adverb

This is a table of type adverb and their frequencies. Use it to search & browse the list to learn more about your study carrel.

adverb	frequency
also	12732
however	5909
well	5365
therefore	3067
highly	2978
respectively	2694
significantly	2453
recently	2077
previously	1884
furthermore	1738
even	1680
moreover	1526
still	1490
directly	1448
together	1336
often	1269
currently	1163
interestingly	1132
specifically	1112
first	1068
finally	1045
now	1042
mainly	976
especially	888
yet	881
rather	877
less	864
particularly	843
far	799
subsequently	798
usually	788
thereby	785
much	781
strongly	777
approximately	752
relatively	728
potentially	713
generally	711
indeed	706
widely	699
additionally	694
already	689
similarly	674
hence	672
fully	659
probably	651
successfully	622
almost	607
completely	597
clearly	586
commonly	585
rapidly	584
newly	550
partially	548
possibly	545
efficiently	541
prior	540
differentially	535
least	529
later	513
alone	503
typically	491
closely	487
instead	481
nevertheless	459
largely	448
mostly	444
easily	437
long	433
negatively	429
likely	429
primarily	427
intrinsically	419
initially	416
functionally	416
importantly	412
experimentally	412
selectively	405
frequently	395
namely	386
consequently	381
just	371
positively	364
notably	364
poorly	360
simultaneously	350
structurally	348
predominantly	346
genetically	343
effectively	330
slightly	320
naturally	320
clinically	319
biologically	312
better	309
extremely	308
next	303
independently	302
double	300
extensively	299
greatly	296
normally	295
alternatively	289
presumably	282
quite	279
immediately	275
early	273
statistically	272
nearly	270
earlier	266
perhaps	262
overall	260
worldwide	244
ultimately	243
preferentially	243
commercially	243
covalently	240
readily	238
nt	238
exclusively	236
chemically	235
briefly	235
surprisingly	234
always	233
markedly	226
apparently	225
best	225
simply	221
overnight	217
increasingly	217
otherwise	216
dramatically	215
accordingly	214
tightly	213
sometimes	213
stably	212
upstream	206
single	206
back	206
essentially	205
apart	203
originally	200
eventually	188
twice	186
likewise	186
correctly	185
transiently	182
considerably	179
longer	176
downstream	176
actually	175
remarkably	170
actively	167
unfortunately	165
substantially	164
separately	164
randomly	160
consistently	159
broadly	154
partly	152
herein	147
indirectly	146
nonetheless	145
terminally	144
constitutively	144
properly	143
individually	142
enough	142
continuously	142
equally	140
differently	140
necessarily	139
critically	138
orally	138
quickly	138
second	137
ns3	135
altogether	135
conversely	134
accurately	134
forward	133
ago	133
away	132
collectively	127
regardless	125
around	125
somewhat	124
solely	124
besides	123
severely	123
gradually	121
obviously	119
close	118
virtually	117
systematically	117
quantitatively	117
precisely	115
entirely	115
elsewhere	110
spontaneously	109
never	108
strictly	106
fluorescently	106
firstly	105
certainly	103
sufficiently	102
carefully	102
slowly	101
roughly	101
physiologically	99
evolutionarily	99
n't	98
weakly	97
totally	96
manually	94
distantly	94
soon	93
routinely	92
spatially	90
faster	89
heavily	89
globally	88
ever	88
presently	88
translationally	87
encephalitis	86
rarely	82
nowadays	82
locally	81
dsdna	81
uniquely	80
thereafter	80
exactly	80
drastically	80
moderately	79
daily	79
progressively	79
intriguingly	78
automatically	77
traditionally	76
thoroughly	76
strikingly	74
computationally	74
proteolytically	73
freely	73
either	73
online	72
theoretically	70
fast	70
reversibly	69
late	68
constantly	67
physically	67
occasionally	66
ca	66
natively	65
enzymatically	65
catalytically	64
meanwhile	63
versa	62
secondly	62
ubiquitously	61
hardly	61
lastly	60
freshly	60
short	59
sequentially	59
irrespective	59
higher	59
basically	59
rationally	58
conformationally	57
recombinantly	57
abundantly	56
ideally	56
comparatively	55
reliably	54
cally	54
afterwards	54
