verb

This is a table of type verb and their frequencies. Use it to search & browse the list to learn more about your study carrel.

verb	frequency
used	2497
infect	2131
shows	1887
induced	1398
contained	1275
suggest	1105
binding	911
includes	861
following	845
detected	841
observed	833
indicate	826
occurs	781
found	769
determined	759
demonstrated	750
described	731
associated	726
cause	718
expressed	712
mediated	694
resulted	652
requires	637
increased	617
involved	577
appears	576
produced	563
identified	546
see	536
encodes	531
compared	504
provided	491
revealing	463
develop	459
known	437
performed	427
report	419
obtained	412
isolated	409
reduced	408
derived	405
forming	393
affects	389
generated	386
inhibited	367
incubated	363
treating	352
related	349
remain	346
based	344
studied	324
represents	321
led	304
examined	303
inoculated	302
strain	298
tested	288
supported	283
conserved	281
confirmed	266
purified	265
play	264
targeted	263
considered	258
analyzed	252
predict	249
regulating	242
allowing	241
characterized	241
linked	240
exhibited	239
added	238
made	236
labeled	235
depending	233
enhanced	232
contributes	226
establish	224
activated	220
replicated	219
grew	215
washed	214
maintain	214
staining	211
neutralizing	209
became	208
lacking	202
altering	202
spreads	198
corresponding	197
give	195
demyelinating	193
taken	192
processed	192
measured	192
interfering	191
acts	189
prevents	187
consisted	184
correlates	183
decreasing	183
synthesized	180
located	179
removed	178
selected	177
differ	177
controls	173
cleaves	172
interact	171
presented	170
collected	169
protecting	169
investigated	169
recognized	165
directed	164
noted	163
understand	162
fixed	161
stranded	159
served	158
seemed	158
carried	158
proposed	155
translated	153
triggered	151
defined	151
blocking	150
prepared	148
vary	143
limited	141
localized	140
transfected	138
stimulate	135
modified	134
according	134
persisted	133
reflected	131
promote	131
harvested	131
budding	131
map	130
assessed	126
calculated	125
displayed	122
exposed	121
expected	121
thought	119
extended	119
survived	118
functions	118
released	117
cloned	117
restricted	116
influenced	115
reached	114
suckling	112
comprise	112
designated	111
transcribed	110
evaluated	110
replace	109
existed	109
recovered	108
read	108
signaling	107
supplemented	107
shared	106
eliminate	106
separated	105
explain	104
yielded	103
introduced	103
delay	103
initiates	101
spanning	100
facilitate	99
modulate	99
utilized	99
sequenced	99
incorporated	98
continued	98
accumulate	97
sheds	96
retains	96
died	96
range	95
diluted	95
transferred	94
needs	94
visualize	94
transmitted	93
reacted	93
begins	92
underwent	90
called	90
enveloped	89
elevated	89
receive	89
employed	88
differentiates	88
confer	88
suppressing	87
failed	87
create	87
enter	86
coded	86
assayed	86
acquired	85
inactivated	85
subjected	84
applied	84
accompanied	84
resembles	83
emerged	83
refer	81
reviewed	80
injected	80
evolve	79
amplified	79
publish	79
thank	78
secreted	78
elicit	78
cleared	78
migrate	77
extracted	76
assembles	76
overlapping	74
belongs	74
combines	73
discussed	73
regards	73
propagates	72
pausing	72
abolishes	72
starting	70
participate	70
contaminated	70
disrupted	69
achieved	68
cultured	68
precipitate	68
monitor	67
frameshifting	67
constructed	67
bred	67
transported	64
repeated	64
infiltrating	64
embedded	64
address	63
mouse	62
resuspended	61
excluded	60
disseminated	60
adapted	60
implicated	59
borne	59
changed	58
engineered	57
accounted	57
concluded	57
attributed	57
killed	57
tends	57
buffered	57
packaged	57
lysed	56
illustrate	56
estimating	56
conjugated	56
arose	56
reversed	56
fuse	55
exerts	55
possessed	54
drives	53
surrounding	53
impaired	53
summarize	52
proven	52
passaged	52
explored	52
distinguish	52
elucidated	51
avoid	51
crossing	51
mock	51
