noun

This is a table of type noun and their frequencies. Use it to search & browse the list to learn more about your study carrel.

noun	frequency
virus	727
viruses	472
sequence	472
sequences	427
protein	401
gene	399
strains	356
amino	290
cells	278
acid	276
genome	258
analysis	258
codon	243
strain	241
genes	208
study	191
region	187
samples	184
°	178
species	158
usage	157
cell	151
infection	147
coronavirus	136
proteins	129
isolates	122
dna	121
type	120
host	119
influenza	112
structure	104
primers	104
bats	104
results	103
number	103
differences	102
min	101
site	101
sites	98
replication	98
coronaviruses	98
regions	97
nucleotides	95
disease	95
data	95
polymerase	93
group	93
changes	93
detection	92
reaction	92
bat	91
expression	89
antibodies	88
piglets	85
rnas	84
glycoprotein	83
genomes	82
diarrhea	82
domain	81
leader	80
bias	80
length	79
studies	79
mutations	78
table	75
primer	75
presence	74
position	70
ml	68
deletion	68
pigs	67
products	66
cdna	65
positions	65
isolation	64
culture	64
variation	63
substitutions	62
sequencing	62
chicken	62
spike	61
method	61
identity	61
epidemic	61
addition	61
assay	60
time	60
role	60
virulence	59
transcription	59
acids	59
groups	58
authors	58
sample	57
residues	56
genus	56
cases	54
base	54
amplification	54
date	54
membrane	54
infections	54
analyses	52
manufacturer	51
characterization	51
cattle	51
vaccine	50
swine	50
evolution	50
stem	49
end	49
content	49
receptor	48
comparison	47
vaccines	46
subunit	46
control	46
loop	45
dinucleotide	45
activity	45
reading	44
kit	44
accession	43
antibody	43
chickens	43
frame	43
gel	43
humans	43
members	43
homology	43
program	42
mrna	42
hairpin	42
tissue	41
case	41
plants	40
alignment	40
bank	40
similarity	40
title	40
version	39
software	39
serotype	39
outbreaks	39
motif	39
glycosylation	39
gastroenteritis	39
cord_uid	39
diversity	38
family	38
order	38
relationship	38
segment	38
structures	38
values	37
tree	37
test	37
specificity	37
s1	37
nucleocapsid	37
material	37
animals	37
range	36
adaptation	36
mutation	36
recombination	36
sensitivity	36
target	36
transmission	36
specimens	35
journal	35
size	34
shrna	34
pseudoknot	34
poultry	34
field	34
pathogenicity	33
pdcov	32
outbreak	32
trees	32
rate	32
transferase	32
value	31
titer	31
diarrhoea	31
days	31
contrast	31
consensus	31
prevalence	30
effect	30
numbers	30
plasmids	30
sense	30
reference	30
subisolates	30
system	30
veroe6	30
instructions	29
countries	29
dinucleotides	29
frequency	29
fusion	29
binding	29
orfs	29
serum	29
synthesis	29
template	29
transfection	29
selection	29
result	28
information	28
identification	28
fragments	28
formation	28
cycles	28
diagnosis	27
antigen	27
composition	27
function	27
domains	27
peptide	27
reactions	27
level	26
animal	26
birds	26
cap	26
codons	26
correlation	26
fragment	26
isolate	26
laboratory	26
protease	26
line	26
signs	26
work	26
medium	26
strand	26
terminal	26
plates	26
part	26
mortality	26
nucleotide	25
assays	25
characteristics	25
complex	25
development	25
envelope	25
hantavirus	25
hepatitis	25
bronchitis	25
patterns	25
relationships	25
report	25
research	25
s2	25
serotypes	25
titers	25
plasmid	25
inhibition	24
cluster	24
efficiency	24
electrophoresis	24
evidence	24
factor	24
post	24
period	24
properties	24
response	24
use	24
vole	24
methylation	23
amount	23
clade	23
inoculation	23
lineages	23
effects	23
motifs	23
residue	23
restriction	23
syndrome	23
total	23
phosphorylation	23
overlap	22
agent	22
article	22