right	53
practically	53
kindly	53
fairly	53
dynamically	53
biochemically	53
p7	52
metabolically	52
subcutaneously	52
repeatedly	52
third	52
therapeutically	51
publicly	51
endogenously	51
dependently	51
absolutely	51
unexpectedly	50
thereof	50
specially	50
high	50
economically	50
concomitantly	48
intravenously	48
potently	48
really	48
outside	48
persistently	47
minimally	47
half	47
synergistically	46
inversely	46
intracellularly	46
coarse	46
along	46
chronically	45
principally	44
inherently	44
shortly	44
regularly	44
virally	44
passively	43
comprehensively	43
disulfide	43
urgently	42
closer	42
morphologically	41
curiously	41
truly	40
merely	40
gratefully	40
technically	39
serially	39
energetically	39
mechanically	38
artificially	38
distinctly	38
lower	38
pharmacologically	38
phylogenetically	38
unambiguously	38
reasonably	38
undoubtedly	37
temporally	37
seemingly	37
intraperitoneally	37
exceptionally	37
cooperatively	37
mildly	36
fortunately	36
top	36
whereas	36
thermally	35
qualitatively	35
profoundly	35
irreversibly	35
intimately	35
incompletely	35
marginally	34
historically	34
environmentally	34
adequately	33
appropriately	33
barely	33
explicitly	33
preferably	33
therein	33
thermodynamically	33
transcriptionally	32
steadily	32
purely	32
fundamentally	32
fold	32
deeply	32
competitively	32
definitely	31
formerly	31
developmentally	31
gently	31
wide	31
intensively	31
putatively	30
aside	30
annually	30
pcdna	30
internally	30
finely	29
unusually	29
arguably	29
course	29
externally	29
centrally	29
immunologically	29
permanently	29
sterically	29
though	29
systemically	28
reproducibly	28
maybe	28
maximally	28
massively	28
iteratively	28
incorrectly	28
exogenously	28
uniformly	28
intramuscularly	27
ahead	27
cantly	27
concurrently	27
linearly	27
perfectly	27
viral	27
forth	27
optimally	27
tentatively	26
optically	26
mechanistically	26
intranasally	26
hereafter	26
formally	26
visually	26
inside	25
characteristically	25
ciently	25
densely	25
loosely	25
molecularly	25
mutually	25
rigorously	25
somehow	25
adversely	24
classically	24
electrically	24
latently	24
live	24
near	24
reportedly	24
continually	23
doubly	23
evidently	23
exponentially	23
firmly	23
hopefully	23
isotopically	23
posttranslationally	23
vrna	23
nsp10	23
spectrophotometrically	22
singly	22
seriously	22
predominately	22
noticeably	22
evenly	22
conclusively	22
enormously	21
correspondingly	21
cotranslationally	21
deep	21
financially	21
extracellularly	21
interferon	21
robustly	21
fine	20
abnormally	20
allosterically	20
bacterially	20
conveniently	20
crucially	20
dsrna	20
conventionally	20
fourth	20
phenotypically	20
ribavirin	20
synthetically	20
topologically	20
unequivocally	20
universally	20
jointly	20
low	19
acutely	19
antigenically	19
atg5	19
conceptually	19
astrocyte	19
orthogonally	19
safely	19
semi	19
slow	19
suitably	19
prominently	19
nonspecifically	18
antiparallel	18
electrostatically	18
ill	18
invariably	18
periodically	18
reassembly	18
retrospectively	18
schematically	18
successively	18
empirically	17
conceivably	17
deliberately	17
dose	17
reverse	17
medically	17
vastly	17
oxidatively	17
homogeneously	16
elegantly	16
histologically	16
hitherto	16
conditionally	16
sharply	16
strategically	16
tight	16
x-100	16
matter	15
ectopically	15
hereby	15
identically	15
industrially	15
inevitably	15
intensely	15
inward	15
little	15
magnetically	15
oppositely	15
mavs	15
mrnas	15
nm	15
pdna	15
pharmaceutically	15
promptly	15
ssdna	15
surely	15
thrice	15
left	14
clear	14
coordinately	14
lately	14
numerically	14
nucleotide	14
straight	14
suddenly	14
und	14
geographically	13
aberrantly	13
arbitrarily	13
compositionally	13
convincingly	13
cytoplasmically	13
diffusely	13
dominantly	13
endothelial	13
electrophoretically	13
graphically	13
paradoxically	13
ultrasonically	13
inefficiently	13
supposedly	13
superficially	13
temporarily	13
onwards	13
maternally	13
laterally	13
