adverb

This is a table of type adverb and their frequencies. Use it to search & browse the list to learn more about your study carrel.

adverb	frequency
also	22878
however	11617
well	8575
highly	5320
respectively	5255
therefore	5064
previously	4866
significantly	4819
recently	3614
even	3290
still	2673
directly	2670
furthermore	2644
moreover	2414
together	2323
first	2317
currently	2213
often	2150
approximately	2059
interestingly	1984
specifically	1898
nt	1783
less	1781
especially	1732
now	1701
double	1685
finally	1606
yet	1574
rather	1548
prior	1540
relatively	1529
subsequently	1510
mainly	1473
particularly	1434
indeed	1366
much	1347
similarly	1337
additionally	1322
generally	1315
likely	1308
potentially	1305
rapidly	1293
far	1288
usually	1275
probably	1272
later	1249
strongly	1230
single	1189
efficiently	1180
fully	1164
least	1134
thereby	1131
clearly	1128
closely	1110
newly	1091
already	1082
alone	1078
almost	1056
widely	1030
completely	986
commonly	980
differentially	975
hence	967
successfully	964
clinically	907
frequently	907
possibly	896
partially	888
instead	869
initially	868
long	858
typically	843
ns3	840
primarily	824
nevertheless	814
effectively	795
importantly	784
largely	768
upstream	750
statistically	729
genetically	727
next	720
immediately	714
downstream	706
mostly	702
briefly	695
worldwide	692
notably	691
experimentally	682
simultaneously	676
naturally	669
just	662
negatively	651
early	645
independently	623
easily	616
slightly	606
positively	595
greatly	590
consequently	589
extremely	578
poorly	571
encephalitis	570
perhaps	564
better	545
readily	544
selectively	540
overall	533
alternatively	527
predominantly	525
twice	523
exclusively	523
namely	514
nearly	507
always	503
functionally	484
longer	457
sometimes	451
overnight	445
extensively	445
quite	440
presumably	440
earlier	437
otherwise	436
normally	436
back	433
structurally	429
ultimately	419
apparently	415
chemically	406
surprisingly	398
originally	398
critically	398
daily	396
commercially	392
dramatically	383
best	381
apart	375
randomly	374
consistently	369
eventually	366
substantially	366
remarkably	363
preferentially	357
accordingly	357
broadly	354
separately	343
simply	333
second	331
regardless	326
ago	325
markedly	320
quickly	319
dsdna	314
covalently	312
never	311
essentially	309
actively	308
persistently	305
forward	303
likewise	297
collectively	297
indirectly	290
considerably	288
biologically	288
equally	287
individually	286
stably	286
nonetheless	284
routinely	281
unfortunately	279
severely	278
increasingly	278
tightly	275
necessarily	269
enough	269
actually	269
away	267
orally	267
around	265
conversely	255
rarely	252
accurately	249
correctly	246
transiently	245
continuously	244
soon	243
globally	241
elsewhere	240
entirely	238
somewhat	236
serially	222
carefully	220
ribavirin	218
partly	217
herein	217
ever	207
besides	206
virtually	205
gradually	205
solely	201
altogether	197
manually	197
firstly	196
differently	195
kindly	194
properly	193
sufficiently	191
thereafter	190
precisely	186
n't	184
evolutionarily	184
slowly	177
virally	175
roughly	175
certainly	175
strictly	174
constitutively	173
strikingly	173
close	172
intrinsically	171
potently	170
locally	170
systematically	168
intranasally	166
occasionally	165
distantly	165
phylogenetically	164
faster	164
theoretically	164
obviously	163
meanwhile	163
late	157
chronically	155
transcriptionally	150
either	150
progressively	149
regularly	148
online	147
spontaneously	144
quantitatively	140
terminally	139
moderately	138
weakly	137
uniquely	136
exactly	136
translationally	135
live	135
intriguingly	132
third	131
lastly	131
short	129
fluorescently	128
traditionally	125
sequentially	123
right	123
historically	123
presently	122
fast	122
annually	122
totally	121
publicly	121
irrespective	121
heavily	121
drastically	121
freshly	119
repeatedly	118
secondly	117
physically	116
unexpectedly	114
thoroughly	114
retrospectively	113
serologically	111
nowadays	111
massively	111
