This is a table of type adverb and their frequencies. Use it to search & browse the list to learn more about your study carrel.
adverb | frequency |
---|---|
also | 22878 |
however | 11617 |
well | 8575 |
highly | 5320 |
respectively | 5255 |
therefore | 5064 |
previously | 4866 |
significantly | 4819 |
recently | 3614 |
even | 3290 |
still | 2673 |
directly | 2670 |
furthermore | 2644 |
moreover | 2414 |
together | 2323 |
first | 2317 |
currently | 2213 |
often | 2150 |
approximately | 2059 |
interestingly | 1984 |
specifically | 1898 |
nt | 1783 |
less | 1781 |
especially | 1732 |
now | 1701 |
double | 1685 |
finally | 1606 |
yet | 1574 |
rather | 1548 |
prior | 1540 |
relatively | 1529 |
subsequently | 1510 |
mainly | 1473 |
particularly | 1434 |
indeed | 1366 |
much | 1347 |
similarly | 1337 |
additionally | 1322 |
generally | 1315 |
likely | 1308 |
potentially | 1305 |
rapidly | 1293 |
far | 1288 |
usually | 1275 |
probably | 1272 |
later | 1249 |
strongly | 1230 |
single | 1189 |
efficiently | 1180 |
fully | 1164 |
least | 1134 |
thereby | 1131 |
clearly | 1128 |
closely | 1110 |
newly | 1091 |
already | 1082 |
alone | 1078 |
almost | 1056 |
widely | 1030 |
completely | 986 |
commonly | 980 |
differentially | 975 |
hence | 967 |
successfully | 964 |
clinically | 907 |
frequently | 907 |
possibly | 896 |
partially | 888 |
instead | 869 |
initially | 868 |
long | 858 |
typically | 843 |
ns3 | 840 |
primarily | 824 |
nevertheless | 814 |
effectively | 795 |
importantly | 784 |
largely | 768 |
upstream | 750 |
statistically | 729 |
genetically | 727 |
next | 720 |
immediately | 714 |
downstream | 706 |
mostly | 702 |
briefly | 695 |
worldwide | 692 |
notably | 691 |
experimentally | 682 |
simultaneously | 676 |
naturally | 669 |
just | 662 |
negatively | 651 |
early | 645 |
independently | 623 |
easily | 616 |
slightly | 606 |
positively | 595 |
greatly | 590 |
consequently | 589 |
extremely | 578 |
poorly | 571 |
encephalitis | 570 |
perhaps | 564 |
better | 545 |
readily | 544 |
selectively | 540 |
overall | 533 |
alternatively | 527 |
predominantly | 525 |
twice | 523 |
exclusively | 523 |
namely | 514 |
nearly | 507 |
always | 503 |
functionally | 484 |
longer | 457 |
sometimes | 451 |
overnight | 445 |
extensively | 445 |
quite | 440 |
presumably | 440 |
earlier | 437 |
otherwise | 436 |
normally | 436 |
back | 433 |
structurally | 429 |
ultimately | 419 |
apparently | 415 |
chemically | 406 |
surprisingly | 398 |
originally | 398 |
critically | 398 |
daily | 396 |
commercially | 392 |
dramatically | 383 |
best | 381 |
apart | 375 |
randomly | 374 |
consistently | 369 |
eventually | 366 |
substantially | 366 |
remarkably | 363 |
preferentially | 357 |
accordingly | 357 |
broadly | 354 |
separately | 343 |
simply | 333 |
second | 331 |
regardless | 326 |
ago | 325 |
markedly | 320 |
quickly | 319 |
dsdna | 314 |
covalently | 312 |
never | 311 |
essentially | 309 |
actively | 308 |
persistently | 305 |
forward | 303 |
likewise | 297 |
collectively | 297 |
indirectly | 290 |
considerably | 288 |
biologically | 288 |
equally | 287 |
individually | 286 |
stably | 286 |
nonetheless | 284 |
routinely | 281 |
unfortunately | 279 |
severely | 278 |
increasingly | 278 |
tightly | 275 |
necessarily | 269 |
enough | 269 |
actually | 269 |
away | 267 |
orally | 267 |
around | 265 |
conversely | 255 |
rarely | 252 |
accurately | 249 |
correctly | 246 |
transiently | 245 |
continuously | 244 |
soon | 243 |
globally | 241 |
elsewhere | 240 |
entirely | 238 |
somewhat | 236 |
serially | 222 |
carefully | 220 |
ribavirin | 218 |
partly | 217 |
herein | 217 |
ever | 207 |
besides | 206 |
virtually | 205 |
gradually | 205 |
solely | 201 |
altogether | 197 |
manually | 197 |
firstly | 196 |
differently | 195 |
kindly | 194 |
properly | 193 |
sufficiently | 191 |
thereafter | 190 |
precisely | 186 |
n't | 184 |
evolutionarily | 184 |
slowly | 177 |
virally | 175 |
roughly | 175 |
certainly | 175 |
strictly | 174 |
constitutively | 173 |
strikingly | 173 |
close | 172 |
intrinsically | 171 |
potently | 170 |
locally | 170 |
systematically | 168 |
intranasally | 166 |
occasionally | 165 |
distantly | 165 |
phylogenetically | 164 |
faster | 164 |
theoretically | 164 |
obviously | 163 |
meanwhile | 163 |
late | 157 |
chronically | 155 |
transcriptionally | 150 |
either | 150 |
progressively | 149 |
regularly | 148 |
online | 147 |
spontaneously | 144 |
quantitatively | 140 |
terminally | 139 |
moderately | 138 |
weakly | 137 |
uniquely | 136 |
exactly | 136 |
translationally | 135 |
live | 135 |
intriguingly | 132 |
third | 131 |
lastly | 131 |
short | 129 |
fluorescently | 128 |
traditionally | 125 |
sequentially | 123 |
right | 123 |
historically | 123 |
presently | 122 |
fast | 122 |
annually | 122 |
totally | 121 |
publicly | 121 |
irrespective | 121 |
heavily | 121 |
drastically | 121 |
freshly | 119 |
repeatedly | 118 |
secondly | 117 |
physically | 116 |
unexpectedly | 114 |
thoroughly | 114 |
retrospectively | 113 |
serologically | 111 |
nowadays | 111 |
massively | 111 |
urgently | 110 |
systemically | 108 |
fairly | 107 |
automatically | 107 |
intravenously | 106 |
catalytically | 106 |
versa | 106 |
nsp10 | 106 |
