This is a table of type adverb and their frequencies. Use it to search & browse the list to learn more about your study carrel.
adverb | frequency |
---|---|
also | 4840 |
however | 2374 |
well | 1937 |
significantly | 1138 |
therefore | 1089 |
respectively | 1062 |
highly | 1055 |
previously | 881 |
even | 769 |
recently | 751 |
often | 604 |
furthermore | 577 |
now | 562 |
together | 492 |
still | 489 |
currently | 477 |
differentially | 476 |
moreover | 460 |
usually | 453 |
especially | 435 |
directly | 429 |
first | 417 |
interestingly | 406 |
less | 360 |
far | 358 |
relatively | 352 |
finally | 351 |
approximately | 346 |
mainly | 336 |
already | 322 |
specifically | 318 |
widely | 317 |
rather | 317 |
potentially | 309 |
particularly | 309 |
yet | 308 |
much | 299 |
commonly | 284 |
probably | 266 |
genetically | 265 |
hence | 264 |
least | 264 |
strongly | 253 |
generally | 252 |
frequently | 246 |
successfully | 241 |
rapidly | 241 |
subsequently | 237 |
similarly | 235 |
additionally | 232 |
later | 227 |
clearly | 225 |
closely | 223 |
almost | 217 |
thereby | 214 |
fully | 214 |
statistically | 212 |
indeed | 211 |
completely | 211 |
prior | 204 |
long | 203 |
clinically | 201 |
alone | 197 |
just | 194 |
efficiently | 179 |
easily | 172 |
newly | 171 |
stably | 169 |
partially | 166 |
primarily | 163 |
typically | 162 |
mostly | 162 |
possibly | 160 |
instead | 160 |
initially | 156 |
positively | 155 |
nevertheless | 155 |
double | 154 |
likely | 148 |
negatively | 144 |
predominantly | 140 |
poorly | 138 |
consequently | 138 |
effectively | 137 |
slightly | 134 |
nearly | 128 |
perhaps | 126 |
sometimes | 122 |
naturally | 122 |
normally | 120 |
functionally | 119 |
extremely | 119 |
nt | 119 |
independently | 119 |
largely | 118 |
importantly | 116 |
greatly | 115 |
overall | 114 |
worldwide | 113 |
increasingly | 112 |
namely | 109 |
always | 108 |
better | 107 |
notably | 107 |
randomly | 107 |
early | 106 |
next | 105 |
quite | 103 |
simply | 102 |
selectively | 102 |
markedly | 101 |
simultaneously | 100 |
earlier | 97 |
ultimately | 96 |
surprisingly | 96 |
alternatively | 94 |
ago | 93 |
longer | 91 |
chemically | 90 |
biologically | 90 |
upstream | 89 |
immediately | 88 |
otherwise | 87 |
extensively | 86 |
experimentally | 85 |
apparently | 85 |
separately | 84 |
commercially | 84 |
briefly | 83 |
best | 82 |
never | 81 |
exclusively | 81 |
back | 77 |
around | 77 |
dramatically | 76 |
eventually | 75 |
readily | 74 |
considerably | 74 |
publicly | 73 |
necessarily | 73 |
actually | 73 |
soon | 72 |
substantially | 72 |
remarkably | 69 |
essentially | 68 |
accurately | 68 |
rarely | 67 |
consistently | 65 |
single | 63 |
severely | 63 |
quickly | 63 |
critically | 63 |
enough | 62 |
constitutively | 62 |
downstream | 60 |
originally | 60 |
preferentially | 60 |
systematically | 59 |
online | 59 |
apart | 59 |
unfortunately | 59 |
likewise | 58 |
carefully | 58 |
second | 57 |
forward | 57 |
regardless | 54 |
accordingly | 54 |
partly | 53 |
entirely | 53 |
ever | 52 |
twice | 52 |
structurally | 52 |
presumably | 51 |
equally | 51 |
covalently | 51 |
differently | 49 |
spontaneously | 48 |
individually | 47 |
continuously | 47 |
actively | 47 |
occasionally | 45 |
orally | 44 |
gradually | 44 |
tightly | 44 |
precisely | 44 |
traditionally | 43 |
elsewhere | 43 |
transiently | 43 |
nowadays | 42 |
nonetheless | 42 |
collectively | 42 |
certainly | 41 |
besides | 41 |
cantly | 41 |
economically | 41 |
pdna | 41 |
properly | 41 |
solely | 40 |
presently | 40 |
conversely | 40 |
herein | 39 |
broadly | 39 |
transcriptionally | 38 |
manually | 38 |
freely | 38 |
firstly | 38 |
correctly | 37 |
n't | 37 |
routinely | 37 |
slowly | 37 |
virtually | 36 |
encephalitis | 36 |