urgently	110
systemically	108
fairly	107
automatically	107
intravenously	106
catalytically	106
versa	106
nsp10	106
constantly	105
reliably	104
minimally	104
dsrna	104
mutually	103
absolutely	103
outside	102
ideally	100
spatially	99
comparatively	99
shortly	98
reverse	97
internally	97
viral	95
uniformly	95
freely	95
antigenically	95
physiologically	90
interferon	90
abundantly	90
dynamically	89
undoubtedly	89
synergistically	87
hardly	86
immunologically	86
truly	84
enzymatically	84
artificially	83
appropriately	83
computationally	82
economically	81
lower	80
near	79
inversely	79
ubiquitously	79
therapeutically	78
proteolytically	78
half	78
seemingly	76
merely	76
unusually	75
therein	75
perfectly	75
intracellularly	75
afterwards	75
morphologically	74
preferably	73
concomitantly	72
along	72
profoundly	71
higher	70
basically	70
acutely	70
visually	69
principally	69
formerly	69
comprehensively	69
specially	68
exceptionally	67
concurrently	67
wide	67
incompletely	67
temporally	66
safely	66
reasonably	66
prospectively	66
inherently	66
geographically	65
correspondingly	65
closer	64
mildly	64
rationally	64
universally	64
subcutaneously	63
densely	63
metabolically	63
reproducibly	61
really	61
thereof	60
intraperitoneally	60
adequately	60
practically	59
exponentially	58
barely	58
mechanically	58
qualitatively	58
linearly	57
formally	57
deeply	57
intensively	56
unambiguously	55
temporarily	55
explicitly	55
competitively	54
aside	54
marginally	54
somehow	53
lncrnas	53
biochemically	53
internationally	52
thermodynamically	51
robustly	51
ifit2	51
gently	51
cantly	51
capsid	50
dependently	50
hopefully	50
reversibly	50
steadily	49
sexually	49
periodically	49
biorxiv	49
technically	48
taxonomically	48
optimally	48
fundamentally	48
reportedly	47
medically	47
permanently	47
cooperatively	47
singly	47
whereas	47
tentatively	47
productively	46
mechanistically	46
high	46
curiously	46
histologically	45
hereafter	45
gratefully	45
putatively	45
vrna	45
vertically	44
though	44
ssdna	44
schematically	44
low	44
endogenously	44
ectopically	44
classically	44
adversely	44
maybe	43
conceivably	43
exogenously	43
phenotypically	43
qpcr	43
seriously	43
forth	42
evidently	42
conclusively	42
bacterially	42
ahead	42
definitively	41
continually	41
inevitably	41
empirically	41
intimately	41
ill	40
deep	40
definitely	40
evenly	40
externally	40
unequivocally	40
invariably	40
mavs	40
noticeably	40
sharply	40
fortunately	39
distinctly	39
energetically	39
fine	39
vastly	39
inside	39
semi	39
weekly	39
latently	39
molecularly	38
free	38
arguably	38
shrna	37
characteristically	37
sterically	37
vigorously	36
purely	36
promptly	36
fold	36
abnormally	36
modestly	35
analogously	35
course	35
extraordinarily	35
ca	35
officially	35
pdcov	35
x-100	35
paradoxically	35
surgically	34
intramuscularly	34
fourth	34
financially	34
faithfully	34
conceptually	34
cally	34
lately	33
arbitrarily	33
crucially	33
developmentally	33
nasally	33
maternally	33
mrnas	33
radioactively	33
last	32
inefficiently	32
iteratively	31
conveniently	31
conventionally	31
home	31
dominantly	31
oligonucleotide	31
prematurely	31
pharmacologically	31
predominately	31
onwards	31
triple	30
suddenly	30
spectrophotometrically	30
pdna	30
jointly	30
horizontally	30
consecutively	30
ciently	30
rigorously	29
infrequently	29
posttranslationally	29
seldom	29
tremendously	29
und	29
synthetically	28
prominently	28
irreversibly	28
identically	28
firmly	28
deliberately	28
coarse	28
microscopically	27
conformationally	27
finely	27
generously	27
matter	27
top	27
sporadically	27
successively	27
topologically	27
ssrna	27
nonspecifically	26
incorrectly	26
epidemiologically	26
comparably	26
aberrantly	26
epigenetically	25
dose	25
doubly	25
eif2α	25
hereby	25
grossly	25
tenfold	25
thrice	25
disulfide	24
dual	24
magnetically	24
else	24
loosely	24
thermally	24
prophylactically	24
thirdly	24
vsrnas	24
proportionally	24
exceedingly	23
anywhere	23
dually	23
enormously	23
environmentally	23
