adverb

This is a table of type adverb and their frequencies. Use it to search & browse the list to learn more about your study carrel.

adverb	frequency
also	18482
however	9461
well	6347
highly	4378
therefore	3449
often	3093
even	3072
recently	2955
previously	2576
respectively	2364
usually	2264
still	2232
currently	1961
especially	1925
first	1875
directly	1834
significantly	1811
now	1805
less	1772
particularly	1771
furthermore	1626
approximately	1557
generally	1514
moreover	1439
relatively	1410
yet	1377
later	1367
frequently	1363
together	1354
rather	1351
mainly	1346
probably	1321
commonly	1297
rapidly	1213
encephalitis	1181
interestingly	1152
potentially	1128
indeed	1126
much	1103
newly	1098
closely	1068
far	1067
finally	1064
similarly	1035
primarily	1001
subsequently	988
typically	975
likely	968
already	968
specifically	967
prior	966
worldwide	960
widely	951
least	930
naturally	913
clearly	869
almost	862
additionally	858
long	847
experimentally	811
hence	810
efficiently	791
genetically	778
thereby	763
sometimes	731
fully	714
clinically	710
double	709
successfully	697
completely	689
initially	688
alone	676
possibly	670
largely	670
early	660
nevertheless	656
mostly	650
just	614
readily	613
perhaps	610
easily	600
strongly	580
effectively	574
single	571
nt	565
always	560
instead	559
importantly	531
extremely	525
nearly	483
better	473
rarely	470
consequently	469
partially	462
normally	462
longer	460
negatively	454
eventually	454
poorly	446
simultaneously	440
otherwise	437
broadly	436
greatly	428
immediately	428
apparently	425
quite	423
occasionally	411
predominantly	408
extensively	408
notably	393
quickly	392
ultimately	390
earlier	378
increasingly	377
best	376
back	373
briefly	371
alternatively	368
slightly	352
namely	346
antigenically	336
ns3	331
independently	328
presumably	326
positively	324
originally	324
overall	313
soon	313
ago	305
necessarily	299
severely	298
unfortunately	297
never	294
daily	294
commercially	289
simply	288
apart	284
twice	284
globally	284
live	282
actually	275
selectively	273
regardless	272
exclusively	271
routinely	268
orally	267
persistently	266
statistically	264
likewise	259
elsewhere	251
critically	248
essentially	247
dramatically	246
next	244
intranasally	243
indirectly	242
consistently	242
annually	239
certainly	235
ever	233
preferentially	232
considerably	232
remarkably	230
substantially	228
enough	219
second	215
virtually	212
accordingly	212
nonetheless	210
surprisingly	207
away	206
entirely	206
randomly	205
somewhat	204
actively	204
differentially	203
conversely	203
equally	201
functionally	198
sufficiently	195
continuously	192
carefully	191
structurally	190
markedly	189
separately	189
around	184
biologically	179
upstream	177
ribavirin	175
partly	171
overnight	171
heavily	166
covalently	166
regularly	165
gradually	165
properly	163
historically	162
forward	160
immunologically	156
downstream	156
strictly	153
individually	152
shortly	150
accurately	150
chemically	148
late	147
chronically	143
obviously	141
n't	137
slowly	137
traditionally	136
solely	135
roughly	135
dsdna	135
presently	133
thereafter	132
locally	132
tightly	132
constantly	131
differently	124
undoubtedly	123
collectively	122
phylogenetically	121
serologically	120
fairly	120
distantly	117
morphologically	116
thoroughly	115
repeatedly	114
virally	113
close	112
besides	112
herein	109
spontaneously	108
stably	107
precisely	104
either	104
outside	103
irrespective	103
ideally	102
serially	102
fortunately	100
firstly	100
versa	97
progressively	97
latently	97
geographically	97
altogether	97
acutely	97
correctly	96
fast	96
theoretically	95
faster	95
economically	95
totally	94
exactly	93
physically	92
really	91
viral	90
secondly	89
adequately	89
merely	89
short	89
third	89
urgently	89
transiently	87
subcutaneously	87
meanwhile	87
online	86
moderately	86
intramuscularly	86
drastically	86
evolutionarily	85
principally	85
nowadays	84
reliably	83
artificially	81
free	80
vertically	80
systematically	79
potently	79
truly	78
strikingly	77
formerly	77
epidemiologically	76
basically	76
hardly	76
sporadically	75
medically	75
quantitatively	74
passively	74