altogether | 36 |
quantitatively | 35 |
obviously | 35 |
daily | 35 |
away | 35 |
indirectly | 34 |
somewhat | 33 |
phenotypically | 33 |
strictly | 33 |
totally | 33 |
uniquely | 32 |
thereafter | 32 |
locally | 32 |
histologically | 32 |
close | 32 |
unexpectedly | 31 |
progressively | 31 |
overnight | 31 |
higher | 31 |
gp64 | 31 |
evolutionarily | 31 |
constantly | 30 |
afterwards | 30 |
ubiquitously | 30 |
weakly | 30 |
meanwhile | 29 |
either | 29 |
annually | 29 |
sufficiently | 29 |
intravenously | 28 |
freshly | 28 |
eqtl | 27 |
roughly | 27 |
physiologically | 27 |
fairly | 27 |
comparatively | 27 |
irrespective | 26 |
adequately | 26 |
third | 26 |
really | 26 |
seemingly | 26 |
phylogenetically | 25 |
automatically | 25 |
basically | 24 |
exactly | 24 |
heavily | 24 |
abundantly | 24 |
faster | 24 |
repeatedly | 24 |
ideally | 24 |
moderately | 24 |
strikingly | 24 |
short | 24 |
virally | 23 |
secondly | 23 |
absolutely | 22 |
developmentally | 22 |
dsdna | 22 |
fast | 22 |
inversely | 22 |
lastly | 22 |
late | 22 |
maternally | 22 |
physically | 22 |
regularly | 22 |
truly | 22 |
comprehensively | 21 |
dependently | 21 |
globally | 21 |
inherently | 21 |
intracellularly | 21 |
massively | 21 |
mechanically | 21 |
persistently | 21 |
principally | 21 |
spatially | 21 |
outside | 21 |
terminally | 20 |
safely | 20 |
morphologically | 20 |
drastically | 20 |
abnormally | 20 |
hardly | 19 |
along | 19 |
closer | 19 |
financially | 19 |
reliably | 19 |
intriguingly | 19 |
putatively | 19 |
wide | 19 |
aside | 18 |
intensively | 18 |
retrospectively | 18 |
practically | 18 |
molecularly | 18 |
seriously | 18 |
shortly | 18 |
therapeutically | 18 |
thereof | 18 |
high | 17 |
incompletely | 17 |
historically | 17 |
immunologically | 17 |
systemically | 17 |
lower | 17 |
unusually | 17 |
mildly | 17 |
minimally | 17 |
metabolically | 16 |
versa | 16 |
antigenically | 16 |
distantly | 16 |
intraperitoneally | 16 |
endogenously | 16 |
mutually | 16 |
permanently | 16 |
spectrophotometrically | 16 |
subcutaneously | 16 |
translationally | 16 |
somehow | 15 |
acutely | 15 |
computationally | 15 |
deliberately | 15 |
exponentially | 15 |
pharmacologically | 15 |
environmentally | 15 |
synergistically | 15 |
theoretically | 15 |
unambiguously | 15 |
though | 15 |
formerly | 15 |
temporally | 15 |
technically | 15 |
exceptionally | 14 |
adversely | 14 |
appropriately | 14 |
ca | 14 |
artificially | 14 |
fundamentally | 14 |
gratefully | 14 |
grossly | 14 |
merely | 14 |
preferably | 14 |
fluorescently | 14 |
kindly | 13 |
ciently | 13 |
conditionally | 13 |
deeply | 13 |
dominantly | 13 |
half | 13 |
intrinsically | 13 |
lincrna | 13 |
marginally | 13 |
reasonably | 13 |
reversibly | 13 |
seldom | 13 |
visually | 13 |
profoundly | 13 |
medically | 12 |
barely | 12 |
electrically | 12 |
enzymatically | 12 |
geographically | 12 |
intranasally | 12 |
maybe | 12 |
linearly | 12 |
near | 12 |
nodosa | 12 |
purely | 12 |
reverse | 12 |
sequentially | 12 |
serially | 12 |
universally | 12 |
hopefully | 11 |
ahead | 11 |
cally | 11 |
chronically | 11 |
classically | 11 |
clonally | 11 |
ecologically | 11 |
evenly | 11 |
exogenously | 11 |
surgically | 11 |
invariably | 11 |
noticeably | 11 |
optimally | 11 |
periodically | 11 |
potently | 11 |
reproducibly | 11 |
steadily | 11 |
therein | 11 |
explicitly | 10 |
industrially | 10 |
implicitly | 10 |
formally | 10 |
fine | 10 |
extracellularly | 10 |
interferon | 10 |
densely | 10 |
definitely | 10 |
concomitantly | 10 |
conceptually | 10 |
arguably | 10 |
anywhere | 10 |
intensely | 10 |
continually | 10 |
internationally | 10 |
tentatively | 10 |
irregularly | 10 |
undoubtedly | 10 |
tremendously | 10 |
thoroughly | 10 |
viral | 10 |
uniformly | 10 |