constantly | 105 |
reliably | 104 |
minimally | 104 |
dsrna | 104 |
mutually | 103 |
absolutely | 103 |
outside | 102 |
ideally | 100 |
spatially | 99 |
comparatively | 99 |
shortly | 98 |
reverse | 97 |
internally | 97 |
viral | 95 |
uniformly | 95 |
freely | 95 |
antigenically | 95 |
physiologically | 90 |
interferon | 90 |
abundantly | 90 |
dynamically | 89 |
undoubtedly | 89 |
synergistically | 87 |
hardly | 86 |
immunologically | 86 |
truly | 84 |
enzymatically | 84 |
artificially | 83 |
appropriately | 83 |
computationally | 82 |
economically | 81 |
lower | 80 |
near | 79 |
inversely | 79 |
ubiquitously | 79 |
therapeutically | 78 |
proteolytically | 78 |
half | 78 |
seemingly | 76 |
merely | 76 |
unusually | 75 |
therein | 75 |
perfectly | 75 |
intracellularly | 75 |
afterwards | 75 |
morphologically | 74 |
preferably | 73 |
concomitantly | 72 |
along | 72 |
profoundly | 71 |
higher | 70 |
basically | 70 |
acutely | 70 |
visually | 69 |
principally | 69 |
formerly | 69 |
comprehensively | 69 |
specially | 68 |
exceptionally | 67 |
concurrently | 67 |
wide | 67 |
incompletely | 67 |
temporally | 66 |
safely | 66 |
reasonably | 66 |
prospectively | 66 |
inherently | 66 |
geographically | 65 |
correspondingly | 65 |
closer | 64 |
mildly | 64 |
rationally | 64 |
universally | 64 |
subcutaneously | 63 |
densely | 63 |
metabolically | 63 |
reproducibly | 61 |
really | 61 |
thereof | 60 |
intraperitoneally | 60 |
adequately | 60 |
practically | 59 |
exponentially | 58 |
barely | 58 |
mechanically | 58 |
qualitatively | 58 |
linearly | 57 |
formally | 57 |
deeply | 57 |
intensively | 56 |
unambiguously | 55 |
temporarily | 55 |
explicitly | 55 |
competitively | 54 |
aside | 54 |
marginally | 54 |
somehow | 53 |
lncrnas | 53 |
biochemically | 53 |
internationally | 52 |
thermodynamically | 51 |
robustly | 51 |
ifit2 | 51 |
gently | 51 |
cantly | 51 |
capsid | 50 |
dependently | 50 |
hopefully | 50 |
reversibly | 50 |
steadily | 49 |
sexually | 49 |
periodically | 49 |
biorxiv | 49 |
technically | 48 |
taxonomically | 48 |
optimally | 48 |
fundamentally | 48 |
reportedly | 47 |
medically | 47 |
permanently | 47 |
cooperatively | 47 |
singly | 47 |
whereas | 47 |
tentatively | 47 |
productively | 46 |
mechanistically | 46 |
high | 46 |
curiously | 46 |
histologically | 45 |
hereafter | 45 |
gratefully | 45 |
putatively | 45 |
vrna | 45 |
vertically | 44 |
though | 44 |
ssdna | 44 |
schematically | 44 |
low | 44 |
endogenously | 44 |
ectopically | 44 |
classically | 44 |
adversely | 44 |
maybe | 43 |
conceivably | 43 |
exogenously | 43 |
phenotypically | 43 |
qpcr | 43 |
seriously | 43 |
forth | 42 |
evidently | 42 |
conclusively | 42 |
bacterially | 42 |
ahead | 42 |
definitively | 41 |
continually | 41 |
inevitably | 41 |
empirically | 41 |
intimately | 41 |
ill | 40 |
deep | 40 |
definitely | 40 |
evenly | 40 |
externally | 40 |
unequivocally | 40 |
invariably | 40 |
mavs | 40 |
noticeably | 40 |
sharply | 40 |
fortunately | 39 |
distinctly | 39 |
energetically | 39 |
fine | 39 |
vastly | 39 |
inside | 39 |
semi | 39 |
weekly | 39 |
latently | 39 |
molecularly | 38 |
free | 38 |
arguably | 38 |
shrna | 37 |
characteristically | 37 |
sterically | 37 |
vigorously | 36 |
purely | 36 |
promptly | 36 |
fold | 36 |
abnormally | 36 |
modestly | 35 |
analogously | 35 |
course | 35 |
extraordinarily | 35 |
ca | 35 |
officially | 35 |
pdcov | 35 |
x-100 | 35 |
paradoxically | 35 |
surgically | 34 |
intramuscularly | 34 |
fourth | 34 |
financially | 34 |
faithfully | 34 |
conceptually | 34 |
cally | 34 |
lately | 33 |
arbitrarily | 33 |
crucially | 33 |
developmentally | 33 |
nasally | 33 |
maternally | 33 |
mrnas | 33 |
radioactively | 33 |
last | 32 |
inefficiently | 32 |
iteratively | 31 |
conveniently | 31 |
conventionally | 31 |
home | 31 |
dominantly | 31 |
oligonucleotide | 31 |
prematurely | 31 |
pharmacologically | 31 |
predominately | 31 |
onwards | 31 |
triple | 30 |
suddenly | 30 |
spectrophotometrically | 30 |
pdna | 30 |
jointly | 30 |
horizontally | 30 |
consecutively | 30 |
ciently | 30 |
rigorously | 29 |
infrequently | 29 |
posttranslationally | 29 |
seldom | 29 |
tremendously | 29 |
und | 29 |
synthetically | 28 |
prominently | 28 |
irreversibly | 28 |
identically | 28 |
firmly | 28 |
deliberately | 28 |
coarse | 28 |
microscopically | 27 |
conformationally | 27 |
finely | 27 |
generously | 27 |
matter | 27 |
top | 27 |
sporadically | 27 |
successively | 27 |
topologically | 27 |
ssrna | 27 |
nonspecifically | 26 |
incorrectly | 26 |
epidemiologically | 26 |
comparably | 26 |
aberrantly | 26 |
epigenetically | 25 |
dose | 25 |
doubly | 25 |
eif2α | 25 |
hereby | 25 |
grossly | 25 |
tenfold | 25 |
thrice | 25 |
disulfide | 24 |
dual | 24 |
magnetically | 24 |
else | 24 |
loosely | 24 |
thermally | 24 |
prophylactically | 24 |
thirdly | 24 |
vsrnas | 24 |
proportionally | 24 |
exceedingly | 23 |
anywhere | 23 |
dually | 23 |
enormously | 23 |
environmentally | 23 |
clear | 23 |
left | 23 |
natively | 23 |
nucleoside | 23 |
surely | 23 |
remotely | 23 |
b2c | 22 |
convincingly | 22 |
histopathologically | 22 |
passively | 22 |
postoperatively | 22 |
slower | 22 |
supposedly | 22 |
antiparallel | 21 |