concentration	22
distance	22
dogs	22
frameshift	22
hosts	22
immunity	22
mixture	22
pair	22
substitution	22
phage	22
voles	22
virion	22
years	22
process	22
pol	22
pig	22
bases	21
difference	21
diseases	21
epitopes	21
extraction	21
farms	21
feces	21
genera	21
interference	21
levels	21
symptoms	21
methods	21
variations	21
times	21
vector	21
signal	21
point	21
particles	21
kidney	20
ad	20
alignments	20
clones	20
clusters	20
deletions	20
enzyme	20
kda	20
'	20
kinase	20
mechanism	20
organization	20
pressure	20
product	20
protocol	20
strategy	20
majority	20
generation	19
chain	19
coding	19
conditions	19
eggs	19
ends	19
fact	19
frames	19
member	19
origin	19
passage	19
passages	19
picornaviruses	19
pseudoknots	19
stop	19
adenoviruses	18
buffer	18
cleavage	18
co	18
cultures	18
distribution	18
lung	18
extent	18
human	18
extension	18
methyl	18
subunits	18
turkey	18
tissues	18
temperature	18
model	18
sm	18
production	18
pairs	18
incubation	17
axis	17
basis	17
change	17
computer	17
duck	17
example	17
factors	17
frameshifting	17
attenuation	17
lineage	17
pedvs	17
loops	17
set	17
rna	17
tgev	17
pcr	17
novel	17
mouse	17
markers	17
ability	16
amplicons	16
blast	16
component	16
database	16
fatality	16
frequencies	16
occurrence	16
pathogens	16
populations	16
protection	16
reservoir	16
rs	16
segments	16
shift	16
swabs	16
poxviruses	16
cov	15
epitope	15
entry	15
ducks	15
adenovirus	15
conclusion	15
areas	15
amber	15
mammals	15
loss	15
findings	15
percentage	15
transcriptase	15
ppi	15
world	15
water	15
translation	15
vaccination	15
support	15
step	15
sha	15
year	15
dhav-1	14
hybridization	14
growth	14
fluid	14
exception	14
epidemiology	14
assembly	14
deltacoronavirus	14
clades	14
bootstrap	14
astroviruses	14
litter	14
insect	14
key	14
weeks	14
search	14
neutralization	14
treatment	14
terminus	14
surveillance	14
sh	14
source	14
resistance	14
replicase	14
portion	14
pattern	14
others	14
finding	13
nsp	13
limit	13
identities	13
hemagglutinin	13
form	13
optimization	13
distances	13
dilution	13
classification	13
cl6/07	13
agents	13
observation	13
tool	13
pathogen	13
tail	13
phages	13
vlps	13
variety	13
users	13
tests	13
variant	13
similarities	13
rt	13
risk	13
procedure	13
phylogenetic	13
interaction	12
enteritis	12
heptanucleotide	12
genotype	12
gag	12
features	12
f422	12
experiments	12
event	12
approach	12
determinant	12
day	12
cycle	12
avirulent	12
attachment	12
antisense	12
agarose	12
likelihood	12
junction	12
class	12
mechanisms	12
sizes	12
molecules	12
variants	12
understanding	12
types	12
surface	12
volume	12
substrate	12
subgroup	12
turkeys	12
seedlings	12
roles	12
respect	12
rates	12
proteases	12
prediction	12
pathogenesis	12
screening	12
events	11
lines	11
kb	11
insertion	11
induction	11
alphacoronaviruses	11
conservation	11
coli	11
cats	11
acknowledgments	11
nt	11
neighbor	11
parts	11
tract	11
ped	11
peptides	11
polyprotein	11
population	11
potential	11
proportion	11
reagent	11
reverse	11
rotavirus	11
summary	11
wells	11
transmembrane	11
dose	10
egg	10
gc%	10
interactions	10
glycoproteins	10
h.	10
homologies	10
design	10
determinants	10
bands	10
core	10
concentrations	10
cloning	10
capsid	10
calves	10
association	10
antisera	10
abundance	10
immunization	10
propagation	10
library	10
side	10
liver	10
variability	10
techniques	10
tag	10
supernatants	10
splice	10
sl	10
situation	10
technique	10
serine	10
points	10
paper	10
nomenclature	10
milk	10
mice	10
rodent	10
location	10