sexually | 10 |
qualitatively | 10 |
pharmaceutically | 10 |
maximally | 10 |
low | 10 |
reportedly | 10 |
concurrently | 9 |
empirically | 9 |
dynamically | 9 |
dose | 9 |
distinctly | 9 |
conventionally | 9 |
biochemically | 9 |
chromosomally | 9 |
centrally | 9 |
behind | 9 |
bacterially | 9 |
fold | 9 |
excessively | 9 |
hereby | 9 |
vastly | 9 |
prominently | 9 |
incorrectly | 9 |
urgently | 9 |
topically | 9 |
specially | 9 |
right | 9 |
slow | 9 |
perfectly | 9 |
officially | 9 |
lncrnas | 9 |
literally | 9 |
internally | 9 |
infrequently | 9 |
doubt | 8 |
horizontally | 8 |
firmly | 8 |
enormously | 8 |
else | 8 |
doubtless | 8 |
intimately | 8 |
diffusely | 8 |
course | 8 |
correspondingly | 8 |
characteristically | 8 |
analogously | 8 |
afterward | 8 |
hyphae | 8 |
notoriously | 8 |
intramuscularly | 8 |
reproductively | 8 |
upwards | 8 |
temporarily | 8 |
sharply | 8 |
rigorously | 8 |
straight | 8 |
proportionally | 8 |
ns3 | 8 |
variably | 8 |
live | 8 |
lately | 8 |
last | 8 |
loosely | 7 |
arbitrarily | 7 |
epigenetically | 7 |
faithfully | 7 |
forth | 7 |
histopathologically | 7 |
immunohistochemically | 7 |
imo | 7 |
ironically | 7 |
onwards | 7 |
prematurely | 7 |
robustly | 7 |
tenfold | 7 |
top | 7 |
topologically | 7 |
und | 7 |
whereas | 7 |
optically | 7 |
foremost | 6 |
imatinib | 6 |
hitherto | 6 |
highest | 6 |
free | 6 |
fourth | 6 |
fortunately | 6 |
chiefly | 6 |
externally | 6 |
etoposide | 6 |
competitively | 6 |
broad | 6 |
anatomically | 6 |
indefinitely | 6 |
immensely | 6 |
modestly | 6 |
inevitably | 6 |
prospectively | 6 |
insofar | 6 |
successively | 6 |
soft | 6 |
slower | 6 |
scientifically | 6 |
strail | 6 |
productively | 6 |
pdcov | 6 |
surely | 6 |
microscopically | 6 |
prenatally | 6 |
intratracheally | 6 |
identically | 5 |
farther | 5 |
finely | 5 |
gently | 5 |
intuitively | 5 |
ill | 5 |
inefficiently | 5 |
irreversibly | 5 |
mechanistically | 5 |
exceedingly | 5 |
falsely | 5 |
cooperatively | 5 |
erv1 | 5 |
dual | 5 |
cytogenetically | 5 |
curiously | 5 |
crucially | 5 |
morbidly | 5 |
causally | 5 |
bilaterally | 5 |
astrocyte | 5 |
aerobically | 5 |
accidentally | 5 |
methodologically | 5 |
hierarchically | 5 |
nally | 5 |
round | 5 |
nasally | 5 |
vertically | 5 |
vegetatively | 5 |
unequivocally | 5 |
twofold | 5 |
synthetically | 5 |
supposedly | 5 |
singly | 5 |
shrna | 5 |
semi | 5 |
thirdly | 5 |
rgs4 | 5 |
paradoxically | 5 |
natively | 5 |
purportedly | 5 |
occupationally | 5 |
oligonucleotide | 5 |
overly | 5 |
passively | 5 |
peripherally | 5 |
predominately | 5 |
ptrail | 5 |
counter | 4 |
epidemiologically | 4 |
cyclophosphamide | 4 |
dsrna | 4 |
ectopically | 4 |
energetically | 4 |
favorably | 4 |
everywhere | 4 |
exhaustively | 4 |
exquisitely | 4 |
extraordinarily | 4 |
genotypically | 4 |
consecutively | 4 |
conveniently | 4 |
abruptly | 4 |
concordantly | 4 |
conclusively | 4 |
conceivably | 4 |
comparably | 4 |
hypothetically | 4 |
coarse | 4 |
catalytically | 4 |
basally | 4 |
autonomously | 4 |
aseptically | 4 |
anymore | 4 |
abroad | 4 |
aberrantly | 4 |
30-fold | 4 |
hereafter | 4 |
commensally | 4 |
intracerebrally | 4 |
radioactively | 4 |
intradermally | 4 |
within | 4 |
triple | 4 |
transgenically | 4 |
statically | 4 |
serologically | 4 |
sensitively | 4 |
ribavirin | 4 |
remotely | 4 |
regionally | 4 |
recurrently | 4 |
recombinantly | 4 |
reciprocally | 4 |
rationally | 4 |
suddenly | 4 |
radically | 4 |
n=18 | 4 |
provisionally | 4 |
inward | 4 |
latter | 4 |
longest | 4 |
macroscopically | 4 |
iteratively | 4 |
neither | 4 |
pathologically | 4 |
popularly | 4 |
nucleotide | 4 |
intrathecally | 4 |
oppositely | 4 |
ifitms | 3 |
flexibly | 3 |
g1f | 3 |
graphically | 3 |
hard | 3 |
endothelial | 3 |