immunoprecipitated	51
placed	51
radiolabeled	50
counted	50
comes	50
centrifuged	50
work	49
mention	49
leaving	49
fold	49
documented	49
believed	49
attenuated	49
named	48
divided	48
highlights	48
assumed	48
resolved	48
transformed	48
weanling	48
condensed	47
charged	47
enabled	47
designed	47
focus	47
originated	46
mounted	46
composed	46
clarify	46
termed	45
restored	45
quantified	45
mixed	45
hypothesized	45
distributed	45
a59-infected	45
converted	44
complement	44
set	43
capped	43
underlying	43
tolerated	42
shaped	42
rescue	41
paired	41
deleted	41
conducted	41
analysed	40
stored	40
purchased	39
marked	39
lost	39
inserted	38
anchored	38
digested	38
dried	38
flanked	38
verify	38
live	38
primed	38
probed	38
recruit	38
screen	38
helped	37
normalized	37
listed	37
shifted	37
peaked	37
sacrificed	37
raise	36
frozen	36
expanded	36
covering	36
chose	36
transplanted	35
imply	35
glycosylated	35
ensured	35
overlaying	34
assigned	34
classified	34
fall	34
necrotizing	34
wasting	34
permitted	34
ruled	34
stabilizing	34
terminated	34
connected	33
co	33
rely	33
diminished	33
immunized	33
destroyed	32
colonized	32
cut	32
accelerated	32
improves	32
preceded	32
responded	32
upregulates	32
resides	31
irradiated	31
coupled	31
concerning	31
complete	31
attached	31
approved	31
attempts	30
accomplished	30
constitute	30
mutating	30
harboring	30
discovered	30
speculated	29
specified	29
nondenaturing	29
kept	29
gains	29
fed	29
encountered	29
circulating	29
mimicking	28
depicting	28
interferon	28
mean	28
declined	28
pelleted	28
programmed	28
progressed	28
postulated	28
switch	28
enriched	27
coexpressed	27
depleted	27
posing	27
housed	27
infer	27
seeding	27
sustaining	26
rendered	26
presumed	26
plated	26
overcome	26
modeling	26
lies	26
filled	26
excreted	26
dissociated	26
challenged	26
weaning	26
diverged	25
engaged	25
coating	25
emphasizes	25
matched	25
exacerbated	25
hybridized	25
hemagglutinating	25
exchanged	24
administered	24
arguing	24
attracted	24
complicating	24
concentrate	24
counteracting	24
homogenized	24
nested	24
passed	24
scored	24
sort	24
suspended	24
pooled	23
diagnosed	23
impact	23
missing	23
attained	23
preserves	23
substituting	23
trace	23
proteins	23
host	22
approached	22
chased	22
desired	22
exceeded	22
heating	22
embryonated	22
ifns	22
imaging	22
manifest	22
prolonged	22
quantitated	22
sought	22
assisted	21
integrated	21
coincided	21
competed	21
contrasts	21
coordinating	21
damaged	21
dissolved	21
evade	21
held	21
solved	21
moving	21
permeabilized	21
numbering	21
ribosylated	21
precluded	21
stopped	21
outlined	21
opposed	21
offered	21
parallels	20
bringing	20
checking	20
deposited	20
destined	20
dissected	20
drawn	20
encompassing	20
recommended	20
phosphorylating	20
reconstructed	20
rinsed	20
run	20
stem	20
titered	20
viewed	20
accommodate	19
evidenced	19
deduced	19
degraded	19
enlarged	19
aligned	19
favors	19
interpreted	19
ligated	19
post	19
supplied	19
immunostained	19
detailed	18
accept	18
aged	18
anticipated	18
draining	18
multiplied	18
provoked	18
recorded	18
linearized	17
acknowledged	17
ameliorated	17
eluted	17
grouped	17
inherited	17
invading	17
lasts	17
compromise	17
nsp1	17
occupied	17
organized	17
potentiating	17
prefers	17
scattered	17
unwinding	17
titrated	17
underlined	17
denoting	16
disappeared	16
ending	16
exploit	16
filtered	16
goes	16
loaded	16
manipulated	16
methylate	16
minimize	16
point	16
pretreated	16
rose	16
suffering	16
validated	16
mhv-3-induced	16
downregulated	15
exemplified	15
electrophoresed	15
elaborated	15
adsorbing	15
corrected	15
compensated	15
alleviates	15
nondemyelinating	15
lined	15
underscores	15
operate	15
remyelinate	15
optimized	15
suspect	15
succumbed	15
turned	15
refine	15
pronounced	15
positions	15
perfused	15
aimed	14
annotated	14
averaging	14
cells	14
corroborates	14
culling	14
discriminate	14