drift	9
cm	9
collection	9
comparisons	9
complement	9
display	9
files	9
dsrna	9
ethidium	9
guanine	9
immunofluorescence	9
caliciviruses	9
industry	9
advantages	9
bursal	9
bthev	9
bromide	9
blot	9
beginning	9
astrovirus	9
area	9
age	9
affinity	9
adv	9
activities	9
aa	9
#	9
importance	9
clustering	9
interest	9
processing	9
intestine	9
vp5	9
velifer	9
vectors	9
tube	9
termini	9
suppression	9
stretch	9
reservoirs	9
reports	9
ratio	9
rabbit	9
programs	9
termination	9
probe	9
nature	9
possibility	9
knowledge	9
lesions	9
lg	9
losses	9
load	9
need	9
neuraminidase	9
none	9
parvovirus	9
plot	9
elements	8
farm	8
embryo	8
emergence	8
epidemics	8
explanation	8
extracts	8
families	8
hr	8
fever	8
fluorescence	8
gamma	8
gels	8
guano	8
helicase	8
incidence	8
dehydration	8
electron	8
agreement	8
death	8
datasets	8
-1	8
absence	8
adult	8
insertions	8
antiserum	8
appearance	8
application	8
bathevs	8
brain	8
candidate	8
colony	8
combination	8
contents	8
controls	8
cross	8
increase	8
heat	8
insights	8
question	8
readthrough	8
retroviral	8
retroviruses	8
rnai	8
severity	8
shape	8
significance	8
spleen	8
supernatant	8
susceptibility	8
suspension	8
terms	8
trends	8
tropism	8
vp2	8
investigation	8
yeast	8
reactivity	8
signature	8
pseudoknotting	8
orf	8
marker	8
provinces	8
microscopy	8
monkey	8
nm	8
nsps	8
oligonucleotide	8
membranes	8
organisms	8
patient	8
patients	8
percent	8
piglet	8
pandemic	8
plant	8
hemagglutination	7
efforts	7
embryos	7
faeces	7
failure	7
figs	7
functions	7
gsjiii/07	7
hairpins	7
i	7
hev	7
investigations	7
lane	7
lengths	7
leukemia	7
libraries	7
life	7
discovery	7
dpi	7
accessory	7
diarrheic	7
determination	7
map	7
a.	7
advs	7
amounts	7
assistance	7
availability	7
axes	7
bathev	7
blood	7
challenge	7
chest	7
chicks	7
construction	7
contact	7
cytoplasm	7
deficiency	7
degree	7
manner	7
stability	7
mix	7
reagents	7
reasons	7
replicates	7
requirements	7
residuals	7
rest	7
ribosome	7
rise	7
sets	7
sows	7
status	7
stool	7
sub	7
systems	7
technology	7
well	7
®	7
modification	7
reason	7
sei	7
qpcr	7
peritonitis	7
protocols	7
monolayer	7
month	7
ns1	7
one	7
orange	7
particle	7
pastv	7
molecule	7
phase	7
phenomenon	7
plate	7
polypeptides	7
predictions	7
prevention	7
problem	7
graph	6
environment	6
enzymes	6
existence	6
feature	6
flask	6
forces	6
fraction	6
gold	6
helix	6
groupings	6
gut	6
divergence	6
history	6
hypothesis	6
inhibitor	6
inoculum	6
instance	6
ecology	6
lysis	6
dilutions	6
differentiation	6
accordance	6
ampli	6
bacteria	6
biology	6
boar	6
boars	6
bp	6
cat	6
cavity	6
characterizations	6
chinju99	6
classes	6
complexes	6
consequence	6
databases	6
denaturation	6
density	6
light	6
start	6
mutability	6
room	6
route	6
saline	6
sampling	6
scale	6
series	6
sheep	6
spread	6
stacking	6
weight	6
summer	6
tables	6
testing	6
trachea	6
utrs	6
variola	6
vivo	6
mutagenesis	6
roost	6
templates	6
responses	6
preparedness	6
regulation	6
observations	6
orthohantavirus	6
parapoxviruses	6
pathway	6
picornavirus	6
precursor	6
pathotype	6
prnat-3	6
procedures	6
province	6
prv	6
questions	6
receptors	6
probes	6
recovery	6
element	5
geese	5
fipv	5
ferrets	5
experiment	5
equivalent	5
dnas	5
drug	5
dog	5
distemper	5
glycerol	5
directions	5
genotypes	5
iii	5
guinea	5
half	5
hand	5
hantaviruses	5
head	5
health	5
heptad	5
ii	5
inability	5
insight	5
interferon	5
interspecies	5
deviation	5
diameter	5
antibiotics	5
degradation	5
branch	5
1ab	5
3a	5
8)	5
accumulation	5
adenine	5
algorithms	5