histochemically | 3 |
htert | 3 |
humanely | 3 |
i-3c | 3 |
generically | 3 |
latently | 3 |
incidentally | 3 |
intein | 3 |
intentionally | 3 |
jointly | 3 |
kind | 3 |
laterally | 3 |
left | 3 |
legally | 3 |
lentiviral | 3 |
light | 3 |
electronically | 3 |
encouragingly | 3 |
blindly | 3 |
electrochemically | 3 |
clear | 3 |
a549 | 3 |
admittedly | 3 |
adoptively | 3 |
agriculturally | 3 |
aminoglycoside | 3 |
arnt | 3 |
asymmetrically | 3 |
beneficially | 3 |
biotechnologically | 3 |
little | 3 |
collaboratively | 3 |
dually | 3 |
conspicuously | 3 |
controversially | 3 |
convincingly | 3 |
coordinately | 3 |
custom | 3 |
cystically | 3 |
definitively | 3 |
diagnostically | 3 |
disappointingly | 3 |
disproportionately | 3 |
lincrnas | 3 |
conservatively | 3 |
lq1601 | 3 |
technologically | 3 |
sincerely | 3 |
socially | 3 |
somatically | 3 |
somewhere | 3 |
ssdna | 3 |
sterically | 3 |
strategically | 3 |
succinctly | 3 |
suitably | 3 |
synchronously | 3 |
thermodynamically | 3 |
shortest | 3 |
unacceptably | 3 |
unilaterally | 3 |
unnecessarily | 3 |
v2.0 | 3 |
vely | 3 |
virologically | 3 |
vr-2332 | 3 |
worst | 3 |
wrongly | 3 |
magnetically | 3 |
since | 3 |
synaptically | 3 |
sensibly | 3 |
paclitaxel | 3 |
matter | 3 |
secondarily | 3 |
mbsa | 3 |
meiotically | 3 |
monthly | 3 |
neonatally | 3 |
neurally | 3 |
new | 3 |
numerically | 3 |
orthotopically | 3 |
overtly | 3 |
nucleus | 3 |
paternally | 3 |
predictably | 3 |
satisfactorily | 3 |
regrettably | 3 |
proteolytically | 3 |
promptly | 3 |
retrogradely | 3 |
postnatally | 3 |
post | 3 |
personally | 3 |
lipoplex | 2 |
hormonally | 2 |
home | 2 |
henceforth | 2 |
happily | 2 |
h4r | 2 |
full | 2 |
fruitfully | 2 |
fortuitously | 2 |
fmlp | 2 |
fluorometrically | 2 |
electrostatically | 2 |
factor-2 | 2 |
excellently | 2 |
evolved | 2 |
evidently | 2 |
evectively | 2 |
equivalently | 2 |
eosinophil | 2 |
entfernt | 2 |
enantiomerically | 2 |
eloquently | 2 |
elegantly | 2 |
hydrolytically | 2 |
hot | 2 |
lentivirally | 2 |
hyper | 2 |
hypoxically | 2 |
lethally | 2 |
eif-4a | 2 |
leftward | 2 |
laea | 2 |
irretrievably | 2 |
intraventricularly | 2 |
intravascularly | 2 |
intragastrically | 2 |
intracranially | 2 |
intra | 2 |
interspecifically | 2 |
inside | 2 |
inexpensively | 2 |
inducibly | 2 |
inclusively | 2 |
inadequately | 2 |
improperly | 2 |
impressively | 2 |
immuno | 2 |
imminently | 2 |
ifn-0~ | 2 |
ifi44 | 2 |
höher | 2 |
electrophoretically | 2 |
caudally | 2 |
eg | 2 |
bioinformatically | 2 |
bidirectionally | 2 |
beforehand | 2 |
badly | 2 |
backwards | 2 |
axenically | 2 |
asnps | 2 |
arrhythmias | 2 |
arrestin | 2 |
arl13b | 2 |
arabinose | 2 |
apically | 2 |
anyway | 2 |
anecdotally | 2 |
anaerobically | 2 |
ambiguously | 2 |
alike | 2 |
aldh1a7 | 2 |
aggressively | 2 |
15-fold | 2 |
-ra | 2 |
-protein | 2 |
-hq | 2 |
-2016 | 2 |
biocatalytically | 2 |
biorxiv | 2 |
efficaciously | 2 |
blind | 2 |
easy | 2 |
disulfide | 2 |
distinctively | 2 |
distally | 2 |
directionally | 2 |
digitally | 2 |
descriptively | 2 |
deep | 2 |
dec | 2 |
dead | 2 |
dark | 2 |
contrastingly | 2 |
contrarily | 2 |
congenitally | 2 |
conformationally | 2 |
confidently | 2 |
complex | 2 |
colorimetrically | 2 |
coincidentally | 2 |
circularly | 2 |
cheaply | 2 |
cd3e | 2 |
c3h | 2 |
leukemias | 2 |
fittingly | 2 |
logically | 2 |
synchronically | 2 |
super | 2 |
sucessfully | 2 |
subtly | 2 |
stoichiometrically | 2 |
stepwise | 2 |
sporadically | 2 |
speculatively | 2 |
spectrally | 2 |
sparsely | 2 |
spacially | 2 |
sort | 2 |
sooner | 2 |
sonographically | 2 |
smorf | 2 |
smoothly | 2 |
smallest | 2 |
similarily | 2 |
sept4 | 2 |
semantically | 2 |
sadly | 2 |
rll | 2 |
rigidly | 2 |
rhpbef | 2 |
suprisingly | 2 |
syngeneically | 2 |