electroporated	14
escape	14
euthanized	14
immunoblotted	14
learned	14
packed	14
reconstituted	14
reproduced	14
runted	14
sectioned	14
stacking	14
lanes	14
augment	13
clustered	13
catalyze	13
behave	13
abrogated	13
aiding	13
aggregated	13
counter	13
committed	13
striking	13
delineate	13
hunched	13
matured	13
reactivated	13
resist	13
scanned	13
traffic	13
dropped	13
bulged	12
dictated	12
dehydrated	12
confined	12
colored	12
buried	12
agarose	12
builds	12
boiled	12
arranged	12
govern	12
adjusted	12
ing	12
denaturing	12
knocked	12
rearranging	12
unravels	12
looking	12
truncated	12
subcloned	12
revised	12
recurring	12
revert	12
proofreading	12
proceed	12
phased	12
omitted	12
met	12
counterstained	11
experienced	11
excised	11
eradicated	11
distended	11
declare	11
adopt	11
communicating	11
colocalize	11
coli	11
blotting	11
ascribed	11
fits	11
featuring	11
stand	11
hampered	11
searching	11
informed	11
uncovering	11
trypsinized	11
trimmed	11
specifi	11
tempting	11
scraped	11
returns	11
prompted	11
projected	11
perpetuating	11
liberates	11
diffusing	10
hinder	10
guided	10
get	10
fecting	10
encapsidated	10
discarded	10
judged	10
delivered	10
capture	10
backcrossed	10
appreciate	10
annealed	10
anesthetized	10
insolubilized	10
tagged	10
like	10
relapsing	10
log	10
undertaken	10
wrote	10
spun	10
segregating	10
resumed	10
translocate	10
recombined	10
protruding	10
profiling	10
plotted	10
molecules	10
pull	10
coprecipitated	9
harbour	9
evoked	9
duplicated	9
copied	9
coiled	9
consuming	9
coinfected	9
autoclaved	9
mhv-3-infected	9
manage	9
interspersed	9
mitigates	9
putting	9
weighed	9
thawed	9
sedimented	9
scaling	9
shake	9
proliferating	9
prevail	9
picked	9
offset	9
dispersed	8
hydrolyze	8
glycoproteins	8
fractionated	8
expression	8
ensue	8
effected	8
dominated	8
automated	8
coronaviruses	8
cooling	8
computing	8
complexed	8
awaits	8
immunolabelling	8
arrested	8
antigens	8
immobilized	8
ascertain	8
imported	8
said	8
interrupt	8
supershifted	8
suffices	8
traverses	8
submitted	8
spliced	8
solubilizing	8
split	8
reasoned	8
polyadenylated	8
mating	8
masks	8
join	8
jhm)-induced	8
predispose	8
intervening	8
humidified	7
enclosed	7
favours	7
fi	7
jumped	7
immunolabeling	7
inhabits	7
dismissed	7
elongating	7
agree	7
detached	7
deserves	7
cited	7
breaking	7
aspirating	7
asked	7
ascending	7
lay	7
adhered	7
lactate	7
impedes	7
multinucleated	7
stressed	7
opens	7
weakening	7
warmed	7
ventilated	7
travel	7
trapping	7
supposed	7
subtracted	7
substantiate	7
typified	7
stated	7
shorten	7
sequestered	7
scribed	7
sampled	7
represses	7
prestimulated	7
soiled	7
pre	7
kinase	6
graded	6
immunoprecipitation	6
inbred	6
infested	6
internalize	6
necessitating	6
mhv-4-infected	6
narrow	6
nonenveloped	6
nursed	6
focussed	6
goto	6
alternating	6
emulsified	6
dysregulated	6
cx43	6
contradicts	6
contracted	6
confound	6
circumvent	6
ceased	6
bled	6
advance	6
accesses	6
ordered	6
orchestrating	6
glutaraldehyde	6
overexpressed	6
simplify	6
partitioned	6
warranted	6
wanes	6
vacuolated	6
vaccinated	6
update	6
unliganded	6
tained	6
summed	6
struggle	6
standardized	6
slowed	6
waddling	6
wish	6
quarantine	6
seroconverted	6
penetrated	6
pinches	6
predominated	6
perturb	6
questioned	6
receptordestroying	6
reinforce	6
sense	6
seroconvert	6
dealing	5
decided	5
decoded	5
degenerating	5
descended	5
dialyzed	5
distilled	5
divert	5
eat	5
edited	5
fragmented	5
exported	5
flatten	5
flow	5
force	5
haemagglutinating	5
halt	5
hijack	5
hope	5
hospitalized	5
cooperates	5
crosslinking	5
bypass	5
confuses	5
conditioned	5
abbreviated	5
afforded	5
anaesthetized	5
answered	5
antagonizing	5
appended	5
approximated	5
balanced	5
bedding	5
bridging	5
implanting	5
caught	5
cellmediated	5
chronic	5
circling	5
cisacting	5
closed	5
coeruleus	5
combat	5
compounding	5
conceived	5
ignored	5
emitted	5