amplifications	5
ancestor	5
lack	5
applications	5
attempt	5
biases	5
brl/87	5
decline	5
calf	5
capping	5
capture	5
centrifugation	5
citrus	5
clone	5
colonies	5
con	5
country	5
cysteine	5
cytosine	5
dataset	5
lab	5
flasks	5
lamp	5
primate	5
proc	5
profiles	5
projections	5
purification	5
recognition	5
regard	5
ribose	5
rpv	5
solution	5
spring	5
stalk	5
streptomycin	5
strip	5
subisolate	5
taq	5
threonine	5
tpg	5
transcripts	5
trypsin	5
turn	5
units	5
vaccinia	5
virology	5
vp1	5
week	5
winter	5
locations	5
pro	5
temperatures	5
present	5
ones	5
machinery	5
pox	5
maintenance	5
manufacture	5
means	5
mismatches	5
mm	5
nacl	5
ng	5
night	5
nodes	5
nsy	5
oligo	5
morbidity	5
panel	5
pfu	5
polyomaviruses	5
polymorphism	5
phylogeny	5
polypeptide	5
phosphate	5
phosphoprotein	5
penicillin	5
pathotypes	5
parallel	5
papain	5
fowl	4
freeze	4
formamide	4
fields	4
examples	4
equipment	4
entomopoxviruses	4
enteritidis	4
dye	4
enrichment	4
efficiencies	4
dynamics	4
disruption	4
dntp	4
dni	4
gc	4
displacement	4
ga98a	4
inactivation	4
genetics	4
goat	4
insert	4
detail	4
inhibitors	4
individuals	4
indications	4
impact	4
immunohistochemistry	4
immunodeficiency	4
ice	4
hour	4
gz902	4
grouping	4
groove	4
grant	4
government	4
digestion	4
amantadine	4
description	4
antigenicity	4
birnaviruses	4
band	4
b3	4
asparagine	4
aromaticity	4
arg	4
antigens	4
adv1	4
deer	4
adjuvant	4
activation	4
acknowledgements	4
abs	4
2c	4
1:1000	4
intensity	4
blotting	4
brasiliensis	4
brief	4
bursa	4
cycler	4
csfvs	4
criteria	4
cpg	4
cow	4
course	4
copy	4
contrary	4
columns	4
city	4
cause	4
cation	4
casein	4
cartography	4
c.	4
inspection	4
months	4
inventory	4
retrovirus	4
sialic	4
serology	4
s1a	4
rule	4
round	4
rns	4
review	4
requirement	4
publication	4
repeat	4
release	4
recommendations	4
rat	4
rank	4
quantity	4
quality	4
sodium	4
staining	4
standard	4
stock	4
μl	4
js2004	4
virions	4
tumor	4
trapping	4
transfer	4
transcript	4
tools	4
threat	4
thermocycler	4
survey	4
subpopulation	4
sublineage	4
subgenotypes	4
stocks	4
pyv	4
swab	4
prototype	4
models	4
mid	4
methyltransferase	4
methionine	4
metal	4
measure	4
matrix	4
materials	4
manuscript	4
ligation	4
licence	4
leporipoxviruses	4
layers	4
profile	4
kobuvirus	4
lavage	4
mixtures	4
lm	4
platform	4
peroxidase	4
processes	4
pm	4
plots	4
place	4
piece	4
poults	4
phenylalanine	4
polyproteins	4
paramyxoviruses	4
palm	4
orthopoxviruses	4
objective	4
nucleus	4
mutants	4
mutant	4
exchanges	3
fecal	3
ferret	3
fibroblast	3
detachment	3
filter	3
fluorescent	3
folding	3
evaluation	3
fruit	3
funding	3
examination	3
drugs	3
error	3
envelop	3
effort	3
efficacy	3
editor	3
duration	3
diversities	3
district	3
dissection	3
discussions	3
direction	3
glycine	3
differential	3
generations	3
improvement	3
glycosidase	3
implications	3
kinds	3
definition	3
japonensis	3
input	3
initiator	3
initiation	3
inference	3
infectivity	3
indicator	3
indication	3
index	3
incubator	3
immunoglobulin	3
goal	3
images	3
illumination	3
igg	3
hydrophobicity	3
house	3
horseradish	3
homolog	3
guidelines	3
guanines	3
gravy	3
grapefruit	3
gradient	3
degrees	3
bar	3
damage	3
anatipestifer	3
bond	3
body	3
bath	3
basepairing	3
bamhi	3
baculovirus	3
author	3
atmosphere	3
assessment	3
asia-2	3
arrow	3
appetite	3
amplicon	3
boxes	3
aminopeptidase	3
alternative	3
alterations	3
algorithm	3
ages	3
actin	3
abundances	3
4b	3
1a	3
1990s	3
-ntr	3
ladder	3
box	3
broiler	3
curve	3
club	3
criterion	3
cows	3
covariations	3
contigs	3