repetitively | 2 |
t)(partially | 2 |
longitudinally | 2 |
μl | 2 |
x-100 | 2 |
worse | 2 |
whole | 2 |
weekly | 2 |
vigorously | 2 |
vere | 2 |
utterly | 2 |
upside | 2 |
unstably | 2 |
unquestionably | 2 |
unevenly | 2 |
unequally | 2 |
uncommonly | 2 |
trimeric | 2 |
topographically | 2 |
tnav2c | 2 |
thrombin | 2 |
thermally | 2 |
tgase1 | 2 |
terribly | 2 |
taxonomically | 2 |
reuptake | 2 |
Δp2 | 2 |
repaglinide | 2 |
optionally | 2 |
operatively | 2 |
operationally | 2 |
onward | 2 |
odd | 2 |
obliquely | 2 |
objectively | 2 |
nontheless | 2 |
nominally | 2 |
nm | 2 |
niosomes | 2 |
nanocarrier | 2 |
n=5 | 2 |
mutationally | 2 |
mrnas | 2 |
morever | 2 |
monotherapy | 2 |
minus | 2 |
midway | 2 |
microbiologically | 2 |
mathematically | 2 |
magnetic | 2 |
lowly | 2 |
recursively | 2 |
opposite | 2 |
luciferase | 2 |
outward | 2 |
posttranslationally | 2 |
outwardly | 2 |
reassembly | 2 |
radially | 2 |
quietly | 2 |
publically | 2 |
profile | 2 |
privately | 2 |
predominantely | 2 |
precipitously | 2 |
powerfully | 2 |
recessively | 2 |
posttranscriptionally | 2 |
phewas | 2 |
overboard | 2 |
postsynaptically | 2 |
overseas | 2 |
pal4404 | 2 |
recombinationally | 2 |
phislt | 2 |
plausibly | 2 |
politically | 2 |
pi-103 | 2 |
posteriorly | 2 |
evolutionally | 1 |
fastest | 1 |
faintly | 1 |
facultatively | 1 |
factually | 1 |
f(x | 1 |
eyciently | 1 |
extracorporeally | 1 |
extemporaneously | 1 |
exosome | 1 |
exempli | 1 |
ethically | 1 |
ethnically | 1 |
especifically | 1 |
esp | 1 |
ephrinb2a | 1 |
environmentfriendly | 1 |
ently | 1 |
enta | 1 |
enos | 1 |
endothelialcell | 1 |
fcgammari | 1 |
endoscopically | 1 |
episomally | 1 |
fourthly | 1 |
festgestellt | 1 |
frighteningly | 1 |
geometrically | 1 |
genetlcally | 1 |
generously | 1 |
gene(s | 1 |
gattctctaactgcgcatgcttctgcgcacgcgcaatagacattccaggacttccgggcacttcgtaaggtttaaaaaggatgcttcgcgttttctctctcctttttggagacagattc | 1 |
gata4 | 1 |
gastric | 1 |
g4hunter | 1 |
für | 1 |
futhermore | 1 |
frcm | 1 |
find_enriched_pathway | 1 |
foxq1as | 1 |
formoterol | 1 |
forever | 1 |
focally | 1 |
fmhv | 1 |
flush | 1 |
fluorimetrically | 1 |
fluoreseently | 1 |
fluid | 1 |
flavoprotein | 1 |
endodermally | 1 |
dropwise | 1 |
endocytically | 1 |
disporportionately | 1 |
docilely | 1 |
docetaxel | 1 |
dnase1 | 1 |
dlbcl | 1 |
dk-2200 | 1 |
diversely | 1 |
diverently | 1 |
disulphide | 1 |
disturbingly | 1 |
disproportionally | 1 |
discretely | 1 |
donally | 1 |
discontinuously | 1 |
disadvantageously | 1 |
diregtly | 1 |
diethylaminoethoxyphenyl)-1-phenyl-2-p | 1 |
dietetically | 1 |
diametrically | 1 |
diachronically | 1 |
devastatingly | 1 |
detrimentally | 1 |
gloriously | 1 |
domestically | 1 |
dorsally | 1 |
endlessly | 1 |
educationally | 1 |
emptively | 1 |
electrophysiologically | 1 |
electrolytically | 1 |
elaborately | 1 |
eif4e | 1 |
eif4aiii | 1 |
effortlessly | 1 |
effcctively | 1 |
eetopically | 1 |
eeeently | 1 |
edna | 1 |
doubly | 1 |
ec~ | 1 |
eccentrically | 1 |
eber-1 | 1 |
earliest | 1 |
ealretinin-22k | 1 |
eagerly | 1 |
e234 | 1 |
dutifully | 1 |
duly | 1 |
due | 1 |
geschnitten | 1 |
ifnlr1 | 1 |
glycosidically | 1 |
immunosenescence | 1 |
indelibly | 1 |
incrementally | 1 |
incredibly | 1 |
inasmuch | 1 |
inappropriately | 1 |
inadvertently | 1 |
impractically | 1 |
imperfectly | 1 |
imperceptibly | 1 |
immunotoxic | 1 |
immunochemically | 1 |
indoors | 1 |
immediadiately | 1 |
immature | 1 |
imidazole | 1 |
im | 1 |
il1403 | 1 |
il10rb | 1 |
il-8 | 1 |
il)-8 | 1 |
ihprf1 | 1 |
ighm | 1 |
indistinguishably | 1 |
inductively | 1 |
gondii(me49 | 1 |
intellectually | 1 |
intrathymically | 1 |
intraspecifically | 1 |
intraprostatically | 1 |
intraoperatively | 1 |
intrahepatically | 1 |
intracorporeally | 1 |
intermolecularly | 1 |