intravenously	74
sexually	73
safely	73
unusually	73
weakly	73
seldom	73
seemingly	72
histologically	72
intriguingly	71
formally	71
sequentially	69
preferably	69
freely	69
kindly	67
deeply	67
exceptionally	67
uniformly	67
purely	67
uniquely	66
manually	66
concurrently	66
universally	65
right	65
appropriately	65
course	64
absolutely	64
adversely	64
lastly	64
terminally	64
wide	63
publicly	63
constitutively	62
interferon	61
comparatively	61
seriously	60
incompletely	60
intensively	59
synergistically	59
near	59
inherently	58
inevitably	58
microscopically	57
low	57
invariably	57
home	57
closer	57
intracellularly	56
along	56
cantly	56
inversely	56
productively	56
unexpectedly	55
temporally	55
suddenly	55
retrospectively	55
reasonably	55
arguably	55
ahead	55
though	54
cold	54
intrinsically	53
spatially	53
mildly	53
und	52
periodically	52
minimally	52
densely	52
continually	52
characteristically	52
afterwards	52
fundamentally	51
abundantly	51
practically	51
intracerebrally	51
dsrna	50
ill	50
physiologically	49
tentatively	48
maternally	48
intraperitoneally	48
aside	48
fluorescently	47
concomitantly	47
high	47
reportedly	47
therapeutically	47
grossly	46
systemically	45
profoundly	45
infrequently	45
horizontally	45
explicitly	45
p7	44
hopefully	44
inadvertently	44
promptly	44
prophylactically	44
technically	44
ubiquitously	43
perfectly	43
optimally	43
specially	42
mechanically	42
lower	42
forth	42
freshly	41
internally	41
massively	41
singly	41
translationally	40
proteolytically	40
comprehensively	40
taxonomically	39
permanently	39
mutually	39
deliberately	39
conventionally	39
maybe	38
gratefully	38
paradoxically	38
temporarily	38
qualitatively	38
therein	37
steadily	37
internationally	37
gently	37
enzymatically	37
empirically	37
ecologically	37
indoors	36
deep	36
else	36
exponentially	36
somehow	36
inside	36
lately	36
thereof	36
firmly	35
classically	35
computationally	34
officially	34
robustly	34
rationally	34
intimately	33
parenterally	32
weekly	31
higher	31
competitively	31
alike	31
marginally	30
eg	30
correspondingly	30
definitively	30
disproportionately	30
predominately	30
environmentally	30
half	30
hev	30
surely	30
automatically	30
evenly	29
evidently	29
nasally	29
convincingly	29
metabolically	29
intratracheally	29
seasonally	29
sharply	29
transcriptionally	29
visually	29
vrnps	29
irreversibly	28
extracellularly	28
distinctly	28
curiously	28
barely	28
extraordinarily	27
chiefly	27
cooperatively	27
enormously	27
matter	27
molecularly	27
scientifically	27
whereas	27
phenotypically	26
biochemically	26
everywhere	26
nm	26
round	26
vastly	26
vrna	26
definitely	25
abnormally	25
accidentally	25
cally	25
conceivably	25
conceptually	25
unambiguously	25
doubly	25
finely	25
fourth	25
intermittently	25
fecally	25
onwards	24
conclusively	24
indefinitely	24
jointly	24
little	24
prematurely	24
provisionally	24
rigorously	24
supposedly	24
tenfold	24
intentionally	23
behind	23
congenitally	23
endogenously	23
vigorously	23
prospectively	23
synthetically	23
putatively	23
unequivocally	22
secondarily	22
schematically	22
pathologically	22
inadequately	22
coarse	22
asymptomatically	22
abruptly	22
genotypically	21
dually	21
enterically	21
posttranslationally	21
hitherto	21
overly	21
sterically	21
hereafter	20
anywhere	20
bacterially	20
capsid	20
catalytically	20
endemically	20
etiologically	20
thirdly	20
lightly	20
reproducibly	20
triple	20
virologically	20
wholly	20
mavs	20
hard	19
intradermally	19
intensely	19
insufficiently	19
histopathologically	19
prominently	19
gp64	19
anymore	19
afterward	19
abroad	19
linearly	19
transplacentally	19
radically	19
sooner	19
variously	19
tremendously	19
successively	19
reverse	19
somewhere	19
slow	19
reversibly	19
socially	19
improperly	18
cautiously	18
consecutively	18
conveniently	18
hereby	18
exceedingly	18
last	18
mechanistically	18
neonatally	18
north	18
notoriously	18
exogenously	17
autonomously	17
broad	17
crucially	17
doubt	17
energetically	17
ethically	17
satisfactorily	17
incorrectly	17
intracranially	17
literally	17
noticeably	17
surgically	17
thermally	17
nonspecifically	16
comparably	16
foremost	16
inefficiently	16