injured	5
requests	5
resting	5
ruffled	5
sensitized	5
shut	5
shuttling	5
sit	5
slides	5
strengthened	5
stripping	5
supernatant	5
templated	5
tethering	5
transition	5
triturated	5
try	5
types	5
virusinduced	5
wanted	5
wt	5
®	5
innate	5
residues	5
subdivided	5
renewed	5
oligodendrocyte	5
regenerating	5
liver	5
lo6	5
lowered	5
melting	5
mhvinduced	5
minced	5
misfolding	5
nonsegmented	5
noticed	5
intensifying	5
oriented	5
pulsing	5
rederive	5
redefine	5
ranked	5
regained	5
pressed	5
postfixed	5
overlying	5
expedited	4
happening	4
fasted	4
mirror	4
floxed	4
fulfil	4
gated	4
genes	4
generalized	4
grant	4
handled	4
ingest	4
hatched	4
imposed	4
impregnated	4
influenza	4
equal	4
intertwined	4
matter	4
maximized	4
merged	4
metastasize	4
mhv-4-induced	4
equipped	4
asserted	4
enumerated	4
culminating	4
agglutinate	4
astrocytes	4
attack	4
chattering	4
chilled	4
coassembled	4
constrains	4
construed	4
contacts	4
copurified	4
cx43-mediated	4
encouraged	4
dampen	4
dedicated	4
defi	4
dehydrogenaseelevating	4
destabilize	4
discerned	4
disinfected	4
distorting	4
emulated	4
encircled	4
mhvinfected	4
ferments	4
mockinfected	4
sterilized	4
securing	4
selflimiting	4
sold	4
shielded	4
shipped	4
silenced	4
situated	4
snap	4
stalled	4
staying	4
sucking	4
rotated	4
synchronized	4
synthesised	4
tailoring	4
tell	4
threatening	4
times	4
uncoiled	4
viruses	4
virusinfected	4
mrnas	4
scaffolding	4
track	4
rocking	4
pinpointed	4
retrieved	4
myelinated	4
necropsied	4
neutralising	4
novo	4
nsp3	4
nsp4	4
obligates	4
owing	4
photographed	4
neuroattenuated	4
proc	4
reinitiate	4
quasispecies	4
replenishing	4
reserved	4
remembered	4
repair	4
rehydrated	4
recapitulated	4
reassorted	4
realized	4
extrapolate	3
extinguished	3
exsanguinated	3
executed	3
escalating	3
equilibrated	3
envision	3
engulfed	3
emanate	3
displaced	3
drink	3
downstream	3
double	3
disturb	3
dicted	3
diabetes	3
devise	3
film	3
deubiquitinating	3
fertilized	3
hydrate	3
flash	3
floating	3
deparaffinized	3
insuring	3
instructed	3
inspired	3
incurred	3
incriminate	3
inbreeding	3
imparting	3
immune	3
immortalized	3
hide	3
heralded	3
heals	3
h-2-inducing	3
genome	3
gauging	3
fueled	3
fosters	3
fluctuate	3
desquamated	3
burgeoned	3
demarcated	3
cascade	3
boxed	3
bounded	3
boosted	3
blurred	3
bite	3
benefit	3
bend	3
autoradiographed	3
art20	3
aliquoted	3
aggravate	3
adpribosylated	3
admitted	3
administrated	3
acute	3
absorbed	3
ablated	3
5v	3
-infected	3
intercrossing	3
categorize	3
deisgylating	3
cautioned	3
deciphering	3
dashed	3
cycling	3
curves	3
cultivated	3
counterbalanced	3
cost	3
coronavirusderived	3
conveyed	3
conforming	3
conflicting	3
compiled	3
compelled	3
comigrating	3
coinfect	3
coimmunoprecipitated	3
coalesced	3
ceacam1a	3
cdna	3
intended	3
discharged	3
jhminfected	3
sloughed	3
skimmed	3
shunted	3
shaded	3
sev	3
saved	3
saturated	3
sanitized	3
rolling	3
rmed	3
revisited	3
restrained	3
repurified	3
repositioning	3
renamed	3
remodels	3
remitting	3
relocated	3
reiterated	3
refute	3
slipped	3
spaced	3
rebind	3
speaking	3
justify	3
×g	3
witness	3
withdrawn	3
wet	3
virusencoded	3
vimentin	3
vated	3
unmethylated	3
uncoating	3
uenced	3
tissue	3
tied	3
tailing	3
succeeds	3
subsided	3
stirred	3
spotted	3
speciated	3
reemerges	3
thymectomized	3
reassociate	3
perfringens	3
pared	3
oligomerizes	3
neoformans	3
neighboring	3
motivate	3
monocytes	3
mocktreated	3
mismatched	3
minute	3
mined	3
membranespanning	3
matted	3
lymphocytes	3
log2-normalized	3
lend	3
layered	3
launching	3
rationalizing	3
juxtaposed	3
paving	3
membrane	3
phagocytosing	3
prefixed	3
radiating	3
rated	3
phosphoimaging	3
rabbit	3
queried	3
quenched	3
prohibit	3
progeny	3
pretreat	3
prototyped	3
preexisting	3
polarize	3
portrayed	3
plaqued	3
ported	3
polymeraseencoding	3
poly(a)-containing	3
plucking	3
practicing	3
enzootic	2
