2 |
| chronic hepatitis | DISEASE | 2 |
| bovine | TAXON | 2 |
| bronchitis | DISEASE | 2 |
| brucellosis | DISEASE | 2 |
| c8mv2eve | CHEMICAL | 2 |
| camels camelus dromedarius | TAXON | 2 |
| chills | DISEASE | 2 |
| chloroquine hydroxychloroquine | CHEMICAL | 2 |
| cholecystitis | DISEASE | 2 |
| adenoviruses | TAXON | 2 |
| adenovirus vaccines | TAXON | 2 |
| adenovirus type 4 | TAXON | 2 |
| acute respiratory syndrome coronavirus 2 | DISEASE | 2 |
| uw health | ORG | 2 |
| hyponatremia | DISEASE | 2 |
| ussr | GPE | 2 |
| uptake | GPE | 2 |
| vp1 gene | TAXON | 2 |
| vandermeer et al 23 | PERSON | 2 |
| variables | PERSON | 2 |
| washington state | GPE | 2 |
| west nile | LOC | 2 |
| wuhan hubei | GPE | 2 |
| zhejiang | GPE | 2 |
| acute gastrointestinal illness | DISEASE | 2 |
| acute illness | DISEASE | 2 |
| acute kidney injury aki | DISEASE | 2 |
| acute lymphoblastic leukemia | DISEASE | 2 |
| acute respiratory distress syndrome | DISEASE | 2 |
| acute respiratory failure | DISEASE | 2 |
| chronic disease | DISEASE | 2 |
| wisconsin community | CHEMICAL | 2 |
| chronic kidney disease | DISEASE | 2 |
| fungal infection | DISEASE | 2 |
| enoxaparin | GPE | 2 |
| enterovirus infection | DISEASE | 2 |
| eschar | DISEASE | 2 |
| febrile hrv respiratory infection | DISEASE | 2 |
| febrile pharyngitis | DISEASE | 2 |
| febrile rhinovirus illness | DISEASE | 2 |
| fever dry cough | DISEASE | 2 |
| fluvastatin | GPE | 2 |
| fungi | TAXON | 2 |
| esensor | CHEMICAL | 2 |
| haemophagocytic syndrome | DISEASE | 2 |
| hernia small bowel obstruction | DISEASE | 2 |
| herpes zoster | DISEASE | 2 |
| human enterovirus | TAXON | 2 |
| hyperlipidemia | DISEASE | 2 |
| humidity | DISEASE | 2 |
| chronic lung allograft dysfunction | DISEASE | 2 |
| hydroxyferroquine | GPE | 2 |
| encephalopathy | DISEASE | 2 |
| heparin | CHEMICAL | 2 |
| discordance | DISEASE | 2 |
| coronavirus infection | DISEASE | 2 |
| congestive heart failure | DISEASE | 2 |
| digital | ORG | 2 |
| convalescent | DISEASE | 2 |
| coronavirus sars cov | DISEASE | 2 |
| coronavirus sars cov 2 outside of wuhan china retrospective | DISEASE | 2 |
| coronavirus bocavirus | TAXON | 2 |
| chronic lung disease | DISEASE | 2 |
| coronavirus infected pneumonia | DISEASE | 2 |
| coronavirus sars | DISEASE | 2 |
| coryza | DISEASE | 2 |
| d m | ORG | 2 |
| diabetic | DISEASE | 2 |
| deoxyribonucleic acid | CHEMICAL | 2 |
| cough sore throat runny nose | DISEASE | 2 |
| conflict | DISEASE | 2 |
| cystic fibrosis | DISEASE | 2 |
| croup | DISEASE | 2 |
| mark c chu helen y | PERSON | 1 |
| marine corps | ORG | 1 |
| marietjie cohen cheryl | PERSON | 1 |
| marguerite johnson jennie e garland joseph m aung su | PERSON | 1 |
| marco de martino | PERSON | 1 |
| marco | CHEMICAL | 1 |
| marcia b sabeti pardis c kuritzkes daniel r grad yonatan h | DISEASE | 1 |
| mann whitney u | PERSON | 1 |
| marcia b sabeti pardis | PERSON | 1 |
| marcello alessandro licastro | PERSON | 1 |
| mannheim germany input | GPE | 1 |
| mapulaneng hospitals | PERSON | 1 |
| manuel y lott lisa cropper | PERSON | 1 |
| mantel haenszel | PERSON | 1 |
| mansour m marcos | PERSON | 1 |
| marburg | GPE | 1 |
| massachusetts general hospital | ORG | 1 |
| markelz | CHEMICAL | 1 |
| matthew r thomas | CHEMICAL | 1 |
| medical research council | ORG | 1 |
| medicaid services | ORG | 1 |
| mallipattu | CHEMICAL | 1 |
| mesh | ORG | 1 |
| matthew v n title the antibody response | CHEMICAL | 1 |
| matthew v n | PERSON | 1 |
| matthew blake | PERSON | 1 |
| marrow transplant clinical trials network trial | ORG | 1 |
| medicare | ORG | 1 |
| matikwana | GPE | 1 |
| marzano | PERSON | 1 |
| maryland | GPE | 1 |
| mary tu foundation | PERSON | 1 |
| marshfield | GPE | 1 |
| mallipattu s k jawa | PERSON | 1 |
| mf59 adjuvanted | CHEMICAL | 1 |
| maintenance home care system for nonurban young men | ORG | 1 |
| magro | GPE | 1 |
| methods active | ORG | 1 |
| methods a cross | ORG | 1 |
| mers cov infections | DISEASE | 1 |
| mers cov ifa | ORG | 1 |
| mers cov ec | ORG | 1 |
| mers cov broad | ORG | 1 |
| mers cov 26 | ORG | 1 |
| ma la ct | PERSON | 1 |
| ma | GPE | 1 |
| lymphohistiocytosis associated | PERSON | 1 |
| lyme | DISEASE | 1 |
| lyla | CHEMICAL | 1 |
| mediterranean boutonneuse fever haemophagocytic syndrome | DISEASE | 1 |
| luminex austin tx | PERSON | 1 |
| luebeck germany | PERSON | 1 |
| methods all | ORG | 1 |
| methods medical | ORG | 1 |
| mf59 novartis international ag | ORG | 1 |
| ms | ORG | 1 |
| magna pure lc | ORG | 1 |
| madin | GPE | 1 |
| madaline | CHEMICAL | 1 |
| macias gil | PERSON | 1 |
| macdougall | ORG | 1 |
| msd south africa | ORG | 1 |
| mrd | ORG | 1 |
| mf59 vaccines | ORG | 1 |
| mpfb | CHEMICAL | 1 |
| mos | ORG | 1 |
| mmf cyclosporine | ORG | 1 |
| miracle | GPE | 1 |
| miqe | ORG | 1 |
| mip 1 alpha | CHEMICAL | 1 |
| medimmune | GPE | 1 |
| mpumalanga province | GPE | 1 |
| mediterranean spotted fever msf | CHEMICAL | 1 |
| nct02266628 | CHEMICAL | 1 |
| nat positive | ORG | 1 |
| n k t | CHEMICAL | 1 |
| n ce | CHEMICAL | 1 |
| n 41 | ORG | 1 |
| n 3458 cohorts | ORG | 1 |
| n 2030 | ORG | 1 |
| n 111 | ORG | 1 |
| n 1013 | ORG | 1 |
| n | ORG | 1 |
| mylona evangelia | PERSON | 1 |
| mycobacterium tuberculosis | CHEMICAL | 1 |
| munjal | CHEMICAL | 1 |
| multivariate | ORG | 1 |
| multivariable cox | PERSON | 1 |
| mozambique community | ORG | 1 |
| nct01610245 | CHEMICAL | 1 |
| nct03301090 | CHEMICAL | 1 |
| meece | CHEMICAL | 1 |
| nct03336619 | CHEMICAL | 1 |
| np sars cov | DISEASE | 1 |
| lower | ORG | 1 |
| np sars | DISEASE | 1 |
| nl63 united states food and drug administration false positive | ORG | 1 |
| nih | ORG | 1 |
| nibrg | CHEMICAL | 1 |
| nhc | ORG | 1 |
| ngs | ORG | 1 |
| nct04323839 | CHEMICAL | 1 |
| nct043235929 | CHEMICAL | 1 |
| nct04323592 italy | ORG | 1 |
| nct04315870 | CHEMICAL | 1 |
| nct04292899 10 | ORG | 1 |
| nct04257656 | CHEMICAL | 1 |
| nct04252274 | CHEMICAL | 1 |
| morin | CHEMICAL | 1 |
| mootien joy eyriey | PERSON | 1 |
| mooso | CHEMICAL | 1 |
| montefiore medical center institutional review board | ORG | 1 |
| michelle j kahn kathleen dawood | PERSON | 1 |
| micaela gasparini stefano bonifazi | PERSON | 1 |
| micaela | CHEMICAL | 1 |
| meta analysis self service diagnosis | ORG | 1 |
| meta analysis national institutes of health association of treatment with hydroxychloroquine or azithromycin with in hospital mortality in patients | ORG | 1 |
| meta | ORG | 1 |
| met | DISEASE | 1 |
| merck | ORG | 1 |
| mental health | ORG | 1 |
| meningoencephalitis | DISEASE | 1 |
| meningitis | DISEASE | 1 |
| menglong ma | PERSON | 1 |
| memories | ORG | 1 |
| melanie | PERSON | 1 |
| melanau bidayuh | PERSON | 1 |
| michigan | GPE | 1 |
| microangiopathic hemolytic anemia | DISEASE | 1 |
| microbiology laboratory | PERSON | 1 |
| mobile comprehensive hiv prevention app for men | ORG | 1 |
| montefiore asp supplementary | ORG | 1 |
| montalvo maria | PERSON | 1 |
| monocyte | GPE | 1 |
| molecular evidence | PERSON | 1 |
| molecular | ORG | 1 |
| moderate | ORG | 1 |
| mix | PERSON | 1 |
| middle east respiratory syndrome | LOC | 1 |
| missing bmi | ORG | 1 |
| mismatch | DISEASE | 1 |
| minnesota department of health responding | ORG | 1 |
| minnesfond | TAXON | 1 |
| mild | ORG | 1 |
| middle east | LOC | 1 |
| lucio zucchetto | PERSON | 1 |
| jessica choi | PERSON | 1 |
| louisiana chicago | GPE | 1 |
| janos hajagos | PERSON | 1 |
| jamie | PERSON | 1 |
| james carter | PERSON | 1 |
| james aragon | PERSON | 1 |
| jsf | ORG | 1 |
| jh | PERSON | 1 |
| jc jz | ORG | 1 |
| jc | ORG | 1 |
| jama health forum2020 detection of sars cov 2 rna and antibodies in diverse samples protocol to validate the sufficiency of provider | ORG | 1 |
| j m | ORG | 1 |
| italy s | GPE | 1 |
| italy ethics logistics | ORG | 1 |