behind | 21 |
incidentally | 21 |
coaxially | 21 |
conditionally | 21 |
recombinantly | 21 |
intentionally | 21 |
overly | 21 |
variably | 21 |
vrnps | 21 |
intracranially | 21 |
farther | 20 |
autonomously | 20 |
blunt | 20 |
confidently | 20 |
enterically | 20 |
extracellularly | 20 |
hard | 20 |
intracerebrally | 20 |
luciferase | 20 |
nationally | 20 |
nsp9 | 20 |
optically | 20 |
notoriously | 19 |
intensely | 19 |
isotopically | 19 |
inadvertently | 19 |
pcdna | 19 |
rmers | 19 |
radically | 19 |
hyper | 18 |
appreciably | 18 |
coordinately | 18 |
diffusely | 18 |
electrically | 18 |
everywhere | 18 |
genotypically | 18 |
highest | 18 |
imatinib | 18 |
intuitively | 18 |
limd1 | 18 |
nm | 18 |
nsp2 | 18 |
reciprocally | 18 |
round | 18 |
slow | 18 |
timely | 18 |
twofold | 18 |
immunohistochemically | 17 |
allosterically | 17 |
falsely | 17 |
disproportionately | 17 |
kinetically | 17 |
little | 17 |
pathologically | 17 |
exquisitely | 16 |
alike | 16 |
backward | 16 |
doubt | 16 |
electrochemically | 16 |
exosome | 16 |
aseptically | 16 |
favorably | 16 |
invasively | 16 |
p7 | 16 |
predictably | 16 |
reversely | 16 |
immensely | 16 |
diagnostically | 15 |
electrostatically | 15 |
electrophoretically | 15 |
discontinuously | 15 |
directionally | 15 |
broad | 15 |
chiefly | 15 |
cautiously | 15 |
alternately | 15 |
accidentally | 15 |
gp64 | 15 |
full | 15 |
nicely | 15 |
henceforth | 15 |
ns2a | 15 |
suitably | 15 |
sensitively | 15 |
scientifically | 15 |
numerically | 15 |
upf3b | 15 |
voluntarily | 15 |
maximally | 15 |
lincrnas | 15 |
lincrna | 15 |
ifit1 | 15 |
foremost | 14 |
adoptively | 14 |
anymore | 14 |
centrally | 14 |
cfdna | 14 |
compositionally | 14 |
congenitally | 14 |
digitally | 14 |
ecologically | 14 |
fluorescein | 14 |
incredibly | 14 |
humanely | 14 |
sooner | 14 |
insufficiently | 14 |
strategically | 14 |
spectrally | 14 |
visibly | 14 |
presumptively | 14 |
plausibly | 14 |
mock | 14 |
lytically | 14 |
-were | 13 |
afterward | 13 |
autoproteolytically | 13 |
geometrically | 13 |
clonally | 13 |
counter | 13 |
eg | 13 |
eukaryotically | 13 |
excessively | 13 |
bilaterally | 13 |
inadequately | 13 |
oppositely | 13 |
trim5α | 13 |
somewhere | 13 |
orthogonally | 13 |
indiscriminately | 13 |
mathematically | 13 |
inward | 13 |
intradermally | 13 |
inducibly | 13 |
ncrna | 12 |
belpv | 12 |
deeper | 12 |
docetaxel | 12 |
homogeneously | 12 |
inappropriately | 12 |
indefinitely | 12 |
indoors | 12 |
longest | 12 |
longitudinally | 12 |
minus | 12 |
topically | 12 |
nsp15 | 12 |
nucleotide | 12 |
optionally | 12 |
outward | 12 |
photochemically | 12 |
provisionally | 12 |
rnase | 12 |
straight | 12 |
negative | 12 |
cotranslationally | 11 |
hitherto | 11 |
graphically | 11 |
extemporaneously | 11 |
equivalently | 11 |
legally | 11 |
conservatively | 11 |
blindly | 11 |
anonymously | 11 |
abroad | 11 |
hugely | 11 |
sparsely | 11 |
monthly | 11 |
symmetrically | 11 |
neutrally | 11 |
μl | 11 |
upper | 11 |
upwards | 11 |
per | 11 |
noncovalently | 11 |
niclosamide | 11 |
new | 11 |
electronically | 10 |
contrarily | 10 |
dropwise | 10 |
distinctively | 10 |
direct | 10 |
cytoplasmically | 10 |
cumulatively | 10 |
controversially | 10 |
amply | 10 |
beforehand | 10 |
astrocyte | 10 |
assays | 10 |
anyway | 10 |
adaptively | 10 |
abruptly | 10 |
-p | 10 |
intermittently | 10 |
hypothetically | 10 |
threefold | 10 |
intra | 10 |
personally | 10 |
leafroll | 10 |
variously | 10 |
swiftly | 10 |
subtly | 10 |
sincerely | 10 |
pretty | 10 |
post | 10 |
recurrently | 10 |
operationally | 10 |
macroscopically | 10 |
noninvasively | 10 |
light | 10 |
lightly | 10 |
lentiviral | 10 |
morbidly | 10 |
n=5 | 10 |
cold | 9 |
ironically | 9 |
insofar | 9 |
hierarchically | 9 |
genomically | 9 |
fivefold | 9 |
erroneously | 9 |
endonucleolytically | 9 |
detectably | 9 |
isothermally | 9 |
chromosomally | 9 |
basally | 9 |
backwards | 9 |
asymmetrically | 9 |
anatomically | 9 |
ambiguously | 9 |
albeit | 9 |
-tag | 9 |
irregularly | 9 |
open | 9 |
laterally | 9 |
pharmaceutically | 9 |
wholly | 9 |
understandably | 9 |
super | 9 |
subfamily | 9 |
stringently | 9 |
singularly | 9 |
rhd- | 9 |
pro | 9 |
meaningfully | 9 |
overwhelmingly | 9 |
wrongly | 9 |
onward | 9 |
objectively | 9 |
nearby | 9 |
nationwide | 9 |
micrornas | 9 |
oronasally | 9 |
focally | 8 |
evolutionally | 8 |
exhaustively | 8 |
n=18 | 8 |
imperfectly | 8 |
intratracheally | 8 |
majorly | 8 |
endothelial | 8 |
ethically | 8 |
cross | 8 |
endemically | 8 |
distally | 8 |
dietetically | 8 |
complex | 8 |
bioinformatically | 8 |
badly | 8 |
autocatalytically | 8 |
-escape | 8 |
oxidatively | 8 |
nucleocapsid | 8 |
narrowly | 8 |
peripherally | 8 |
stochastically | 8 |
popularly | 8 |
yearly | 8 |
virologically | 8 |
upward | 8 |
unsuccessfully | 8 |
unnecessarily | 8 |
technologically | 8 |
superficially | 8 |
stoichiometrically | 8 |
unevenly | 8 |
sometime | 8 |
secondarily | 8 |
seasonally | 8 |
score | 8 |
scarcely | 8 |
realistically | 8 |
pubrc1-p88u | 8 |
preliminarily | 8 |
snorna | 8 |
nonsevere | 7 |
lowest | 7 |
magnetic | 7 |
mistakenly | 7 |
neonatally | 7 |
oft | 7 |
nsp14-nsp10 | 7 |
nuclease | 7 |