contamination	3
condition	3
concern	3
colostrum	3
color	3
codonw	3
coauthors	3
coa	3
civets	3
broth	3
chromatography	3
chance	3
challenges	3
cg	3
cds	3
cd	3
cave	3
causes	3
calculation	3
ca	3
burden	3
buds	3
laboratories	3
polyacrylamide	3
leaves	3
state	3
tgevs	3
tetrad	3
terminology	3
taxonomy	3
targets	3
swo	3
survival	3
subtype	3
subset	3
subgenotype	3
stomatitis	3
stems	3
stalling	3
sacrimontis	3
spots	3
specimen	3
speci	3
space	3
slippage	3
sides	3
sheet	3
server	3
sequencer	3
seedling	3
sec	3
sea	3
thirds	3
thv	3
thymines	3
titration	3
µg	3
zj2000	3
yellows	3
workflow	3
way	3
vomiting	3
volumes	3
view	3
verodogslam	3
uv	3
user	3
usb	3
uracil	3
turns	3
trna	3
triplicate	3
triphosphatase	3
treatments	3
transmissibility	3
transformation	3
tracheal	3
tpa	3
toxicity	3
titres	3
titre	3
score	3
third	3
rpm	3
mother	3
parameter	3
outgroup	3
outcome	3
oligonucleotides	3
numbering	3
nucleoprotein	3
notion	3
neonates	3
necrosis	3
name	3
multiplex	3
multibasic	3
mortem	3
pathogenecity	3
molluscum	3
modifications	3
mink	3
microscope	3
mfpyv	3
mem	3
maternity	3
maps	3
mab	3
m7	3
lymphocyte	3
rounds	3
passaging	3
lion	3
pathways	3
probability	3
rodents	3
risks	3
ribonucleoprotein	3
resemblance	3
relatedness	3
reassortment	3
rabies	3
quantification	3
pseudorabies	3
promoter	3
proliferation	3
problems	3
lime	3
probabilities	3
pneumonia	3
principles	3
pellets	3
phenomena	3
phosphatase	3
pl1	3
phtgev	3
polymerases	3
pools	3
predication	3
preference	3
preparations	3
endoplasmic	2
esterase	2
establishment	2
erythrocytes	2
enigmas	2
energies	2
elucidation	2
endemicity	2
encoding	2
encephalomyelitis	2
emphasis	2
exceptions	2
estimates	2
fashion	2
exoribonuclease	2
exploration	2
eye	2
facility	2
factories	2
ej1	2
fauna	2
favor	2
fcov.	2
fibroma	2
filters	2
finder	2
fitness	2
elongation	2
droppings	2
effusion	2
effectiveness	2
decades	2
deciliation	2
decontamination	2
decreases	2
defense	2
delivery	2
deltacoronaviruses	2
dendrogram	2
dengue	2
depression	2
depth	2
deubiquitinating	2
dideoxy	2
discrepancies	2
fixation	2
dntps	2
dolphin	2
doses	2
downer	2
downstream	2
dozen	2
dpi/81	2
ducklings	2
dy(t	2
editing	2
dithiothreitol	2
islands	2
flocks	2
inertia	2
hexamer	2
hills	2
isotype	2
hpi	2
hq916314	2
hunting	2
hvrs	2
hydrophilicity	2
hydroxyl	2
hyperplasia	2
immunizations	2
industries	2
infant	2
herds	2
infiltration	2
inflammation	2
inhabitants	2
insects	2
instability	2
interests	2
intervals	2
intestines	2
investigators	2
ion	2
island	2
deaths	2
herpesviruses	2
herd	2
fluids	2
glasshouse	2
foot	2
force	2
formalin	2
format	2
forms	2
forward	2
future	2
gallus	2
gaps	2
gc12s	2
gibcobrl	2
glass	2
glucose	2
hepaciviruses	2
glutamine	2
goats	2
governorate	2
graft	2
grafting	2
graphs	2
gun	2
gz29112	2
h5	2
harbor	2
help	2
helper	2
debris	2
candidates	2
dearth	2
attributes	2
analogy	2
ancestors	2
antagonist	2
antigenically	2
antigenome	2
approx	2
arrangement	2
aspects	2
assumption	2
asterisks	2
atrophy	2
attempts	2
auto	2
br1/	2
average	2
avoidance	2
b1	2
baculoviruses	2
bark	2
barns	2
basal	2
beta	2
bicarbonate	2
block	2
borders	2
bottom	2
ampicillin	2
alphacoronavirues	2
alpha	2
allantoic	2
-3	2
-ends	2
-speci	2
11th	2
1980s	2
1b	2
2l	2
3c	2
7ab	2
\1	2
accuracy	2
acetate	2
adaptations	2
adenines	2
adenosine	2
adjustment	2
aerosol	2
af321056	2
affiliations	2
agar	2
agrose	2
aid	2
aim	2
aims	2
aliquots	2
bovine	2
breed	2
ddxgq	2
copyright	2
confidence	2
confirmation	2
conflict	2