immunohistochemically	12
adoptively	12
autonomously	12
biorxiv	12
cfdna	12
circularly	12
confidently	12
free	12
imatinib	12
notoriously	12
intuitively	12
noncovalently	12
variably	12
serologically	12
tenfold	12
thapsigargin	12
timely	12
kinetically	12
pathologically	11
asymmetrically	11
comparably	11
consecutively	11
highest	11
oligonucleotide	11
optionally	11
peripherally	11
predictably	11
prospectively	11
radioactively	11
satisfactorily	11
spectrally	11
valproate	11
deeper	10
doubt	10
diagnostically	10
definitively	10
alternately	10
capsid	10
behind	10
farther	10
afterward	10
excessively	10
insufficiently	10
foxo3	10
mathematically	10
plausibly	10
prematurely	10
productively	10
promiscuously	10
twofold	10
weekly	10
majorly	10
flexibly	9
exhaustively	9
exosome	9
hierarchically	9
foremost	9
generously	9
grossly	9
electronically	9
entropically	9
chromosomally	9
eif2α	9
cross	9
contrarily	9
apically	9
anywhere	9
aerobically	9
admittedly	9
incidentally	9
inadvertently	9
taxonomically	9
insofar	9
sporadically	9
last	9
triple	9
trimeric	9
tremendously	9
topically	9
upwards	9
surgically	9
thirdly	9
somewhere	9
outward	9
sensitively	9
seldom	9
round	9
radically	9
overly	9
site(s	9
favourably	8
hirudin	8
histopathologically	8
indefinitely	8
horizontally	8
implicitly	8
improperly	8
faithfully	8
favorably	8
-turns	8
ecologically	8
dual	8
counter	8
chiefly	8
causally	8
basolaterally	8
aka	8
interchain	8
instantaneously	8
cautiously	8
internationally	8
scarcely	8
vertically	8
variously	8
technologically	8
swiftly	8
super	8
stepwise	8
selfassembly	8
scientifically	8
symmetrically	8
publically	8
nicely	8
pp65	8
modestly	8
n=5	8
macroscopically	8
nutritionally	8
officially	8
outwards	8
imo	7
-protein	7
biosynthetically	7
distinctively	7
doubtless	7
else	7
epigenetically	7
etoposide	7
everywhere	7
exceedingly	7
extraordinarily	7
gp64	7
cumulatively	7
hyper	7
intradermally	7
provisionally	7
intratracheally	7
vigorously	7
sort	7
sometime	7
remotely	7
unsurprisingly	7
postoperatively	7
parenterally	7
ns1(ed	7
microscopically	7
lightly	7
contrastingly	6
hypothetically	6
hydrophobically	6
geometrically	6
fibrinopeptide	6
exquisitely	6
enantiomerically	6
inwardly	6
detectably	6
dark	6
albeit	6
coherently	6
beforehand	6
assays	6
aseptically	6
alike	6
adaptively	6
accidentally	6
a549	6
-were	6
immensely	6
disappointingly	6
latter	6
secondarily	6
light	6
vrnps	6
visibly	6
vegetatively	6
th	6
stoichiometrically	6
smallest	6
slower	6
shrna	6
usp14	6
proportionally	6
preliminarily	6
post	6
partway	6
noninvasively	6
new	6
neither	6
nally	6
lumenally	6
prophylactically	6
homogenously	5
falsely	5
fbxo3	5
gö	5
henceforth	5
home	5
intricately	5
hpev3-vp0	5
impressively	5
inductively	5
intentionally	5
itraq	5
diversely	5
ethnically	5
anymore	5
disproportionately	5
crystallographically	5
convergently	5
controversially	5
consequentially	5
coincidentally	5
beneficially	5
arnt	5
arg50val	5
appreciably	5
luciferase	5
analytically	5
across	5
lncrnas	5
erv1	5
lys|gly	5
reversely	5
mucosa	5
αiib	5
wholly	5
vp0	5
ubiquitin	5
threefold	5
synchronously	5
synaptically	5
subtly	5
solid	5
smoothly	5
rigidly	5
ribosomally	5
understandably	5
retrogradely	5
photochemically	5
onward	5
nterminally	5
ostensibly	5
overwhelmingly	5
perpendicular	5
ordinarily	5
popularly	5
prenatally	5
reciprocally	5
recurrently	5
repetitively	5
doubtlessly	4
dually	4
enthalpically	4
erf1	4
erroneously	4
excellently	4
exemplarily	4
fortuitously	4
gfpuv	4
hard	4
heterogeneously	4
interactively	4
immunochemically	4
inappropriately	4
incredibly	4
inner	4
instantly	4
isotropically	4
intrathecally	4
invasively	4
irrespectively	4
isostere	4
directionally	4
discretely	4
bidirectionally	4
cytologically	4
cyclophosphamide	4
logically	4
-tag	4
30-fold	4
ab!ab	4
advantageously	4
agnoprotein	4
amply	4
anomalously	4
anti-100	4
anyway	4
autocatalytically	4
backwards	4
bilaterally	4
bioinformatically	4
clockwise	4
clonally	4
cold	4