clear	23
left	23
natively	23
nucleoside	23
surely	23
remotely	23
b2c	22
convincingly	22
histopathologically	22
passively	22
postoperatively	22
slower	22
supposedly	22
antiparallel	21
behind	21
incidentally	21
coaxially	21
conditionally	21
recombinantly	21
intentionally	21
overly	21
variably	21
vrnps	21
intracranially	21
farther	20
autonomously	20
blunt	20
confidently	20
enterically	20
extracellularly	20
hard	20
intracerebrally	20
luciferase	20
nationally	20
nsp9	20
optically	20
notoriously	19
intensely	19
isotopically	19
inadvertently	19
pcdna	19
rmers	19
radically	19
hyper	18
appreciably	18
coordinately	18
diffusely	18
electrically	18
everywhere	18
genotypically	18
highest	18
imatinib	18
intuitively	18
limd1	18
nm	18
nsp2	18
reciprocally	18
round	18
slow	18
timely	18
twofold	18
immunohistochemically	17
allosterically	17
falsely	17
disproportionately	17
kinetically	17
little	17
pathologically	17
exquisitely	16
alike	16
backward	16
doubt	16
electrochemically	16
exosome	16
aseptically	16
favorably	16
invasively	16
p7	16
predictably	16
reversely	16
immensely	16
diagnostically	15
electrostatically	15
electrophoretically	15
discontinuously	15
directionally	15
broad	15
chiefly	15
cautiously	15
alternately	15
accidentally	15
gp64	15
full	15
nicely	15
henceforth	15
ns2a	15
suitably	15
sensitively	15
scientifically	15
numerically	15
upf3b	15
voluntarily	15
maximally	15
lincrnas	15
lincrna	15
ifit1	15
foremost	14
adoptively	14
anymore	14
centrally	14
cfdna	14
compositionally	14
congenitally	14
digitally	14
ecologically	14
fluorescein	14
incredibly	14
humanely	14
sooner	14
insufficiently	14
strategically	14
spectrally	14
visibly	14
presumptively	14
plausibly	14
mock	14
lytically	14
-were	13
afterward	13
autoproteolytically	13
geometrically	13
clonally	13
counter	13
eg	13
eukaryotically	13
excessively	13
bilaterally	13
inadequately	13
oppositely	13
trim5α	13
somewhere	13
orthogonally	13
indiscriminately	13
mathematically	13
inward	13
intradermally	13
inducibly	13
ncrna	12
belpv	12
deeper	12
docetaxel	12
homogeneously	12
inappropriately	12
indefinitely	12
indoors	12
longest	12
longitudinally	12
minus	12
topically	12
nsp15	12
nucleotide	12
optionally	12
outward	12
photochemically	12
provisionally	12
rnase	12
straight	12
negative	12
cotranslationally	11
hitherto	11
graphically	11
extemporaneously	11
equivalently	11
legally	11
conservatively	11
blindly	11
anonymously	11
abroad	11
hugely	11
sparsely	11
monthly	11
symmetrically	11
neutrally	11
μl	11
upper	11
upwards	11
per	11
noncovalently	11
niclosamide	11
new	11
electronically	10
contrarily	10
dropwise	10
distinctively	10
direct	10
cytoplasmically	10
cumulatively	10
controversially	10
amply	10
beforehand	10
astrocyte	10
assays	10
anyway	10
adaptively	10
abruptly	10
-p	10
intermittently	10
hypothetically	10
threefold	10
intra	10
personally	10
leafroll	10
variously	10
swiftly	10
subtly	10
sincerely	10
pretty	10
post	10
recurrently	10
operationally	10
macroscopically	10
noninvasively	10
light	10
lightly	10
lentiviral	10
morbidly	10
n=5	10
cold	9
ironically	9
insofar	9
hierarchically	9
genomically	9
fivefold	9
erroneously	9
endonucleolytically	9
detectably	9
isothermally	9
chromosomally	9
basally	9
backwards	9
asymmetrically	9
anatomically	9
ambiguously	9
albeit	9
-tag	9
irregularly	9
open	9
laterally	9
pharmaceutically	9
wholly	9
understandably	9
super	9
subfamily	9
stringently	9
singularly	9
rhd-	9
pro	9
meaningfully	9
overwhelmingly	9
wrongly	9
onward	9
objectively	9
nearby	9
nationwide	9
micrornas	9
oronasally	9
focally	8
evolutionally	8
exhaustively	8
n=18	8
imperfectly	8
intratracheally	8
majorly	8
endothelial	8
ethically	8
cross	8
endemically	8
distally	8
dietetically	8
complex	8
bioinformatically	8
badly	8
autocatalytically	8
-escape	8
oxidatively	8
nucleocapsid	8
narrowly	8
peripherally	8
stochastically	8
popularly	8
yearly	8
virologically	8
upward	8
unsuccessfully	8
unnecessarily	8
technologically	8
superficially	8
stoichiometrically	8