nicely	16
confidently	16
oft	16
ssdna	16
upwards	16
legally	16
semi	16
pharmacologically	16
enzootically	15
agnoprotein	15
aseptically	15
atg5	15
conditionally	15
dynamically	15
clear	15
forever	15
modestly	15
n'a	15
narrowly	15
scarcely	15
yearly	15
illegally	14
atypically	14
ciently	14
contrarily	14
disulfide	14
electrically	14
exquisitely	14
farther	14
publically	14
neuraminidase	14
numerically	14
onward	14
pnl4	14
strategically	14
swiftly	14
visibly	14
suitably	14
humanely	13
amply	13
anatomically	13
ca	13
conformationally	13
dropwise	13
electrostatically	13
externally	13
ironically	13
lethally	13
loosely	13
mathematically	13
outdoors	13
variably	13
left	13
nearby	12
arbitrarily	12
belpv	12
deeper	12
fold	12
eif2α	12
nodosa	12
sometime	12
south	12
topically	12
vegetatively	12
outward	12
favorably	11
immensely	11
focally	11
fine	11
financially	11
biorxiv	11
eagerly	11
centrally	11
alarmingly	11
mentally	11
incidentally	11
oronasally	11
noncovalently	11
since	11
ordinarily	11
synchronously	11
subclinically	11
straight	11
within	11
sensitively	11
sensibly	11
popularly	11
-p	10
laterally	10
causally	10
cially	10
cotranslationally	10
cyclophosphamide	10
dependently	10
elegantly	10
excessively	10
graphically	10
hugely	10
immunochemically	10
insofar	10
uncommonly	10
longitudinally	10
subgroup	10
magnetically	10
understandably	10
symptomatically	10
subtly	10
twofold	10
regionally	10
recombinantly	10
radiologically	10
plasmon	10
n'y	10
coincidentally	9
full	9
falsely	9
faithfully	9
dual	9
developmentally	9
counter	9
conservatively	9
antiparallel	9
c3h	9
beforehand	9
aunps	9
asymmetrically	9
antivirally	9
alternately	9
aggressively	9
inappropriately	9
impressively	9
subfamily	9
intuitively	9
proportionally	9
können	9
venereally	9
thrice	9
voluntarily	9
sparsely	9
regressively	9
qpcr	9
timely	9
politically	9
na1	9
maximally	9
macroscopically	9
luckily	9
leafroll	9
nationally	9
generously	8
electronically	8
exhaustively	8
faecally	8
fatally	8
fresh	8
henceforth	8
hardest	8
hemodynamically	8
heretofore	8
il)-2	8
dose	8
ectopically	8
aptly	8
dominantly	8
diffusely	8
diagnostically	8
culturally	8
clonally	8
bilaterally	8
basolaterally	8
badly	8
instantaneously	8
andersoni	8
although	8
aka	8
agnps	8
incredibly	8
appreciably	8
intra	8
pretty	8
whole	8
whatsoever	8
usefully	8
topologically	8
inward	8
thin	8
symmetrically	8
stringently	8
smoothly	8
silently	8
sadly	8
purposely	8
x-100	8
postoperatively	8
neatly	8
personally	8
irregularly	8
logically	8
lytically	8
metagenomically	8
longest	8
nosocomially	8
nsp2	8
occupationally	8
overseas	8
perinatally	8
inextricably	7
mucosally	7
mitotically	7
minus	7
microbially	7
intricately	7
instantly	7
innately	7
coordinately	7
highest	7
hematogenously	7
geometrically	7
fortuitously	7
electrophoretically	7
cumulatively	7
beneficially	7
analogously	7
ns2a	7
nsp10	7
operationally	7
spectrally	7
optically	7
west	7
unsurprisingly	7
unintentionally	7
top	7
teilweise	7
super	7
unnecessarily	7
reciprocally	7
radially	7
quicker	7
quently	7
predictably	7
overtly	7
radioactively	7
outwards	7
morally	6
harmlessly	6
homogeneously	6
hypothetically	6
judiciously	6
monthly	6
neurologically	6
negative	6
neither	6
nonsevere	6
nucleoside	6
h10n7	6
h5n1-like	6
adaptively	6
ethnically	6
equivalently	6
e3l	6
distally	6
conspicuously	6
backward	6
apically	6
antiviral	6
aberrantly	6
30-fold	6
2k	6
oligonucleotide	6
objectively	6
intermediately	6
peripherally	6
thankfully	6
upward	6
upside	6
unpredictably	6
unduly	6
undeniably	6
trimeric	6
transovarially	6
threefold	6
thick	6
thermodynamically	6
thence	6
unanimously	6
singularly	6
re-	6
severe	6
postnatally	6
proactively	6
prohibitively	6
protectively	6
plausibly	6
red	6
worst	6
retrogradely	6
rightly	6
realistically	6
digitally	5
favourably	5
direct	5
encouragingly	5
eosinophil	5
epidemically	5
erroneously	5
expectedly	5
fluorescein	5
fivefold	5
flat	5
generically	5
hierarchically	5
hpiv4	5
ifitms	5
ically	5
allegedly	5
concisely	5
anytime	5
accidently	5
admittedly	5
allantoically	5
imatinib	5
alongside	5
anecdotally	5
anyway	5
colloquially	5
arrhythmias	5
basally	5
biomedically	5
burtoni	5