| italy a | DISEASE | 1 |
| italy 30 | GPE | 1 |
| irvine ca usa | ORG | 1 |
| investigational new drug | ORG | 1 |
| jane magaret amalia | PERSON | 1 |
| janssen | PERSON | 1 |
| joshua pirofski liise | PERSON | 1 |
| janssen s f s s | PERSON | 1 |
| jolene | CHEMICAL | 1 |
| john | PERSON | 1 |
| johannesburg | GPE | 1 |
| jocelyn olorunju | PERSON | 1 |
| joan kirley | PERSON | 1 |
| jiao qian | PERSON | 1 |
| jian li | PERSON | 1 |
| ns1 | ORG | 1 |
| jesper | DISEASE | 1 |
| jennifer p kieke burney | PERSON | 1 |
| jennifer k shinde vivek | PERSON | 1 |
| jay a el khoury joseph | PERSON | 1 |
| javascript arrays | PERSON | 1 |
| jason gallagher | PERSON | 1 |
| japan | GPE | 1 |
| introduction of the appropriate use | ORG | 1 |
| intrauterine infection | DISEASE | 1 |
| international society for heart and lung transplantation | ORG | 1 |
| internal medicine | ORG | 1 |
| implementing an antibiotic stewardship program | ORG | 1 |
| impact of infectious disease consultation on quality of care mortality | ORG | 1 |
| immunotherapy | ORG | 1 |
| immunocompromised | DISEASE | 1 |
| immunity | GPE | 1 |
| immediate | LOC | 1 |
| illumina truseq | ORG | 1 |
| ig g | ORG | 1 |
| identifying | PERSON | 1 |
| identifier nct01610245 | ORG | 1 |
| ian basile | PERSON | 1 |
| ivd | ORG | 1 |
| iu ml | ORG | 1 |
| ishlt | ORG | 1 |
| iqr pao | ORG | 1 |
| implications for prevention measures | ORG | 1 |
| incidence | PERSON | 1 |
| incidence of rsv illness | ORG | 1 |
| injection | ORG | 1 |
| interim infection prevention | ORG | 1 |
| interim | ORG | 1 |
| instructions | ORG | 1 |
| institutional review boards | ORG | 1 |
| inpatient | ORG | 1 |
| innovative | ORG | 1 |
| influenza illness | DISEASE | 1 |
| indonesia | GPE | 1 |
| influenza hospitalizations | ORG | 1 |
| influenza c | ORG | 1 |
| influenza a virus circulation | ORG | 1 |
| infectious diseases society of america | ORG | 1 |
| infectious complications following cd19 chimeric antigen receptor | ORG | 1 |
| indy maddocks | PERSON | 1 |
| jolene wong chen seong archuleta sophia | PERSON | 1 |
| jouberton clinic | ORG | 1 |
| louisiana | GPE | 1 |
| legionella pneumophila | TAXON | 1 |
| lecronier et al | PERSON | 1 |
| lecronier | DISEASE | 1 |
| learn | PERSON | 1 |
| latinx african american asian american | ORG | 1 |
| lars magnus | PERSON | 1 |
| lars erik | PERSON | 1 |
| larry park | PERSON | 1 |
| larissa tatro | PERSON | 1 |
| lakes | CHEMICAL | 1 |
| laidler matthew | PERSON | 1 |
| lacedonia donato | DISEASE | 1 |
| lacedonia | GPE | 1 |
| laboratoriemedicin sahlgrenska university | ORG | 1 |
| laboratoriemedicin | CHEMICAL | 1 |
| la rosée | PERSON | 1 |
| legionella | PERSON | 1 |
| lepak alexander j chen derrick j | PERSON | 1 |
| jovan borjan julie | PERSON | 1 |
| li ziang gong | PERSON | 1 |
| loss of smell and taste | DISEASE | 1 |
| loss | PERSON | 1 |
| lopinavir ritonavir | CHEMICAL | 1 |
| long island | LOC | 1 |
| long | PERSON | 1 |
| london | GPE | 1 |
| logistic | PERSON | 1 |
| locallevel | ORG | 1 |
| liverpool | GPE | 1 |
| little | PERSON | 1 |
| linkage | PERSON | 1 |
| lindholm david a kiley john l jansen | PERSON | 1 |
| limited value for predicting the net state of immunosuppression after lung transplantation | ORG | 1 |
| lilia | CHEMICAL | 1 |
| liaisons | ORG | 1 |
| los | DISEASE | 1 |
| llc mk2 | GPE | 1 |
| lcd | ORG | 1 |
| lbw sga | ORG | 1 |
| keefe james b title | PERSON | 1 |
| katrin schwarzer | PERSON | 1 |
| kassala | GPE | 1 |
| karra | CHEMICAL | 1 |
| kardiologie krefeld | PERSON | 1 |
| kara w carlson margrit | PERSON | 1 |
| kaplan meier | ORG | 1 |
| kapit hospitals specimens | PERSON | 1 |
| kapit 1 9951 | ORG | 1 |
| kanwar anubhav | PERSON | 1 |
| kansas city mo | GPE | 1 |
| kalogeropoulos a | CHEMICAL | 1 |
| kalligeros markos | PERSON | 1 |
| kaletra lopinavir | CHEMICAL | 1 |
| k cernoch | CHEMICAL | 1 |
| kemp jacqueline m | PERSON | 1 |
| kenya respiratory | PERSON | 1 |
| kiamanesh d kim n koraishy f lingham v mansour m marcos l miller j | CHEMICAL | 1 |
| kwazulu natal province | GPE | 1 |
| lbw ptb | ORG | 1 |
| lbw mid | ORG | 1 |
| lbw 26 | ORG | 1 |
| lasso | ORG | 1 |
| la | CHEMICAL | 1 |
| kymriah | PERSON | 1 |
| kwazulu natal | PERSON | 1 |
| kidney | ORG | 1 |
| kupffer | PERSON | 1 |
| kuching | GPE | 1 |
| kolmogorov smirnov | PERSON | 1 |
| king abdulaziz university hospital | ORG | 1 |
| king abdulaziz city | GPE | 1 |
| kidney disorders | DISEASE | 1 |
| np sars cov 2 rt pcr | ORG | 1 |
| pui 9 10 | ORG | 1 |
| narciso baldoquin | PERSON | 1 |
| respiratory viral panel luminex | ORG | 1 |
| respiratory illness post ad vaccine | ORG | 1 |
| respiratory illness | DISEASE | 1 |
| respiratory failure | DISEASE | 1 |
| respiratory distress syndrome | DISEASE | 1 |
| residency training | PERSON | 1 |
| research consortium blood | ORG | 1 |
| report of positive placental swabs for sars cov 2 | ORG | 1 |
| repeat pcr | PERSON | 1 |
| repeat | PERSON | 1 |
| remel lenexa ks | PERSON | 1 |
| remdesivir use | PERSON | 1 |
| remdesivir gs | PERSON | 1 |
| registry plus link plus | ORG | 1 |
| region halland potential | ORG | 1 |
| regeneron | ORG | 1 |
| respiratory syndrome coronavirus infection | DISEASE | 1 |
| respiratory diseases | DISEASE | 1 |
| purpura fulminans q fever | DISEASE | 1 |
| respiratory infections | DISEASE | 1 |
| roche diagnostics | ORG | 1 |
| robert petersdorf | PERSON | 1 |
| rickettsia japonica | TAXON | 1 |
| rickettsia conorii infection a | DISEASE | 1 |
| rickettsia conorii infection | DISEASE | 1 |
| rickettsia japonica table 2 26 27 a | CHEMICAL | 1 |
| rickettsia japonica | PERSON | 1 |
| rhinovirus infections | DISEASE | 1 |
| rhinovirus disease | DISEASE | 1 |
| rheumatologic | PERSON | 1 |
| rheumatic | DISEASE | 1 |
| retrospective | GPE | 1 |
| results hazard | PERSON | 1 |
| respiratory viral infections | DISEASE | 1 |
| respiratory syncytial virus infections | DISEASE | 1 |
| recent rct | ORG | 1 |
| recent public health emergency responses | ORG | 1 |
| reba confalonieri marco | ORG | 1 |
| re | PERSON | 1 |
| roc | GPE | 1 |
| rnase | ORG | 1 |
| rhdu inclusion | ORG | 1 |
| recovery rct | ORG | 1 |
| rdv alt 5xunl alt 3xunl | ORG | 1 |
| r r b cell acute lymphoblastic leukemia b all 2 3 4 the first commercially available | CHEMICAL | 1 |
| questions | ORG | 1 |
| query | ORG | 1 |
| queens brooklyn staten island | ORG | 1 |
| quaternary ammonium disinfectant issues encountered | ORG | 1 |
| quasi | PERSON | 1 |
| qu | CHEMICAL | 1 |
| qiagen hilden | PERSON | 1 |
| qiagen | ORG | 1 |
| qiamp | ORG | 1 |
| rsv a infection | DISEASE | 1 |
| rsv b | ORG | 1 |
| rsv mslrtd | ORG | 1 |
| racial health disparities | ORG | 1 |
| raw | ORG | 1 |
| ravaglia | CHEMICAL | 1 |
| rapid | PERSON | 1 |
| randall j perez katherine k | PERSON | 1 |
| rand eleanor | PERSON | 1 |
| ramos casals | ORG | 1 |
| racial ethnic disparities | ORG | 1 |
| rt pcr table 1 viral rna | ORG | 1 |
| race ethnicity | LOC | 1 |
| raccanelli | CHEMICAL | 1 |
| rvp luminex | PERSON | 1 |
| rvp | ORG | 1 |
| rtu | ORG | 1 |
| rt pcrconfirmed rsv | ORG | 1 |
| roche liat | ORG | 1 |
| rosenbaum 28 | PERSON | 1 |
| ross fishman | PERSON | 1 |
| shcrc duke nus | ORG | 1 |
| sathbo | DISEASE | 1 |
| sarah philo | PERSON | 1 |
| sarah kadar | PERSON | 1 |
| santus | DISEASE | 1 |
| sanofi pasteur | PERSON | 1 |
| sandra valtier | PERSON | 1 |
| sandra s | PERSON | 1 |
| sandaradura | GPE | 1 |
| salton francesco confalonieri | PERSON | 1 |
| salmeterol | CHEMICAL | 1 |
| sahr philip k | PERSON | 1 |
| stata | ORG | 1 |
| st131 | CHEMICAL | 1 |
| spc00401 | CHEMICAL | 1 |
| spc000384 | CHEMICAL | 1 |
| saudi arabia positive | GPE | 1 |
| scartabellati | CHEMICAL | 1 |
| schoenfeld | GPE | 1 |
| seqirus inc | ORG | 1 |
| ipc fellows | ORG | 1 |
| serious rsv | ORG | 1 |
| sergio scala raffaele lanini | PERSON | 1 |