confluence	2
constraints	2
contagiosum	2
context	2
contract	2
contributions	2
convenience	2
coordinates	2
copies	2
corona	2
camp	2
correlations	2
correspondence	2
cost	2
coverage	2
coverslips	2
cpc	2
credit	2
crossover	2
ctaaac	2
cycling	2
cytochrome	2
cytosines	2
compositions	2
components	2
complications	2
complexity	2
capacity	2
capital	2
care	2
cc	2
cdnas	2
cesium	2
changing	2
chaperone	2
characteristic	2
chemistry	2
chimpanzee	2
chip	2
chloride	2
chloroform	2
circovirus	2
cities	2
claims	2
classifications	2
code	2
codes	2
coil	2
coinfection	2
colon	2
column	2
community	2
isolator	2
manifestations	2
issue	2
silico	2
sector	2
separation	2
serogroup	2
serogroups	2
settings	2
sharing	2
shedding	2
shifting	2
shock	2
shot	2
shrinkage	2
silencing	2
simplicity	2
season	2
sister	2
sod	2
sources	2
sow	2
spacer	2
speciation	2
spectrum	2
speed	2
spikes	2
spite	2
splicing	2
spot	2
seasons	2
salt	2
raccoon	2
replacement	2
ranks	2
rapidity	2
ratios	2
raxml	2
rdrp	2
recombinations	2
recommendation	2
reductions	2
redundancy	2
relation	2
reliability	2
repair	2
representation	2
s1126	2
representative	2
reproduction	2
respiratory	2
reticulum	2
reviews	2
rinderpest	2
rnase	2
roots	2
rootstock	2
rotor	2
rules	2
s)(r	2
ssrna	2
stages	2
states	2
washing	2
ubiquity	2
ultraviolet	2
unit	2
utility	2
v3.1	2
vampire	2
versions	2
vice	2
villous	2
virome	2
voltage	2
war	2
web	2
statistic	2
west	2
whale	2
widespread	2
wildlife	2
wpi	2
yatapox	2
yatapoxviruses	2
ygdd	2
zipper	2
À	2
×	2
jq696855	2
trs	2
trnas	2
trimer	2
triad	2
stemloops	2
steps	2
strategies	2
strips	2
subclade	2
subclades	2
subgroups	2
sublineages	2
substitute	2
subtypes	2
success	2
suggestions	2
switch	2
tags	2
term	2
testis	2
text	2
therapy	2
tottori2/2014	2
tr	2
transfections	2
transport	2
transposon	2
trays	2
trend	2
rain	2
tracts	2
rabbits	2
module	2
measures	2
mechanism(s	2
media	2
metagenomic	2
microbats	2
microliters	2
microtiter	2
middle	2
migration	2
minute	2
mmtv	2
mock	2
molluscipoxviruses	2
onset	2
mouth	2
n66s	2
names	2
nasal	2
ncrs	2
nephritis	2
neuros1	2
node	2
nonhuman	2
north	2
note	2
nsp13	2
measurement	2
maturation	2
match	2
master	2
jq696856	2
quantities	2
kb8	2
kbp	2
kind	2
lanes	2
ld3	2
leaf	2
leucine	2
ligands	2
ligase	2
literature	2
livers	2
loading	2
loads	2
log	2
lot	2
lymph	2
lysate	2
lysine	2
machine	2
magnesium	2
mamastroviruses	2
manipulations	2
mass	2
nts	2
lysates	2
opportunity	2
predominance	2
phylogenies	2
pi	2
pl2	2
plasma	2
pmol/µl	2
poly	2
possibilities	2
pouch	2
power	2
poxvirus	2
precipitate	2
precision	2
preparation	2
phenotype	2
presentation	2
programme	2
progress	2
project	2
promoters	2
proposal	2
ps	2
ptmk22	2
puppies	2
organs	2
purpose	2
pyrophosphate	2
phenotypes	2
progeny	2
phenol	2
papillomavirus	2
outliers	2
orthologs	2
ph.	2
origins	2
output	2
outside	2
overview	2
p(n	2
p53	2
package	2
pal	2
panning	2
papers	2
p.	2
pastk-76	2
penetration	2
ph	2
pg	2
permission	2
pastvs	2
people	2
periods	2
peafowl	2
path	2
pdcov.	2
endonucleases	1
egress	1
ectodomain	1
ed	1
ef	1
efficacies	1
endonuclease	1
eforg	1
eld	1
eiav	1
endoparasites	1
eld(50	1
eld50	1
elimination	1
enc	1
encephalitis	1
ebolavirus	1
ecori	1
dt14v	1
eaves	1
e?g	1
dodecylsulfate	1
donor	1
energy	1
dot	1
dpresence	1
drawback	1
drawbacks	1
droplet	1
dt	1
dumbbell	1
duplex	1
duplexes	1
dwarf	1
dysentery	1
dysgwdst	1
e2f	1
e3	1
endoribonuclease	1
everything	1
engine	1
ether	1
eu095850	1
eu418976	1
evasion	1
evidences	1