caudally	5
cheaply	5
ifn)-gamma	5
diligently	5
immunogenically	5
protease	5
remotely	5
reproductively	5
smooth	5
spectrophotometrically	5
succinctly	5
superficially	5
th	5
transneuronally	5
transversely	5
unfortunatly	5
unsuccessfully	5
unwittingly	5
vp0	5
worryingly	5
implicitly	5
radiographically	5
vividly	5
presumptively	5
mrnas	5
per	5
interchangeably	5
lys|gly	5
meticulously	5
mistakenly	5
mock	5
inos	5
neutrally	5
opportunistically	5
ostensibly	5
new	5
indiscriminately	5
nutritionally	5
nominally	5
ect	4
fΔct3	4
electrochemically	4
epidermally	4
epigenetically	4
equitably	4
excellently	4
excitingly	4
famously	4
fecal	4
filo-	4
fortnightly	4
für	4
episodically	4
immunosenescence	4
genuinely	4
glabra	4
hither	4
hotly	4
hyper	4
ifitm1	4
inconsistently	4
inconspicuously	4
informally	4
intrathoracically	4
lesser	4
logistically	4
lowest	4
downward	4
eastward	4
blindly	4
doubtless	4
disappointingly	4
-that	4
-usually	4
10-fold	4
ably	4
across	4
adenoidectomy	4
agriculturally	4
albeit	4
amazingly	4
assays	4
astanarg	4
meaningfully	4
bidirectionally	4
bottom	4
categorically	4
centripetally	4
chromatographically	4
chronologically	4
coincidently	4
colorimetrically	4
contemporaneously	4
controversially	4
cpsf30	4
cross	4
cyclically	4
demonstrably	4
directionally	4
luciferase	4
belatedly	4
microbiologically	4
unavoidably	4
rwt	4
serendipitously	4
shorter	4
sixfold	4
stochastically	4
stoichiometrically	4
sublingually	4
sustainably	4
technologically	4
thereupon	4
tight	4
tively	4
transcriptase	4
unevenly	4
reversely	4
unilaterally	4
unknowingly	4
unquestionably	4
upwind	4
vaginally	4
virucidal	4
vitally	4
wider	4
wrongly	4
zoonotically	4
α2	4
μl	4
micrornas	4
rnase	4
unprecedentedly	4
respectfully	4
pathogenetically	4
multi	4
repetitively	4
multifocally	4
myocarditis	4
nationwide	4
non	4
northward	4
nshp01d	4
offshore	4
open	4
organically	4
orthogonally	4
overwhelmingly	4
noninvasively	4
pdna	4
prenatally	4
regrettably	4
relentlessly	4
peacefully	4
recurrently	4
quick	4
privately	4
preemptively	4
pragmatically	4
post	4
phosphoinositide	4
perorally	4
getv	3
extrinsically	3
frankly	3
fourthly	3
fleetingly	3
green	3
federally	3
f1l	3
eminently	3
evolved	3
evolutionally	3
erratically	3
enzymically	3
eloquently	3
eif5	3
efficaciously	3
holistically	3
eccentrically	3
halfway	3
inexorably	3
honestly	3
hormonally	3
diversely	3
interleukin-6	3
intercellularly	3
insidiously	3
ingly	3
infinitely	3
inductively	3
inducibly	3
incidently	3
inapparently	3
inactivé	3
imperfectly	3
il-1β	3
ifnlr1	3
icp46	3
hsv-1/2	3
hsv-1	3
duly	3
allosterically	3
distinctively	3
disproportionally	3
avct12	3
autoradiographically	3
anonymously	3
analytically	3
ambiguously	3
alvéolaire	3
intrarectally	3
alfacon-1	3
advantageously	3
adoptively	3
additively	3
abreast	3
20-fold	3
//doi	3
-where	3
-were	3
-approximately	3
axonally	3
bhk-21	3
br	3
counterintuitively	3
die	3
detrimentally	3
detectably	3
darkly	3
dangerously	3
cytolytically	3
customarily	3
contrastingly	3
bright	3
consequentially	3
conjointly	3
configurationally	3
concordantly	3
complex	3
competently	3
briskly	3
intragastrically	3
confusingly	3
irrevocably	3
somatically	3
smallest	3
small	3
slower	3
sincerely	3
sers	3
serotypically	3
selfassembly	3
segmentally	3
securely	3
rhetorically	3
relatedly	3
rectly	3
reassembly	3
random	3
quietly	3
proximately	3
prevalently	3
solidly	3
someday	3
pp65	3
spectacularly	3
kö	3
worse	3
wisely	3
willingly	3
westward	3
vrnp	3
ventrally	3
utterly	3
unequally	3
tremely	3
tially	3
throughout	3
synaptically	3
subjectively	3
strangely	3
spinulosa	3
speculatively	3
preliminarily	3
softly	3
powerfully	3
nonsignificantly	3
nearest	3
natively	3
nantly	3
nanomaterial	3
mucosa	3
monstrously	3
milder	3
methodically	3
metaphorically	3
meantime	3
mally	3
majorly	3
light	3
liberally	3
legitimately	3
lead	3
positionally	3
nl63	3
mitochondrially	3
northwards	3
patient	3
latter	3
plus	3
physicochemically	3
photochemically	3
phosphatidylinositol	3
pharmaceutically	3
pervasively	3
peculiarly	3
pm-1001	3
particular	3
obligatorily	3
parallelly	3
nsp7	3
ny-1	3
nowhere	3
oftentimes	3
oppositely	3