unevenly	8
sometime	8
secondarily	8
seasonally	8
score	8
scarcely	8
realistically	8
pubrc1-p88u	8
preliminarily	8
snorna	8
nonsevere	7
lowest	7
magnetic	7
mistakenly	7
neonatally	7
oft	7
nsp14-nsp10	7
nuclease	7
nutritionally	7
latter	7
literally	7
30-fold	7
inconsistently	7
improperly	7
genuinely	7
filo-	7
exemplarily	7
excellently	7
elegantly	7
doubtless	7
bidirectionally	7
admittedly	7
ostensibly	7
operatively	7
ethnically	7
outdoors	7
site(s	7
outwards	7
whole	7
whereafter	7
vp0	7
vitally	7
transplacentally	7
transovarially	7
throughout	7
therapeutic	7
synchronously	7
smallest	7
within	7
serendipitously	7
overtly	7
regionally	7
purposely	7
proportionately	7
prohibitively	7
privately	7
prenatally	7
posttranscriptionally	7
paternally	7
satisfactorily	7
encouragingly	6
expectedly	6
favourably	6
fcgriiib	6
flexibly	6
inos	6
generically	6
hbsab	6
hemodynamically	6
impressively	6
intramolecularly	6
dna18	6
easy	6
2k	6
desperately	6
dark	6
concordantly	6
coincidentally	6
aunps	6
asymptomatically	6
antivirally	6
antenatally	6
anomalously	6
amazingly	6
alongside	6
nabs	6
-5aa	6
logically	6
fluorophore	6
neither	6
selfassembly	6
nominally	6
v2.0	6
unquestionably	6
uncommonly	6
trimeric	6
subgroup	6
subclinically	6
stepwise	6
sort	6
sixfold	6
since	6
shortest	6
serbc	6
symptomatically	6
sadly	6
perpendicular	6
nsps	6
s1b	6
ntat2aneo	6
opportunistically	6
parenterally	6
oftentimes	6
postnatally	6
proactively	6
processively	6
protectively	6
proximally	6
eif4e	5
heretofore	5
eif4gi	5
erf1	5
erv1	5
excitingly	5
feasibly	5
formamide	5
fortuitously	5
intricately	5
hsp70h	5
ifi44	5
implicitly	5
insignificantly	5
interchangeably	5
können	5
leucocyte	5
liberally	5
downward	5
eagerly	5
approximatively	5
diversely	5
cotranscriptionally	5
mean+sd	5
50-fold	5
a549	5
abietina	5
across	5
aka	5
arrhythmias	5
asynchronously	5
avct12	5
avidly	5
bhk-21	5
biophysically	5
blast+	5
causally	5
cccdna	5
colorimetrically	5
contiguously	5
logistically	5
aptly	5
meticulously	5
unequally	5
similarily	5
small	5
smoothly	5
snornas	5
socially	5
somatically	5
stali	5
statically	5
unique	5
severe	5
unlikely	5
µm	5
unsurprisingly	5
vegetatively	5
wider	5
worst	5
±sd	5
mg	5
shorter	5
usefully	5
reproductively	5
ordinarily	5
reassuringly	5
mosns	5
nalidixic	5
north	5
microbiologically	5
nsp	5
nsp7	5
openly	5
neatly	5
orf4b	5
reassembly	5
plus	5
protease	5
publically	5
purposefully	5
radiologically	5
organically	5
fourthly	4
flat	4
exempli	4
etms	4
etiologically	4
epistatically	4
discretely	4
ds)rnas	4
doi:10.1016	4
disappointingly	4
diagrammatically	4
dhx15	4
gastric	4
fresh	4
ifn)-gamma	4
gata4	4
graciously	4
green	4
gö	4
helically	4
hev	4
hiv-1/2	4
icosahedrally	4
il)-8	4
incrementally	4
industrially	4
instantly	4
interactively	4
intermediately	4
custom	4
cyclically	4
arna	4
crystallographically	4
contrastingly	4
-1	4
-mostly	4
-where	4
abortively	4
acetaminophen	4
additively	4
advantageously	4
aggressively	4
agriculturally	4
algorithmically	4
ancestrally	4
isrna	4
astanarg	4
atrh5	4
atypically	4
axially	4
basolaterally	4
bdna	4
biweekly	4
brightly	4
bx795	4
categorically	4
cheaply	4
chromatin	4
circrna	4
cognitively	4
collaboratively	4
conjointly	4
consequentially	4
intermolecularly	4
conspicuously	4
kind	4
recursively	4
redundantly	4
regrettably	4
respectfully	4
rhtrim5α	4
rigidly	4
rnaseiii	4
rwt	4
securely	4
sept12	4
silently	4
snornps	4
solid	4
speci¢cally	4
spherically	4
synaptically	4
tively	4
traf6	4
transcriptase	4
trinucleotide	4
truthfully	4
ubiquitination	4
undeniably	4
unidirectionally	4
unpredictably	4
whatsoever	4
worse	4
yes	4
αiib	4
lead	4
red	4
vividly	4
rectly	4
partial	4
measurably	4
rectally	4
mmachine	4
monotherapy	4
n=26	4
nally	4
neuraminidase	4
nlrp3	4
nshp01d	4
nterminally	4
opposite	4
overhead	4
p=0.016	4
paclitaxel	4
mucosa	4
perpendicularly	4
promiscuously	4
pmes.i	4
quicker	4
recombinationally	4
pt7	4
proximately	4
radially	4
preventively	4
posteriorly	4
polynucleotide	4
radiographically	4