colloquially	4
colorimetrically	4
complex	4
conservatively	4
cotranscriptionally	4
custom	4
leukemias	4
meaningfully	4
longitudinally	4
radially	4
regionally	4
rgs4	4
rsba	4
rvv	4
sexually	4
since	4
socially	4
spectroscopically	4
spherically	4
statically	4
steeply	4
stochastically	4
succesfully	4
toxicologically	4
triply	4
unspecifically	4
upside	4
upward	4
usefully	4
vmap	4
vmia	4
worst	4
lowest	4
recursively	4
unevenly	4
r91p	4
od450	4
lytically	4
pviii	4
magnetic	4
mentally	4
morbidly	4
nasally	4
nitroprusside	4
nominally	4
nsp14-nsp10	4
nucleocapsid	4
n=18	4
operationally	4
positionally	4
prohibitively	4
protectively	4
osmotically	4
preoperatively	4
preclinically	4
phosphatidylinositol	4
perpendicularly	4
partial	4
outwardly	4
fittingly	3
enos	3
fastest	3
e¤ciently	3
evolved	3
flat	3
equivalently	3
eif4gi	3
endna	3
electrophysiologically	3
electrochemically	3
edna	3
ect	3
eccentrically	3
furtherly	3
easy	3
fluorometrically	3
i-3c	3
g1f	3
hsv-1	3
diagrammatically	3
inducibly	3
indisputably	3
indiscriminately	3
immunomagnetically	3
icp46	3
hspa1a	3
genuinely	3
hsp90	3
hsp70h	3
heterologously	3
heretofore	3
hemostatically	3
habitually	3
diametrically	3
although	3
cyclina	3
crudely	3
arrestin	3
architecturally	3
aptly	3
angiographically	3
analogously	3
algorithmically	3
aggressively	3
additively	3
acoustically	3
abroad	3
ably	3
6b8	3
10-fold	3
-especially	3
innately	3
asn174	3
astonishingly	3
autoradiographically	3
broad	3
concisely	3
cognitively	3
cisplatin	3
cially	3
cgb	3
cardiosphere	3
br	3
axenically	3
biotechnologically	3
biophysically	3
biomedically	3
bet	3
behaviorally	3
badly	3
infrequently	3
-that	3
integrally	3
sumably	3
sterile	3
spectacularly	3
spatiotemporally	3
sorely	3
slim	3
sixfold	3
sincerely	3
sensibly	3
sadly	3
richly	3
qv	3
quently	3
qev	3
proximally	3
protease	3
subfamily	3
thankfully	3
prkar2a	3
thematically	3
μl	3
αv	3
intermediately	3
µm	3
±sd	3
willingly	3
vitally	3
vectorially	3
unprecedentedly	3
ultrastructurally	3
transverse	3
transgenically	3
torsionally	3
topographically	3
throughout	3
processively	3
sustainably	3
presumptively	3
ns2a	3
narrowly	3
mock	3
misassembly	3
minutely	3
midway	3
microbiologically	3
methodologically	3
lq1601	3
longest	3
lethally	3
latterly	3
l52a	3
kind	3
ionically	3
powerfully	3
nbrsba	3
mg	3
parallelly	3
orthotopically	3
postsynaptically	3
nsp7	3
postnatally	3
pi3p	3
phosphoinositide	3
parenthetically	3
paclitaxel	3
overtly	3
opposite	3
open	3
oft	3
obligatorily	3
nucleoside	3
nucleatum	3
filo-	2
fleetingly	2
fkbp51	2
fivefold	2
gadd45b	2
fibrino	2
flush	2
ffir	2
fluorophore	2
furanose	2
fmlp	2
focally	2
forcibly	2
fore	2
formoterol	2
front	2
full	2
facilely	2
feasibly	2
earliest	2
f1l	2
f-236	2
gata4	2
eagerly	2
ecdna	2
efficaciously	2
eg	2
eif-4a	2
eif4e2	2
eminently	2
epidermally	2
ethically	2
ethod	2
etiologically	2
evectively	2
expectedly	2
expeditiously	2
extrachromosomally	2
extracorporeally	2
gastric	2
intein	2
genera	2
genomically	2
ically	2
idps	2
ik312532	2
im	2
imagej	2
immediateearly	2
inadequately	2
incrementally	2
inexorably	2
inextricably	2
infact	2
ingly	2
inotropically	2
downwards	2
interleukin-2	2
intra	2
intracerebrally	2
iatrogenically	2
i2d	2
hydrophilic	2
hemically	2
glu166	2
glyconavi	2
glycosidically	2
graciously	2
h4r	2
halfway	2
hclat	2
hindlh	2
hydrolytically	2
hnrnp	2
hnrnps	2
homodimer	2
hormonally	2
hotly	2
hourly	2
hugely	2
e2s	2
backward	2
dja1	2
atypically	2
agriculturally	2
alarmingly	2
aldehyde(s	2
amide	2
amniotically	2
anaerobically	2
analogically	2
anatomically	2
anisotropically	2
arabinose	2
arrhythmias	2
artinm	2
asn40	2
asnps	2
aspartimide	2
assembly	2
asynchronously	2
agnps	2
agarose	2
aditionally	2
-score	2
-2016	2
-ar	2
-bcl	2
-essentially	2
-hq	2
-namely	2
-ra	2
15-fold	2
adherently	2
15th	2
34th	2
3abc	2
3bkd	2
73rd	2
a249s	2
adenovirally	2
atractyloside	2
authentically	2
disulphide	2
autoproteolytically	2
concentrationdependently	2