nutritionally | 7 |
latter | 7 |
literally | 7 |
30-fold | 7 |
inconsistently | 7 |
improperly | 7 |
genuinely | 7 |
filo- | 7 |
exemplarily | 7 |
excellently | 7 |
elegantly | 7 |
doubtless | 7 |
bidirectionally | 7 |
admittedly | 7 |
ostensibly | 7 |
operatively | 7 |
ethnically | 7 |
outdoors | 7 |
site(s | 7 |
outwards | 7 |
whole | 7 |
whereafter | 7 |
vp0 | 7 |
vitally | 7 |
transplacentally | 7 |
transovarially | 7 |
throughout | 7 |
therapeutic | 7 |
synchronously | 7 |
smallest | 7 |
within | 7 |
serendipitously | 7 |
overtly | 7 |
regionally | 7 |
purposely | 7 |
proportionately | 7 |
prohibitively | 7 |
privately | 7 |
prenatally | 7 |
posttranscriptionally | 7 |
paternally | 7 |
satisfactorily | 7 |
encouragingly | 6 |
expectedly | 6 |
favourably | 6 |
fcgriiib | 6 |
flexibly | 6 |
inos | 6 |
generically | 6 |
hbsab | 6 |
hemodynamically | 6 |
impressively | 6 |
intramolecularly | 6 |
dna18 | 6 |
easy | 6 |
2k | 6 |
desperately | 6 |
dark | 6 |
concordantly | 6 |
coincidentally | 6 |
aunps | 6 |
asymptomatically | 6 |
antivirally | 6 |
antenatally | 6 |
anomalously | 6 |
amazingly | 6 |
alongside | 6 |
nabs | 6 |
-5aa | 6 |
logically | 6 |
fluorophore | 6 |
neither | 6 |
selfassembly | 6 |
nominally | 6 |
v2.0 | 6 |
unquestionably | 6 |
uncommonly | 6 |
trimeric | 6 |
subgroup | 6 |
subclinically | 6 |
stepwise | 6 |
sort | 6 |
sixfold | 6 |
since | 6 |
shortest | 6 |
serbc | 6 |
symptomatically | 6 |
sadly | 6 |
perpendicular | 6 |
nsps | 6 |
s1b | 6 |
ntat2aneo | 6 |
opportunistically | 6 |
parenterally | 6 |
oftentimes | 6 |
postnatally | 6 |
proactively | 6 |
processively | 6 |
protectively | 6 |
proximally | 6 |
eif4e | 5 |
heretofore | 5 |
eif4gi | 5 |
erf1 | 5 |
erv1 | 5 |
excitingly | 5 |
feasibly | 5 |
formamide | 5 |
fortuitously | 5 |
intricately | 5 |
hsp70h | 5 |
ifi44 | 5 |
implicitly | 5 |
insignificantly | 5 |
interchangeably | 5 |
können | 5 |
leucocyte | 5 |
liberally | 5 |
downward | 5 |
eagerly | 5 |
approximatively | 5 |
diversely | 5 |
cotranscriptionally | 5 |
mean+sd | 5 |
50-fold | 5 |
a549 | 5 |
abietina | 5 |
across | 5 |
aka | 5 |
arrhythmias | 5 |
asynchronously | 5 |
avct12 | 5 |
avidly | 5 |
bhk-21 | 5 |
biophysically | 5 |
blast+ | 5 |
causally | 5 |
cccdna | 5 |
colorimetrically | 5 |
contiguously | 5 |
logistically | 5 |
aptly | 5 |
meticulously | 5 |
unequally | 5 |
similarily | 5 |
small | 5 |
smoothly | 5 |
snornas | 5 |
socially | 5 |
somatically | 5 |
stali | 5 |
statically | 5 |
unique | 5 |
severe | 5 |
unlikely | 5 |
µm | 5 |
unsurprisingly | 5 |
vegetatively | 5 |
wider | 5 |
worst | 5 |
±sd | 5 |
mg | 5 |
shorter | 5 |
usefully | 5 |
reproductively | 5 |
ordinarily | 5 |
reassuringly | 5 |
mosns | 5 |
nalidixic | 5 |
north | 5 |
microbiologically | 5 |
nsp | 5 |
nsp7 | 5 |
openly | 5 |
neatly | 5 |
orf4b | 5 |
reassembly | 5 |
plus | 5 |
protease | 5 |
publically | 5 |
purposefully | 5 |
radiologically | 5 |
organically | 5 |
fourthly | 4 |
flat | 4 |
exempli | 4 |
etms | 4 |
etiologically | 4 |
epistatically | 4 |
discretely | 4 |
ds)rnas | 4 |
doi:10.1016 | 4 |
disappointingly | 4 |
diagrammatically | 4 |
dhx15 | 4 |
gastric | 4 |
fresh | 4 |
ifn)-gamma | 4 |
gata4 | 4 |
graciously | 4 |
green | 4 |
gö | 4 |
helically | 4 |
hev | 4 |
hiv-1/2 | 4 |
icosahedrally | 4 |
il)-8 | 4 |
incrementally | 4 |
industrially | 4 |
instantly | 4 |
interactively | 4 |
intermediately | 4 |
custom | 4 |
cyclically | 4 |
arna | 4 |
crystallographically | 4 |
contrastingly | 4 |
-1 | 4 |
-mostly | 4 |
-where | 4 |
abortively | 4 |
acetaminophen | 4 |
additively | 4 |
advantageously | 4 |
aggressively | 4 |
agriculturally | 4 |
algorithmically | 4 |
ancestrally | 4 |
isrna | 4 |
astanarg | 4 |
atrh5 | 4 |
atypically | 4 |
axially | 4 |
basolaterally | 4 |
bdna | 4 |
biweekly | 4 |
brightly | 4 |
bx795 | 4 |
categorically | 4 |
cheaply | 4 |
chromatin | 4 |
circrna | 4 |
cognitively | 4 |
collaboratively | 4 |
conjointly | 4 |
consequentially | 4 |
intermolecularly | 4 |
conspicuously | 4 |
kind | 4 |
recursively | 4 |
redundantly | 4 |
regrettably | 4 |
respectfully | 4 |
rhtrim5α | 4 |
rigidly | 4 |
rnaseiii | 4 |
rwt | 4 |
securely | 4 |
sept12 | 4 |
silently | 4 |
snornps | 4 |
solid | 4 |
speci¢cally | 4 |
spherically | 4 |
synaptically | 4 |
tively | 4 |
traf6 | 4 |
transcriptase | 4 |
trinucleotide | 4 |
truthfully | 4 |
ubiquitination | 4 |
undeniably | 4 |
unidirectionally | 4 |
unpredictably | 4 |
whatsoever | 4 |
worse | 4 |
yes | 4 |
αiib | 4 |
lead | 4 |
red | 4 |
vividly | 4 |
rectly | 4 |
partial | 4 |
measurably | 4 |
rectally | 4 |
mmachine | 4 |
monotherapy | 4 |
n=26 | 4 |
nally | 4 |
neuraminidase | 4 |
nlrp3 | 4 |
nshp01d | 4 |
nterminally | 4 |
opposite | 4 |
overhead | 4 |
p=0.016 | 4 |
paclitaxel | 4 |
mucosa | 4 |
perpendicularly | 4 |
promiscuously | 4 |
pmes.i | 4 |
quicker | 4 |
recombinationally | 4 |
pt7 | 4 |
proximately | 4 |
radially | 4 |
preventively | 4 |
posteriorly | 4 |
polynucleotide | 4 |
radiographically | 4 |
prbcs | 4 |
prebiotically | 4 |
endosomally | 3 |
fecally | 3 |
famously | 3 |
faintly | 3 |
fleetingly | 3 |
etoposide | 3 |
ethnopharmacologically | 3 |
erratically | 3 |
epidemically | 3 |
enzymatic | 3 |
entropically | 3 |