prbcs	4
prebiotically	4
endosomally	3
fecally	3
famously	3
faintly	3
fleetingly	3
etoposide	3
ethnopharmacologically	3
erratically	3
epidemically	3
enzymatic	3
entropically	3
exonuclease	3
elaborately	3
endoscopically	3
endlessly	3
eminently	3
embryonically	3
eif5	3
eif4aiii	3
efficaciously	3
edna	3
eccentrically	3
ebds	3
forever	3
duly	3
fluorometrically	3
ifit3	3
fortnightly	3
il)-2	3
disulphide	3
innately	3
infinitely	3
inexpensively	3
inductively	3
indistinctly	3
inclusively	3
imo	3
immunochemically	3
immuno	3
imagej	3
i-3c	3
forwards	3
hypoxically	3
hydrophobically	3
htert	3
hormonally	3
homogenously	3
heterogeneously	3
harmlessly	3
harder	3
haemodynamically	3
hadv	3
furtherly	3
dnag.	3
allantoically	3
dendritically	3
10/4	3
alphabetically	3
alarmingly	3
agnps	3
agencourt	3
ably	3
5′-fam	3
interfere	3
3-moderatly	3
2-fold	3
15-fold	3
100-fold	3
/socially	3
analytically	3
-v	3
-turns	3
-that	3
-o	3
-naively	3
-manually	3
-incorrectly	3
-approximately	3
-2b	3
-2aa	3
-2007	3
although	3
anecdotally	3
demonstrably	3
chronologically	3
decussately	3
decisively	3
ddx25	3
cytogenetically	3
confusingly	3
concisely	3
compatible	3
colorimetric	3
colloquially	3
clockwise	3
circularly	3
cd105	3
anew	3
cardiosphere	3
bravely	3
biomedically	3
bet	3
beneficially	3
bacteriologically	3
axenically	3
astonishingly	3
architecturally	3
aptamer	3
apt	3
instantaneously	3
trimar	3
intravitreally	3
rnastructure	3
sterile	3
steeply	3
starkly	3
spectroscopically	3
spatiotemporally	3
snrnps	3
simplistically	3
signiwcantly	3
serpinb1	3
seamlessly	3
rotationally	3
rnaimax	3
straightaway	3
ribosomally	3
retrogradely	3
residually	3
representatively	3
replica	3
repetitively	3
ready	3
rapid	3
qv	3
quietly	3
quick	3
sterilely	3
strangely	3
p~0.01	3
vaginally	3
justly	3
m	3
l	3
π	3
Δz	3
~6	3
zoonotically	3
wildly	3
vr-2332	3
vice	3
vanishingly	3
v7.2	3
strong	3
upside	3
unavoidably	3
trivially	3
triply	3
tight	3
tially	3
tia-1	3
thereupon	3
thapsigargin	3
thankfully	3
territorially	3
qev	3
wisely	3
puzzlingly	3
mutationally	3
nsp7l8	3
northward	3
noncompetitively	3
nomenclatorily	3
nl63	3
nitroprusside	3
nearer	3
nct03829384	3
nanomaterial	3
myocarditis	3
mycologically	3
multifocally	3
ny-1	3
morally	3
monotonically	3
monomerically	3
mitochondrially	3
methodologically	3
methodically	3
mentally	3
lq1601	3
localizes	3
psychologicallyspiritually	3
like	3
nucleatum	3
median	3
n’t	3
pirna	3
promisingly	3
oldest	3
prudently	3
primase	3
prevail	3
pres1	3
preclinically	3
precipitously	3
pp65	3
powerfully	3
positionally	3
prevalently	3
piecemeal	3
perinatally	3
physicochemically	3
orthotopically	3
pathogenically	3
patient	3
parenthetically	3
optimem	3
peritoneally	3
pervasively	3
photometrically	3
orbitally	3
eif-4a	2
eightfold	2
eu293175	2
electrocatalytically	2
electrochemical	2
em	2
enantiomerically	2
enthalpically	2
eosinophil	2
episodically	2
extragenically	2
everyday	2
evolved	2
extra	2
extrachromosomally	2
faecally	2
fastest	2
fatally	2
fecal	2
eber1	2
flavivirus	2
fmhv	2
ecdna	2
dicer1	2
earliest	2
e3l	2
dangerously	2
froward	2
de-	2
dead	2
decidedly	2
deferentially	2
delicately	2
delightfully	2
demographically	2
descriptively	2
detrimentally	2
dh10b	2
diagonally	2
dimensionally	2
disome	2
dosedependently	2
doubtlessly	2
downhill	2
dpi	2
e220	2
e2f	2
frankly	2
hydrodynamically	2
fugene	2
furthest	2
ically	2
icpec	2
icpedv-	2
ifnlr1	2
ighm	2
il4	2
illegally	2
imidazole	2
immunogenically	2
immunomagnetically	2
impractically	2
inasmuch	2
inconspicuously	2
indisputably	2
indistinguishably	2
inexorably	2
inflamm	2
ingly	2
inordinately	2
integrally	2
cryomicroscopy	2
hypoxic	2
hybrid	2
https://www.epicentro.iss.it/coronavirus/sars-cov-2	2
happily	2
für	2
gadd45b	2
gdna	2
genera	2
germline	2
glabra	2
h10n7	2
halfway	2
hapn	2
harmonically	2
hsv-1	2
heavy	2
hmgb1	2
hnrnpa1	2
hnrnps	2
homeostatically	2
homotypically	2
hrly	2
hsp90	2
hspa1a	2
damn	2
artinm	2
covalent	2
autosomal	2
acoustically	2
alfacon-1	2