concordantly	2
contemporaneously	2
credibly	2
cryomicroscopy	2
culturally	2
cx30	2
damn	2
dangerously	2
decidedly	2
decisively	2
delicately	2
diagonally	2
digitally	2
dimly	2
direct	2
distally	2
cogently	2
cnkr	2
cleanly	2
biocatalytically	2
avidly	2
b-100	2
b220	2
intramolecularly	2
batf2	2
beautifully	2
bidentately	2
blindly	2
circumstantially	2
blunt	2
ccar1	2
ccordingly	2
cd105	2
chirally	2
cin8	2
circumferentially	2
intracranially	2
aas03703.1	2
intratumorally	2
securely	2
sept4	2
serinc5	2
similarily	2
singularly	2
sinps	2
snornps	2
snuggly	2
sofar	2
soft	2
soluble	2
spacially	2
sparsely	2
spirally	2
ssrna	2
stali	2
standardly	2
stereochemically	2
semantically	2
s1-ctd	2
preferable	2
rhepo	2
prethrombin-2	2
prevalently	2
pro	2
professionally	2
prokaryotically	2
proteasomal	2
pvog	2
quietly	2
radiologically	2
ratiometrically	2
re-	2
real	2
reassuringly	2
redundantly	2
reggamma	2
repaglinide	2
reuptake	2
sticky	2
strangely	2
strsba	2
subgroup	2
univocally	2
unlikely	2
unquestionably	2
uorescein	2
v2.0	2
v83l	2
vanishingly	2
vcard	2
voluntarily	2
vp4	2
warmly	2
whatsoever	2
wich	2
wise	2
wrongly	2
αvβ3/5	2
inwards	2
unique	2
unfairly	2
unequally	2
tnav2c	2
ten	2
terribly	2
thereto	2
thereupon	2
thin	2
thrombin	2
tively	2
transcriptase	2
unconditionally	2
translocationally	2
triazolyl	2
tyr234	2
ubxd1	2
unanimously	2
uncommonly	2
uncompetitively	2
preferently	2
targetp	2
predictively	2
lmra	2
mechanical	2
medicinally	2
microbially	2
micrornas	2
minorly	2
modularly	2
mono	2
monoallelically	2
monocularly	2
morever	2
motionally	2
mucosally	2
mutationally	2
n234	2
n=3	2
nanodiscs	2
nanoscopically	2
map_1386c	2
lmp-1	2
naï	2
lly	2
irregularly	2
ironically	2
possible	2
itr	2
k(+	2
keenly	2
kinase	2
l20f	2
larly	2
lateron	2
leftward	2
legally	2
lesser	2
leucocyte	2
like	2
literally	2
lively	2
nationwide	2
luminometrically	2
neatly	2
offline	2
onebac	2
operatively	2
opportunely	2
orbitally	2
osi-027	2
panx1	2
pathogenically	2
patially	2
pcambia	2
per	2
perorally	2
pfam	2
phiebographically	2
physicochemically	2
neoplastically	2
pi-103	2
plectonemically	2
ofig	2
pathogenetically	2
normaly	2
nsp15	2
neurally	2
nly	2
ofdcg	2
nonbilayer	2
noncompetitively	2
normal	2
nr8383	2
nsp14	2
plus	2
nsp2	2
objectively	2
odd	2
obligately	2
occupationally	2
nucleus	2
nsp5	2
errs	1
episomally	1
epidemiologically	1
episomically	1
epizootifally	1
ephrinb1	1
equivocally	1
erratically	1
errps	1
expectably	1
evolutionally	1
esp	1
espetially	1
ess3b	1
ethoxyzolamide	1
evermore	1
evntually	1
excitingly	1
eonsitently	1
exculsively	1
eovalently	1
eleven	1
enzymeimmunoassays	1
ently	1
electrogenically	1
exteriorly	1
electrolytically	1
electromagnetically	1
electrophillically	1
elf4gl	1
elsewhere.6	1
emarkably	1
embryonically	1
emigrate	1
emptively	1
enantiomer	1
encouragingly	1
endemically	1
endlessly	1
endocrinologically	1
endocytically	1
endogenous	1
enta	1
extemporaneously	1
futhermore	1
extra	1
fro	1
fnst	1
forever	1
formamide	1
fortnightly	1
foundhave	1
foward	1
foxq1as	1
framewere	1
fresh	1
ft.2	1
eyciently	1
fugene	1
fusogenically	1
f~-casein	1
galcer	1
gc	1
gene(s	1
generically	1
genesoriginally	1
elastically	1
fmhv	1
flybase	1
fluorophor	1
fluorimetrically	1
f1-s	1
f279	1
f28y	1
f2a	1
f32-ai113973	1
factor-2	1
factor-2-alpha	1
facultatively	1
faintly	1
fastidiosa	1
fat	1
federally	1
fix	1
flavivirus	1
flavoprotein	1
flexiblenot	1
floral	1
fluidly	1
fluoreseently	1
electro	1
cultly	1
eif4g-1	1
de-	1
cytoplasmitally	1
cytosolic	1
cytosolically	1
d311	1
dag)dependent	1
darkly	1
db)-camp	1
dcally	1
dddna	1
dead	1
eicosanoid	1
dedicatedly	1
deepest	1
defiantly	1
definetly	1
defintely	1
demonst	1
dendritically	1
denote	1
denv	1
cytoplasmic	1
cytoplasm	1
cytolytically	1
cytogenetically	1
covalent	1
cpn60.2	1
craniocaudally	1
crmp1	1
crosswise	1
cruzi	1
cryptically	1
ctareatly	1
ctdna	1
cttccttccggatcacgtgttcat3	1
ctxb	1
germinally	1
currenly	1
cx32	1