exercises	2
exfoliated	2
exit	2
explanted	2
firmed	2
felt	2
fied	2
fluorographed	2
flushed	2
engnet	2
fulfills	2
fortified	2
envisaged	2
eases	2
endowed	2
endogenize	2
embellished	2
embark	2
egfpexpressing	2
effector	2
effacing	2
edged	2
doublestranded	2
dose	2
dons	2
disputed	2
dispose	2
fumigated	2
disintegrate	2
fulminating	2
inverted	2
funding	2
geared	2
disassembled	2
magnified	2
macrophagemediated	2
mabas	2
lodged	2
lieve	2
letting	2
leaks	2
lated	2
lagged	2
invoked	2
insulating	2
instigated	2
inflicted	2
immunophenotyped	2
immunised	2
ifninduced	2
identifi	2
humanized	2
homing	2
hepatocytes	2
hepaticusinfected	2
helicase	2
hd1	2
hanging	2
guarding	2
guaranteed	2
glutinating	2
genera	2
disclose	2
bordered	2
dipping	2
dine	2
cerevisiae	2
cc10-treated	2
catalysed	2
cating	2
capsids	2
candled	2
caging	2
burrowing	2
burnt	2
broadens	2
bonded	2
biotinylated	2
basepairing	2
banded	2
baked	2
authenticated	2
antigenpresenting	2
ankylosed	2
alerting	2
agitated	2
agerelated	2
admixed	2
acylated	2
acetylated	2
acclimated	2
=	2
-resulted	2
-c	2
-/-(p	2
chemotactic	2
cholesterolcontaining	2
cleaned	2
crossreact	2
dimerizes	2
diffracts	2
deter	2
dephosphorylates	2
deemed	2
decumulated	2
decay	2
debated	2
cytolytic	2
meningoencephalitis	2
cured	2
cupped	2
cultureadapted	2
cross	2
clotting	2
crawl	2
cov-2-infected	2
cotransfected	2
copurify	2
coping	2
contemplating	2
congregate	2
confluence	2
concurring	2
commences	2
coexist	2
coevolved	2
coagulating	2
marylated	2
singlestranded	2
metabolizing	2
swell	2
superinfected	2
superimposed	2
sulfated	2
subset	2
studded	2
strated	2
stolen	2
stat1	2
starved	2
spits	2
speeded	2
species	2
spared	2
sonicated	2
solublized	2
soars	2
soaked	2
sliced	2
skin	2
signifying	2
shrunken	2
sheep	2
sheared	2
shames	2
sgrna	2
sensitised	2
sent	2
sealed	2
scavenge	2
swapping	2
tempering	2
scab	2
terized	2
mhv-3-related	2
™	2
α	2
x-114	2
x-100	2
wound	2
whelp	2
wall	2
walked	2
vtft-3-infected	2
virusrelated	2
vaporized	2
upstream	2
unrecycled	2
unmasked	2
uniting	2
unfolded	2
underestimated	2
ulcerate	2
ube2w	2
ts	2
transfect	2
transduced	2
trans	2
tralizing	2
training	2
totaling	2
ticks	2
thrive	2
scarring	2
t7-generated	2
rsa59	2
plateaued	2
plan	2
pioneered	2
pertain	2
permeablized	2
pathway	2
pathogenesis	2
paste	2
p250	2
oxidized	2
opts	2
oftgev	2
ofmacrophages	2
occluded	2
oc43-mediated	2
obstructed	2
nucleotidylating	2
nsp13-associated	2
nontranslated	2
nonglycosylated	2
nding	2
muted	2
mutagenized	2
murinized	2
multiplexed	2
mpv-2	2
mobilizing	2
minimise	2
righting	2
microsequencing	2
plasmid	2
offspring	2
rejoin	2
recognised	2
ribosomes	2
revolutionize	2
plished	2
retired	2
reticulumderived	2
resorted	2
research	2
reordered	2
remind	2
reject	2
register	2
refolding	2
reduction	2
reconciled	2
redirecting	2
reclassified	2
radiosequencing	2
pol1a	2
preincubated	2
prescribed	2
primerextended	2
procured	2
puzzling	2
proteinases	2
reappear	2
rear	2
recede	2
rechallenged	2
foraging	1
fluoresces	1
fluorescence	1
fluids	1
fluorography	1
fmhv.v2	1
follo	1
fades	1
foregoing	1
fosternursed	1
foxp3	1
fractioned	1
fragreported	1
flected	1
frameshift	1
flooded	1
fatal	1
flatembedded	1
flagellates	1
fissions	1
fight	1
fibrosarcoma	1
fibroblasts	1
fgf-2-treated	1
fetus	1
ferrocyanide	1
fered	1
fects	1
fcgr3b.	1
fam)-labeled	1
furnishes	1
freed	1
hardto	1
fusion‐enhancing	1
grouped	1
glyeosylated	1
glyoxalated	1
gm31698	1
grasp	1
grazing	1
groomed	1
gut	1
fusl	1
h&estaining	1
h277ainfected	1
h2h4-igh6	1
hd1-derived	1
heaped	1
facing	1
glycopeptides	1
glycolysated	1
glow	1
ggtgaaggggtg-3	1
gggcgaattcgccaccatgagtggtatagtgaagat	1
gesting	1
germinate	1
genotyped	1
genetic	1
gci	1
gccaugg	1
gasping	1
garnered	1
gamma	1
galvanizing	1
galactosified	1
galactosebinding	1
fad4f28e9ed4392900febb77e26ab54c5435a5fb	1
disabling	1