amniotically	2
amphisome	2
anaerobically	2
angly	2
anisotropically	2
antennae	2
antiviral	2
anyhow	2
anytime	2
apically	2
apobec3h	2
apoferritin	2
archaea	2
arl13b	2
arrestin	2
artifactually	2
asp234	2
asymptotically	2
atg5	2
abcc4	2
a249s	2
a-549	2
-whereas	2
-2016	2
-2a	2
-ar	2
-cite	2
-i	2
-mainly	2
-notably	2
-particularly	2
-possibly	2
//doi	2
99mtc	2
0.5×tbe	2
10-fold	2
20-fold	2
24/7	2
25-fold	2
3′utr	2
4-fold	2
5672r_a6	2
6.9x	2
autoradiographically	2
b.w./day	2
counterintuitively	2
b16-hgp100	2
chirally	2
cially	2
cin8	2
circumferentially	2
cisplatin	2
closest	2
cnkr	2
co	2
coevolve	2
cogently	2
coherently	2
colocalizes	2
combinatorially	2
compassionately	2
complexly	2
concretely	2
configurationally	2
content	2
coordinatively	2
coterminal	2
countably	2
centrifugally	2
ccar1	2
caveolin	2
bly	2
baseline	2
batf2	2
intracardially	2
beneath	2
beside	2
bilayer	2
biosphere	2
biosynthetically	2
blank	2
bmal1	2
catastrophically	2
bodywide	2
boldly	2
bottom	2
brilliantly	2
broader	2
canonically	2
capably	2
capside	2
carelessly	2
interleukin-2	2
beautifully	2
intragastrically	2
rightly	2
rna*dna	2
robotically	2
rrt	2
s3l2-only	2
sembly	2
sensibly	2
serinc5	2
serotypically	2
severalfold	2
shoud	2
sicon	2
significatively	2
siupf3x	2
sjvb	2
smaller	2
smartly	2
smorf	2
sofar	2
sonographically	2
soricomorph	2
southward	2
riluzole	2
rhythmically	2
ppss	2
rgs4	2
preassembly	2
presciently	2
prethrombin-2	2
pretreatment	2
professionally	2
profile	2
programmatically	2
prokaryotically	2
pseudo	2
psmpuw	2
puc	2
quarterly	2
r68a	2
re-	2
realtime	2
recessively	2
relatedly	2
relevantly	2
rep2	2
replicatively	2
responsibly	2
speculatively	2
sre	2
strail	2
succesfully	2
undesirably	2
unduly	2
unilaterally	2
uorf	2
valproate	2
valuably	2
vdna	2
versus	2
warmly	2
webserver	2
west	2
whereupon	2
wich	2
wildest	2
willingly	2
wise	2
worryingly	2
αvβ3/5	2
‫ס‬	2
−)ssdna	2
intranodally	2
unconditionally	2
uncompetitively	2
unbiasedly	2
thin	2
succinctly	2
suggestively	2
sup-	2
symbiotically	2
synonymously	2
synthetic	2
ten	2
tgase1	2
thence	2
thrombin	2
unacceptably	2
tnfrsf10b	2
tnf	2
tone.js	2
topographically	2
traf-6	2
transversely	2
tsntcp	2
ultra	2
ultrastructurally	2
pragmatically	2
substantively	2
polysome	2
miclip	2
mir-17	2
misassembly	2
mitotically	2
modularly	2
monopyrene	2
morever	2
ms2vlps	2
mt594401	2
mt594402	2
mucosally	2
n=41	2
na1	2
naively	2
nantly	2
nascently	2
naï	2
nearest	2
neuac	2
neuronally	2
neurosurgically	2
newer	2
mir-155	2
metronidazole	2
nl4	2
metric	2
intraocularly	2
polymerases	2
ionically	2
iq5	2
irrespectively	2
isothermal	2
itaq	2
ketolide	2
lamivudine	2
lb	2
lesser	2
leukemias	2
lipoplex	2
lmp-1	2
lowly	2
lsm1	2
lumenally	2
luminometrically	2
lys,3	2
mab	2
mass	2
nglycosidically	2
microbially	2
non	2
p=0.027	2
parallel	2
parallelly	2
parametrically	2
parc	2
pathophysiologically	2
pb620	2
pcambia	2
pcdna3.1	2
pde	2
perorally	2
perversely	2
pfam	2
photosynthetically	2
phsh1-shlmp1	2
pi-103	2
pin	2
placentally	2
pltrasc	2
pneumatically	2
pnl4	2
poly(a)-tail	2
p=0.34	2
pdgf	2
nsp16-nsp10	2
nuclearly	2
noncanonically	2
p58ipk	2
norp01d	2
northwest	2
notwithstanding	2
nsp12	2
nsp1–16	2
nsp5	2
nsp6	2
nt10400	2
nucleases	2
nucleicacid	2
nucleolin	2
nucleus	2
occupationally	2
oddly	2
osteoblast	2
overseas	2
p1234	2
noncovalent	2
estingly	1
escrt-	1
ess3b	1
espetially	1
esp	1
explant	1
erkrankt	1
ergodically	1
erently	1
ethoxyzolamide	1
erentially	1
ethnopharmacology	1
expertly	1
eu337016	1
eu448369	1
ewqe9edq	1
exclusrvely	1
exonically	1
expectably	1
expectantly	1
expeditiously	1
expensive	1
expetimentally	1
epub	1
er	1
emergently	1
episomally	1
endergonically	1
extinct	1
elonginc	1
em-	1
elf4gl	1
emigrate	1
emotionally	1
emphatically	1
emptively	1
en	1
endemic	1
endocytically	1
epidermally	1
endogenous	1
endolysosomally	1
endoribonucleolytically	1
endosonographically	1
enigmatically	1
entfällt	1
environmentfriendly	1
enzyme	1
enzymeimmunoassays	1
ephrinb1	1
exteriorly	1
gc-3'-fl	1