exonuclease | 3 |
elaborately | 3 |
endoscopically | 3 |
endlessly | 3 |
eminently | 3 |
embryonically | 3 |
eif5 | 3 |
eif4aiii | 3 |
efficaciously | 3 |
edna | 3 |
eccentrically | 3 |
ebds | 3 |
forever | 3 |
duly | 3 |
fluorometrically | 3 |
ifit3 | 3 |
fortnightly | 3 |
il)-2 | 3 |
disulphide | 3 |
innately | 3 |
infinitely | 3 |
inexpensively | 3 |
inductively | 3 |
indistinctly | 3 |
inclusively | 3 |
imo | 3 |
immunochemically | 3 |
immuno | 3 |
imagej | 3 |
i-3c | 3 |
forwards | 3 |
hypoxically | 3 |
hydrophobically | 3 |
htert | 3 |
hormonally | 3 |
homogenously | 3 |
heterogeneously | 3 |
harmlessly | 3 |
harder | 3 |
haemodynamically | 3 |
hadv | 3 |
furtherly | 3 |
dnag. | 3 |
allantoically | 3 |
dendritically | 3 |
10/4 | 3 |
alphabetically | 3 |
alarmingly | 3 |
agnps | 3 |
agencourt | 3 |
ably | 3 |
5′-fam | 3 |
interfere | 3 |
3-moderatly | 3 |
2-fold | 3 |
15-fold | 3 |
100-fold | 3 |
/socially | 3 |
analytically | 3 |
-v | 3 |
-turns | 3 |
-that | 3 |
-o | 3 |
-naively | 3 |
-manually | 3 |
-incorrectly | 3 |
-approximately | 3 |
-2b | 3 |
-2aa | 3 |
-2007 | 3 |
although | 3 |
anecdotally | 3 |
demonstrably | 3 |
chronologically | 3 |
decussately | 3 |
decisively | 3 |
ddx25 | 3 |
cytogenetically | 3 |
confusingly | 3 |
concisely | 3 |
compatible | 3 |
colorimetric | 3 |
colloquially | 3 |
clockwise | 3 |
circularly | 3 |
cd105 | 3 |
anew | 3 |
cardiosphere | 3 |
bravely | 3 |
biomedically | 3 |
bet | 3 |
beneficially | 3 |
bacteriologically | 3 |
axenically | 3 |
astonishingly | 3 |
architecturally | 3 |
aptamer | 3 |
apt | 3 |
instantaneously | 3 |
trimar | 3 |
intravitreally | 3 |
rnastructure | 3 |
sterile | 3 |
steeply | 3 |
starkly | 3 |
spectroscopically | 3 |
spatiotemporally | 3 |
snrnps | 3 |
simplistically | 3 |
signiwcantly | 3 |
serpinb1 | 3 |
seamlessly | 3 |
rotationally | 3 |
rnaimax | 3 |
straightaway | 3 |
ribosomally | 3 |
retrogradely | 3 |
residually | 3 |
representatively | 3 |
replica | 3 |
repetitively | 3 |
ready | 3 |
rapid | 3 |
qv | 3 |
quietly | 3 |
quick | 3 |
sterilely | 3 |
strangely | 3 |
p~0.01 | 3 |
vaginally | 3 |
justly | 3 |
m | 3 |
l | 3 |
π | 3 |
Δz | 3 |
~6 | 3 |
zoonotically | 3 |
wildly | 3 |
vr-2332 | 3 |
vice | 3 |
vanishingly | 3 |
v7.2 | 3 |
strong | 3 |
upside | 3 |
unavoidably | 3 |
trivially | 3 |
triply | 3 |
tight | 3 |
tially | 3 |
tia-1 | 3 |
thereupon | 3 |
thapsigargin | 3 |
thankfully | 3 |
territorially | 3 |
qev | 3 |
wisely | 3 |
puzzlingly | 3 |
mutationally | 3 |
nsp7l8 | 3 |
northward | 3 |
noncompetitively | 3 |
nomenclatorily | 3 |
nl63 | 3 |
nitroprusside | 3 |
nearer | 3 |
nct03829384 | 3 |
nanomaterial | 3 |
myocarditis | 3 |
mycologically | 3 |
multifocally | 3 |
ny-1 | 3 |
morally | 3 |
monotonically | 3 |
monomerically | 3 |
mitochondrially | 3 |
methodologically | 3 |
methodically | 3 |
mentally | 3 |
lq1601 | 3 |
localizes | 3 |
psychologicallyspiritually | 3 |
like | 3 |
nucleatum | 3 |
median | 3 |
n’t | 3 |
pirna | 3 |
promisingly | 3 |
oldest | 3 |
prudently | 3 |
primase | 3 |
prevail | 3 |
pres1 | 3 |
preclinically | 3 |
precipitously | 3 |
pp65 | 3 |
powerfully | 3 |
positionally | 3 |
prevalently | 3 |
piecemeal | 3 |
perinatally | 3 |
physicochemically | 3 |
orthotopically | 3 |
pathogenically | 3 |
patient | 3 |
parenthetically | 3 |
optimem | 3 |
peritoneally | 3 |
pervasively | 3 |
photometrically | 3 |
orbitally | 3 |
eif-4a | 2 |
eightfold | 2 |
eu293175 | 2 |
electrocatalytically | 2 |
electrochemical | 2 |
em | 2 |
enantiomerically | 2 |
enthalpically | 2 |
eosinophil | 2 |
episodically | 2 |
extragenically | 2 |
everyday | 2 |
evolved | 2 |
extra | 2 |
extrachromosomally | 2 |
faecally | 2 |
fastest | 2 |
fatally | 2 |
fecal | 2 |
eber1 | 2 |
flavivirus | 2 |
fmhv | 2 |
ecdna | 2 |
dicer1 | 2 |
earliest | 2 |
e3l | 2 |
dangerously | 2 |
froward | 2 |
de- | 2 |
dead | 2 |
decidedly | 2 |
deferentially | 2 |
delicately | 2 |
delightfully | 2 |
demographically | 2 |
descriptively | 2 |
detrimentally | 2 |
dh10b | 2 |
diagonally | 2 |
dimensionally | 2 |
disome | 2 |
dosedependently | 2 |
doubtlessly | 2 |
downhill | 2 |
dpi | 2 |
e220 | 2 |
e2f | 2 |
frankly | 2 |
hydrodynamically | 2 |
fugene | 2 |
furthest | 2 |
ically | 2 |
icpec | 2 |
icpedv- | 2 |
ifnlr1 | 2 |
ighm | 2 |
il4 | 2 |
illegally | 2 |
imidazole | 2 |
immunogenically | 2 |
immunomagnetically | 2 |
impractically | 2 |
inasmuch | 2 |
inconspicuously | 2 |
indisputably | 2 |
indistinguishably | 2 |
inexorably | 2 |
inflamm | 2 |
ingly | 2 |
inordinately | 2 |
integrally | 2 |
cryomicroscopy | 2 |
hypoxic | 2 |
hybrid | 2 |
https://www.epicentro.iss.it/coronavirus/sars-cov-2 | 2 |
happily | 2 |
für | 2 |
gadd45b | 2 |
gdna | 2 |
genera | 2 |
germline | 2 |
glabra | 2 |
h10n7 | 2 |
halfway | 2 |
hapn | 2 |
harmonically | 2 |
hsv-1 | 2 |
heavy | 2 |
hmgb1 | 2 |
hnrnpa1 | 2 |
hnrnps | 2 |
homeostatically | 2 |
homotypically | 2 |
hrly | 2 |
hsp90 | 2 |
hspa1a | 2 |
damn | 2 |
artinm | 2 |
covalent | 2 |
autosomal | 2 |
acoustically | 2 |
alfacon-1 | 2 |
amniotically | 2 |
amphisome | 2 |
anaerobically | 2 |
angly | 2 |
anisotropically | 2 |
antennae | 2 |
antiviral | 2 |
anyhow | 2 |
anytime | 2 |
apically | 2 |
apobec3h | 2 |