extrachromosomally	2
endosomally	2
ensuite	2
enthusiastically	2
erfolgreich	2
embryonically	2
estingly	2
exosome	2
explosively	2
invasively	2
facultatively	2
farthest	2
fastest	2
fiercely	2
flavivirus	2
flexibly	2
fore	2
elaborately	2
electrocatalytically	2
cytoplasmically	2
edna	2
diagrammatically	2
forwards	2
ddi	2
decidedly	2
delicately	2
demographically	2
dently	2
desirably	2
desperately	2
diametrically	2
edly	2
different	2
discontinuously	2
disturbingly	2
doubtlessly	2
earliest	2
eastwards	2
easy	2
eber1	2
fortuitum	2
industrially	2
furthest	2
ifnl4	2
hyphae	2
höher	2
ic3b	2
icam-1	2
icpedv-	2
identical	2
identically	2
ifimt1	2
igem	2
hydrophobically	2
il-1	2
immediateearly	2
inadvertantly	2
incessantly	2
indisputably	2
indonesia/5/05	2
cytologically	2
intraaxonally	2
hydroponically	2
hydrophilic	2
futhermore	2
h3a	2
g-200	2
gata4	2
gc	2
gehören	2
genomically	2
glycosidically	2
good	2
graciously	2
hadv	2
hydrazone	2
harder	2
harmoniously	2
hkely	2
hnrnps	2
hopelessly	2
hp6b	2
hspa1a	2
hydraulically	2
cytopathically	2
asymptotically	2
creatively	2
aetiologically	2
a-549	2
a36r	2
a3b1	2
abortively	2
adherently	2
adv	2
aeragmosa	2
aerobically	2
affectively	2
apoferritin	2
aimlessly	2
airborne	2
amphisome	2
anaerobically	2
angiitis	2
anteriorly	2
antigenetically	2
antigenieally	2
a-/b	2
884/1,074	2
63•	2
50-fold	2
-cell	2
-cite	2
-early	2
-essentially	2
-high	2
-how	2
-i	2
-mainly	2
-mostly	2
-namely	2
-typically	2
-whereas	2
-~	2
15-fold	2
38th	2
3bkd	2
5-fold	2
anyhow	2
approximatively	2
cotranscriptionally	2
coarsely	2
cavally	2
centrifugally	2
cessfully	2
chelate	2
chromosomally	2
circularly	2
closest	2
co	2
coevolve	2
astonishingly	2
cogently	2
collaboratively	2
concretely	2
contemporarily	2
contralaterally	2
coordinatively	2
copiously	2
cordingly	2
brilliantly	2
brightly	2
blatantly	2
biosphere	2
astrocyte	2
asynchronously	2
atively	2
atopia	2
attest	2
autocatalytically	2
autoproteolytically	2
avidly	2
azathioprine	2
b220	2
beautifully	2
beneath	2
beside	2
beyond	2
biannually	2
biarsenically	2
biennially	2
intracytoplasmically	2
fcgrs	2
inwardly	2
spectroscopically	2
site(s	2
sively	2
slender	2
smartly	2
snornps	2
soft	2
southwards	2
sparingly	2
spirally	2
significatively	2
ssrna	2
stali	2
starkly	2
stiffly	2
succesfully	2
sudden	2
suggestively	2
swamps	2
sinps	2
sialoside	2
prrsv-2	2
retrovirally	2
questionably	2
real	2
realtime	2
reassuringly	2
recognizably	2
recursively	2
resonantly	2
responsibly	2
richly	2
serinc5	2
rigidly	2
riluzole	2
rnaseiii	2
robotically	2
rostrally	2
rough	2
secretly	2
senp2	2
symbiotically	2
synonymously	2
tangibly	2
vietnam/1203/04	2
unofficially	2
unspecifically	2
unter	2
valuably	2
vcard	2
verbally	2
vice	2
vietnam/1203/	2
vmia	2
tellingly	2
warmly	2
webserver	2
wt	2
www.cdc	2
yellow	2
µm	2
αvβ3/5	2
inwards	2
unlikely	2
unfavourably	2
uneventfully	2
underlaid	2
ten	2
thc~,ori¢	2
thereunder	2
thinly	2
tically	2
tnav2c	2
topographically	2
transstadially	2
u-251	2
uber	2
ubiquitination	2
uenza	2
ularly	2
ultrastructurally	2
unabated	2
uncoat	2
uncontrollably	2
pä	2
α2-ar	2
proximally	2
nanorod	2
mmachine	2
monoallelically	2
multivalently	2
mutationally	2
mysteriously	2
n=28	2
nabs	2
nally	2
narrow	2
nterminally	2
neurally	2
newer	2
nonbilayer	2
normal	2
norp01d	2
notwithstanding	2
ns4a	2
nsp15	2
mittlere	2
miraculously	2
millionfold	2
methodologically	2
proudly	2
ipsilaterally	2
iteratively	2
kind	2
kinetically	2
knowingly	2
l20f	2
laminae	2
larly	2
latterly	2
leukemias	2
lineally	2
logarithmically	2
luminometrically	2
lyrically	2
mab	2
measurably	2
nsp5	2
irrefutably	2
nuclease	2
particluarly	2
pathogenically	2
pathophysiologically	2
peritoneally	2
photometrically	2
pletely	2
plpcx	2
pneumatically	2
posthumously	2
posttranscriptionally	2
preassembly	2
prebiotically	2
preferently	2
presciently	2
preventively	2
profusely	2
prolifically	2
nucleocapsid	2
patently	2
promiscuously	2
parenthetically	2
oldest	2
number(s	2
painstakingly	2
nur	2
obsessively	2
occassionally	2
oddly	2
of~3	2
of~6	2
promisingly	2
olitis	2
ospedalizzati	2
oniy	2
overland	2
ostreae	2
painfully	2
optimem	2
openly	2
operatively	2
faunally	1