| sera | PERSON | 1 |
| seqirus inc m h | ORG | 1 |
| seqirus inc holly springs nc | ORG | 1 |
| senegal | GPE | 1 |
| schwab foundations potential | ORG | 1 |
| selfcollection | ORG | 1 |
| secondary hemophagocytic lymphohistiocytosis | DISEASE | 1 |
| seattle children s hospital | ORG | 1 |
| seattle | GPE | 1 |
| seaview | ORG | 1 |
| schwartz carmela oster | PERSON | 1 |
| sot lymphoma leukemia | DISEASE | 1 |
| shcrc cycle | ORG | 1 |
| ross zafonte | PERSON | 1 |
| sgas | CHEMICAL | 1 |
| sars cov 2 pcr | ORG | 1 |
| sars cov 2 healthcare | ORG | 1 |
| sars cov 2 considerations | ORG | 1 |
| sars cov 2 antibody | ORG | 1 |
| sars cov 19 false | ORG | 1 |
| sars cov 1 persistence | ORG | 1 |
| sars cov 2 evolution | ORG | 1 |
| sars cov 2 | ORG | 1 |
| s gan t j saltz m saltz | PERSON | 1 |
| rübben albert yang | PERSON | 1 |
| rybak natasha | PERSON | 1 |
| ryan shields | PERSON | 1 |
| rxnorm | ORG | 1 |
| russia | GPE | 1 |
| routine | ORG | 1 |
| sars cov 2 positive | ORG | 1 |
| sars cov 2 safety | ORG | 1 |
| sars cov 2 viral | ORG | 1 |
| sars coronavirus infection | DISEASE | 1 |
| scc soft computer | ORG | 1 |
| sc | ORG | 1 |
| sas institute inc cary nc usa | ORG | 1 |
| sas institute inc cary nc rsv | ORG | 1 |
| sas institute cary nc usa | ORG | 1 |
| sas institute cary nc | ORG | 1 |
| sars coronavirus sars cov | DISEASE | 1 |
| sars cov 2 infection a c c e p t e d | DISEASE | 1 |
| sars t cell immunity | DISEASE | 1 |
| sars cov 2 infections | DISEASE | 1 |
| sars cov 2 infection | DISEASE | 1 |
| sars cov infections | DISEASE | 1 |
| sars cov 25 | ORG | 1 |
| sars cov 2 or 2 | ORG | 1 |
| python tm | ORG | 1 |
| purpura | ORG | 1 |
| narciso baldoquin waldemar | CHEMICAL | 1 |
| ohio | GPE | 1 |
| odalys | ORG | 1 |
| occupational | ORG | 1 |
| observational health data sciences | ORG | 1 |
| ors | ORG | 1 |
| orf1ab | ORG | 1 |
| orf | ORG | 1 |
| ohdsi | ORG | 1 |
| nucleotide basic local alignment search tool | ORG | 1 |
| nucleoside | CHEMICAL | 1 |
| nucleic acid | CHEMICAL | 1 |
| novartis south africa | ORG | 1 |
| novartis international ag | ORG | 1 |
| novartis influenza vaccines ltd | ORG | 1 |
| novartis influenza vaccines | ORG | 1 |
| novartis group | ORG | 1 |
| off | CHEMICAL | 1 |
| olorunju | CHEMICAL | 1 |
| puritan medical products co | ORG | 1 |
| online survey annals | ORG | 1 |
| overweight | ORG | 1 |
| outcome | ORG | 1 |
| outbreaks | TAXON | 1 |
| outbreak response and | ORG | 1 |
| ostrowsky belinda | PERSON | 1 |
| orthopedic surgeons | PERSON | 1 |
| orthopedic surgeon | ORG | 1 |
| oropharyngeal samples food and drug administration | ORG | 1 |
| organize journal clubs | ORG | 1 |
| oregon | GPE | 1 |
| orange county | GPE | 1 |
| orang | GPE | 1 |
| operating room procedures united states | ORG | 1 |
| opening up new supply chains focus on surface disinfection | ORG | 1 |
| openepi | ORG | 1 |
| northern italy | LOC | 1 |
| northern israel | LOC | 1 |
| northeast | LOC | 1 |
| north west provinces | LOC | 1 |
| nepal impact | ORG | 1 |
| neonatal late onset infection | ORG | 1 |
| neisseria meningitidis bordetella pertussis | DISEASE | 1 |
| neisseria meningitidis bordetella | TAXON | 1 |
| neisseria | GPE | 1 |
| native | ORG | 1 |
| national institutes of health | ORG | 1 |
| national institute for the infectious diseases l recommendations | ORG | 1 |
| national health commission | ORG | 1 |
| national | ORG | 1 |
| nataraj n sun s tsai c wang y abbasi s abdullah r ahmad s bai k | CHEMICAL | 1 |
| nasopharyngeal sars cov 2 | DISEASE | 1 |
| nasia safdar | PERSON | 1 |
| nasia | GPE | 1 |
| nasal washes | PERSON | 1 |
| nepal rhinovirus | GPE | 1 |
| netherlands | GPE | 1 |
| neutropenia | DISEASE | 1 |
| nigeria | GPE | 1 |
| north america | LOC | 1 |
| nori priya | PERSON | 1 |
| nordén | GPE | 1 |
| nonurban | CHEMICAL | 1 |
| niranjan hohenboken | GPE | 1 |
| nile virus | TAXON | 1 |
| nicole chen sharon dwyer dominic | PERSON | 1 |
| new caledonia | GPE | 1 |
| nga hung | LOC | 1 |
| ng | CHEMICAL | 1 |
| next | ORG | 1 |
| new zealand | GPE | 1 |
| new york city boroughs feasibility | GPE | 1 |
| new mexico | GPE | 1 |
| palisi network management | ORG | 1 |
| pb2 | ORG | 1 |
| pcr quantitation | ORG | 1 |
| peter mojares | PERSON | 1 |
| porrovecchio andrea | PERSON | 1 |
| porrachia | DISEASE | 1 |
| pornthep richmond peter smith | PERSON | 1 |
| poovathor | CHEMICAL | 1 |
| poorer | GPE | 1 |
| pooling nyc | PERSON | 1 |
| poltavskiy eduard mooso | PERSON | 1 |
| pneumocystis pneumonia | DISEASE | 1 |
| pneumocystis jirovecii infection | DISEASE | 1 |
| pneumocystis | GPE | 1 |
| plasma | GPE | 1 |
| placental pathology | ORG | 1 |
| piantadosi anne mukerji | PERSON | 1 |
| phocine | CHEMICAL | 1 |
| phase 3 multi center | ORG | 1 |
| portability | TAXON | 1 |
| possible vertical transmission of sars cov 2 | ORG | 1 |
| post | ORG | 1 |
| promotes antibiotic stewardship in hospitals health | ORG | 1 |
| purine | CHEMICAL | 1 |
| public health laboratory network | ORG | 1 |
| psychological impact of the covid | ORG | 1 |
| provider | PERSON | 1 |
| providence rhode island usa | GPE | 1 |
| protocols | ORG | 1 |
| professionals | DISEASE | 1 |
| postexposure | CHEMICAL | 1 |
| pretoria | GPE | 1 |
| preprocedure | CHEMICAL | 1 |
| preparedness for concomitant disasters personal protective equipment supply | ORG | 1 |
| pregnancy and possible vertical transmission antibodies in infants | ORG | 1 |
| potential maternal and infant outcomes | ORG | 1 |
| posttest | ORG | 1 |
| pfizer south africa | LOC | 1 |
| personal protective equipment | ORG | 1 |
| pcr vrti cmv | ORG | 1 |
| persistence | ORG | 1 |
| parainfluenza virus infection | DISEASE | 1 |
| parainfluenza virus | TAXON | 1 |
| pangolin | CHEMICAL | 1 |
| pandemic covid 2019 infection | DISEASE | 1 |
| palmetto | PERSON | 1 |
| pacific islander other | GPE | 1 |
| pacheco alejandra | CHEMICAL | 1 |
| pao 2 fio 2 ratio 300 | ORG | 1 |
| ppe weibo | PERSON | 1 |
| ppe participate | ORG | 1 |
| poc nucleic acid | CHEMICAL | 1 |
| pivassociated sari | ORG | 1 |
| piv type 3 infection | DISEASE | 1 |
| piv illness | DISEASE | 1 |
| piv disease | DISEASE | 1 |
| parainfluenza virus infection | DISEASE | 1 |
| parainfluenza virus infections | DISEASE | 1 |
| parati | CHEMICAL | 1 |
| paypal eligible | PERSON | 1 |
| periodic | PERSON | 1 |
| per gao | PERSON | 1 |
| people s hospital ethics committee | ORG | 1 |
| pediatric acute lung injury and sepsis investigators | ORG | 1 |
| pearson s | ORG | 1 |
| pearson | PERSON | 1 |
| paul humphries romney m miller | PERSON | 1 |
| parati mara villani massimiliano radovanovic | PERSON | 1 |
| patruno vincenzo tamburrini mario | PERSON | 1 |
| patricia l long | PERSON | 1 |
| pathogen mini kit | PERSON | 1 |
| pathogen | ORG | 1 |
| pastick katelyn | PERSON | 1 |
| participants | PERSON | 1 |
| iqr interquartile | ORG | 1 |
| cdc world health organization who | ORG | 1 |
| ip000155 | CHEMICAL | 1 |
| camelus | GPE | 1 |
| cambridge ma pr | ORG | 1 |
| calvin wang | PERSON | 1 |
| california acute | ORG | 1 |
| calculation of | ORG | 1 |
| cti time | ORG | 1 |
| cti patients | ORG | 1 |
| csa | CHEMICAL | 1 |
| crs immunotherapy | ORG | 1 |
| cpap | ORG | 1 |
| covid19 | ORG | 1 |
| covid 19 symptoms see video https | DISEASE | 1 |
| covid 19 pneumonia date | ORG | 1 |
| covid 19 infected pneumonia | DISEASE | 1 |
| covid 19 e g tocilizumab | ORG | 1 |
| covid 19 sars cov 2 repeat | ORG | 1 |
| camelids world health organization | ORG | 1 |
| camelus dromedarius | TAXON | 1 |
| biocryst pharma | ORG | 1 |
| cameroon ghana | PERSON | 1 |
| census tract initial | ORG | 1 |
| cellai michele | PERSON | 1 |
| cases | PERSON | 1 |
| casarin | CHEMICAL | 1 |
| carole | DISEASE | 1 |
| caribbean | LOC | 1 |
| capital medical university ethics review board | ORG | 1 |