exude	1
duces	1
doubt	1
dramatized	1
drift	1
dripped	1
drugbased	1
dsrna	1
duplicons	1
extruded	1
dwarfed	1
dye	1
earlyinduced	1
ecotypes	1
ected	1
elected	1
doubleimmunolabeling	1
doubleanchored	1
donates	1
dolinearized	1
docking	1
dntp	1
disregarded	1
disprove	1
disorganizes	1
dislodge	1
discounted	1
discontinued	1
disassociated	1
helix	1
dis	1
dipeptides	1
dimodified	1
electroblotted	1
electrobtotted	1
electrotransferred	1
ertargeting	1
exthis	1
exsanguated	1
experiment	1
expend	1
excited	1
excepting	1
examinod	1
euthanatized	1
etching	1
estilflating	1
esterified	1
esting	1
essing	1
erupt	1
eroded	1
eleetrophoresed	1
equated	1
ependyma	1
enzymes	1
enucleated	1
entwines	1
enterotropic	1
entangled	1
entails	1
endangered	1
encephalomyocarditis	1
encase	1
encapsulated	1
en	1
eluded	1
heightened	1
intracellufar	1
hemisected	1
lected	1
la6-infected	1
labeied	1
labored	1
laboratory	1
lavage	1
leap	1
lengthen	1
hentac	1
leptomeninges	1
leukemiainducing	1
leveraging	1
lifting	1
linear	1
linearbetween	1
l2-infected	1
keratinized	1
kd	1
kaolintreated	1
kallikrein-1-related	1
k183	1
k(124	1
j.2.2v-1	1
j.1462	1
ivrresulted	1
iterated	1
ited	1
issued	1
isotion	1
isomerize	1
isg15-modified	1
irrigated	1
lipidcontaining	1
liquefied	1
lled	1
lys-63-conjugated	1
medenatured	1
mda5-mediated	1
master	1
marklocated	1
map2b	1
mandates	1
malized	1
mained	1
magnesiumcoordinating	1
macrophagederived	1
macrophages	1
macerated	1
mab	1
m)-q#(s	1
lyophilized	1
lllll	1
luxol	1
luteinizing	1
lurking	1
luciferase‐expressing	1
luciferase	1
ltrating	1
ltering	1
lps)-stimulated	1
lpf9lpky	1
loosening	1
loop	1
loo	1
long1	1
locks	1
invite	1
invested	1
inverse	1
hydrocephalus	1
immunologie	1
immunocompromised	1
immune‐mediated	1
immunemediated	1
immerging	1
imlicalc	1
imagined	1
illuminates	1
ifn-~f	1
ifit1	1
identi	1
icvinfected	1
hypomyelinated	1
hyperventilate	1
hvea	1
immunosuppressed	1
humbled	1
http://interferome.its.monash.edu.au	1
hsv1)-mediated	1
hrp)-labeled	1
homogenates	1
hitherto	1
histaminesensitizing	1
hinted	1
highlite	1
herniated	1
herewith	1
hepatomas	1
hepatiduced	1
heparinized	1
immunopurified	1
impinge	1
invalidated	1
installed	1
invaginated	1
intubated	1
digitized	1
inteφreting	1
interspaced	1
interrogated	1
interrelated	1
intermixed	1
interleukin-6	1
interferonregulated	1
interconnected	1
interchanged	1
interactions	1
inter	1
inspected	1
implemented	1
infused	1
inflamed	1
infl	1
infec	1
induction	1
inducer	1
indicted	1
indexed	1
incoφorate	1
inconsefrom	1
incinerated	1
inception	1
inactiviting	1
imprinted	1
dilated	1
cruzi	1
digestion	1
belies	1
balooned	1
barrier	1
bated	1
beanshaped	1
beinfected	1
beled	1
bestow	1
arbitrated	1
better	1
bhq-1)-labeled	1
bifurcating	1
bilayers	1
binucleated	1
biopsied	1
back	1
b3-induced	1
autoisolated	1
autobaved	1
authorized	1
atteuuated	1
attests	1
attending	1
ated	1
assure	1
assembly	1
aspects	1
articulating	1
arrived	1
arming	1
arf1-depleted	1
archiving	1
biotinlected	1
biotwin	1
bisected	1
calibrate	1
cd62l	1
cd161	1
cd11b	1
ccuacuu	1
ccacaagca~~gggctggtctg	1
cc2-treated	1
cc1	1
cataloged	1
catagorizing	1
casts	1
caspase-1-activating	1
care	1
cap-0-containing	1
cant	1
calcuhted	1
blinded	1
calcium	1
c5amediated	1
c57bli6	1
c57bl/6jxdba/2j-1	1
c(is	1
c';~40	1
branching	1
brally	1
brain	1
bottlenecked	1
bootstapping	1
boldfaced	1
bluestained	1
blockade	1
arching	1
aquired	1
difficileassociated	1
15-fold	1
-rna	1
-tct	1
-transcriptome	1
1'8su1	1
1/64	1
1163(cys→his	1
17(c	1
appropriated	1
1:200	1
1inked	1
3'-nested	1
4-producing	1
5lated	1
\'\'0	1
-remitting	1
-polyadenylated	1
-o	1
-maxmultihits	1
-izing	1
-induced	1
-identified	1
-hydroxycytidineinduced	1
-fixed	1
-firmicutes	1
-expressing	1
-containing	1
-binding	1
-2692	1
-11	1
-1	1
-/-	1
a/~	1
a1-coding	1
a146	1
aeruginosa	1
apcconjugated	1