exchange	1
excitation	1
exhibit	1
exibility	1
experimentation	1
exposure	1
express	1
expressions	1
extensions	1
extents	1
extract	1
document	1
extremes	1
etiology	1
estimator	1
engineering	1
estimate	1
enhancement	1
enigma	1
enteropathogenicity	1
enterovirus	1
entomopox-	1
entrance	1
entries	1
environments	1
epitome	1
epv	1
equilibrium	1
equine	1
equivalents	1
eradication	1
es/	1
escherichia	1
est	1
documentation	1
culturing	1
dnapurification	1
crossovers	1
cryo	1
crypt	1
ct	1
cultivation	1
cup	1
custom	1
cv	1
cwl040/98	1
cyanol	1
cylanol	1
cys623	1
cytocidal	1
cytokines	1
cytopathogenicity	1
damages	1
dastvs	1
datp	1
crossreactivity	1
crinkle	1
daytime	1
credibility	1
f0	1
corollary	1
corporation	1
cos7	1
costs	1
cotton	1
counterpart	1
counterparts	1
counting	1
covalent	1
covariance	1
cover	1
covs	1
cowpox	1
cp	1
cpm	1
cpv-2	1
days–3	1
deal	1
dn1	1
difluoride	1
dihydrochloride	1
diii	1
dimension	1
dioxide	1
dis	1
disadvantage	1
disaster	1
discoideum	1
discrepancy	1
discussion	1
dish	1
disinfection	1
disorders	1
disseminating	1
dissemination	1
distress	1
distributions	1
digestive	1
difficulty	1
declaration	1
diagram	1
delay	1
demands	1
denaturating	1
dendrograms	1
derivation	1
dermis	1
descriptions	1
desig	1
desktop	1
destruction	1
details	1
detections	1
determinations	1
deubuquitinating	1
developments	1
deviations	1
dhav-3	1
exudate	1
homologues	1
f1	1
heterotrimer	1
highthroughput	1
histidine	1
histocompatibility	1
hits	1
hl	1
hm447045	1
hm447046	1
hm756259	1
hn-2014	1
holder	1
cord-344558	1
homotrimers	1
horses	1
hospital	1
hospitals	1
household	1
hq529709	1
hexanucleotide	1
heterogeneity	1
hra	1
herpesvirus	1
guangdong/1/1996	1
guanidinium	1
gures	1
h1	1
habitat	1
haemagglutinating	1
hallmark	1
harp	1
hcov)-229e	1
heights	1
helices	1
hemagglutinins	1
hemoagglutinin	1
hepes	1
heptameric	1
heptanucleotides	1
heptapeptide	1
hq916316	1
http://cbrg.inf.ethz.ch/	1
f2	1
ii-2	1
illness	1
illnesses	1
imitation	1
immune	1
immunisation	1
immunogens	1
immunopathology	1
immunoperoxidase	1
impacts	1
implementation	1
incision	1
inclination	1
inclusion	1
incongruence	1
inconsistencies	1
indices	1
indonesia/5/2005-and	1
ikkonikovi	1
igy	1
http://evolve.zoo.ox.ac.uk/	1
igv	1
http://www.kazusa.or.jp/codon/	1
https	1
husbandry	1
hutnf	1
hybridists	1
hybridoma	1
hydrolysate	1
hypercytokinemia	1
hyperthermia	1
hypervariable	1
i0	1
i1	1
i4tkdgy4	1
icedihm2	1
idea	1
ideas	1
identi-	1
gu226951	1
gtg	1
gt	1
fetuses	1
film	1
finger	1
finish	1
fip	1
fj571067	1
flaviviruses	1
floor	1
folds	1
forecasting	1
forks	1
formaldehyde	1
foundations	1
fours	1
fr/	1
fractionation	1
fractions	1
frugiperda	1
fidelity	1
females	1
ground	1
felv	1
f3	1
f5f8598f9aff41bfddfd8c731f3756b85fedba37	1
f?l	1
facilities	1
facts	1
failures	1
farming	1
farrow	1
fea	1
feasibility	1
fecov	1
feed	1
feeder	1
feedlots	1
felid	1
feline	1
fellows	1
furin	1
g418	1
gagpol	1
gain	1
gl1201	1
gland	1
glycans	1
glycol	1
glyoxal	1
goose	1
gpc	1
gq504720	1
gq504721	1
gq504722	1
gq504724	1
gq504725	1
grandis	1
grants	1
green	1
grey	1
grid	1
gfcov	1
germ	1
geometry	1
genebased	1
gal	1
gammacoronaviruses	1
gammacov	1
gammaherpesvirus	1
gap	1
gar	1
gas	1
generecombinant	1
gentamycin	1
geneticin	1
genocluster	1
genomic	1
genomics	1
genomospecies	1
genotyping	1
gens	1
cord-348896-a2mjj5dt	1
breeder	1
cord-311712-lkvt9slp	1
af262030	1
af281651	1
af321055	1
af413070	1
af416626	1
af454945	1
af455136	1
af464901	1
agencies	1
agglutination	1