| cape town south africa respiratory | LOC | 1 |
| cape town | GPE | 1 |
| candida glabrata fungaemia | DISEASE | 1 |
| candida glabrata | TAXON | 1 |
| cancers | DISEASE | 1 |
| cancer eortc | DISEASE | 1 |
| caminati | DISEASE | 1 |
| cameroon progress | LOC | 1 |
| covid 19 sars cov 2 | ORG | 1 |
| covid 19 sars cov | ORG | 1 |
| covid 19 repeat | ORG | 1 |
| covid 19 rt pcr test laboratory corporation of america burlington nc | ORG | 1 |
| cd4 | GPE | 1 |
| cbc | ORG | 1 |
| ca008748 | CHEMICAL | 1 |
| c resik sonia | CHEMICAL | 1 |
| c nucleic acid | CHEMICAL | 1 |
| c nucleic | ORG | 1 |
| butler | PERSON | 1 |
| brooke army medical center bamc | ORG | 1 |
| brigham | PERSON | 1 |
| brien thomas | PERSON | 1 |
| briefly | PERSON | 1 |
| brendish et al | PERSON | 1 |
| bradley heather sullivan patrick s title willingness | PERSON | 1 |
| boston children s hospital deland fellow in health care and society office | ORG | 1 |
| borneo | PERSON | 1 |
| cd8 | ORG | 1 |
| serology | PERSON | 1 |
| cdc s ebola | DISEASE | 1 |
| covid 19 23 | ORG | 1 |
| covid 19 latinx | ORG | 1 |
| covid 19 laboratory markers transcriptomic characteristics | ORG | 1 |
| covid 19 ip 10 | ORG | 1 |
| covid 19 data analysis group | ORG | 1 |
| covid 19 corticosteroid | ORG | 1 |
| covid 19 coronavirus disease | DISEASE | 1 |
| conclusions rapid | ORG | 1 |
| cdm | DISEASE | 1 |
| conclusions latinx | ORG | 1 |
| cmv viremia | DISEASE | 1 |
| cmv mismatches | TAXON | 1 |
| cms | ORG | 1 |
| chf congestive heart failure copd | DISEASE | 1 |
| chf congestive heart failure | DISEASE | 1 |
| center for biologics evaluation research and review cber and committee for medicinal products for human use chmp | ORG | 1 |
| centers for disease control and prevention cdc electronic | ORG | 1 |
| centers for disease control and prevention summary | ORG | 1 |
| clinical trial nct04273763 | GPE | 1 |
| comorbidities | ORG | 1 |
| commentary obesity | DISEASE | 1 |
| commentary idsa | PERSON | 1 |
| coinfection | DISEASE | 1 |
| cohen et al | PERSON | 1 |
| cognitive | ORG | 1 |
| cockcroft gault equation | ORG | 1 |
| covs 229e oc43 and nl63 | TAXON | 1 |
| cov oc43 cov nl63 cov 229e | DISEASE | 1 |
| cov oc43 cov | ORG | 1 |
| cov hku1 pneumonia | DISEASE | 1 |
| clostridium difficile infection | DISEASE | 1 |
| clostridium | GPE | 1 |
| clorox | CHEMICAL | 1 |
| clopper pearson | PERSON | 1 |
| comparing | GPE | 1 |
| complement | ORG | 1 |
| composition | ORG | 1 |
| coronaviridae nelfinavir | PERSON | 1 |
| coronavirus sars cov | DISEASE | 1 |
| coronavirus sars cov | DISEASE | 1 |
| coronavirus locations | TAXON | 1 |
| coronavirus fatalities | DISEASE | 1 |
| coronavirus deaths | DISEASE | 1 |
| coronavirus covid 19 | ORG | 1 |
| cornelius jambol goh hieng hua | PERSON | 1 |
| connecticut | GPE | 1 |
| control recommendations for patients | ORG | 1 |
| control m | ORG | 1 |
| control | ORG | 1 |
| contrarily hlh | ORG | 1 |
| consensus group revision | ORG | 1 |
| consensus group | ORG | 1 |
| clinicians biosecurity news implementation of mitigation strategies for communities | ORG | 1 |
| clinical metagenomic sequencing | PERSON | 1 |
| centers for disease control and prevention world health organization | ORG | 1 |
| clinical laboratories challenges | ORG | 1 |
| china genomic | ORG | 1 |
| china central television | ORG | 1 |
| china association of covid 19 | ORG | 1 |
| china 11 | ORG | 1 |
| children s hospital the institute of medicine at tribhuvan university | ORG | 1 |
| chi | ORG | 1 |
| chest | ORG | 1 |
| chen shi robinson patrick | PERSON | 1 |
| chen | PERSON | 1 |
| cheesan lee | PERSON | 1 |
| chart 1 | PERSON | 1 |
| chanthavanich | DISEASE | 1 |
| chang wong toh mee lim | PERSON | 1 |
| chaillon | CHEMICAL | 1 |
| central california | LOC | 1 |
| chlamydia gonorrhea | DISEASE | 1 |
| chlamydial | TAXON | 1 |
| chlamydial infections | DISEASE | 1 |
| chu | PERSON | 1 |
| clinical characteristics and reasons for differences in duration from symptom onset | ORG | 1 |
| cleveland | GPE | 1 |
| classification of ttv | ORG | 1 |
| circular | ORG | 1 |
| chuet | CHEMICAL | 1 |
| chu et al 23 | PERSON | 1 |
| chronic obstructive pulmonary disease copd | DISEASE | 1 |
| cho | CHEMICAL | 1 |
| chronic obstructive pulmonary disease | DISEASE | 1 |
| chronic kidney disease | DISEASE | 1 |
| chronic cardiopulmonary disease | DISEASE | 1 |
| christine wang | PERSON | 1 |
| christensen paul a | PERSON | 1 |
| chris hani baragwanath academic hospital | ORG | 1 |
| bonferroni holms | PERSON | 1 |
| biofire filmarray pneumonia panel | ORG | 1 |
| coronavirus infection | DISEASE | 1 |
| adult | ORG | 1 |
| adriane | CHEMICAL | 1 |
| addressing maternal health | ORG | 1 |
| adam | PERSON | 1 |
| ad related respiratory illness | DISEASE | 1 |
| ad disease | DISEASE | 1 |
| acute kidney injury | DISEASE | 1 |
| acute west nile | LOC | 1 |
| acute lung injury | DISEASE | 1 |
| achilles heel | DISEASE | 1 |
| aceh province | GPE | 1 |
| accordingly sheahan | PERSON | 1 |
| access | ORG | 1 |
| acceava strep | PERSON | 1 |
| acari ixodidae vectors | TAXON | 1 |
| acari ixodidae | PERSON | 1 |
| adriane avalos | ORG | 1 |
| advanced kit | PERSON | 1 |
| biofire diagnostics inc | ORG | 1 |
| advice | ORG | 1 |
| amrin amin channel news asia claps | ORG | 1 |
| american men s internet survey of behaviors of men | ORG | 1 |
| amelia | GPE | 1 |
| amanda busby university of hertfordshire | ORG | 1 |
| alzahrani | CHEMICAL | 1 |
| alsaaidi | CHEMICAL | 1 |
| algae | PERSON | 1 |
| alejandra plana deborah | PERSON | 1 |
| air force | ORG | 1 |
| ahmad s bai k bennett guerrero | PERSON | 1 |
| african american patients and white patients | ORG | 1 |
| aflunov seqirus vaccines ltd | ORG | 1 |
| aff millwood | CHEMICAL | 1 |
| afar | TAXON | 1 |
| aeromonas | GPE | 1 |
| abstraction | GPE | 1 |
| abdullah | PERSON | 1 |
| abdulaziz hassan ahmed m tolah ahmed m alamari sawsan | PERSON | 1 |
| atg lg rr pl | ORG | 1 |
| 4 4 4 0 days | CHEMICAL | 1 |
| 3jd2gn73 a | CHEMICAL | 1 |
| 3jd2gn73 | DISEASE | 1 |
| 327609 cord_uid | DISEASE | 1 |
| 320511 | DISEASE | 1 |
| 310872 cord_uid 2z1wnj63 | CHEMICAL | 1 |
| 282862 | DISEASE | 1 |
| 2302 | CHEMICAL | 1 |
| 229e | TAXON | 1 |
| 2 united states | GPE | 1 |
| 2 3 4 5 6 7 8 9 10 11 12 13 14 15 | CHEMICAL | 1 |
| 11 978 | CHEMICAL | 1 |
| 10773 | DISEASE | 1 |
| 104 unique prescribers | ORG | 1 |
| 1 9951 n 112 9331 e | CHEMICAL | 1 |
| 7737 | DISEASE | 1 |
| 8e78698bbfa9929daa90da37b5ffc982f4b3e052 | CHEMICAL | 1 |
| a systematic review of treatment and outcomes of pregnant women with covid 19 | ORG | 1 |
| ajs | ORG | 1 |
| atc | ORG | 1 |
| ars turning technologies solutions | ORG | 1 |
| anc 500 | ORG | 1 |
| alfgbg 439391 | CHEMICAL | 1 |
| alf | DISEASE | 1 |
| aki transaminitis | DISEASE | 1 |
| ai131971 | CHEMICAL | 1 |
| a yang | PERSON | 1 |
| ai036214 | CHEMICAL | 1 |
| ai007061 | CHEMICAL | 1 |
| agggcattytggacaaakcgtcta | CHEMICAL | 1 |
| ag000222 | CHEMICAL | 1 |
| acs | CHEMICAL | 1 |
| ac vp mt | ORG | 1 |
| analysis | LOC | 1 |
| andrews | PERSON | 1 |
| anhui | GPE | 1 |
| b cell lymphoblastic leukemia | DISEASE | 1 |
| bang heejung polage christopher | ORG | 1 |
| bactrian camel detection | ORG | 1 |
| bactrian camel | TAXON | 1 |
| bacterial | PERSON | 1 |
| bacteria | TAXON | 1 |
| bacteremia results | PERSON | 1 |
| background adenovirus | PERSON | 1 |
| brief report | ORG | 1 |
| bnp measures | ORG | 1 |
| bmi | ORG | 1 |
| bk | ORG | 1 |
| bd universal viral transport becton dickinson and company | ORG | 1 |
| bd sars cov | ORG | 1 |
| bamc s institutional review board questionnaires | ORG | 1 |
| b5 supplementary | PERSON | 1 |
| bangladesh | GPE | 1 |
| bankrupt | PERSON | 1 |
| barbara volpe maria | PERSON | 1 |
| belongia edward | PERSON | 1 |
| bio rad hercules ca | ORG | 1 |