apoferritin | 2 |
archaea | 2 |
arl13b | 2 |
arrestin | 2 |
artifactually | 2 |
asp234 | 2 |
asymptotically | 2 |
atg5 | 2 |
abcc4 | 2 |
a249s | 2 |
a-549 | 2 |
-whereas | 2 |
-2016 | 2 |
-2a | 2 |
-ar | 2 |
-cite | 2 |
-i | 2 |
-mainly | 2 |
-notably | 2 |
-particularly | 2 |
-possibly | 2 |
//doi | 2 |
99mtc | 2 |
0.5×tbe | 2 |
10-fold | 2 |
20-fold | 2 |
24/7 | 2 |
25-fold | 2 |
3′utr | 2 |
4-fold | 2 |
5672r_a6 | 2 |
6.9x | 2 |
autoradiographically | 2 |
b.w./day | 2 |
counterintuitively | 2 |
b16-hgp100 | 2 |
chirally | 2 |
cially | 2 |
cin8 | 2 |
circumferentially | 2 |
cisplatin | 2 |
closest | 2 |
cnkr | 2 |
co | 2 |
coevolve | 2 |
cogently | 2 |
coherently | 2 |
colocalizes | 2 |
combinatorially | 2 |
compassionately | 2 |
complexly | 2 |
concretely | 2 |
configurationally | 2 |
content | 2 |
coordinatively | 2 |
coterminal | 2 |
countably | 2 |
centrifugally | 2 |
ccar1 | 2 |
caveolin | 2 |
bly | 2 |
baseline | 2 |
batf2 | 2 |
intracardially | 2 |
beneath | 2 |
beside | 2 |
bilayer | 2 |
biosphere | 2 |
biosynthetically | 2 |
blank | 2 |
bmal1 | 2 |
catastrophically | 2 |
bodywide | 2 |
boldly | 2 |
bottom | 2 |
brilliantly | 2 |
broader | 2 |
canonically | 2 |
capably | 2 |
capside | 2 |
carelessly | 2 |
interleukin-2 | 2 |
beautifully | 2 |
intragastrically | 2 |
rightly | 2 |
rna*dna | 2 |
robotically | 2 |
rrt | 2 |
s3l2-only | 2 |
sembly | 2 |
sensibly | 2 |
serinc5 | 2 |
serotypically | 2 |
severalfold | 2 |
shoud | 2 |
sicon | 2 |
significatively | 2 |
siupf3x | 2 |
sjvb | 2 |
smaller | 2 |
smartly | 2 |
smorf | 2 |
sofar | 2 |
sonographically | 2 |
soricomorph | 2 |
southward | 2 |
riluzole | 2 |
rhythmically | 2 |
ppss | 2 |
rgs4 | 2 |
preassembly | 2 |
presciently | 2 |
prethrombin-2 | 2 |
pretreatment | 2 |
professionally | 2 |
profile | 2 |
programmatically | 2 |
prokaryotically | 2 |
pseudo | 2 |
psmpuw | 2 |
puc | 2 |
quarterly | 2 |
r68a | 2 |
re- | 2 |
realtime | 2 |
recessively | 2 |
relatedly | 2 |
relevantly | 2 |
rep2 | 2 |
replicatively | 2 |
responsibly | 2 |
speculatively | 2 |
sre | 2 |
strail | 2 |
succesfully | 2 |
undesirably | 2 |
unduly | 2 |
unilaterally | 2 |
uorf | 2 |
valproate | 2 |
valuably | 2 |
vdna | 2 |
versus | 2 |
warmly | 2 |
webserver | 2 |
west | 2 |
whereupon | 2 |
wich | 2 |
wildest | 2 |
willingly | 2 |
wise | 2 |
worryingly | 2 |
αvβ3/5 | 2 |
ס | 2 |
−)ssdna | 2 |
intranodally | 2 |
unconditionally | 2 |
uncompetitively | 2 |
unbiasedly | 2 |
thin | 2 |
succinctly | 2 |
suggestively | 2 |
sup- | 2 |
symbiotically | 2 |
synonymously | 2 |
synthetic | 2 |
ten | 2 |
tgase1 | 2 |
thence | 2 |
thrombin | 2 |
unacceptably | 2 |
tnfrsf10b | 2 |
tnf | 2 |
tone.js | 2 |
topographically | 2 |
traf-6 | 2 |
transversely | 2 |
tsntcp | 2 |
ultra | 2 |
ultrastructurally | 2 |
pragmatically | 2 |
substantively | 2 |
polysome | 2 |
miclip | 2 |
mir-17 | 2 |
misassembly | 2 |
mitotically | 2 |
modularly | 2 |
monopyrene | 2 |
morever | 2 |
ms2vlps | 2 |
mt594401 | 2 |
mt594402 | 2 |
mucosally | 2 |
n=41 | 2 |
na1 | 2 |
naively | 2 |
nantly | 2 |
nascently | 2 |
naï | 2 |
nearest | 2 |
neuac | 2 |
neuronally | 2 |
neurosurgically | 2 |
newer | 2 |
mir-155 | 2 |
metronidazole | 2 |
nl4 | 2 |
metric | 2 |
intraocularly | 2 |
polymerases | 2 |
ionically | 2 |
iq5 | 2 |
irrespectively | 2 |
isothermal | 2 |
itaq | 2 |
ketolide | 2 |
lamivudine | 2 |
lb | 2 |
lesser | 2 |
leukemias | 2 |
lipoplex | 2 |
lmp-1 | 2 |
lowly | 2 |
lsm1 | 2 |
lumenally | 2 |
luminometrically | 2 |
lys,3 | 2 |
mab | 2 |
mass | 2 |
nglycosidically | 2 |
microbially | 2 |
non | 2 |
p=0.027 | 2 |
parallel | 2 |
parallelly | 2 |
parametrically | 2 |
parc | 2 |
pathophysiologically | 2 |
pb620 | 2 |
pcambia | 2 |
pcdna3.1 | 2 |
pde | 2 |
perorally | 2 |
perversely | 2 |
pfam | 2 |
photosynthetically | 2 |
phsh1-shlmp1 | 2 |
pi-103 | 2 |
pin | 2 |
placentally | 2 |
pltrasc | 2 |
pneumatically | 2 |
pnl4 | 2 |
poly(a)-tail | 2 |
p=0.34 | 2 |
pdgf | 2 |
nsp16-nsp10 | 2 |
nuclearly | 2 |
noncanonically | 2 |
p58ipk | 2 |
norp01d | 2 |
northwest | 2 |
notwithstanding | 2 |
nsp12 | 2 |
nsp1–16 | 2 |
nsp5 | 2 |
nsp6 | 2 |
nt10400 | 2 |
nucleases | 2 |
nucleicacid | 2 |
nucleolin | 2 |
nucleus | 2 |
occupationally | 2 |
oddly | 2 |
osteoblast | 2 |
overseas | 2 |
p1234 | 2 |
noncovalent | 2 |
estingly | 1 |
escrt- | 1 |
ess3b | 1 |
espetially | 1 |
esp | 1 |
explant | 1 |
erkrankt | 1 |
ergodically | 1 |
erently | 1 |
ethoxyzolamide | 1 |
erentially | 1 |
ethnopharmacology | 1 |
expertly | 1 |
eu337016 | 1 |
eu448369 | 1 |
ewqe9edq | 1 |
exclusrvely | 1 |
exonically | 1 |
expectably | 1 |
expectantly | 1 |
expeditiously | 1 |
expensive | 1 |
expetimentally | 1 |
epub | 1 |
er | 1 |
emergently | 1 |
episomally | 1 |
endergonically | 1 |
extinct | 1 |
elonginc | 1 |
em- | 1 |
elf4gl | 1 |
emigrate | 1 |
emotionally | 1 |
emphatically | 1 |
emptively | 1 |
en | 1 |
endemic | 1 |
endocytically | 1 |
epidermally | 1 |
endogenous | 1 |
endolysosomally | 1 |
endoribonucleolytically | 1 |
endosonographically | 1 |
enigmatically | 1 |
entfällt | 1 |
environmentfriendly | 1 |
enzyme | 1 |
enzymeimmunoassays | 1 |
ephrinb1 | 1 |
exteriorly | 1 |
gc-3'-fl | 1 |
extrahelically | 1 |
flightless | 1 |
fluoreseently | 1 |