extrahelically	1
flightless	1
fluoreseently	1
fluorochrome	1
folic	1
follistatin	1
forcefully	1
forcibly	1
foster	1
foul	1
foward	1
frameshift	1
frenziedly	1
fro	1
frustratingly	1
futher	1
g46s	1
gag	1
galcer	1
gattctctaactgcgcatgcttctgcgcacgcgcaatagacattccaggacttccgggcacttcgtaaggtttaaaaaggatgcttcgcgttttctctctcctttttggagacagattc	1
gcvb	1
gene(s	1
gestationally	1
gig.db	1
electrophillically	1
fluid	1
flagellin	1
extrinsically	1
fk866	1
f1l	1
f2a	1
f7l4ty2j	1
facetiously	1
factor-2	1
factor-2-alpha	1
factor-4e	1
facultatively	1
failure(aclf	1
fak)family	1
fastidiously	1
fcgrs	1
fcorl	1
fcrn	1
fd4ap	1
fdc40ef786bf3a2a8ab0cc411620bfd21a11333d	1
federally	1
fetally	1
fifth	1
fifthly	1
figuratively	1
filtrate	1
fittingly	1
electrophysiologically	1
d4t	1
electronegatively	1
docilely	1
deoxyribose	1
devastatingly	1
diametrically	1
dicistronically	1
die	1
diligently	1
din2	1
dinucelotide	1
diphosphate	1
directedly	1
disadvantageously	1
disappointedly	1
discordantly	1
discreetly	1
discriminately	1
discursively	1
disporportionately	1
disproportionally	1
distributively	1
diurnally	1
divergently	1
divisively	1
dlbcl	1
denv	1
densitometrically	1
denote	1
dag)dependent	1
cytologically	1
cytolytically	1
cytoplasmitally	1
cytosolic	1
d120	1
d1312	1
d262c	1
gloriously	1
d52a	1
d71e	1
darkly	1
denatur	1
dc+	1
dddna	1
ddi	1
ddpcr	1
defectively	1
definetly	1
defintely	1
deleteriously	1
deltarn	1
demon-130	1
dnase1l3	1
domestically	1
electively	1
downfield	1
easely	1
easiest	1
east	1
eastwards	1
eber-1	1
eber1:~10	1
ect	1
ec~	1
eeeently	1
eetopically	1
effectievere	1
effectually	1
effkiently	1
egy-1	1
eicosanoid	1
eif2γ	1
eif4	1
eif4g-1	1
eigenschap	1
eii	1
elaborated'pseudoknot	1
elastically	1
elder	1
earnestly	1
ealretinin-22k	1
eachother	1
dt)18	1
downwards	1
doxorubicin	1
dphpc	1
dq376622	1
dq834384	1
drastisch	1
drh-3	1
drx-500	1
dsrna-1	1
dsrnas	1
dubmut	1
e9996bcc14b0cdf1da458165de69a67eaa1736b6	1
duodenum	1
duplex	1
e0206	1
e1-ecori	1
e1-p7	1
e192	1
e234	1
e35d6c05896a75cddc4c93d3fb6e7eac55087a95	1
e4broad	1
e6ap	1
gln-172	1
häufiger	1
glu166	1
incalculably	1
incontrovertibly	1
indelibly	1
independantly	1
indicatively	1
indifferently	1
inexplicably	1
inextricably	1
infact	1
infamously	1
infectiveness	1
infiziert	1
influenzavirusa	1
informally	1
informatically	1
informationally	1
ingeniously	1
inland	1
innovatively	1
inopportunely	1
inosine	1
insm1	1
inspiringly	1
instinctively	1
incisively	1
inaccurately	1
glutaredoxin	1
in2	1
ifn)-λ	1
ifvs	1
ihprf1	1
il-1β	1
il-8	1
il12b	1
imbert	1
immediadiately	1
immediateearly	1
immediatly	1
imminently	1
immunocytochemically	1
immunogenetically	1
immunohistologically	1
immunol	1
immunophenotypically	1
immunosenescence	1
immunosuppressant	1
immunsupprimierter	1
imperceptibly	1
implant	1
imprecisely	1
improbably	1
institutionally	1
integrin	1
integrity-	1
intellectually	1
irf-3-dependent	1
irf7/8	1
irmaediately	1
irrefutably	1
irreparably	1
irreplaceably	1
irretrievably	1
irs-1ptyr20	1
irtually	1
isbh	1
isg20	1
isocyanide	1
isoelectrically	1
isstrand	1
isuf	1
itraq	1
itwas	1
iu	1
iv.group	1
j.f.peden	1
jak)/stat	1
jca-154	1
jcem;1997;82:234	1
ires-2a	1
irdly	1
ipknot	1
intradermolingually	1
intercellularly	1
interferongamma	1
interleukin-1beta	1
interleukin-6	1
interperitoneally	1
intersectin	1
intraabdominally	1
intraaxonally	1
intracerebally	1
intracytoplasmically	1
intramucosally	1
iontophorefically	1
intransally	1
intrapentoneally	1
intrathecally	1
intratumorally	1
intravaginally	1
intronsearly	1
invertase	1
involuntarily	1
inwards	1
ionophore	1
ifi27	1
idually	1
idna	1
heteroduplexes	1
h847	1
haem	1
hal2p	1
halfapparently	1
halfmaximally	1
hardest	1
harmfully	1
harmlose	1
harshly	1
hastily	1
hbcs	1
hbeag	1
hbmecs	1
helix	1
helpab	1
hem45	1
hemmi	1
heparin	1
hepatocyte	1
hepg2-neo	1
heptameric	1
hereditarily	1
hereinafter	1
h5n1-like	1
h4a	1
h33n	1
grb10	1
gly	1
glycopeptide	1
glycosidically	1
gneetically	1
gondii(me49	1
gp1	1
gr-1	1
gr6v098c	1