cxcr3	1
cyclically	1
cylindrically	1
cys144	1
cytochemically	1
descriptively	1
deservedly	1
desperately	1
dr12,were	1
ds)rnas	1
ds410	1
duly	1
e2-p7	1
e220	1
e234	1
e6ap	1
ealretinin-22k	1
easely	1
eber-1	1
eber1	1
ectodomain	1
ec~	1
educationally	1
eeeently	1
eetopically	1
efficiencly	1
effkiently	1
effortlessly	1
dropwise	1
dphpc	1
determinedempirically	1
doxorubicin	1
detrimentally	1
dh10b	1
din2	1
dinucelotide	1
dioxol-5-yl)-3a,4,5,9b	1
disadvantageously	1
discernibly	1
discontinuously	1
discrepantly	1
disparately	1
diverently	1
divergently	1
divisively	1
dk-2200	1
dna-242	1
docilely	1
doi:10.1016	1
downhill	1
downward	1
genotypically	1
i83-!ljl	1
glabra	1
inexpensively	1
inasmuch	1
inconsistently	1
index(the	1
indifferently	1
indispensably	1
indistinguishably	1
indubitably	1
inevitable	1
inexactly	1
inexplicably	1
il)-8	1
inexplicitly	1
infinitely	1
infinitesimally	1
infinitum	1
inguinally	1
innovatively	1
inos	1
insectcell	1
inseparably	1
inaptly	1
inally	1
inaccurately	1
in2	1
il4	1
ile97val	1
immedately	1
immediadiately	1
imminently	1
immovably	1
immue	1
immuno	1
immunoassay	1
immunofluorescently	1
immunogenetically	1
immunogenically	1
immunosenescence	1
immunotoxic	1
imperceptibly	1
imperfectly	1
important	1
impractically	1
imprecisely	1
insignificantly	1
integrity-	1
interactome3d	1
intrarectally	1
intravaginally	1
intraventricularly	1
intravesically	1
intravitally	1
intravitreally	1
involuntarily	1
inİzmir	1
ionophore	1
iontophorefically	1
ipfam	1
ires-2a	1
irmaediately	1
irreparably	1
irrevocably	1
irs-1ptyr20	1
ischemically	1
isgs).29subsequently	1
isnot	1
counterclockwisely	1
intrathoracically	1
intraperitoncally	1
intercellularly	1
intrapentoneally	1
interchangeably	1
interfacially	1
interfere	1
intermittently	1
intermolecularly	1
intestinally	1
intracardially	1
intracellular	1
intracellularlly	1
intracerebroventricularly	1
intracorporeally	1
intracortically	1
intraeellularly	1
intraeranieally	1
intragastrically	1
intrahippocampally	1
intrahypothalamically	1
intramucosally	1
intraoperatively	1
il1403	1
ignificantly	1
gly	1
helical	1
harmlessly	1
harmonically	1
hastily	1
hcat-4	1
hcdna	1
hcmv	1
healthily	1
heavier	1
heavy	1
helically	1
igg1-fab	1
helpab	1
hemichannel	1
hemodymamieally	1
heparin	1
hereditarily	1
hermodynamically	1
heterocomplexes	1
heuristically	1
hev	1
harmfully	1
harder	1
happily	1
halfmaximally	1
gly-15	1
gly103	1
glyoxyl	1
golgimanic	1
gondii(me49	1
gravely	1
green	1
gromacs-3.3	1
gruel	1
guidelinesgenerally	1
gvfld.	1
h1152p	1
isocalorically	1
h155y	1
h2r	1
h337	1
h33n	1
hadv	1
haemostatically	1
hexagonally	1
hexameric	1
hey-1	1
hsod1	1
hsp60	1
hsp60-hsp10	1
hun4	1
hydropathically	1
hydrophilically	1
hydroponically	1
hyperalgesia	1
hyungsoo	1
i+5	1
icosahedrally	1
icre	1
icsarsdorf9b	1
ideal	1
idh3a	1
idly	1
idually	1
ie1	1
ifically	1
ifit1	1
hsp100s	1
hsemophiliscs	1
hgfap	1
hs013-hs016	1
higly	1
histochemically	1
histopatologically	1
hither	1
hku1)-usually	1
hlly	1
homeostatically	1
homoassembly	1
homogeneuosly	1
homopolypeptide	1
honestly	1
honigkueheniihnlicher	1
hook1	1
hotter	1
hp1437	1
hpr85	1
hr=0.89	1
hrd1p	1
hrough	1
counterintuitively	1
anciently	1
correlatively	1
afterthat	1
admiringly	1
adora2b	1
adventitiously	1
advisably	1
ae1c	1
aerugenosa	1
aetiologically	1
afar	1
afore	1
againstcovid-19	1
a2ap	1
agalactiae	1
agb82887.1	1
agglomeratively	1
aggresome	1
aggresomes	1
aggressivere	1
agnostically	1
agronomically	1
ah109	1
adhaere	1
additionly	1
additionaly	1
actometer	1
a4iu9qg6	1
a5b1	1
a66	1
aa)g.	1
aalso	1
ab	1
ab)6	1
ab217130	1
abcd2	1
abrb	1
abruptly	1
ac	1
acaricide	1
accaugg	1
acceptably	1
accidently	1
acdna	1
acsomega.0c03206	1
action~	1
akeady	1
ala27	1
alanyl-	1
altough	1
ambt	1
aminonucleoside	1
aminoterminus	1
amongand	1
amphisome	1
analgetically	1
anaphylactically	1
anonymously	1
antagonistically	1
antennae	1
anterogradely	1
anthroylouabain	1
antibacterially	1
antibiotically	1