| bio rad | ORG | 1 |
| bilateral | ORG | 1 |
| berlin | GPE | 1 |
| benjamin hon | PERSON | 1 |
| beneficial | ORG | 1 |
| beijing detection | ORG | 1 |
| barbara wade | PERSON | 1 |
| beigel et al | PERSON | 1 |
| basic view and detailed view | ORG | 1 |
| basel switzerland | GPE | 1 |
| basel | GPE | 1 |
| based | GPE | 1 |
| baricitinib | GPE | 1 |
| b cell lymphoma | DISEASE | 1 |
| b cell aplasia | DISEASE | 1 |
| animal contact | TAXON | 1 |
| azithromycin | CHEMICAL | 1 |
| applied biosystems usa | ORG | 1 |
| applied biosystems foster city ca | ORG | 1 |
| applied biosystems ca | ORG | 1 |
| app | ORG | 1 |
| antonella montico | TAXON | 1 |
| antonella | CHEMICAL | 1 |
| antimicrobial stewardship and infection prevention | ORG | 1 |
| antimicrobial stewardship programs | ORG | 1 |
| antimicrobial | ORG | 1 |
| antigen | GPE | 1 |
| antibody response | ORG | 1 |
| anne pirofski | PERSON | 1 |
| annalisa romagnoli | PERSON | 1 |
| anna tang | PERSON | 1 |
| ann justo | PERSON | 1 |
| apps | GPE | 1 |
| arabi | CHEMICAL | 1 |
| aran | CHEMICAL | 1 |
| aspergillus species schistosoma | TAXON | 1 |
| autoimmunity | DISEASE | 1 |
| austria | GPE | 1 |
| atlanta | GPE | 1 |
| asymptomatic pregnant woman | ORG | 1 |
| association of early | ORG | 1 |
| association of public health laboratories | ORG | 1 |
| aspergillus hyphae | TAXON | 1 |
| archived | PERSON | 1 |
| asia | LOC | 1 |
| aseptic | ORG | 1 |
| arturo casadevall | PERSON | 1 |
| arkansas | GPE | 1 |
| aridi jad | PERSON | 1 |
| arena pharmaceuticals | ORG | 1 |
| coronavirus disease covid | DISEASE | 1 |
| coronavirus infections | DISEASE | 1 |
| ip | ORG | 1 |
| hev igg | ORG | 1 |
| hellp | DISEASE | 1 |
| hd | DISEASE | 1 |
| hct | ORG | 1 |
| hai | ORG | 1 |
| h5n1 virus infection | DISEASE | 1 |
| h5n1 vaccine 7 | TAXON | 1 |
| h5n1 infections | DISEASE | 1 |
| h5n1 infection | DISEASE | 1 |
| h3n6 | GPE | 1 |
| h2o | CHEMICAL | 1 |
| h1n1v | CHEMICAL | 1 |
| h1n1 monovalent | PERSON | 1 |
| h1n1 influenza | PERSON | 1 |
| h1n1 illness | DISEASE | 1 |
| h1n1 disease | DISEASE | 1 |
| hellp overlapping clinical pictures | ORG | 1 |
| hev igg igm | ORG | 1 |
| gastrointestinal symptoms | DISEASE | 1 |
| hev meningoencephalitis | DISEASE | 1 |
| hlhresembling hyperinflammation | CHEMICAL | 1 |
| hlhresembling | ORG | 1 |
| hlh sepsis | DISEASE | 1 |
| hlh misdiagnosis | DISEASE | 1 |
| hlh padhi | CHEMICAL | 1 |
| hlh across speciality collaboration | ORG | 1 |
| hku1 infection | DISEASE | 1 |
| hku | ORG | 1 |
| hiv type | TAXON | 1 |
| hiv lymphoma | DISEASE | 1 |
| hiv diabetes cancer liver disease kidney disease | DISEASE | 1 |
| hiv prevention app | TAXON | 1 |
| hiv parainfluenza virus piv | DISEASE | 1 |
| hiv parainfluenza virus | TAXON | 1 |
| hiv dna | TAXON | 1 |
| h1n1 public perceptions anxiety | DISEASE | 1 |
| h1n1 4 h3n2 and 1 h3n6 strains with 97 identity the second contig 111 nucleotides | DISEASE | 1 |
| h02ab04 | PERSON | 1 |
| görzer | GPE | 1 |
| gilead sciences inc gilead sciences statement on expanding global supply of investigational antiviral remdesivir | ORG | 1 |
| gilead sciences inc | ORG | 1 |
| gilead | ORG | 1 |
| ghana | GPE | 1 |
| germany | GPE | 1 |
| geospatial distribution and predictors of mortality in hospitalized patients | ORG | 1 |
| george goodwin | PERSON | 1 |
| genewiz | ORG | 1 |
| genmark eplex | ORG | 1 |
| genmark dx esensor respiratory viral panel | ORG | 1 |
| genbank supplementary | ORG | 1 |
| gelins | CHEMICAL | 1 |
| gel | PERSON | 1 |
| gautret | PERSON | 1 |
| gauteng province | GPE | 1 |
| gilead us food and drug administration | ORG | 1 |
| glo germ | PERSON | 1 |
| gonorrhea | CHEMICAL | 1 |
| gregory gray | PERSON | 1 |
| guillain barré | ORG | 1 |
| guillain | DISEASE | 1 |
| guidance for risk assessment and work restrictions for healthcare personnel with potential exposure | ORG | 1 |
| guibone | CHEMICAL | 1 |
| guatemala | GPE | 1 |
| grein et | PERSON | 1 |
| greater boston pandemic fabrication team | ORG | 1 |
| gonorrhea screening a systemic review | ORG | 1 |
| gravid patients vaginal | ORG | 1 |
| graphpad software inc san diego ca | ORG | 1 |
| graphpad | ORG | 1 |
| graph healthcare | ORG | 1 |
| grant p30 | PERSON | 1 |
| good clinical practices | ORG | 1 |
| hpiv | TAXON | 1 |
| hpiv s pyogenes streptococcus | DISEASE | 1 |
| hrv infection | DISEASE | 1 |
| huang | PERSON | 1 |
| humans | TAXON | 1 |
| human rhinoviruses community | ORG | 1 |
| human respiratory coronavirus hku1 | TAXON | 1 |
| human monocytic | TAXON | 1 |
| human immunodeficiency virus status | DISEASE | 1 |
| human coronavirus oc43 | TAXON | 1 |
| human anelloviruses | TAXON | 1 |
| human adenovirus | TAXON | 1 |
| human immunodeficiency virus hiv infected | DISEASE | 1 |
| human coronavirus infections | DISEASE | 1 |
| human coronavirus hku1 | TAXON | 1 |
| human coronavirus | TAXON | 1 |
| hueston linda kok jen | PERSON | 1 |
| hubei province | GPE | 1 |
| huang jing liu fangkun teng ziwei chen jindong zhao | PERSON | 1 |
| humidity | ORG | 1 |
| hyalomma dromedarii | DISEASE | 1 |
| hyalomma excavatum acari ixodidae | DISEASE | 1 |
| idsa | ORG | 1 |
| intergrowth | ORG | 1 |
| il1 42 etoposide | CHEMICAL | 1 |
| il 6 | ORG | 1 |
| il 2 | ORG | 1 |
| il 10 | ORG | 1 |
| ifa antibody | ORG | 1 |
| icd10 | CHEMICAL | 1 |
| hydrocortisone | CHEMICAL | 1 |
| ibv one | ORG | 1 |
| ibm corp | ORG | 1 |
| iav three | ORG | 1 |
| iav ibv | ORG | 1 |
| hypoxia | PERSON | 1 |
| hypertension heart disease obesity | DISEASE | 1 |
| huang dayong | PERSON | 1 |
| huanan | GPE | 1 |
| hrv infections | DISEASE | 1 |
| houston methodist hospital | ORG | 1 |
| health usa | ORG | 1 |
| health system | ORG | 1 |
| health malaysia | ORG | 1 |
| health insurance portability and accountability act | ORG | 1 |
| health care providers public health laboratory network | ORG | 1 |
| headache | GPE | 1 |
| hazard ratio | ORG | 1 |
| harvard medical school t32 ag000222 potential | ORG | 1 |
| harvard medical school | ORG | 1 |
| harvard mit center for regulatory science department of dermatology brigham | ORG | 1 |
| hannah a wilson michael r | PERSON | 1 |
| hadassah | PERSON | 1 |
| html | ORG | 1 |
| hsv | DISEASE | 1 |
| hrvassociated | ORG | 1 |
| health and public policy committee | ORG | 1 |
| healthy | PERSON | 1 |
| hematologic | ORG | 1 |
| hierarchies | GPE | 1 |
| house | ORG | 1 |
| hospital | ORG | 1 |
| holms | CHEMICAL | 1 |
| hoard robert | PERSON | 1 |
| hilary hon yun kueh | PERSON | 1 |
| higashi griscelli | PERSON | 1 |
| hepatitis e virus reinfections | DISEASE | 1 |
| hemophagocytic | DISEASE | 1 |
| hepatitis b infection | DISEASE | 1 |
| henter | PERSON | 1 |
| hemophagocytosis | GPE | 1 |
| hemophagocytic syndrome | DISEASE | 1 |
| hemophagocytic lymphohistiocytosis hlh | DISEASE | 1 |
| hemophagocytic lymphohistiocytosis | DISEASE | 1 |
| gatta | ORG | 1 |
| garbino et al 29 | ORG | 1 |
| coronavirus outbreaks | TAXON | 1 |
| drawing | GPE | 1 |
| dr marco de | CHEMICAL | 1 |
| dorothy supplementary | PERSON | 1 |
| dong et al 20 | PERSON | 1 |
| don | PERSON | 1 |
| dolinski rina akria luiza yampoulski yevgeni awad jamal title a | DISEASE | 1 |
| dolinski rina akria luiza yampoulski yevgeni awad jamal | PERSON | 1 |
| disinfectant sprays | CHEMICAL | 1 |
| disinfectant | ORG | 1 |
| disclaimer | PERSON | 1 |
| dis doi | PERSON | 1 |
| digital | ORG | 1 |
| diagnostic | GPE | 1 |
| diagnose | DISEASE | 1 |
| diabetes mellitus | DISEASE | 1 |
| developing interactive antimicrobial stewardship and infection prevention | ORG | 1 |
| dr valentina luzzi | CHEMICAL | 1 |
| drs liise | PERSON | 1 |
| galidesivir bcx4430 | PERSON | 1 |
| due | ORG | 1 |
| effectiveness of | ORG | 1 |
| echovirus | TAXON | 1 |
| ebola rna viruses | TAXON | 1 |
| eastern massachusetts | LOC | 1 |