antigp-1	1
antigenbased	1
antidetected	1
antibodytreated	1
antedates	1
anergic	1
anchorless	1
analyed	1
amended	1
allied	1
alludes	1
allo	1
af201929	1
aerosolized	1
a59-induced	1
advised	1
adrps	1
adenovirusmediated	1
addicted	1
acrylamide-0.2	1
acidified	1
acidhydrolyzing	1
acid)-containing	1
accomodate	1
acclimatize	1
accentuates	1
abstract	1
a5a734c9891784441fe1c1ca78ddd5a8dd32c5be	1
a59infected	1
cd90.1	1
cearelated	1
cellenriched	1
deaecellulose	1
d1epv	1
d4mit25-d4mit80	1
dam	1
damp	1
dated	1
db.restricted	1
debilitate	1
cellinduced	1
decapping	1
decorating	1
deepen	1
defect	1
deferens	1
deflate	1
d187	1
d130a	1
cx43)-mediated	1
customized	1
curtailing	1
curring	1
curling	1
culture-"adapted	1
cuffing	1
crystallized	1
cryosections	1
cryoprotected	1
cruziinfected	1
membranecontaining	1
crossreacted	1
cripple	1
crinkled	1
deformed	1
deg	1
dein	1
deprotected	1
difficile	1
differentiationassociated	1
difference	1
difated	1
dif	1
dideoxynucleotide	1
dewaxed	1
deviates	1
devastating	1
deteriorates	1
derivatized	1
derepress	1
derailed	1
deproteinized	1
deprived	1
deionized	1
depresses	1
deposlted	1
depopulate	1
depolymerizing	1
dependence	1
denuded	1
dentransfected	1
denominated	1
dendrodendritic	1
demyelinfrom	1
demultiplexing	1
demineralized	1
demes	1
demands	1
cribing	1
creeping	1
credited	1
cl-2	1
coisolated	1
coincorporated	1
coined	1
coerced	1
codetermining	1
cocultured	1
coaxes	1
coactivated	1
coaccumulated	1
co)transfected	1
clumps	1
cludes	1
clubbed	1
clipping	1
circumscribed	1
colreagent	1
cinaediassociated	1
ciating	1
chromosome	1
chromatographied	1
chitinized	1
chewing	1
chemokinemediated	1
chelating	1
characterised	1
cessed	1
certified	1
centrifugation	1
centering	1
cells	1
collapsed	1
compartmentalised	1
creased	1
conterstained	1
crassiceps	1
cracked	1
cov	1
coursed	1
coughing	1
coronavirusassociated	1
cord-304954	1
cord-252882	1
cord-021413	1
cord-003199	1
copackaged	1
cooccurring	1
converge	1
contraindicated	1
contend	1
compartmentalized	1
contained~1000	1
consult	1
conraining	1
connexin43-mediated	1
conjoin	1
condensate	1
concentained	1
cona)-conditioned	1
compress	1
comply	1
complexexpressing	1
complexassociated	1
complex	1
complementa-	1
medicated	1
nonhemolyzed	1
membraneproximal	1
smoldering	1
signifi	1
simulates	1
sixfold	1
sketched	1
sleeping	1
slurried	1
smoothed	1
sclerosing	1
smoothwalled	1
sn00p8iw	1
snare	1
snorted	1
snythesizes	1
sociated	1
signs	1
sieved	1
shuffled	1
sheer	1
shaved	1
sharpened	1
sgmrna	1
severe	1
sevenfold	1
serumenriched	1
separable	1
senting	1
senescencerelated	1
semipurified	1
semi	1
selfinteract	1
seglycosylated	1
soiledbedding	1
spannrng	1
spawned	1
stretches	1
supplanted	1
summarised	1
suited	1
suf	1
sued	1
suclding	1
substraterepositioning	1
subneutralizing	1
submerged	1
subiculum	1
stunting	1
structured	1
strucencoded	1
stroying	1
streaking	1
speci	1
strated	1
strangulated	1
strainrelated	1
stick	1
stalk	1
stage	1
ssrna	1
spray	1
sporulated	1
splenectomized	1
spironucleosis	1
spill	1
spend	1
species	1
scrunching	1
scarify	1
mented	1
reprint	1
rephosphorylated	1
repiieates	1
replication	1
replipolymerase	1
reported.1,2,20	1
reprecipitated	1
reprobed	1
saturatediunsaturated	1
repurposing	1
requirements	1
resampling	1
reseeded	1
reshaping	1
resistant	1
reovirus	1
reorganize	1
remarked	1
relocalizes	1
religated	1
relegated	1
relaxed	1
relapsingremitting	1
reisolated	1
reinvigorated	1
reinvade	1
reinterpreted	1
reintegrate	1
reinstate	1
reinoculated	1
reinfect	1
reigns	1
resorb	1
responses	1
restarted	1
rnaguided	1
satisfy	1
salvage	1
salivate	1
sa59r	1
s4ahvrexhibited	1
s4ahvr161	1
s330	1
rupture	1
runde	1
rsmhv2-infected	1
rsa59-induced	1
roughened	1
roles	1
rnasynthesizing	1
rnacontaining	1
restimulated	1
rived	1
risks	1
rigidifying	1
rificed	1
riboprofiling	1