expertly	1
expressively	1
expressly	1
extemporaneously	1
extinct	1
extra	1
extracorporeally	1
extraeellularly	1
extragenically	1
f1-score	1
experirnentally	1
factor-2-alpha	1
factor-4e	1
faintly	1
fakultativ	1
fascinatingly	1
fat	1
f1efd3e9e9b8878cf36e752a1b53162960c620c5	1
exonuclease	1
expeditiously	1
expecially	1
erf1	1
fcgammar	1
erfolgt	1
erkrankt	1
erkrankter	1
erlin-2	1
erreger	1
esistanee	1
esp	1
ess3b	1
esthetically	1
ethnobotanically	1
evd)-early	1
every	1
ewqe9edq	1
exceed	1
expansively	1
evanescently	1
floh-	1
fcγr	1
fluorochrome	1
fluorophore	1
flutimide	1
fmhv	1
fnst	1
followprobably	1
followup	1
forcefully	1
forcibly	1
forensically	1
formoterol	1
forsythoside	1
fortituously	1
forv)-antigenically	1
foxo3	1
frantically	1
frenziedly	1
frighteningly	1
fluorometrically	1
fluorimetric	1
fd4ab143e7dd8db7255b11177505986e87b50943	1
fluid	1
fd4ap	1
feasible	1
feasibly	1
fectively	1
feebly	1
fewest	1
fhf)dpreviously	1
fifthly	1
filovirusexperimentally	1
filtrate	1
firsrtly	1
fit	1
fittingly	1
fi}r	1
fl'equently	1
flachen	1
flawlessly	1
erently	1
e6ap	1
eponymously	1
downwards	1
dissimilarly	1
distressingly	1
distributionally	1
divergently	1
doi.org/10.1016/j.antiviral.2018.04.016	1
domestically	1
dorsally	1
downright	1
doxorubicin	1
epizootifally	1
dq376622	1
drastisch	1
ds)rnas	1
dsrna-1	1
durably	1
duringexperimentally	1
e10-e12	1
e192	1
disparately	1
discursively	1
discretely	1
discrepantly	1
funduscopy	1
damningly	1
dead	1
deaminase	1
decreasingly	1
deleteriously	1
delightfully	1
democratically	1
derogatorily	1
dh10b	1
di-	1
diethylaminoethoxyphenyl)-1-phenyl-2-p	1
differntly	1
dinucelotide	1
diphosphate	1
disappointedly	1
discernibly	1
e2-p7	1
e2f	1
e4broad	1
elsewise	1
embarrassingly	1
emotionally	1
enantiomerically	1
endolysosomally	1
endonucleolytically	1
endoribonucleolytically	1
endospore	1
entfällt	1
ently	1
entrywise	1
enzymatic	1
enzymeimmunoassays	1
ephrinb2	1
episomally	1
episomically	1
epistatically	1
epizootically	1
em	1
elonginc	1
earnestly	1
eloborately	1
east	1
eber-1	1
eber1:~10	1
ecaa8cecc95975aa76c039f0322558def8f93c2b	1
eerily	1
effkiently	1
eif2γ	1
eif4	1
eif4e	1
eightfold	1
einher	1
eldeerly	1
electively	1
electrocardiographically	1
electrochemical	1
electromagnetically	1
electronmicroscopy	1
frustratingly	1
hydrologically	1
g46s	1
ily	1
imidazole	1
immaculately	1
immanently	1
immuno	1
immunoassay	1
immunochemical	1
immunohistologically	1
immunomagnetically	1
immunosuppressant	1
immunsupprimierter	1
imniunochemically	1
impeccably	1
imperatively	1
imponiert	1
important	1
impulsively	1
in)directly	1
im	1
ilaterally	1
inaccurately	1
ilarly	1
hypodermically	1
häufiger	1
i+	1
iatrogenically	1
icantly	1
icosahedrally	1
idually	1
ifi44	1
ifn)-λ	1
ifnγ(+	1
ifvs	1
igg2a	1
ignµcf	1
il-1rn	1
il-8	1
il-8ra	1
il12rb1	1
in/	1
inadequtely	1
hygienically	1
inshore	1
instinctively	1
intanasally	1
integrally	1
inteifere	1
intelligently	1
interestedly	1
interfere	1
interfiere	1
interleukin-2	1
interstadially	1
intracardially	1
intraeellularly	1
intraeranieally	1
intransally	1
intraocularly	1
intrapentoneally	1
intraperitonially	1
insignificantly	1
inosine	1
inadvertedly	1
inordinately	1
inc.-formerly	1
incontestably	1
inconveniently	1
incredulously	1
incrementally	1
indifferently	1
inescapably	1
inexpensively	1
inexplicably	1
infact	1
infamously	1
infectiveness	1
infectivitygenerally	1
inferiorly	1
infirm	1
infiziert	1
influenzavirusa	1
hyperoside	1
d71e	1
gainedvery	1
greatfully	1
grippotyphosa	1
groundwatersr-4where	1
growingly	1
h1n1)swl	1
haematogenously	1
haemodynamically	1
haphazardly	1
haptic	1
harmlose	1
harshly	1
hastily	1
hav7neg2	1
hbmecs	1
head	1
healthy	1
heavlly	1
hematologically	1
grim-	1
gravimetrically	1
heteroduplexes	1
gravelly	1
gasgenerally	1
gelpest	1
gene(s	1
genera	1
gingivostomatitis	1
gliomas	1
globotriaosylceramide	1
glutaraldehyde	1
gly	1
gly-15	1
glycopeptide	1
gm066706	1
gp1	1
gp120predominantly	1
gp19	1
gp350/220	1
granatum	1
hereunder	1
heterogeneously	1
hydrodynamically	1
hpiv-2	1
hrv2-cy5	1
hsp100s	1
hsp47)-also	1
hsp60	1
hsp60-hsp10	1
hsp90	1
hsp90α	1
http://arbidol.org/arbidol-childrens-study.pdf	1