antibodies.cancer.gov	1
antifluorescein	1
antigen-1	1
antigendb	1
antigentically	1
amazingly	1
althrough	1
alcalophilus	1
alternanthera	1
aldh8	1
aldo1	1
alfab)6	1
algally	1
algebraically	1
aligand	1
alimentiire	1
alkali	1
alkoholisehen	1
allogeneically	1
allyl	1
alo	1
alongside	1
alpha-2-glycoprotein	1
alphabetically	1
alphafetoprotein	1
alphaherpesvirus	1
alphamelanocyte	1
alphasynuclein	1
a3g	1
a291686d0744c0e784513f9cb8aec79f0c93d74e	1
antiparalell	1
-directly	1
-approximately	1
-atpase	1
-btg	1
-chemokine	1
-ciber	1
-clinicaltrials.gov	1
-cooh/-s-(ch	1
-currently	1
-cyp	1
-dthiogalactopyranoside	1
a19d	1
-early	1
-enzyme	1
-forkhead	1
-fortunately	1
-ganglioside	1
-glucosidase	1
-ha1	1
-hrp	1
-i	1
-apparently	1
-amyloid	1
-also	1
-9.5	1
isparticularly	1
--asn	1
--gaschromatographische	1
--sequence	1
--u	1
-1.550	1
-10,000-fold	1
-10,9536	1
-1117	1
-15	1
-15.01	1
-16,6795	1
-2-amino	1
-2003	1
-2007	1
-26.35	1
-2a	1
-7.1	1
-8,8561	1
-inside	1
-leu47argwere	1
-likely	1
//doi	1
100-fold	1
11,136,317a	1
19)f	1
19k	1
1bhp	1
2,2'-dichlorodiethylsulfide	1
2-fold	1
20-fold	1
24/7	1
25-fold	1
2wcd	1
35x	1
4.2x103	1
4oht	1
5.50±0.16	1
61−63	1
6vsb	1
a(mino	1
a1.i4	1
0n	1
.clearly	1
-mainly	1
-~	1
-mochlim	1
-most	1
-nkg2a	1
-no	1
-notably	1
-nps	1
-nsp10	1
-o	1
-possibly	1
-preferably	1
-primarily	1
-spectroscopic	1
-spectroscopy	1
-synuclein	1
-tg;fcgriib	1
-thrombin	1
-tks4-beta	1
-toxic	1
-usually	1
antimicrobially	1
antiporter	1
cordially	1
cdcs	1
cas9-knockout	1
caspase1	1
catalitically	1
catastrophically	1
categorically	1
caudally	1
causative	1
causually	1
cd,6st	1
celltetratuftsin	1
bly	1
cementoblast	1
central	1
centromeric	1
cfinically	1
cflip	1
channelalso	1
cheaply	1
chelate	1
chemoselectively	1
cas9-crrna	1
carelessly	1
cardially	1
cardiacally	1
bral-2	1
bre5p	1
brefeldina	1
brightly	1
brilliantly	1
bt/	1
businessq	1
butylparaben	1
bv1	1
bzip	1
bzlf-1	1
b~-~t~	1
c383	1
ca2+/calmodulin	1
calcyclin	1
calmly	1
calorimetric	1
canbe	1
carboxy	1
chemotactically	1
chop10	1
chromatin	1
concave	1
concretely	1
confidentially	1
conformally	1
confusingly	1
congenitally	1
consciously	1
conspiciously	1
conspicuously	1
constructively	1
constructswere	1
contemporarily	1
content	1
continously	1
contralaterally	1
contrariwise	1
contrary	1
controllably	1
controversely	1
coolly	1
conceptionally	1
complications•	1
chromatographically	1
competitive	1
circadianly	1
circrna	1
ck2Α	1
clearely	1
clustalw	1
cml14	1
co	1
coarsely	1
coevally	1
collaboratively	1
collaterally	1
collide	1
colloidally	1
comfortably	1
commertially	1
communally	1
compact	1
compassionately	1
compellingly	1
bottom	1
blue	1
antithrombotically	1
aspecifically	1
aryl	1
as-	1
asana	1
ascovirus	1
asdna	1
asignificantly	1
aslo	1
asn234	1
asp287	1
aspects.%	1
blast+	1
assaystypically	1
assumably	1
assumedly	1
astray	1
asymmetly	1
asymptotically	1
at30	1
atg8-family	1
athermodynamically	1
artifacts?yatskin	1
articularly	1
artficially	1
arterially	1
an~100-fold	1
aound	1
ap-2	1
aphidicolin	1
apieally	1
apob	1
apobec	1
apociii	1
appear[s	1
apperently	1
aqueous	1
arbely	1
architectonically	1
aregenerally	1
arejust	1
arerelatively	1
arf6p	1
arglabin	1
arl1p	1
atomistically	1
atp5f1a	1
atropinesterase	1
bap	1
bayk	1
bbn	1
bcl2-mcl1-bcl2l1	1
benzo[a]pyrene	1
bernasconi	1
betweenthe	1
bevore	1
bhk-21	1
bhv-1	1
bigger	1
biggest	1
bilayer	1
binary	1
biochemieally	1
biolistically	1
bionhemically	1
biphasically	1
bitopically	1
biweekly	1
basicly	1
bamh	1
attoampere	1
bal3l	1
auc24	1
aufgrund	1
aug#3	1
autocrinally	1
autoigg	1
autonomous	1
autophagyprotein	1
autosomaldominantly	1
averagely	1
axially	1
axin2	1
ay282752	1
ay310120	1
azgp1	1
azide-	1
azocasein	1
b2acf257e97d8fb539f0a68c348c2559271ba932	1
baa-4370-platesa2	1
bad	1
isometrically	1
wet	1
isuf	1
skip	1
signifycantly	1
signi¢cantly	1
sigulticnatly	1
simplex	1
simultanously	1
singnificantly	1
sitespecifically	1
sizeably	1
skimpily	1