gracefully	1
graduately	1
gripap1	1
h1n1)swl	1
grna	1
gruel	1
gtggatacacccgggaggtcactctccccgggctctgtccaagtggcgtaggggagcatagggctctgccccatgatgtacaagtccctttccacaacgttggaaataaagctgggcct	1
gtx118713-s	1
guanylyl	1
gvfld.	1
göpfert	1
h(x(n(t)))/log	1
h-2k	1
h143	1
hermetically	1
hexagonally	1
idly	1
hhv-6-dna	1
hsp100s	1
hsp60	1
hsp60-hsp10	1
hsp90α	1
hsv)-2	1
hsv1	1
htr8-svneo	1
http://exon.niaid.nih	1
http://orcid.org/0000-0002-1713-8220	1
http://www.iipcr.com/eweb/	1
http://www.who	1
https://doi.org/10.1038/s41401-019-0332-7	1
https://orcid.org/0000-0002-7141-1785	1
hydrologically	1
hypernegatively	1
hyperoside	1
cys144	1
i287	1
iatrogenically	1
ibv-15532r	1
icam-1	1
icam-5	1
icsarsdorf9b	1
hrv‐3	1
hq660155	1
hpr85	1
hm175/18f	1
higly	1
himmediately	1
his52	1
histochemically	1
histomorphologically	1
histopatologically	1
hiv-1-productively	1
hivenv	1
hku12	1
hl87144	1
hnrnp	1
hpiv4	1
hntcp	1
homodimer	1
homogeneuosly	1
homopolymeric	1
honestly	1
hotly	1
hp1437	1
hpa-4	1
hpev	1
hpiv-2	1
cys301	1
bzlf-1	1
cymmv	1
a.128.1	1
a0/33.3	1
a1874-u1879	1
a19d	1
a27·(g7-c14	1
a31a3	1
a3c3	1
a3g	1
a66	1
aa)g.	1
aaz95518.1	1
ab	1
ab)6	1
ab-3730	1
ab047639	1
ab217130	1
abo*a01	1
abovepotently	1
abrb	1
abzusichern	1
ac	1
ac-15	1
academically	1
accaugg	1
a.com/pipel	1
a-172	1
amperometrically	1
a+u	1
3dna	1
4.2x103	1
4su	1
5-day	1
5-fold	1
50fold	1
5469e5474	1
5th	1
6-carboxyfluorescein	1
6-fluoro-3-hydroxy-2-pyrazinecarboxamide	1
60x	1
61−63	1
63•	1
6hrs	1
6nur	1
6vsb	1
7.73-fold	1
7269117b84a91a52f5ce7bd335b967559962eaa6	1
8.6fold	1
97·03	1
\/irology	1
a'-j	1
a'n	1
accumulate~10	1
aceris	1
acliv	1
aco//	1
aiv)another	1
akeady	1
al1	1
alaninal	1
alere	1
alfab)6	1
algebraically	1
alkali	1
allegedly	1
allyl	1
alphamelanocyte	1
alternanthera	1
alternate	1
althrough	1
altough	1
alv	1
am946981	1
amfrinsulin	1
amide	1
amidite	1
amikacin	1
amim	1
amirna	1
aids).therefore	1
ai54238	1
ahighly	1
afield	1
act	1
adenoviral	1
adfigzc1	1
aerobically	1
aerodynamically	1
aetiologically	1
af283103	1
af345858	1
afar	1
affirmatively	1
afloop	1
ah2012/12	1
afresh	1
ag7404	1
agarose	1
aggresomes	1
agmoir	1
agnoprotein	1
agnostically	1
agonistically	1
agro	1
agronomically	1
3ae00	1
3abc	1
35x	1
-how	1
-azido	1
-block	1
-cell	1
-chf	1
-ciber	1
-classically	1
-clinically	1
-cmethyl	1
-constitutively	1
-cooh/-s-(ch	1
-ct18	1
-cyp	1
-d	1
-donor	1
-either	1
-enzyme	1
-especially	1
-essentially	1
-family	1
-finally	1
-formerly	1
-fortunately	1
-globally	1
-atrh5	1
-apparently	1
-amyloid	1
-2003	1
-(kallikrein	1
--asn	1
-/model	1
-10,9536	1
-1117	1
-15	1
-16,6795	1
-192	1
-19a	1
-20	1
-4231	1
-alternatively	1
-4c.	1
-509c	1
-6-carboxyfluorescein	1
-6wkq	1
-8,8561	1
-81bp	1
-9.5	1
-aaaaaa	1
-ab	1
-acggtgc	1
-hif2	1
-hrp	1
3-timely	1
-immediately	1
-theoretically	1
-thrombin	1
-tks4-beta	1
-usually	1
-utrÁ3	1
-worldwide	1
-wp7	1
-zustand	1
-γ	1
1.4620.75	1
1.6x	1
100x	1
150×150-nt	1
17-fold	1
1785-y	1
18-fold	1
19k	1
1slightly	1
2-bis	1
2/+ifn	1
2ahm	1
2′-fl	1
2′-fluoro-/amino	1
-tg;fcgriib	1
-temporally	1
-subsequently	1
-practically	1
-importantly	1
-leu47argwere	1
-likely	1
-log10(bonferroni	1
-mochlim	1
-namely	1
-nkg2a	1
-not	1
-phosphatidylinositol	1
-poorly	1
-preferably	1
-strand	1
-preliminary	1
-primarily	1
-promoter	1
-really	1
-sensitive	1
-smallpox	1
-spectroscopic	1
-ssdna	1
-start	1
-stat	1
amongand	1
amtor	1
cylindrically	1
celltetratuftsin	1
central	1
centripetally	1
cffdna	1
cflip	1
challengingly	1
chelate	1
chop10	1
choreographically	1
chr3	1
chromatographically	1
cicantly	1
cifically	1
circadianly	1
cl15h6	1
claudin	1
cleanly	1
clearely	1
cleverly	1
climatologically	1
clinicopathologically	1
clustalw	1
cml14	1
cmtr1	1
cently	1
cefotaxime	1
analyte	1
cdcs	1
bs232	1
bsah	1
bsp119i	1
bsp120i	1
bta798	1
bvd2-pb	1
bvp10	1
bwn	1
jhm(3	1
c-682	1
c145i	1
c5x	1
cagi5	1
calmly	1
calorimetric	1
capillary	1
carbontetrachroride	1
card1	1
cardiacally	1
caspase-8	1
catl	1
caudally	1
cause(s	1
cm²	1
codebase	1
cohesively	1