fluorochrome | 1 |
folic | 1 |
follistatin | 1 |
forcefully | 1 |
forcibly | 1 |
foster | 1 |
foul | 1 |
foward | 1 |
frameshift | 1 |
frenziedly | 1 |
fro | 1 |
frustratingly | 1 |
futher | 1 |
g46s | 1 |
gag | 1 |
galcer | 1 |
gattctctaactgcgcatgcttctgcgcacgcgcaatagacattccaggacttccgggcacttcgtaaggtttaaaaaggatgcttcgcgttttctctctcctttttggagacagattc | 1 |
gcvb | 1 |
gene(s | 1 |
gestationally | 1 |
gig.db | 1 |
electrophillically | 1 |
fluid | 1 |
flagellin | 1 |
extrinsically | 1 |
fk866 | 1 |
f1l | 1 |
f2a | 1 |
f7l4ty2j | 1 |
facetiously | 1 |
factor-2 | 1 |
factor-2-alpha | 1 |
factor-4e | 1 |
facultatively | 1 |
failure(aclf | 1 |
fak)family | 1 |
fastidiously | 1 |
fcgrs | 1 |
fcorl | 1 |
fcrn | 1 |
fd4ap | 1 |
fdc40ef786bf3a2a8ab0cc411620bfd21a11333d | 1 |
federally | 1 |
fetally | 1 |
fifth | 1 |
fifthly | 1 |
figuratively | 1 |
filtrate | 1 |
fittingly | 1 |
electrophysiologically | 1 |
d4t | 1 |
electronegatively | 1 |
docilely | 1 |
deoxyribose | 1 |
devastatingly | 1 |
diametrically | 1 |
dicistronically | 1 |
die | 1 |
diligently | 1 |
din2 | 1 |
dinucelotide | 1 |
diphosphate | 1 |
directedly | 1 |
disadvantageously | 1 |
disappointedly | 1 |
discordantly | 1 |
discreetly | 1 |
discriminately | 1 |
discursively | 1 |
disporportionately | 1 |
disproportionally | 1 |
distributively | 1 |
diurnally | 1 |
divergently | 1 |
divisively | 1 |
dlbcl | 1 |
denv | 1 |
densitometrically | 1 |
denote | 1 |
dag)dependent | 1 |
cytologically | 1 |
cytolytically | 1 |
cytoplasmitally | 1 |
cytosolic | 1 |
d120 | 1 |
d1312 | 1 |
d262c | 1 |
gloriously | 1 |
d52a | 1 |
d71e | 1 |
darkly | 1 |
denatur | 1 |
dc+ | 1 |
dddna | 1 |
ddi | 1 |
ddpcr | 1 |
defectively | 1 |
definetly | 1 |
defintely | 1 |
deleteriously | 1 |
deltarn | 1 |
demon-130 | 1 |
dnase1l3 | 1 |
domestically | 1 |
electively | 1 |
downfield | 1 |
easely | 1 |
easiest | 1 |
east | 1 |
eastwards | 1 |
eber-1 | 1 |
eber1:~10 | 1 |
ect | 1 |
ec~ | 1 |
eeeently | 1 |
eetopically | 1 |
effectievere | 1 |
effectually | 1 |
effkiently | 1 |
egy-1 | 1 |
eicosanoid | 1 |
eif2γ | 1 |
eif4 | 1 |
eif4g-1 | 1 |
eigenschap | 1 |
eii | 1 |
elaborated'pseudoknot | 1 |
elastically | 1 |
elder | 1 |
earnestly | 1 |
ealretinin-22k | 1 |
eachother | 1 |
dt)18 | 1 |
downwards | 1 |
doxorubicin | 1 |
dphpc | 1 |
dq376622 | 1 |
dq834384 | 1 |
drastisch | 1 |
drh-3 | 1 |
drx-500 | 1 |
dsrna-1 | 1 |
dsrnas | 1 |
dubmut | 1 |
e9996bcc14b0cdf1da458165de69a67eaa1736b6 | 1 |
duodenum | 1 |
duplex | 1 |
e0206 | 1 |
e1-ecori | 1 |
e1-p7 | 1 |
e192 | 1 |
e234 | 1 |
e35d6c05896a75cddc4c93d3fb6e7eac55087a95 | 1 |
e4broad | 1 |
e6ap | 1 |
gln-172 | 1 |
häufiger | 1 |
glu166 | 1 |
incalculably | 1 |
incontrovertibly | 1 |
indelibly | 1 |
independantly | 1 |
indicatively | 1 |
indifferently | 1 |
inexplicably | 1 |
inextricably | 1 |
infact | 1 |
infamously | 1 |
infectiveness | 1 |
infiziert | 1 |
influenzavirusa | 1 |
informally | 1 |
informatically | 1 |
informationally | 1 |
ingeniously | 1 |
inland | 1 |
innovatively | 1 |
inopportunely | 1 |
inosine | 1 |
insm1 | 1 |
inspiringly | 1 |
instinctively | 1 |
incisively | 1 |
inaccurately | 1 |
glutaredoxin | 1 |
in2 | 1 |
ifn)-λ | 1 |
ifvs | 1 |
ihprf1 | 1 |
il-1β | 1 |
il-8 | 1 |
il12b | 1 |
imbert | 1 |
immediadiately | 1 |
immediateearly | 1 |
immediatly | 1 |
imminently | 1 |
immunocytochemically | 1 |
immunogenetically | 1 |
immunohistologically | 1 |
immunol | 1 |
immunophenotypically | 1 |
immunosenescence | 1 |
immunosuppressant | 1 |
immunsupprimierter | 1 |
imperceptibly | 1 |
implant | 1 |
imprecisely | 1 |
improbably | 1 |
institutionally | 1 |
integrin | 1 |
integrity- | 1 |
intellectually | 1 |
irf-3-dependent | 1 |
irf7/8 | 1 |
irmaediately | 1 |
irrefutably | 1 |
irreparably | 1 |
irreplaceably | 1 |
irretrievably | 1 |
irs-1ptyr20 | 1 |
irtually | 1 |
isbh | 1 |
isg20 | 1 |
isocyanide | 1 |
isoelectrically | 1 |
isstrand | 1 |
isuf | 1 |
itraq | 1 |
itwas | 1 |
iu | 1 |
iv.group | 1 |
j.f.peden | 1 |
jak)/stat | 1 |
jca-154 | 1 |
jcem;1997;82:234 | 1 |
ires-2a | 1 |
irdly | 1 |
ipknot | 1 |
intradermolingually | 1 |
intercellularly | 1 |
interferongamma | 1 |
interleukin-1beta | 1 |
interleukin-6 | 1 |
interperitoneally | 1 |
intersectin | 1 |
intraabdominally | 1 |
intraaxonally | 1 |
intracerebally | 1 |
intracytoplasmically | 1 |
intramucosally | 1 |
iontophorefically | 1 |
intransally | 1 |
intrapentoneally | 1 |
intrathecally | 1 |
intratumorally | 1 |
intravaginally | 1 |
intronsearly | 1 |
invertase | 1 |
involuntarily | 1 |
inwards | 1 |
ionophore | 1 |
ifi27 | 1 |
idually | 1 |
idna | 1 |
heteroduplexes | 1 |
h847 | 1 |
haem | 1 |
hal2p | 1 |
halfapparently | 1 |
halfmaximally | 1 |
hardest | 1 |
harmfully | 1 |
harmlose | 1 |
harshly | 1 |
hastily | 1 |
hbcs | 1 |
hbeag | 1 |
hbmecs | 1 |
helix | 1 |
helpab | 1 |
hem45 | 1 |
hemmi | 1 |
heparin | 1 |
hepatocyte | 1 |
hepg2-neo | 1 |
heptameric | 1 |
hereditarily | 1 |
hereinafter | 1 |
h5n1-like | 1 |
h4a | 1 |
h33n | 1 |
grb10 | 1 |
gly | 1 |
glycopeptide | 1 |
glycosidically | 1 |
gneetically | 1 |
gondii(me49 | 1 |
gp1 | 1 |
gr-1 | 1 |
gr6v098c | 1 |
gracefully | 1 |
graduately | 1 |
gripap1 | 1 |
h1n1)swl | 1 |
grna | 1 |
gruel | 1 |