| eastern france analysis | ORG | 1 |
| early transmission dynamics | ORG | 1 |
| ev overall | ORG | 1 |
| esrd | DISEASE | 1 |
| e virus rna | TAXON | 1 |
| durham north carolina | GPE | 1 |
| duplicate | ORG | 1 |
| dulin | CHEMICAL | 1 |
| duke university the duke global health institute sibu hospital clinical research center | ORG | 1 |
| duke university s global health institute | ORG | 1 |
| duke data | ORG | 1 |
| detroit | GPE | 1 |
| detection of sars cov 2 | ORG | 1 |
| detection of sars cov | ORG | 1 |
| detailed tables | PERSON | 1 |
| dp2ai144244 | CHEMICAL | 1 |
| dnr | CHEMICAL | 1 |
| dnaemia | ORG | 1 |
| divein | ORG | 1 |
| d dimer | CHEMICAL | 1 |
| d s | ORG | 1 |
| cybulski robert j okulicz | PERSON | 1 |
| cutaneous vasculitis | ORG | 1 |
| critical care utilization | ORG | 1 |
| critical | GPE | 1 |
| crcl | ORG | 1 |
| coxsackie a9 virus | TAXON | 1 |
| cox proportional hazards | TAXON | 1 |
| covid 19 caution | ORG | 1 |
| coronaviruses oc43 and nl63 | TAXON | 1 |
| dr | DISEASE | 1 |
| dsm | ORG | 1 |
| dsmb | GPE | 1 |
| david roberts md | PERSON | 1 |
| detailed | GPE | 1 |
| design | ORG | 1 |
| deng j garcia v gayen s kurc | PERSON | 1 |
| deborah morin craig ryan patricia | PERSON | 1 |
| deaths across | PERSON | 1 |
| david tong md | PERSON | 1 |
| david j al jarrah | PERSON | 1 |
| daejeon a | GPE | 1 |
| datasets kdigo | PERSON | 1 |
| darunavir cobicistat | CHEMICAL | 1 |
| darby | GPE | 1 |
| daniel dulin michael | PERSON | 1 |
| dane county | GPE | 1 |
| damien hone | PERSON | 1 |
| ehrlichia chaffeensis infection | DISEASE | 1 |
| einstein | ORG | 1 |
| el khoury joseph | CHEMICAL | 1 |
| fang | GPE | 1 |
| fishers | PERSON | 1 |
| filmarray respiratory panel biofire | ORG | 1 |
| fibrosis | DISEASE | 1 |
| fetal membrane samples | ORG | 1 |
| fengxia lai xunxi liang | PERSON | 1 |
| fengxia | CHEMICAL | 1 |
| females | ORG | 1 |
| female nurses effectiveness | ORG | 1 |
| febrile illness | DISEASE | 1 |
| febrile rhinovirus illness | ORG | 1 |
| features severity | PERSON | 1 |
| favipiravir rna | ORG | 1 |
| fatemeh memar | PERSON | 1 |
| fatemeh | CHEMICAL | 1 |
| farmakiotis dimitrios | DISEASE | 1 |
| flanigan timothy | CHEMICAL | 1 |
| flu | TAXON | 1 |
| fluconazole | CHEMICAL | 1 |
| frey sharon | PERSON | 1 |
| gaccione | CHEMICAL | 1 |
| gac | CHEMICAL | 1 |
| förderkreis stiftung herzchirurgie | LOC | 1 |
| fungal infection | DISEASE | 1 |
| fungal | PERSON | 1 |
| fuchun | CHEMICAL | 1 |
| frey | DISEASE | 1 |
| fluxergy | ORG | 1 |
| françois | GPE | 1 |
| frank assaf chalid | PERSON | 1 |
| foster city | CHEMICAL | 1 |
| forecast | LOC | 1 |
| fluxergy bayer aids healthcare foundation | ORG | 1 |
| fluxergy bayer aids | DISEASE | 1 |
| fangkun | DISEASE | 1 |
| faculty | ORG | 1 |
| eleftherios | CHEMICAL | 1 |
| DISEASE | 1 | |
| equine influenza | PERSON | 1 |
| equine | CHEMICAL | 1 |
| epstein barr virus valganciclovir | DISEASE | 1 |
| epstein barr virus ebv 4 secondary | DISEASE | 1 |
| epstein barr virus | PERSON | 1 |
| epididymitis | DISEASE | 1 |
| environmental services department novel | ORG | 1 |
| enteroviruses | DISEASE | 1 |
| enterobacter | ORG | 1 |
| enteric | DISEASE | 1 |
| england professional practice committee and committee on laboratory practices | ORG | 1 |
| enago | ORG | 1 |
| emerging infections program | ORG | 1 |
| emergency use authorization | ORG | 1 |
| emergency department | ORG | 1 |
| erin k | PERSON | 1 |
| erin parker | PERSON | 1 |
| eritrea | GPE | 1 |
| fam | CHEMICAL | 1 |
| fwuni12 | DISEASE | 1 |
| fvc | ORG | 1 |
| fu a | CHEMICAL | 1 |
| fs pc ps sh rs sl | ORG | 1 |
| fbs | DISEASE | 1 |
| fam tgcagtcctcgctcactgggcacg | ORG | 1 |
| exceeds | CHEMICAL | 1 |
| ethiopia molecular | ORG | 1 |
| evangelia k | DISEASE | 1 |
| european organization for research and treatment of cancer invasive fungal infections cooperative group national institute of allergy and infectious diseases | ORG | 1 |
| european country | ORG | 1 |
| european centre for disease prevention | ORG | 1 |
| europe | LOC | 1 |
| ethnicity disability | DISEASE | 1 |
| serologic | ORG | 1 |
| coxsackievirus | TAXON | 1 |
| severe acute respiratory illness programme | ORG | 1 |
| preand | ORG | 1 |
| poly dt | CHEMICAL | 1 |
| pneumonitis | DISEASE | 1 |
| pneumonias | DISEASE | 1 |
| pneumonia urinary tract infections | DISEASE | 1 |
| pneumonia bronchitis | DISEASE | 1 |
| pneumonia coronavirus hku1 infection | DISEASE | 1 |
| pneumonia coronavirus hku1 | DISEASE | 1 |
| pneumonia 31 | ORG | 1 |
| pneumocystis pneumonia | DISEASE | 1 |
| pleural effusions | DISEASE | 1 |
| pleural effusion | DISEASE | 1 |
| photophobia | DISEASE | 1 |
| pentamidine | CHEMICAL | 1 |
| penicillin allergy | CHEMICAL | 1 |
| penicillin allergies | CHEMICAL | 1 |
| positional vertigo | DISEASE | 1 |
| preand post | ORG | 1 |
| new york city | GPE | 1 |
| prednisolone | CHEMICAL | 1 |
| pulmonary invasive mold infection | DISEASE | 1 |
| pulmonary infection | DISEASE | 1 |
| pulmonary embolism | DISEASE | 1 |
| public behaviors perceptions depression | DISEASE | 1 |
| psychological distress | DISEASE | 1 |
| psychiatric disorder | DISEASE | 1 |
| protective behaviors and personal health | DISEASE | 1 |
| protective behaviors | DISEASE | 1 |
| prostate biopsy infection | DISEASE | 1 |
| prostaglandins | CHEMICAL | 1 |
| prock3co | DISEASE | 1 |
| preterm delivery pregnancy | DISEASE | 1 |
| pregnancy fever | DISEASE | 1 |
| prednisone azathioprine | CHEMICAL | 1 |
| prednisolone dexamethasone | CHEMICAL | 1 |
| penicillin allergic | CHEMICAL | 1 |
| penicillin | CHEMICAL | 1 |
| pdm09h1n1 influenza | PERSON | 1 |
| pathologies | DISEASE | 1 |
| orchitis enteroviruses | DISEASE | 1 |
| opine | CHEMICAL | 1 |
| ofy316 sha 945fac2c9ade4e451cc0cb8388cf9de8b2f00a47 | ORG | 1 |
| ofy050 sha | PERSON | 1 |
| ofaa436 | ORG | 1 |
| occupational infection | DISEASE | 1 |
| obstructive pulmonary disease obstructive sleep apnea syndrome obesity hypoventilation syndrome | DISEASE | 1 |
| obstructive lung disease | DISEASE | 1 |
| o2zfilcl | CHEMICAL | 1 |
| nystatin | CHEMICAL | 1 |
| nucleotide nucleotide | CHEMICAL | 1 |
| nosocomial infection | DISEASE | 1 |
| nonventilator | CHEMICAL | 1 |
| nonrespiratory illness | DISEASE | 1 |
| nitric oxide | CHEMICAL | 1 |
| org fluview | PERSON | 1 |
| organ dysfunction | DISEASE | 1 |
| organ dysfunction failure | DISEASE | 1 |
| parainfluenza types 1 | TAXON | 1 |
| pathogen coinfection | DISEASE | 1 |
| parotitis | DISEASE | 1 |
| parasites | TAXON | 1 |
| paramyxovirus | TAXON | 1 |
| parainfluenza viruses pivs 2 9 | TAXON | 1 |
| parainfluenza virus types | TAXON | 1 |
| panfab | CHEMICAL | 1 |
| organ failure | DISEASE | 1 |
| pandemic coronavirus disease | DISEASE | 1 |
| pancreatitis pericarditis peritonitis | DISEASE | 1 |
| oxygen copd | CHEMICAL | 1 |
| overweight | DISEASE | 1 |
| overload anxiety | DISEASE | 1 |
| oropharyngeal sars | DISEASE | 1 |
| purpura | ORG | 1 |
| purpura fulminans | DISEASE | 1 |
| pyogenes illness | DISEASE | 1 |
| respiratory tract infection lrti | DISEASE | 1 |
| rhonchi hospital | ORG | 1 |
| rhinoviruses a b | DISEASE | 1 |
| rhinovirus febrile respiratory illness | DISEASE | 1 |
| rhinovirus and coronavirus | DISEASE | 1 |
| rhinitis conjunctivitis otitis sinusitis pharyngitis sore | DISEASE | 1 |
| rheumatological disorders | DISEASE | 1 |
| rheumatoid | DISEASE | 1 |
| rheumatic fever | DISEASE | 1 |
| rhesus macaque | TAXON | 1 |
| respiratory viruses 1 2 | TAXON | 1 |
| respiratory viruses | TAXON | 1 |
| respiratory virus nucleic acid | TAXON | 1 |
| respiratory virus disease | DISEASE | 1 |
| respiratory virus co infection | DISEASE | 1 |
| respiratory tract tracheobronchitis | DISEASE | 1 |
| rickettsial | TAXON | 1 |
| rickettsial diseases | DISEASE | 1 |
| rickettsioses | TAXON | 1 |