interleukin-6 | 1 |
interesiingly | 1 |
interchangeably | 1 |
integrin | 1 |
inevitable | 1 |
instinctively | 1 |
instantly | 1 |
insm1 | 1 |
insert | 1 |
inopportunely | 1 |
innately | 1 |
informationally | 1 |
infinitum | 1 |
infinitely | 1 |
inexplicably | 1 |
ifnwp2 | 1 |
dermally | 1 |
ifnap~ | 1 |
h-2d. | 1 |
hemostatically | 1 |
hemodynamically | 1 |
hemmi | 1 |
helically | 1 |
hcmv | 1 |
hcdna | 1 |
hastily | 1 |
halfmaximally | 1 |
h2r | 1 |
h-2kb | 1 |
h-2-and | 1 |
ifit3 | 1 |
h(x(n(t)))/log | 1 |
göpfert | 1 |
gö | 1 |
gvfld. | 1 |
gtggatacacccgggaggtcactctccccgggctctgtccaagtggcgtaggggagcatagggctctgccccatgatgtacaagtccctttccacaacgttggaaataaagctgggcct | 1 |
gruel | 1 |
gripap1 | 1 |
grb10 | 1 |
gravitationally | 1 |
graciously | 1 |
hepatocyte | 1 |
hereditarily | 1 |
heretofore | 1 |
heritably | 1 |
ifi27 | 1 |
ie1 | 1 |
idealistically | 1 |
hyperalgesia | 1 |
hydrophilic | 1 |
http://metascape.org/gp/index.html#/main/step1 | 1 |
http://exon.niaid.nih | 1 |
htrail | 1 |
hsv1 | 1 |
hsv)-2 | 1 |
hsp90b1 | 1 |
hp1437 | 1 |
hot- | 1 |
homologously | 1 |
homogenously | 1 |
homogeneously | 1 |
hochrepetitiver | 1 |
hly | 1 |
histopatologically | 1 |
hey-1 | 1 |
heuristically | 1 |
desperately | 1 |
cautiously | 1 |
dendritically | 1 |
af203005 | 1 |
alternanthera | 1 |
allosterically | 1 |
allelically | 1 |
algorithmically | 1 |
algally | 1 |
akeady | 1 |
aka | 1 |
ai107792 | 1 |
agronomically | 1 |
afield | 1 |
af203003 | 1 |
although | 1 |
aerugenosa | 1 |
advantageously | 1 |
adroitly | 1 |
adrift | 1 |
adora2b | 1 |
admiringly | 1 |
adenoassputum | 1 |
addtionally | 1 |
additionly | 1 |
adaptively | 1 |
alternately | 1 |
althrough | 1 |
actometer | 1 |
aound | 1 |
arterially | 1 |
arly | 1 |
arerelatively | 1 |
architectonically | 1 |
aptly | 1 |
appreciably | 1 |
apoe- | 1 |
apieally | 1 |
aphidicolin | 1 |
ap-2 | 1 |
antiparallel | 1 |
amazingly | 1 |
antibiotically | 1 |
antibiotic | 1 |
anterogradely | 1 |
anteriorly | 1 |
anomalously | 1 |
angiomatoid | 1 |
anew | 1 |
anciently | 1 |
analytically | 1 |
analgetically | 1 |
adamantly | 1 |
acoustically | 1 |
demonalso | 1 |
-ab | 1 |
-primarily | 1 |
-notably | 1 |
-monoxime | 1 |
-melanocyte | 1 |
-leu47argwere | 1 |
-k27 | 1 |
-intron | 1 |
-clinicaltrials.gov | 1 |
-b13 | 1 |
-also | 1 |
-8,8561 | 1 |
-start | 1 |
-7.1 | 1 |
-2007 | 1 |
-2003 | 1 |
-16,6795 | 1 |
-15 | 1 |
-10-fold | 1 |
-10,9536 | 1 |
-1 | 1 |
-/model | 1 |
--sequence | 1 |
-promoter | 1 |
-synuclein | 1 |
accumbens | 1 |
72∞c. | 1 |
accaugg | 1 |
ac068580 | 1 |
ac- | 1 |
abstractly | 1 |
abrb | 1 |
ably | 1 |
abdominally | 1 |
aac(6 | 1 |
aa)g. | 1 |
a31a3 | 1 |
4-fold | 1 |
-that | 1 |
3.2.7.2 | 1 |
25-fold | 1 |
24/7 | 1 |
20-fold | 1 |
2,2'-dichlorodiethylsulfide | 1 |
//doi | 1 |
-were | 1 |
-untereinheit | 1 |
-typically | 1 |
-tks4-beta | 1 |
asap | 1 |
asdna | 1 |
asic3 | 1 |
clearely | 1 |
concentrationdependently | 1 |
complelely | 1 |
commertially | 1 |
colocalizes | 1 |
colloquially | 1 |
collide | 1 |
clusterprofiler | 1 |
clustalw | 1 |
clockwise | 1 |
cleverly | 1 |
claudin | 1 |
consensuspathdb | 1 |
ckmically | 1 |
cisplatin | 1 |
ciinmonly | 1 |
chst12 | 1 |
chronologically | 1 |
channelalso | 1 |
cdta | 1 |
ccl-185 | 1 |
cbnps | 1 |
cavernosa | 1 |
conically | 1 |
consequentially | 1 |
aslo | 1 |
cytoplasmitally | 1 |
demographically | 1 |
delicately | 1 |
delaga)(partially | 1 |
deg | 1 |
definetly | 1 |
deeper | 1 |
decidedly | 1 |
dearly | 1 |
dbest | 1 |
db)-camp | 1 |
cumulatively | 1 |
constructively | 1 |
culturally | 1 |
cross | 1 |
crisper | 1 |
cotranslationally | 1 |
correctively | 1 |
cord-290861 | 1 |
coolly | 1 |
controversely | 1 |
contradictorily | 1 |
contemporarily | 1 |
caveolin | 1 |
intravesically | 1 |
cardially | 1 |