rhamnose	1
rg-2072	1
rg-1722	1
rfpexpressing	1
reticuassociated	1
retargeted	1
retard	1
resuits	1
restricdicted	1
surface	1
surged	1
surveyed	1
vectored	1
vacate	1
vacraised	1
vacuolized	1
variants	1
variation	1
vealed	1
vefold	1
swine	1
vesicles	1
vested	1
vided	1
vims	1
violated	1
virions	1
v"ith	1
uv	1
usurp	1
usrng	1
uranyl	1
uploaded	1
uphold	1
unveiling	1
untangling	1
unlock	1
unloaded	1
unleashing	1
uninduced	1
uniestimated	1
unglycosylated	1
undiluted	1
underly	1
virologie	1
virusassociated	1
virusbased	1
withstand	1
∆∆ct	1
Ιηοοφοrated	1
αmediated	1
À	1
~nd	1
zoster	1
ylated	1
y59a	1
xed	1
x-100-treated	1
wreak	1
wrapping	1
wound	1
worry	1
whet	1
virusbinding	1
welldefined	1
wellcharacterized	1
welcomed	1
weightsupported	1
weighted	1
worn	1
wax	1
water	1
waiting	1
vtes	1
volved	1
visulaized	1
visualise	1
virusneutralizing	1
uncoupled	1
uncoats	1
uncloned	1
teased	1
tlr3-mediated	1
tioned	1
tinged	1
tilting	1
tified	1
threshold	1
threefold	1
thermotactic	1
th17-mediated	1
th1)-inducing	1
termined	1
tered	1
teins	1
tegumented	1
taught	1
topped	1
tated	1
targetting	1
tackle	1
t82a	1
t7-mediated	1
t7-driven	1
t7-coupled	1
t4-related	1
synthesis	1
synergize	1
syndromeassociated	1
syncytia	1
synapsing	1
symbolized	1
tolerized	1
traded	1
uncleaved	1
trolling	1
unappreciated	1
unannotated	1
ultracentrifugamoved	1
ultilized	1
ubiquinated	1
ubilized	1
twopronged	1
tuning	1
tunicamycintreated	1
tuning	1
tumbling	1
tted	1
tse)-containing	1
trypsin	1
troduced	1
trailing	1
tritcconjugated	1
triplicate	1
triple	1
triphosphorylated	1
tributed	1
trated	1
transstructed	1
transsect	1
transpires	1
transmembranespanning	1
transit	1
transilluminated	1
transcomplement	1
transacting	1
reheat	1
regrow	1
regrouping	1
operationalized	1
ofmhvselected	1
oft	1
oligo(g)-binding	1
oligomers	1
oncolytic	1
onstrated	1
optimised	1
pegylated	1
orated	1
orf1bencoding	1
orfs	1
orted	1
orthograde	1
outbred	1
ofdv	1
ofcoronaviruses	1
oculated	1
oc43-inoculated	1
obviated	1
obscured	1
obof	1
o/667	1
nussinserted	1
nucleotide	1
nsp6-coding	1
nsp4-n258	1
nsp1–nsp11	1
nsp14-associated	1
nsp1-containing	1
ns065727	1
noxderived	1
outcompeted	1
outgrown	1
outperformed	1
painted	1
peared	1
pdcs	1
pd-1-positive	1
pcrbased	1
pbstreated	1
pay	1
pathomised	1
parylated	1
partrcipate	1
parted	1
parse	1
parameters	1
pant	1
palmitoylated	1
p65	1
outscored	1
p3Ј	1
p38-mapk	1
p2Ј	1
p1-colonized	1
p)ibv-5	1
oxytoca	1
oxygenates	1
override	1
overlooked	1
overloading	1
overlaied	1
overheating	1
overexpress	1
overestimate	1
novoinitiating	1
nourovirulent	1
nontransfected	1
mild	1
monoinfected	1
monocontaminated	1
moderate	1
mlected	1
mistaken	1
missorting	1
misplaced	1
misled	1
misincorporated	1
misidentified	1
misfold	1
misdirected	1
misconstrue	1
ministered	1
microscopy	1
monotected	1
micropressed	1
microinjected	1
microgliaassociated	1
microdissected	1
mhv‐3)‐induced	1
mhv-3infected	1
mhv-2infected	1
mhv-1-induced	1
mhv)-associated	1
method	1
methanolyzed	1
metalbinding	1
mers	1
merits	1
monolayer	1
motifs	1
nonshivering	1
nd	1
nonoverlapping	1
nonneutralizing	1
noninfected	1
nonbridging	1
nonadapted	1
nized	1
nished	1
nidoviruses	1
nictitating	1
neutrophil	1
nen.0b013e31821da499	1
neglected	1
negating	1
necrotising	1
naturallyoccuring	1
motorized	1
nac1	1
n7-methylated	1
mutilating	1
mutantinfected	1
murtna	1
murizined	1
murinecoronavims	1
murid	1
multivarying	1
multimerize	1
multifaceted	1
mstricted	1
mrna7	1
mp6-xt22	1
pected	1
pellet	1
refrain	1
rag	1
quenced	1
quired	1
r)ibv	1
r837-induced	1
radiolabelled	1
radiolabled	1
rag1-/-or	1
penile	1
randomprimed	1
rats	1
re)introduced	1
reacquire	1
reaggregates	1
reanalyzed	1
quell	1
quadruplicated	1
qj7bli6	1
q192a.	1
pyruvate	1
pursue	1
purposed	1
purported	1
purifled	1
punctuated	1
pseudotyped	1
proximal	1
protonated	1