| s disease | DISEASE | 1 |
| serotypes viruses | TAXON | 1 |
| seroconversions | DISEASE | 1 |
| sepsis septic shock | DISEASE | 1 |
| seizure disorders | DISEASE | 1 |
| season | PERSON | 1 |
| sarilumab | CHEMICAL | 1 |
| ruminants | TAXON | 1 |
| rickettsioses hemophagocytosis syndrome | DISEASE | 1 |
| rotavirus | TAXON | 1 |
| rituximab | CHEMICAL | 1 |
| ritonavir lpv | CHEMICAL | 1 |
| ritonavir a | CHEMICAL | 1 |
| ritonavir | CHEMICAL | 1 |
| right leg tenderness | DISEASE | 1 |
| respiratory tract infections laryngotracheobronchitis croup | DISEASE | 1 |
| respiratory tract infection arti | DISEASE | 1 |
| pyrrolo | GPE | 1 |
| respiratory tract illness coronavirus hku1 | DISEASE | 1 |
| respiratory diseases | DISEASE | 1 |
| respiratory complaint | DISEASE | 1 |
| respiratory comorbidity | DISEASE | 1 |
| respiratory bacterial colonization | DISEASE | 1 |
| renal impairment | DISEASE | 1 |
| reassortant | TAXON | 1 |
| rat | TAXON | 1 |
| rash headache nausea vomiting | DISEASE | 1 |
| radiation accidents | DISEASE | 1 |
| rabies | TAXON | 1 |
| rabbit | TAXON | 1 |
| rh5n1 | ORG | 1 |
| quaternary ammonium | CHEMICAL | 1 |
| qnxj7d9l | CHEMICAL | 1 |
| qrt pcr | ORG | 1 |
| respiratory distress respiratory frequency 30 min o 2 saturation index | DISEASE | 1 |
| respiratory dyspnea | DISEASE | 1 |
| respiratory failure | DISEASE | 1 |
| respiratory syncytial virus rsv infection | DISEASE | 1 |
| respiratory syndrome coronavirus illness | DISEASE | 1 |
| respiratory syndrome mers infection | DISEASE | 1 |
| respiratory syncytial virus viral hemorrhagic fever | DISEASE | 1 |
| respiratory syncytial virus human metapneumovirus parainfluenza viruses 1 4 influenza coronavirus bocavirus | DISEASE | 1 |
| respiratory syncytial virus human metapneumovirus and influenza virus | DISEASE | 1 |
| respiratory syncytial virus and influenza illnesses | DISEASE | 1 |
| respiratory syncytial virus rsv illness | DISEASE | 1 |
| respiratory high dependency units rhdus | DISEASE | 1 |
| respiratory symptoms loss of smell or taste | DISEASE | 1 |
| respiratory symptoms cough dyspnea | DISEASE | 1 |
| respiratory symptoms | DISEASE | 1 |
| respiratory irritation | DISEASE | 1 |
| respiratory illness deaths | DISEASE | 1 |
| respiratory illness ari | DISEASE | 1 |
| niclosamide | CHEMICAL | 1 |
| neutrophil | GPE | 1 |
| sha 55fae020adeec20e62937122cfca189e4bcd628d | CHEMICAL | 1 |
| influenza virus infections | DISEASE | 1 |
| influenza vaccine effectiveness | ORG | 1 |
| influenza surveillance report | ORG | 1 |
| influenza infections | DISEASE | 1 |
| influenza illness | DISEASE | 1 |
| influenza hospitalization surveillance data | ORG | 1 |
| influenza disease | DISEASE | 1 |
| influenza and respiratory syncytial virus to community | DISEASE | 1 |
| influenza and respiratory syncytial virus infections | DISEASE | 1 |
| influenza and respiratory pathogen | DISEASE | 1 |
| influenza deaths | DISEASE | 1 |
| influenza b enterovirus human | CHEMICAL | 1 |
| influenza antiviral | ORG | 1 |
| influenza a viruses supplementary table s1 the obtained sequences were identical for samples spc00384 spc00394 | DISEASE | 1 |
| influenza a viruses query | DISEASE | 1 |
| influenza a viruses | DISEASE | 1 |
| influenza virus infection association | ORG | 1 |
| influenzas | CHEMICAL | 1 |
| neutropenia anc 500 | ORG | 1 |
| insect bites | TAXON | 1 |
| kidney and testis damage | DISEASE | 1 |
| kidney and testis | DISEASE | 1 |
| judo working | PERSON | 1 |
| israelensis | DISEASE | 1 |
| ischemia | DISEASE | 1 |
| intravascular coagulation dic | DISEASE | 1 |
| intrauterine growth retardation | DISEASE | 1 |
| intralobular septal thickening basilar atelectasis small | DISEASE | 1 |
| interstitial lung disease cerebrovascular disease chronic kidney disease | DISEASE | 1 |
| interstitial and alveolar infiltrates | DISEASE | 1 |
| intermittent flares | DISEASE | 1 |
| interleukine | CHEMICAL | 1 |
| interferon ɣ 2 3 rickettsia | CHEMICAL | 1 |
| interferon beta infb | CHEMICAL | 1 |
| interferon beta | CHEMICAL | 1 |
| influenza a virus infection | DISEASE | 1 |
| influenza a virus by rt pcr table 1 viral rna | DISEASE | 1 |
| influenza a pathogens | DISEASE | 1 |
| influenza a influenza b respiratory syncytial virus and rhinovirus enterovirus | DISEASE | 1 |
| infections tuberculosis leishmaniasis rickettsiosis | DISEASE | 1 |
| infections osteomyelitis pneumonia | DISEASE | 1 |
| infections bloodstream meningitis c difficile | DISEASE | 1 |
| infections hais | DISEASE | 1 |
| infection sars cov | DISEASE | 1 |
| infected worries | DISEASE | 1 |
| infant hemophagocytic lymphohistiocytosis | DISEASE | 1 |
| immunosuppresion | DISEASE | 1 |
| immunopathological damage | DISEASE | 1 |
| immunodeficiency syndromes chediak higashi griscelli | DISEASE | 1 |
| immunocompetent adult ehrlichia | DISEASE | 1 |
| immune impairment | DISEASE | 1 |
| illness fever | DISEASE | 1 |
| idiopathic pulmonary fibrosis neuromuscular disorders dementia | DISEASE | 1 |
| idiopathic pulmonary fibrosis | DISEASE | 1 |
| infectious agents | DISEASE | 1 |
| infectious autoimmune | DISEASE | 1 |
| infectious events figure 1 and table 2 | DISEASE | 1 |
| inflammatory polyradiculopathy encephalitis | DISEASE | 1 |
| influenza a coinfection | DISEASE | 1 |
| influenza a h1n1 virus and their seroconversion | DISEASE | 1 |
| influenza a h1n1 pdm09 viral pneumonia covid | DISEASE | 1 |
| influenza a h1n1 pdm09 impact of neuraminidase inhibitor treatment on outcomes of public health importance during the 2009 2010 influenza a h1n1 pandemic | DISEASE | 1 |
| influenza a h1n1 pandemic a polling study in five countries the lancet infectious diseases | DISEASE | 1 |
| influenza a h1n1 | DISEASE | 1 |
| inflammatory exanthematous eruptions | DISEASE | 1 |
| infectious events or acute rejections | DISEASE | 1 |
| infiltrative disease | DISEASE | 1 |
| inferiority | DISEASE | 1 |
| infectious threats like covid | DISEASE | 1 |
| infectious threats infectious diseases id | DISEASE | 1 |
| infectious syndromes | DISEASE | 1 |
| infectious on inanimate surfaces | DISEASE | 1 |
| kidney injury | DISEASE | 1 |
| kidney injury hepatocellular | DISEASE | 1 |
| lactate | CHEMICAL | 1 |
| metronidazole | CHEMICAL | 1 |
| murine | TAXON | 1 |
| mumps virus | PERSON | 1 |
| multivariate cox proportional hazards | ORG | 1 |
| multiple sclerosis ms | DISEASE | 1 |
| multiple infections | DISEASE | 1 |
| multicentre retrospective matched | ORG | 1 |
| multicentre | PERSON | 1 |
| mslrtd | DISEASE | 1 |
| mouse | TAXON | 1 |
| morphine | CHEMICAL | 1 |
| min max | PERSON | 1 |
| migraines hypercoagulability | DISEASE | 1 |
| migraine | DISEASE | 1 |
| microvasculopathy | DISEASE | 1 |
| microvascular injury | DISEASE | 1 |
| myalgia fever | DISEASE | 1 |
| mycophenolate mofetil mmf | CHEMICAL | 1 |
| mycophenolate mofetil mmf cyclosporine | CHEMICAL | 1 |
| nephrotic syndrome | DISEASE | 1 |
| neuronal necrosis | DISEASE | 1 |
| neurologic toxicity | DISEASE | 1 |
| neurologic disease | DISEASE | 1 |
| neuroinvasive astrovirus infection | DISEASE | 1 |
| neuroinvasive astrovirus | TAXON | 1 |
| nerve compression | DISEASE | 1 |
| ncbi | CHEMICAL | 1 |
| myelin degeneration | DISEASE | 1 |
| nausea generalized myalgia generalized | DISEASE | 1 |
| nasal congestion wheezing | DISEASE | 1 |
| n 5 adenovirus n 1 | TAXON | 1 |
| n 1 coinfections | ORG | 1 |
| myositis | DISEASE | 1 |
| myocardial injury | DISEASE | 1 |
| microthrombi | DISEASE | 1 |
| methylprednisolone mp | CHEMICAL | 1 |
| learners | ORG | 1 |
| methamphetamine | CHEMICAL | 1 |
| lupus erythematosus | DISEASE | 1 |
| lung opacities | DISEASE | 1 |
| lung damage | DISEASE | 1 |
| lung adenocarcinoma | DISEASE | 1 |
| lower extremity weakness | DISEASE | 1 |
| lopinavir ritonavir kaletra | CHEMICAL | 1 |
| lopinavir methylprednisolone | PERSON | 1 |