audio | 1 |
bat26 | 1 |
bap | 1 |
backward | 1 |
axonally | 1 |
axially | 1 |
avidly | 1 |
avenae | 1 |
autosomal | 1 |
aug#3 | 1 |
aufgrund | 1 |
auc24 | 1 |
carboxy | 1 |
attb | 1 |
atropinesterase | 1 |
atractyloside | 1 |
asymptotically | 1 |
asymmetly | 1 |
astray | 1 |
astonishingly | 1 |
associatively | 1 |
associ- | 1 |
assays | 1 |
beneath | 1 |
benzo[a]pyrene | 1 |
beside | 1 |
bet | 1 |
capsid | 1 |
canpletely | 1 |
calmly | 1 |
calcein | 1 |
cacabelos | 1 |
ca2+/calmodulin | 1 |
brucelosa | 1 |
broblast | 1 |
broader | 1 |
breathrough | 1 |
bmpr2 | 1 |
bmdexpress | 1 |
bmal1 | 1 |
blue | 1 |
blaoxa-23-like | 1 |
biosynthetically | 1 |
biopsy | 1 |
biophysically | 1 |
biogeographically | 1 |
bimonthly | 1 |
bidimensionally | 1 |
intratumorally | 1 |
milder | 1 |
intravitreally | 1 |
sh | 1 |
snrnp | 1 |
small | 1 |
sixfold | 1 |
sively | 1 |
site(s | 1 |
singnificantly | 1 |
simplistically | 1 |
signifycantly | 1 |
sig | 1 |
shorter | 1 |
sgsequently | 1 |
solidly | 1 |
sequently | 1 |
sepsc | 1 |
sensationally | 1 |
selfassembly | 1 |
sel-001 | 1 |
securely | 1 |
sectionally | 1 |
secretly | 1 |
schematically | 1 |
scdbs | 1 |
sofar | 1 |
sometime | 1 |
sars)18 | 1 |
stateof | 1 |
swiftly | 1 |
sumably | 1 |
subsequent | 1 |
subjectively | 1 |
subfamily | 1 |
strangely | 1 |
stereoselectively | 1 |
steeply | 1 |
statictically | 1 |
stateside | 1 |
stat5 | 1 |
sonochemically | 1 |
standardly | 1 |
sporadicly | 1 |
spirally | 1 |
spermatozoa | 1 |
spefically | 1 |
spectroscopically | 1 |
spectrofluorometrically | 1 |
speciflcally | 1 |
south | 1 |
sorbinil | 1 |
scarcely | 1 |
sagitally | 1 |
pseudoviewer3 | 1 |
real | 1 |
rep52d. | 1 |
remel1 | 1 |
remain | 1 |
relevantly | 1 |
reflexively | 1 |
redundantly | 1 |
redrawn | 1 |
rectally | 1 |
reassuringly | 1 |
realistically | 1 |
rd114-tr | 1 |
replicatively | 1 |
rarer | 1 |
rapid | 1 |
random | 1 |
radiologically | 1 |
radiographically | 1 |
rab3a | 1 |
rab27a | 1 |
rab11-family | 1 |
quantjtatively | 1 |
qpcr | 1 |
reperto4!6~.~espectively | 1 |
reprotypically | 1 |
s1p. | 1 |
robotically | 1 |
s1b | 1 |
s11596 | 1 |
rtks)that | 1 |
rtgevsptv | 1 |
rs59647857 | 1 |
rs5534 | 1 |
rs12490863 | 1 |
rs1037699 | 1 |
rrcently | 1 |
rounder | 1 |
ro-318220 | 1 |
resolutely | 1 |
rnf17 | 1 |
rnaseiii | 1 |
rn_celera | 1 |
rmly | 1 |
rightward | 1 |
ribosomally | 1 |
rhoxf2a | 1 |
reversely | 1 |
retrovirally | 1 |
retrotranspositionally | 1 |
symbiotically | 1 |
symptomatically | 1 |
syndactyly | 1 |
usefully | 1 |
ventrally | 1 |
vehemently | 1 |
vascular | 1 |
varyingly | 1 |
vanishingly | 1 |
valproate | 1 |
validly | 1 |
vac14 | 1 |
v8.1.12 | 1 |
v2r | 1 |
upward | 1 |
vice | 1 |
upper | 1 |
uporfs | 1 |
uporf | 1 |
upf3p | 1 |
untypically | 1 |
unsuccessfully | 1 |
unsually | 1 |
universit4gen | 1 |
unitarily | 1 |
uninterruptedly | 1 |
verglichen | 1 |
visibly | 1 |
synergically | 1 |
xenochemical | 1 |
l | 1 |
∆snf1 | 1 |
über | 1 |
àvis | 1 |
z−score | 1 |
zygotically | 1 |
ymrna | 1 |
yellowish | 1 |
yearly | 1 |
xp_032806557.1 | 1 |
worryingly | 1 |
vitally | 1 |
worlwide | 1 |
woefully | 1 |
wisely | 1 |
wise | 1 |
wider | 1 |
wholly | 1 |
wholeheartedly | 1 |
whereupon | 1 |
whatsoever | 1 |
voluntarily | 1 |
unintentionally | 1 |
unidirectionally | 1 |
uneventfully | 1 |
thankfully | 1 |
thy-1 | 1 |
throughout | 1 |
thinly | 1 |
thically | 1 |
thermochemically | 1 |
thereupon | 1 |
therapeutic | 1 |
thence | 1 |
thematically | 1 |
thapsigargin | 1 |
tex15 | 1 |
unduly | 1 |
territorially | 1 |
ten | 1 |
tellingly | 1 |
teleologically | 1 |
tbhq | 1 |
targettb | 1 |
t98g | 1 |
t188a | 1 |
syn~ | 1 |
syntenically | 1 |
tially | 1 |
tically | 1 |
tight | 1 |
timely | 1 |
underway | 1 |
understoodwere | 1 |
understandably | 1 |