gtggatacacccgggaggtcactctccccgggctctgtccaagtggcgtaggggagcatagggctctgccccatgatgtacaagtccctttccacaacgttggaaataaagctgggcct | 1 |
gtx118713-s | 1 |
guanylyl | 1 |
gvfld. | 1 |
göpfert | 1 |
h(x(n(t)))/log | 1 |
h-2k | 1 |
h143 | 1 |
hermetically | 1 |
hexagonally | 1 |
idly | 1 |
hhv-6-dna | 1 |
hsp100s | 1 |
hsp60 | 1 |
hsp60-hsp10 | 1 |
hsp90α | 1 |
hsv)-2 | 1 |
hsv1 | 1 |
htr8-svneo | 1 |
http://exon.niaid.nih | 1 |
http://orcid.org/0000-0002-1713-8220 | 1 |
http://www.iipcr.com/eweb/ | 1 |
http://www.who | 1 |
https://doi.org/10.1038/s41401-019-0332-7 | 1 |
https://orcid.org/0000-0002-7141-1785 | 1 |
hydrologically | 1 |
hypernegatively | 1 |
hyperoside | 1 |
cys144 | 1 |
i287 | 1 |
iatrogenically | 1 |
ibv-15532r | 1 |
icam-1 | 1 |
icam-5 | 1 |
icsarsdorf9b | 1 |
hrv‐3 | 1 |
hq660155 | 1 |
hpr85 | 1 |
hm175/18f | 1 |
higly | 1 |
himmediately | 1 |
his52 | 1 |
histochemically | 1 |
histomorphologically | 1 |
histopatologically | 1 |
hiv-1-productively | 1 |
hivenv | 1 |
hku12 | 1 |
hl87144 | 1 |
hnrnp | 1 |
hpiv4 | 1 |
hntcp | 1 |
homodimer | 1 |
homogeneuosly | 1 |
homopolymeric | 1 |
honestly | 1 |
hotly | 1 |
hp1437 | 1 |
hpa-4 | 1 |
hpev | 1 |
hpiv-2 | 1 |
cys301 | 1 |
bzlf-1 | 1 |
cymmv | 1 |
a.128.1 | 1 |
a0/33.3 | 1 |
a1874-u1879 | 1 |
a19d | 1 |
a27·(g7-c14 | 1 |
a31a3 | 1 |
a3c3 | 1 |
a3g | 1 |
a66 | 1 |
aa)g. | 1 |
aaz95518.1 | 1 |
ab | 1 |
ab)6 | 1 |
ab-3730 | 1 |
ab047639 | 1 |
ab217130 | 1 |
abo*a01 | 1 |
abovepotently | 1 |
abrb | 1 |
abzusichern | 1 |
ac | 1 |
ac-15 | 1 |
academically | 1 |
accaugg | 1 |
a.com/pipel | 1 |
a-172 | 1 |
amperometrically | 1 |
a+u | 1 |
3dna | 1 |
4.2x103 | 1 |
4su | 1 |
5-day | 1 |
5-fold | 1 |
50fold | 1 |
5469e5474 | 1 |
5th | 1 |
6-carboxyfluorescein | 1 |
6-fluoro-3-hydroxy-2-pyrazinecarboxamide | 1 |
60x | 1 |
61−63 | 1 |
63• | 1 |
6hrs | 1 |
6nur | 1 |
6vsb | 1 |
7.73-fold | 1 |
7269117b84a91a52f5ce7bd335b967559962eaa6 | 1 |
8.6fold | 1 |
97·03 | 1 |
\/irology | 1 |
a'-j | 1 |
a'n | 1 |
accumulate~10 | 1 |
aceris | 1 |
acliv | 1 |
aco// | 1 |
aiv)another | 1 |
akeady | 1 |
al1 | 1 |
alaninal | 1 |
alere | 1 |
alfab)6 | 1 |
algebraically | 1 |
alkali | 1 |
allegedly | 1 |
allyl | 1 |
alphamelanocyte | 1 |
alternanthera | 1 |
alternate | 1 |
althrough | 1 |
altough | 1 |
alv | 1 |
am946981 | 1 |
amfrinsulin | 1 |
amide | 1 |
amidite | 1 |
amikacin | 1 |
amim | 1 |
amirna | 1 |
aids).therefore | 1 |
ai54238 | 1 |
ahighly | 1 |
afield | 1 |
act | 1 |
adenoviral | 1 |
adfigzc1 | 1 |
aerobically | 1 |
aerodynamically | 1 |
aetiologically | 1 |
af283103 | 1 |
af345858 | 1 |
afar | 1 |
affirmatively | 1 |
afloop | 1 |
ah2012/12 | 1 |
afresh | 1 |
ag7404 | 1 |
agarose | 1 |
aggresomes | 1 |
agmoir | 1 |
agnoprotein | 1 |
agnostically | 1 |
agonistically | 1 |
agro | 1 |
agronomically | 1 |
3ae00 | 1 |
3abc | 1 |
35x | 1 |
-how | 1 |
-azido | 1 |
-block | 1 |
-cell | 1 |
-chf | 1 |
-ciber | 1 |
-classically | 1 |
-clinically | 1 |
-cmethyl | 1 |
-constitutively | 1 |
-cooh/-s-(ch | 1 |
-ct18 | 1 |
-cyp | 1 |
-d | 1 |
-donor | 1 |
-either | 1 |
-enzyme | 1 |
-especially | 1 |
-essentially | 1 |
-family | 1 |
-finally | 1 |
-formerly | 1 |
-fortunately | 1 |
-globally | 1 |
-atrh5 | 1 |
-apparently | 1 |
-amyloid | 1 |
-2003 | 1 |
-(kallikrein | 1 |
--asn | 1 |
-/model | 1 |
-10,9536 | 1 |
-1117 | 1 |
-15 | 1 |
-16,6795 | 1 |
-192 | 1 |
-19a | 1 |
-20 | 1 |
-4231 | 1 |
-alternatively | 1 |
-4c. | 1 |
-509c | 1 |
-6-carboxyfluorescein | 1 |
-6wkq | 1 |
-8,8561 | 1 |
-81bp | 1 |
-9.5 | 1 |
-aaaaaa | 1 |
-ab | 1 |
-acggtgc | 1 |
-hif2 | 1 |
-hrp | 1 |
3-timely | 1 |
-immediately | 1 |
-theoretically | 1 |
-thrombin | 1 |
-tks4-beta | 1 |
-usually | 1 |
-utrÁ3 | 1 |
-worldwide | 1 |
-wp7 | 1 |
-zustand | 1 |
-γ | 1 |
1.4620.75 | 1 |
1.6x | 1 |
100x | 1 |
150×150-nt | 1 |
17-fold | 1 |
1785-y | 1 |
18-fold | 1 |
19k | 1 |
1slightly | 1 |
2-bis | 1 |
2/+ifn | 1 |
2ahm | 1 |
2′-fl | 1 |
2′-fluoro-/amino | 1 |
-tg;fcgriib | 1 |
-temporally | 1 |
-subsequently | 1 |
-practically | 1 |
-importantly | 1 |
-leu47argwere | 1 |
-likely | 1 |
-log10(bonferroni | 1 |
-mochlim | 1 |
-namely | 1 |
-nkg2a | 1 |
-not | 1 |
-phosphatidylinositol | 1 |
-poorly | 1 |
-preferably | 1 |
-strand | 1 |
-preliminary | 1 |
-primarily | 1 |
-promoter | 1 |
-really | 1 |
-sensitive | 1 |
-smallpox | 1 |
-spectroscopic | 1 |
-ssdna | 1 |
-start | 1 |
-stat | 1 |
amongand | 1 |
amtor | 1 |
cylindrically | 1 |
celltetratuftsin | 1 |
central | 1 |
centripetally | 1 |
cffdna | 1 |
cflip | 1 |
challengingly | 1 |
chelate | 1 |
chop10 | 1 |
choreographically | 1 |
chr3 | 1 |
chromatographically | 1 |
cicantly | 1 |
cifically | 1 |
circadianly | 1 |
cl15h6 | 1 |
claudin | 1 |
cleanly | 1 |
clearely | 1 |
cleverly | 1 |
climatologically | 1 |
clinicopathologically | 1 |
clustalw | 1 |
cml14 | 1 |
cmtr1 | 1 |
cently | 1 |
cefotaxime | 1 |
analyte | 1 |
cdcs | 1 |
bs232 | 1 |
bsah | 1 |
bsp119i | 1 |
bsp120i | 1 |
bta798 | 1 |
bvd2-pb | 1 |
bvp10 | 1 |
bwn | 1 |
jhm(3 | 1 |
c-682 | 1 |
c145i | 1 |
c5x | 1 |
cagi5 | 1 |
calmly | 1 |
calorimetric | 1 |
capillary | 1 |
carbontetrachroride | 1 |
card1 | 1 |
cardiacally | 1 |
caspase-8 | 1 |
catl | 1 |
caudally | 1 |
cause(s | 1 |
cm² | 1 |
codebase | 1 |
cohesively | 1 |