| lopinavir concentrations lopinavir | CHEMICAL | 1 |
| liver test abnormalities | DISEASE | 1 |
| liver injury | DISEASE | 1 |
| liver disease | DISEASE | 1 |
| livedo reticularis | PERSON | 1 |
| leukopenia wbc | ORG | 1 |
| leukocytosis | DISEASE | 1 |
| leukemia blood disorders neuromuscular disorders obesity | DISEASE | 1 |
| lymphoma alcoholism g6pd deficiency | DISEASE | 1 |
| lymphoma chronic lymphocytic leukemia cll | DISEASE | 1 |
| lymphopenia a | DISEASE | 1 |
| memory b | DISEASE | 1 |
| metabolic diseases | DISEASE | 1 |
| metabolic disease renal disease | DISEASE | 1 |
| metabolic cardiovascular cerebrovascular pulmonary and kidney disease | DISEASE | 1 |
| metabolic acidosis | DISEASE | 1 |
| meta analysis epidemiological | ORG | 1 |
| meningismus testicular swelling | DISEASE | 1 |
| medcalc https www medcalc org confidence | ORG | 1 |
| lymphoproliferative disorder | DISEASE | 1 |
| maternal influenza | ORG | 1 |
| malnutrition | DISEASE | 1 |
| malignant diseases | DISEASE | 1 |
| malaria endemic | TAXON | 1 |
| major diseases | DISEASE | 1 |
| major depression | DISEASE | 1 |
| sha 41872fbc06f76b814df6c46b5b5f7844987386e1 | CHEMICAL | 1 |
| sha b49275c6422462739f6d4992459b7000fa87a608 | CHEMICAL | 1 |
| hypoxia | DISEASE | 1 |
| throat swab | PERSON | 1 |
| the referral ethics committee | ORG | 1 |
| the latter association | ORG | 1 |
| the census bureau | ORG | 1 |
| the association of baseline characteristics | ORG | 1 |
| the world health organization who sars | ORG | 1 |
| the world health organization who | ORG | 1 |
| the venereal disease research laboratory | ORG | 1 |
| the upper respiratory tract | LOC | 1 |
| the upper midwest | LOC | 1 |
| the university of wisconsin | ORG | 1 |
| the university of torino | ORG | 1 |
| the university of california san francisco | ORG | 1 |
| the university of california office of the president | ORG | 1 |
| the university hospital of strasbourg n ce 2020 | ORG | 1 |
| the university centre | ORG | 1 |
| throat runny | PERSON | 1 |
| thrombocytopenia hyponatremia | DISEASE | 1 |
| the renaissance school of medicine at stony brook university | ORG | 1 |
| thrombosis | DISEASE | 1 |
| traumatic stress disorder | DISEASE | 1 |
| trauma | DISEASE | 1 |
| transplant lymphoproliferative disorder ptld | DISEASE | 1 |
| transaminitis | DISEASE | 1 |
| trainingone | CHEMICAL | 1 |
| toxoplasmosis | DISEASE | 1 |
| toxicities | DISEASE | 1 |
| toxic shock | DISEASE | 1 |
| tonsillitis | DISEASE | 1 |
| tocilizumab zinc thiamine | CHEMICAL | 1 |
| tocilizumab steroids | CHEMICAL | 1 |
| tocilizumab sars | CHEMICAL | 1 |
| thrombotic thrombocytopenic purpura ttp | DISEASE | 1 |
| thrombotic thrombocytopenic purpura | DISEASE | 1 |
| thrombotic microvasculopathy | DISEASE | 1 |
| the universities of the witwatersrand kwazulu natal | ORG | 1 |
| the united states a review of challenges potential solutions and future opportunities attitudes | GPE | 1 |
| the united states rolling | GPE | 1 |
| the united states remdesivir | GPE | 1 |
| the uc davis institutional review board | ORG | 1 |
| the u s government title 17 | ORG | 1 |
| the u s food and drug administration | ORG | 1 |
| the u s army office of the surgeon general | ORG | 1 |
| the u s army medical department | ORG | 1 |
| the translational virology core | ORG | 1 |
| the targeted research program potential | ORG | 1 |
| the susceptible exposed infectious recovered seir | GPE | 1 |
| the supplementary appendix | GPE | 1 |
| the severe acute respiratory illness sari program | ORG | 1 |
| the self rating anxiety scale sas | ORG | 1 |
| the seattle region case series respiratory | LOC | 1 |
| the scientific advisory board of oxeia biopharma biodirection elminda | ORG | 1 |
| the sandler bowes | ORG | 1 |
| the san diego center for aids research | ORG | 1 |
| the ucsf | ORG | 1 |
| the us | ORG | 1 |
| the us naval medical research center asia | ORG | 1 |
| the united states environmental protection agency | ORG | 1 |
| the united states protocols | GPE | 1 |
| the united states protocol and key indicators | ORG | 1 |
| the united states impact | GPE | 1 |
| the united states government financial | ORG | 1 |
| the united states estimates | GPE | 1 |
| the united states epidemiology | GPE | 1 |
| the united states chloroquine | GPE | 1 |
| the uniformed services university of the health sciences brooke army infectious | ORG | 1 |
| the united states air force 59th medical wing science and technology air education and training command potential | ORG | 1 |
| the united states 3 | GPE | 1 |
| the united network for organ sharing | ORG | 1 |
| the united nations international children s emergency fund unicef | ORG | 1 |
| the united kingdom a cross | GPE | 1 |
| the unit of biomedical ethics | ORG | 1 |
| trichomoniasis | DISEASE | 1 |
| triphosphate nucleoside | CHEMICAL | 1 |
| tuberculous adenitis | DISEASE | 1 |
| viremia infection | DISEASE | 1 |
| vitro | GPE | 1 |
| vitamin c | CHEMICAL | 1 |
| visceral perforation | DISEASE | 1 |
| viruses enterovirus human | TAXON | 1 |
| viruses bacteria fungi | TAXON | 1 |
| viruses anelloviruses | TAXON | 1 |
| virus vaccine 2 antigen | TAXON | 1 |
| virus type 3 | TAXON | 1 |
| virus type | TAXON | 1 |
| virus nucleocapsid n | TAXON | 1 |
| virus rna | TAXON | 1 |
| virus mycoplasma | TAXON | 1 |
| virus hiv 1 protease inhibitor | TAXON | 1 |
| virus hiv | TAXON | 1 |
| virus hev | TAXON | 1 |
| vomiting a | DISEASE | 1 |
| vs vasculitis | PERSON | 1 |
| weakness | DISEASE | 1 |
| zoonotic coronaviruses | DISEASE | 1 |
| 防护服 gown | PERSON | 1 |
| 的通知 national health commission | ORG | 1 |
| 关于加强卫生应急工作规范化建设 的指导意见 | DISEASE | 1 |
| β lactam regimens | PERSON | 1 |
| Ärztekammer nordrhein | PERSON | 1 |
| zoonotic coronaviruses coronavirus | DISEASE | 1 |
| zoonosis | GPE | 1 |
| weight loss lung hemorrhage | DISEASE | 1 |
| zanamivir peramivir | CHEMICAL | 1 |
| z2eogm18 | CHEMICAL | 1 |
| yiqingchaxun | PERSON | 1 |
| xxgzbdfk | CHEMICAL | 1 |
| wisconsin coronavirus | CHEMICAL | 1 |
| wheeze rales | DISEASE | 1 |
| virus h5n1 | TAXON | 1 |
| viremia epstein barr virus dnaemia | DISEASE | 1 |
| tumor | DISEASE | 1 |
| viral upper respiratory infection | DISEASE | 1 |
| vesiculous rash | DISEASE | 1 |
| ventilator dependence | DISEASE | 1 |
| venous thrombosis | DISEASE | 1 |
| vasculopathic vasculitic | DISEASE | 1 |
| vasculitic rash | DISEASE | 1 |
| variegated squirrel bornavirus | TAXON | 1 |
| varicella infection | DISEASE | 1 |
| vancomycin ceftriaxone | CHEMICAL | 1 |
| vancomycin ceftazidime acyclovir | CHEMICAL | 1 |
| urticaria | DISEASE | 1 |
| underfitting | DISEASE | 1 |
| ultra rapid pathogen identification surpi | ORG | 1 |
| type 3 infection | DISEASE | 1 |
| tympanic membranes gallop murmur abnormal rhythm for cardiac abnormal bowel sounds distended tender for abdominal these n | DISEASE | 1 |
| tumors | DISEASE | 1 |
| viraemia | DISEASE | 1 |
| viral arti | DISEASE | 1 |
| viral dna | TAXON | 1 |
| viral reads | TAXON | 1 |
| viral syndrome fever | DISEASE | 1 |
| viral respiratory tract infectious diseases | DISEASE | 1 |
| viral respiratory tract infections | DISEASE | 1 |
| viral respiratory infections | DISEASE | 1 |
| viral respiratory infection | DISEASE | 1 |
| viral respiratory coinfection | DISEASE | 1 |
| viral proteins | TAXON | 1 |
| viral rna polymerases | TAXON | 1 |
| viral polymerases | TAXON | 1 |
| viral pattern illness | DISEASE | 1 |
| viral meningoencephalitis | DISEASE | 1 |
| viral hepatitis acute cholecystitis cholangitis | DISEASE | 1 |
| viral coinfection illness | DISEASE | 1 |
| viral coinfection | DISEASE | 1 |
| the sahlgrenska university hospital | ORG | 1 |
| the rejang river | LOC | 1 |
| shock | DISEASE | 1 |
| the center for aids research at emory university | ORG | 1 |
| the csl group | ORG | 1 |