http://gvn.org/sapporo_2016	1
http://proteomecentral	1
http://www.ncbi.nih.gov/genomes/flu/	1
https://clinicaltrials.gov/	1
https://doi.org/10.1038/s41598-018-24767-4	1
https://gitlab.com/inkscape/inkscape	1
https://www.sciencemag.org/news/2020/04/coronavirus-found-paris-sewage-points-early	1
humanly	1
humid	1
hq660155	1
hov^ever	1
heterologously	1
hourly	1
heterosexually	1
hetween	1
hexagonally	1
hg).46	1
hhv-6-dna	1
histochemistry	1
hiv-1-persistently	1
hlly	1
hm175/18f	1
hmgb1	1
hollow	1
homeostatically	1
homoassembly	1
homogenously	1
homopolymeric	1
homotypically	1
hotter	1
damn	1
blue	1
d4t	1
af283103	1
adjacent	1
adrp	1
aefca0d78f42100b0ef5fb5a3e95f0c814d129e5	1
aerially	1
aerodynamically	1
aerogenically	1
aerwgmosa	1
af271234	1
afield	1
d198n	1
afloat	1
afresh	1
ag7404	1
againstcovid-19	1
aggresomes	1
ah'eady	1
ah2012/12	1
ahnlicher	1
adipose	1
adiabatically	1
adenovirus-	1
adenoviral	1
abarrently	1
abcc6	1
abovepotently	1
absorbingly	1
absorptive	1
abzusichern	1
ac	1
ac-	1
aca50024	1
accrue	1
acetylsalicylic	1
acidophilic	1
ack-	1
act	1
active	1
acute	1
acycl0vir.7~	1
ahove	1
ai-07007	1
ai100874	1
angiographically	1
anhui/1/2005	1
animalsand	1
anlhraci,~	1
anomalously	1
antagonistically	1
antenatally	1
antennae	1
anterior	1
anterogradely	1
anthropocentrically	1
anthropogenic	1
anthropomorphically	1
antidouble	1
antigen-1	1
antigenic	1
antigenitically	1
antigenomic	1
angly	1
anew	1
airsacculitis	1
anatum	1
alaninal	1
alcanzan	1
aldo1	1
alere	1
aliantois	1
alkali	1
allogeneically	1
alpha4-integrin	1
alphaherpesvirus	1
alphamelanocyte	1
alstoni	1
alternate	1
amicably	1
amirna	1
amperometrically	1
an)other	1
analysi\	1
aback	1
a7eh4dkb	1
a7136066a42782369e2180e54010553e5fd7bbe4	1
-generally	1
-guide	1
-highly	1
-independently	1
-just	1
-likely	1
-methods	1
-most	1
-naturally	1
-o	1
-plausibly	1
-possibly	1
-practically	1
-preferably	1
-previously	1
-principally	1
-retrospectively	1
-rsv	1
-globally	1
-formerly	1
-stability‖	1
-especially	1
--temporal	1
-15	1
-192	1
-2007	1
-238	1
-25~	1
-2b	1
-3050	1
-7.2	1
-also	1
-apparently	1
-atpase	1
-before	1
-clinically	1
-d	1
-displays	1
-effectively	1
-specifically	1
-still	1
a6b7e747ae2abfe57442b3487d1863cea387e234	1
3,10	1
39utr	1
3ae00	1
50fold	1
5469e5474	1
5−10	1
6,10	1
7,10	1
7-when	1
97·03	1
a(mino	1
a+u	1
a-172	1
a.128.1	1
a.62.1	1
a.bianco@ibmc-cnrs.unistra.fr	1
a2,6gal	1
a3b	1
3-o	1
2wcd	1
-subsequently	1
25-fold	1
-tag	1
-though	1
-virosphere	1
-will	1
-zustand	1
.additionally	1
.interestingly	1
100-fold	1
10x	1
13-fold	1
1785-y	1
18-fold	1
1À2)-that	1
2-bis	1
20-times	1
2020b)-approximately	1
24/7	1
antigentically	1
antimicrobially	1
antineoplastischen	1
cas9-crrna	1
catastrophically	1
cathodically	1
catl	1
causually	1
caveolin	1
cbronically	1
ceaselessly	1
ceptually	1
ch,-onically	1
challengingly	1
chemoenzymatically	1
chemotactically	1
choreographically	1
ciearly	1
circumstantially	1
cked	1
clandestinely	1
casually	1
carelessly	1
cliuically	1
captive	1
bly	1
bnab	1
boldly	1
bourrely	1
bpv-1	1
bravely	1
broader	1
bronchiozitis	1
brutally	1
bta798	1
budesonide	1
bvp10	1
c(w	1
campioni	1
candidly	1
canonically	1
capside	1
climatologically	1
clockwise	1
blunt	1
consiently	1
contagiously	1
contradictorily	1
convergently	1
covid-19-especially	1
cp	1
craftily	1
cranially	1
crswnp	1
crudely	1
cryptically	1
cryptographically	1
ct	1
cttccttccggatcacgtgttcat3	1
cunps	1
cursorily	1
custom	1
cva24	1
conspiciously	1
consensually	1
clustalw	1
consciously	1
cm1900	1
coaxially	1
codominantly	1
collaterally	1
colorimetric	1
colourfully	1
comfortably	1
commensurately	1
communally	1
compactly	1
compositionally	1
concentrically	1
concern'benignly	1
concomittently	1
congenially	1
congressionally	1
conmionly	1
bluntly	1
intravaginally	1
antiretroviral	1
aseeptically	1
asexually	1
assambly	1
assembly	1
associate	1
assumably	1
assumedly	1
assuredly	1
ast/89	1
asthma	1
asunder	1
asymptomatische	1
ately	1
atomically	1
attentively	1
attoampere	1
audibly	1
aufgrund	1
aseptischen	1
ascovirus	1
aunr	1
aryl	1
anxiously	1
ap-1and	1
ap-2	1
apace	1
aphtho-	1
apobec	1
appear[s	1
approxiinately	1
arbo-	1