agonists	1
aj249517	1
aj249523	1
aj277801	1
aj310185	1
alanine	1
albumin	1
alcohol	1
af279288	1
af247006	1
amalgamation	1
af165150	1
af076236	1
af083094	1
af091097	1
af091098	1
af091507	1
af094814	1
af094815	1
af094816	1
af094817	1
af094818	1
af094819	1
af133904	1
af155123	1
af159207	1
af159211	1
af159212	1
af159214	1
alteration	1
ambiguity	1
af076227	1
api	1
apparatus	1
approaches	1
approval	1
approximate	1
arginine	1
array	1
arrival	1
arrows	1
arterivirus	1
arteriviruses	1
aspect	1
assemblage	1
assignment	1
associates	1
associations	1
attic	1
attribute	1
apoptosis	1
ap008581	1
ammonium	1
ap006559	1
amoeba	1
amphotericin	1
analogs	1
analogues	1
anchor	1
anchors	1
and.aln	1
anemia	1
annealingextension	1
anneals	1
annotation	1
anorexia	1
antagonists	1
antelopes	1
anticodon	1
antivirals	1
ap006558	1
af076235	1
af076226	1
cord-311204-fc12f845	1
12th	1
1:5000	1
2.1-topo	1
2.3.4	1
200aa	1
29,33±37	1
29th	1
2nd	1
3ab	1
5b	1
7th	1
8u	1
\10-day	1
a(h5	1
a75/17	1
a:1008099209942	1
a:1008105004407	1
a:1008179208217	1
1970s	1
-ttgaatcattaaacagac-3	1
aa173	1
-tatagcagatgatagaattaaca	1
+	1
-10	1
-2	1
-23.86	1
-5	1
-6	1
-7	1
-70	1
-9	1
-co	1
-cttaacaa	1
-cttaacaa-3	1
-ctttacaa	1
-gtaggtattcttacttcacgta-3	1
-o)-methyltransferase	1
-omethyl	1
-portions	1
aa115	1
aa179	1
af076223	1
acetyl	1
acquisition	1
act	1
actinomycin	1
adaptability	1
adapter	1
address	1
adenosyl	1
advance	1
advances	1
advantage	1
advices	1
aetiology	1
af006699	1
af029248	1
af033000	1
af051837	1
af051839	1
acquaintance	1
acetone	1
aaa	1
account	1
aac	1
aactaaac	1
ab	1
ab024076	1
ab037272	1
ab084788	1
ab468064	1
ab551132	1
abattoir	1
abbreviations	1
abilities	1
abstracts	1
acc	1
acceptor	1
access	1
accessibility	1
accessions	1
australian	1
autumn	1
avastroviruses	1
chimera	1
cholerae	1
chordopoxvirus	1
ci	1
circle	1
circoviruses	1
circularization	1
circulation	1
citrate	1
cleavability	1
climate	1
clue	1
clustal_x	1
coat	1
cocirculation	1
coevolution	1
coexistence	1
coinfections	1
choice	1
children	1
collapse	1
chemical	1
cassette	1
catagccaggataagccggtc3	1
cations	1
cattles	1
cauliflower	1
causal	1
causation	1
caves	1
cavities	1
ccastv-2	1
ce	1
centrifuge	1
cerevisiae	1
cfdss	1
character	1
cheetah	1
chelate	1
collaborators	1
colleagues	1
avian	1
consist	1
constant	1
constraint	1
constructs	1
continuity	1
contribution	1
contributor	1
conversion	1
cooperativity	1
copies/µl	1
cord-025704-icedihm2	1
cord-263489-i4tkdgy4	1
cord-269720-o81j3d1j	1
cord-272693	1
cord-295554	1
cord-299573-vq6ckqtd	1
cord-303672-ujp78213	1
cord-307580-nokd5kmx	1
consortium	1
consent	1
colors	1
conjunctivitis	1
colostrums	1
combinations	1
committee	1
compartment	1
competition	1
complementarity	1
completion	1
complexities	1
concept	1
concepts	1
conclusions	1
condons	1
conflicts	1
confluent	1
conformation	1
congestion	1
conjunction	1
casei	1
carrot	1
carriers	1
bastk08/1	1
bastk08–2	1
bastk08–51	1
bcvs	1
bean	1
beet	1
behavior	1
behaviour	1
belief	1
beluga	1
benefits	1
bf00570024	1
bf01702878	1
bfor	1
bile	1
bioedit	1
biopanning	1
biotin	1
bastk08/51	1
basin	1
carp	1
basepairs	1
award	1
ay134875	1
ay278491	1
ay394850	1
ay463059	1
ay653206	1
baboon	1
back	1
background	1
backward	1
backyard	1
bacteriophage	1
badger	1
balti	1
barrier	1
barriers	1
bars	1
bird	1
birth	1
blastn	1
blocking	1
caesarean	1
calicivirus	1
callus	1
camp-	1
cap-0	1
capes	1
capripox-	1
capripoxand	1
capripoxviruses	1
carbon	1
carbonate	1
carboxyl	1
carcasses	1
card	1