unconditionally | 1 |
unanimously | 1 |
umvi0veu | 1 |
ultrastructurally | 1 |
uenza | 1 |
ubiquitination | 1 |
ubc | 1 |
type-4b | 1 |
twentyfold | 1 |
tube2 | 1 |
triply | 1 |
translocationally | 1 |
transcriptase | 1 |
toxicologically | 1 |
totalis | 1 |
topoisomerase | 1 |
tnf-(z | 1 |
tmc1-tmc8 | 1 |
punctually | 1 |
proximately | 1 |
intricately | 1 |
n=26 | 1 |
nebulisa | 1 |
neatly | 1 |
naturallythat | 1 |
nationally | 1 |
narrowly | 1 |
nanotechnologically | 1 |
nanoshell | 1 |
nanocomplex | 1 |
nalidixic | 1 |
naively | 1 |
n=10 | 1 |
neugoto | 1 |
n174q | 1 |
myf3 | 1 |
multidirectionally | 1 |
mucosally | 1 |
morally | 1 |
modularly | 1 |
modifi | 1 |
mock | 1 |
mnccanitantly | 1 |
mmachine | 1 |
nenrotrophtc | 1 |
neuroanatomically | 1 |
mitogenically | 1 |
noncovalentwere | 1 |
npy6r | 1 |
novozym | 1 |
northeast | 1 |
nonterminally | 1 |
nonspecifically | 1 |
nonsignificantly | 1 |
nonsalt | 1 |
nonrandomly | 1 |
nonneuronally | 1 |
nonlethally | 1 |
nomally | 1 |
neuroectodermally | 1 |
nocturnally | 1 |
nivalenol | 1 |
nitroprusside | 1 |
nitroaryl | 1 |
nicely | 1 |
nhp2 | 1 |
nfib | 1 |
newer | 1 |
neutrally | 1 |
neuronally | 1 |
mlly | 1 |
microrna-199a | 1 |
proximally | 1 |
jokingly | 1 |
lengthwise | 1 |
length | 1 |
legitimately | 1 |
lazetidine-2-carboxylic | 1 |
laparoscopy | 1 |
l44rupmi | 1 |
könnten | 1 |
klrc1 | 1 |
klrb1 | 1 |
kin- | 1 |
jca-154 | 1 |
leucovorin | 1 |
iv.group | 1 |
itraq | 1 |
isotopically | 1 |
irmaediately | 1 |
iq5 | 1 |
iontophorefically | 1 |
ionophore | 1 |
inİzmir | 1 |
inwardly | 1 |
intronsearly | 1 |
lesser | 1 |
lf~ | 1 |
microcarrier | 1 |
maximal | 1 |
microbially | 1 |
mg | 1 |
meticulously | 1 |
metazoa | 1 |
metamerically | 1 |
metallothionein | 1 |
mentally | 1 |
meehanleally | 1 |
median | 1 |
meaningfully | 1 |
malignant | 1 |
lilrb1 | 1 |
majorly | 1 |
m19 | 1 |
lumenally | 1 |
lowest | 1 |
localizes | 1 |
lmra | 1 |
lmna''dramatically | 1 |
lly | 1 |
lix1 | 1 |
lilrb2-like | 1 |
nrd2742 | 1 |
nsrp1 | 1 |
numbingly | 1 |
pinocytotically | 1 |
polysome | 1 |
polyprotein | 1 |
polygenic | 1 |
polyclonally | 1 |
polarographically | 1 |
plus | 1 |
plin2 | 1 |
plain | 1 |
pivotally | 1 |
pirinixic | 1 |
pictorially | 1 |
positionally | 1 |
pi3k)/akt | 1 |
photolithographically | 1 |
phosphatidylinositol | 1 |
phonologically | 1 |
pharmacogenetically | 1 |
pgpa | 1 |
pfkfb3 | 1 |
pfam | 1 |
persuasively | 1 |
perorally | 1 |
poorer | 1 |
possibily | 1 |
nutritionally | 1 |
probabilisticallythat | 1 |
propyl- | 1 |
proportionately | 1 |
promiscuously | 1 |
prokaryotically | 1 |
prohibitively | 1 |
prognostically | 1 |
profusely | 1 |
professionally | 1 |
prodom | 1 |
problably | 1 |
prevalently | 1 |
potent | 1 |
pretty | 1 |
premature | 1 |
preliminarily | 1 |
preferrably | 1 |
preferenhally | 1 |
predictively | 1 |
ppp2r1b | 1 |
ppp2r1a | 1 |
ppp(a2'p)na | 1 |
potentiometrically | 1 |
perinuclearly | 1 |
percutaneously | 1 |
per | 1 |
ol | 1 |
outdoors | 1 |
ously | 1 |
ostensibly | 1 |
oronasally | 1 |
orm1-like | 1 |
orfs | 1 |
optoelectronically | 1 |
optimistically | 1 |
ontogenetically | 1 |
ongoingly | 1 |
ohra::tn | 1 |
pentaxin | 1 |
ohra | 1 |
oftentimes | 1 |
oflrf-1 | 1 |
oflfn | 1 |
offline | 1 |
of-120 | 1 |
octoni | 1 |
obligately | 1 |
n~'tinnally | 1 |
nz3/02909 | 1 |
outright | 1 |
ovalbumin | 1 |
overgrowth''-abnormally | 1 |
overwhelmingly | 1 |
pedicel | 1 |
pcambia | 1 |
pbm19 | 1 |
pathw~ | 1 |
pathway(s | 1 |
pathophysiologically | 1 |
parthenogenetically | 1 |
parenthetically | 1 |
parenterally | 1 |
parc | 1 |
parallel | 1 |
paradoxally | 1 |
paracetamol | 1 |
painfully | 1 |
p=0.016 | 1 |
p67phox | 1 |
p-09.03.3 | 1 |
p-04.03.3 | 1 |
oxidatively | 1 |
owever | 1 |
oviral | 1 |
-(kallikrein | 1 |