archaea	1
architectonically	1
architecturally	1
arely	1
arkdpi	1
arose	1
arrêtée	1
artifically	1
auftreten	1
ausdehnen	1
blastn	1
ballum	1
bdna	1
bedroutinely	1
begrudgingly	1
bernasconi	1
bicjf'/icr!li	1
bimodally	1
biochemicaily	1
bioenergetically	1
biologiciilly	1
biosynthetically	1
biparentally	1
bisbenzimide	1
bisindolylmaleimide	1
bit.26890	1
bitopically	1
bitter	1
blast+	1
bbwv-2	1
bal3l	1
auslösen	1
bakterien-	1
autosomal	1
availableprobably	1
aviseptica	1
avoidably	1
awake	1
axenically	1
ay310120	1
ay956384	1
añ	1
b2756f5b3155d2cfb26d7aa5ad135f5c0378ac32	1
b54gfp-2	1
b67151c7d7b53355ea7aeef2187d84cb96597384	1
baa-4370-platesa2	1
babybig	1
backwards	1
bacteriologically	1
bad	1
intratypically	1
misleadingly	1
ionically	1
socioeconomically	1
skillfully	1
slit	1
slowest	1
sm(d34:1	1
smaller	1
snorna	1
snrna	1
soapnuke	1
solitarily	1
qu'aucune	1
solo	1
soluble	1
sonochemically	1
sorely	1
sortase	1
southward	1
spacially	1
sparer	1
sionally	1
simplistically	1
simplex	1
simpler	1
setp	1
several	1
severally	1
sgp	1
sh	1
shghtly	1
shockingly	1
shrna	1
sialyl	1
sialyllactose	1
sibly	1
sicker	1
sideways	1
signficantly	1
signiticantly	1
siloed	1
silty	1
spatial	1
spav-2	1
spectively	1
su-	1
subcomplex	1
subendothelially	1
subliminally	1
suboptimally	1
subperiosteally	1
subseqently	1
substantively	1
sung	1
superior	1
supremely	1
sure	1
suspiciously	1
symbiotrophically	1
symbolically	1
synchronically	1
systempotentially	1
tably	1
sub	1
stylistically	1
speedily	1
stunningly	1
spherically	1
splenitis	1
spread	1
sprechen	1
squarely	1
staggeringly	1
stat1-dna	1
stat5	1
statically	1
steadfastly	1
sterile	1
sterilely	1
stmcturally	1
straightaway	1
stridently	1
stronger	1
stubbornly	1
sensationally	1
semiquantitatively	1
semiconservatively	1
ready	1
regulary	1
reiteratively	1
rele	1
relevantly	1
religiously	1
reluctantly	1
remote	1
rena.com/news/lilly	1
renally	1
rently	1
reoccurs	1
repeadtedly	1
repeatably	1
replica	1
replicatively	1
reposer	1
reprodueibly	1
redundantly	1
reactogenic	1
resistancedwere	1
reactively	1
quasi	1
quasisystematically	1
quercetin	1
quiescently	1
r-2016	1
r-848	1
rab7-positive	1
racially	1
rad11	1
radical	1
radioisotopically	1
radiometrically	1
radv	1
rampantly	1
rapid	1
rarer	1
rchad	1
rer	1
resolutely	1
semiannually	1
rtpi	1
ruefully	1
russia)-were	1
rv144	1
s1-ctd	1
s13287	1
safe	1
safety	1
scarb1	1
schlechtere	1
schwerem	1
scornfully	1
scrupulously	1
seamlessly	1
seasonably	1
secretion，at	1
seletively	1
sembly	1
rudimentarily	1
rtgevsptv	1
respectably	1
rstly	1
respiratorsthat	1
resultingly	1
rhapc	1
rhizomatous	1
rhythmically	1
ri7v2ka3	1
riately	1
rightfully	1
rightward	1
rigourously	1
riodically	1
riä	1
rnaseout	1
rntd	1
rrna	1
rs1800450	1
rs8099917	1
takarah	1
tangentially	1
tantalizingly	1
virsorter_node_428_length_1474_cov_31_388-cat_2	1
virsorter_node_63_length_10962_cov_10_2398-cat_1	1
virsorter_node_6_length_18914_cov_22_0195-cat_2	1
virsorter_node_6_length_39977_cov_34_3534-cat_2	1
virsorter_node_7_length_27940_cov_25_4928-cat_2	1
virsorter_node_93_length_5511_cov_39_8675-cat_1	1
vocally	1
vociferously	1
voltametrically	1
voraciously	1
vr-2332	1
vr-2385	1
vs	1
vs.	1
völlig	1
w^here	1
westwards	1
wherein	1
virsorter_node_60_length_9439_cov_32_4934-cat_1	1
virsorter_node_407_length_2846_cov_138_023_gc021836_gc021836-cat_1	1
wich	1
virsorter_node_27_length_8525_cov_17_6017-cat_2	1
vcjd	1
vdna	1
veev)dcause	1
vefold	1
venerally	1
ventrolaterally	1
verotoxin	1
vesivirus	1
via	1
viceversa	1
virsorter_node_10_length_37636_cov_94_1194-cat_2	1
virsorter_node_110_length_3327_cov_40_0329_id_1235347-cat_2	1
virsorter_node_156_length_3846_cov_90_3208-cat_2	1
virsorter_node_16_length_23516_cov_138_53-cat_2	1
virsorter_node_21_length_10227_cov_70_6216_id_1234280-cat_1	1
virsorter_node_25_length_9400_cov_16_2758-cat_2	1
virsorter_node_271_length_4659_cov_16_1942-cat_2	1
whereupon	1
wide-	1
vanishingly	1
zn2	1
¢rst	1
®	1
±0,2	1
±0.46	1
±ccccagtactgttat	1
×550	1
ßy	1
ðk	1
übegr	1
über	1
übertragenen	1
α(1,2)-man	1
αb	1
αenv	1
βwere	1
−5.2	1
≪1	1
~1550	1
zidovudine	1
wirelessly	1
youngest	1
wirtschaftlich	1
wise	1
withtheclosely	1