slighthly	1
sassembly	1
small	1
smaller	1
smartly	1
snorna	1
snornas	1
snrnps	1
snugly	1
softer	1
somatically	1
significatively	1
signicantly	1
signfficantly	1
siginificantly	1
seamlessly	1
secl-1	1
seldomly	1
semiqualitatively	1
seperately	1
sepsc	1
sequently	1
serbest	1
serpinb1	1
sers	1
setp	1
severalfold	1
severally	1
sgp	1
shortest	1
sialylt	1
sibly	1
sically	1
siginficantly	1
someday	1
sonically	1
sonochemically	1
stereotactically	1
straightforwardly	1
strail	1
stricktly	1
stringently	1
stronger	1
stubbornly	1
sually	1
subcellularly	1
subclinically	1
subdiffusively	1
suboptimally	1
subseqeuntly	1
subsequent	1
subsequentially	1
subtilase	1
sucessfully	1
suely	1
suffciently	1
sulf1	1
sterotaxically	1
stereospecifically	1
sooner	1
stereoselectively	1
sophistically	1
sorbinil	1
south	1
sparingly	1
spationally	1
specificily	1
speci¢cally	1
speclrophotometrically	1
spectrawill	1
spectrofluorometrically	1
speculatively	1
spefically	1
sra	1
ssβgly	1
star	1
stat1-dna	1
stat5	1
state(s	1
statictically	1
scalably	1
sagitally	1
sura	1
recru	1
raxml	1
rbac-2575s.	1
rbcg	1
rcc	1
re0.91	1
readly	1
realistically	1
recessively	1
recognizably	1
rectally	1
sabs	1
red	1
reductively	1
reflexively	1
regioselectively	1
relatedly	1
relentlessly	1
relevantly	1
reluctantly	1
rep52d.	1
rarly	1
rarer	1
radiolytically	1
rab7a	1
protonically	1
prototypically	1
prp40a	1
psey303	1
pt7	1
pts.were	1
punctually	1
purposefully	1
purposely	1
puuaaaa	1
pyd1	1
q315r	1
qt	1
quasi	1
quasiuniversally	1
r'l	1
r10k8-heavy	1
rab27a	1
rab3a	1
rep72	1
replica	1
replicationally	1
roadly	1
robotically	1
rotationally	1
roteg	1
rotein	1
rounder	1
rp9p	1
rs5534	1
rs59647857	1
rstly	1
rtks)that	1
rtpi	1
rutinose	1
s(k	1
s-100	1
s1b	1
s1p	1
s1p.	1
s234	1
s50-s52	1
robotic	1
ro5126766	1
replicatively	1
ro1	1
reproducably	1
reprodueibly	1
residually	1
resolutely	1
resonantly	1
retracted	1
rhizosphere	1
rhodamine	1
rhtnf	1
rhythmically	1
riately	1
ribozyme	1
rightward	1
ripk1	1
risingly	1
riä	1
rmt1p	1
rn_celera	1
ro-318220	1
suprisingly	1
svlp	1
itch	1
viably	1
v33i.	1
vaginally	1
val14	1
vardb	1
varyingly	1
vascular	1
vat2p	1
velcroed	1
vely	1
vice	1
uniaxially	1
vimentin	1
vimsas	1
virologically	1
virulently	1
vnu	1
vpu	1
vs	1
vti1a	1
warfarin	1
v3.1	1
v2.1	1
v1b	1
utterly	1
unilaterally	1
uninterruptedly	1
unitarily	1
universit4gen	1
unknowingly	1
unnecessarily	1
unphysiologically	1
unpleasantly	1
unsuccessfully	1
unsuitably	1
untill	1
uorescently	1
uorf	1
upar	1
upf3p	1
uphill	1
uporf	1
uporfs	1
usp13	1
was~60-fold	1
way	1
webserver	1
~4c	1
~t	1
~ually	1
¢nally	1
±0,2	1
À1.027	1
ÔnormalÕ	1
àvis	1
ın	1
αa	1
αb	1
βcell	1
γgt	1
π	1
σ3	1
χ1	1
⇥	1
∆snf1	1
≥1.5	1
␣	1
~ac	1
zygotically	1
werr	1
zoonotically	1
whereafter	1
whereasvirtually	1
whichuniquely	1
whole	1
wib-801csignificantly	1
wichtigere	1
wider	1
willbe	1
wiser	1
within	1
worlwide	1
worryingly	1
wt	1
x1-x4	1
xp_011543851.1	1
y2h	1
yearly	1
z)α	1
zellspezifischen	1
unidirectionally	1
unfavorably	1
symbolically	1
thr238	1
thence	1
therewith	1
thermochemically	1
thermostatically	1
thioredoxin	1
thirly	1
thoughtfully	1
thoughtlessly	1
thr167	1
throug	1
undirectly	1
thyrotropin	1
ti]dschr	1
tia-1	1
tially	1
tirelessly	1
tly	1
tmc1-tmc8	1
tnf-(z	1
toga-	1
themfunctionally	1
them-	1
tgf)-beta	1
territorially	1
symptomatically	1
synergically	1
syn~	1
t0fold	1
t188a	1
t40i	1
tad	1
tbd-1	1
tbhq	1
tblastn	1
tcr)/nkr	1
tcr-(peptide	1
technosphere	1
teilweise	1
teleologically	1
tellingly	1
temporospatially	1
tendencially	1
teolytically	1
togather	1
top10	1
topoisomerase	1
turally	1
tutively	1
tvdv	1
twentyfold	1
type-4b	1
typicallydeterminedempirically	1
u.k.in	1
ubch5c	1
ube1l	1
ube2j2	1
ubiquitiously	1
uchl5	1
ultimatly	1
unacceptably	1
unbound	1
uncompletely	1
uncompromisingly	1
uncontrollably	1
undeniably	1
underground	1
turbidimetrically	1
tubulin	1
toposelectively	1
tubular	1
torsina	1
toward	1
traf-6	1
tragically	1
transbmchially	1